Discovery of novel ketoxime ether derivatives with potent FXR agonistic activity, oral effectiveness and high liver/blood ratio

Article abstract of DOI:10.1016/j.bmc.2021.116280

The farnesoid X receptor (FXR) is a promising therapeutic target for nonalcoholic steatohepatitis (NASH) and other bile acid related diseases because it plays a critical role in fibrosis, inflammation and bile acid homeostasis. Obeticholic acid (OCA), a FXR agonist which was synthesized from chenodeoxycholic acid, showed desirable curative effects in clinical trials. However, the pruritus which was the main side effect of OCA limited its further applications in NASH. Although pruritus was also observed in the clinical trials of non-steroidal FXR agonists, the proportion of patients with pruritus was much smaller than that of OCA. Thus, we decided to develop non-steroidal FXR agonists and discovered a series of novel FXR agonists which were synthesized from GW4064 by replacing the stilbene group with ketoxime ether. Encouragingly, in the following biological tests, our target compounds 13j and 13z not only showed potent FXR agonistic activities in vitro, but also effectively promoted the expression of target genes in vivo. More importantly, in the pharmacokinetic experiments, compounds 13j and 13z displayed high liver/blood ratio characteristics which were helpful to reduce the potential side effects which were caused by prolonged systemic activation of FXR. In summary, our compounds were good choices for the development of non-steroidal FXR agonists and were deserved further investigation.

Full text of DOI:10.1016/j.bmc.2021.116280

Bioorg. Med. Chem. 43 (2021) 116280
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Discovery of novel ketoxime ether derivatives with potent FXR agonistic
activity, oral effectiveness and high liver/blood ratio
,
b
,
,
,d
Xuehang Tanga 1, Mengmeng Ningb 1, Yangliang Yeb, Yipei Gub, Hongyi Yanb
,
Ying Lengb *, Jianhua Shenb
,
c,
,c,*
a School of Pharmacy, Nanchang University, Nanchang 330000, Jiangxi Province, China
b State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica (SIMM), Chinese Academy of Sciences, No. 555 Zu Chong Zhi Road, Shanghai 201203,
China
c School of Pharmacy, University of Chinese Academy of Sciences, No. 19A Yuquan Road, Beijing 100049, China
d Nano Science and Technology Institute, University of Science and Technology of China, Suzhou 215123, China
A R T I C L E I N F O
A B S T R A C T
Keywords:
The farnesoid X receptor (FXR) is a promising therapeutic target for nonalcoholic steatohepatitis (NASH) and
other bile acid related diseases because it plays a critical role in fibrosis, inflammation and bile acid homeostasis.
Obeticholic acid (OCA), a FXR agonist which was synthesized from chenodeoxycholic acid, showed desirable
curative effects in clinical trials. However, the pruritus which was the main side effect of OCA limited its further
applications in NASH. Although pruritus was also observed in the clinical trials of non-steroidal FXR agonists, the
proportion of patients with pruritus was much smaller than that of OCA. Thus, we decided to develop non-
steroidal FXR agonists and discovered a series of novel FXR agonists which were synthesized from GW4064
by replacing the stilbene group with ketoxime ether. Encouragingly, in the following biological tests, our target
compounds 13j and 13z not only showed potent FXR agonistic activities in vitro, but also effectively promoted
the expression of target genes in vivo. More importantly, in the pharmacokinetic experiments, compounds 13j
and 13z displayed high liver/blood ratio characteristics which were helpful to reduce the potential side effects
which were caused by prolonged systemic activation of FXR. In summary, our compounds were good choices for
the development of non-steroidal FXR agonists and were deserved further investigation.
FXR agonist
Ketoxime ether
Target genes
Liver/blood ratio
Systemic activation
1. Introduction
the intestines, activation of FXR promotes the secretion of fibroblast
growth factor 15 (FGF15) in mice or the secretion of fibroblast growth
The farnesoid X receptor (FXR) was identified as an orphan nuclear
receptor in 1999. It is expressed in the liver, intestines, kidney, adipose
tissue and cardiovascular system. It acts as a key regulator which
maintains the balance of bile acid by regulating the synthesis, transport
and metabolism of bile acid, protecting the liver from the detrimental
effects of bile acid accumulation.1–3 In the liver, activated FXR inhibits
the synthesis of bile acid by inducing the small-heterodimer partner
(SHP) which down-regulates cholesterol 7a-hydroxylase (CYP7A1).4 In
factor 19 (FGF19) in humans. Then they return to the liver via the
enterohepatic circulation and down-regulate CYP7A1, thereby inhibit-
ing the synthesis of bile acid.5 In addition, FXR regulates the bile salt
export pump (BSEP) gene which is one of the downstream target genes
of FXR to control the secretion of bile acid from hepatocytes to gall.6
Moreover, Activated FXR will protect liver from inflammation and
fibrosis by inhibiting the activation of the hepatic stellate cells (HSC).7
Due to its multifunctional activities in fibrosis, inflammation and bile
Abbreviations: LDL, low density lipoprotein; SAR, structure activity relationships; EC50, half maximal effective concentration; NCS, N-Chlorosuccinimide; NBS, N-
Bromosuccinimide; AIBN, 2,2′-Azobis(2-methylpropionitrile); DCM, dichloromethane; MeOH, methanol; THF, tetrahydrofuran; DMF, N, N-dimethyl formamide;
DIPEA, N, N-diisopropylethylamine; TEA, triethylamine; NMR, nuclear magnetic resonance; ESI, electron spray ionization; hERG, human Ether-a-go-go Related Gene;
hTGR5, human Taketa G-protein receptor 5; MTBE, methyl tert-butyl ether; DMEM, dulbecco’s modified eagle medium; ACN, acetonitrile.
* Corresponding authors at: State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica (SIMM), Chinese Academy of Sciences, No. 555 Zu Chong
Zhi Road, Shanghai 201203, China.
E-mail addresses: yleng@simm.ac.cn (Y. Leng), jhshen@simm.ac.cn (J. Shen).
1
These authors contributed equally to this work.
https://doi.org/10.1016/j.bmc.2021.116280
Received 15 February 2021; Received in revised form 7 June 2021; Accepted 11 June 2021
Available online 17 June 2021
0968-0896/© 2021 Elsevier Ltd. All rights reserved.

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
Fig. 1. Representative FXR agonists.
tropane linker to increase the conformational restraint and synthesized
the full FXR agonist LJN452 which showed highly potent in vitro and
vivo.23 Although great progress was made in the development of FXR
agonists, none of FXR agonists was approved for the treatment of NASH.
Ketoxime ether which was appeared in clinical drugs such as Flu-
voxamine and Siponimod (Fig. 2),24,25 was generally considered as the
isostere of aromatic ring. Its geometric configuration and electrical
arrangement were similar to that of benzene ring to some extent.26 The
–
C
N double bond of ketoxime ether showed considerable conforma-
Fig. 2. The clinical drugs which contain ketoxime ether moiety.
tional rigidity because of its planar configuration and lone pair elec-
trons.27,28 Previous research proved that the agonistic activity of
GW4064 would decrease when the double bond was simply reduced
because the conformational rigidity was indispensable to GW4064.29
From this perspective, we decided to replace the stilbene group of
GW4064 with ketoxime ether and synthesized the start compound 1
(SC1) which showed considerable activating ability towards FXR. In the
following studies, we continued to synthesize a series of derivatives of
SC1 and discovered 13j and 13z which showed some favorable prop-
erties including potent activating activity, oral effectiveness and high
liver/blood ratio. High liver/blood ratio was propitious to improve the
efficacy of the FXR agonists in vivo and avoid the potential side effects
which were caused by the prolonged systemic activation of FXR theo-
retically because the main target organs of FXR agonists were liver and
intestines.23,30
acid metabolism, FXR presents as a promising therapeutic target for
NASH.
There is no doubt that Obeticholic acid (OCA, Fig. 1) is the front-
runner among various FXR agonists. However, its untoward effects are
quite disturbing. In the latest phase III trial, patients in the 25 mg OCA
group showed significant improvement in fibrosis compared to those in
the placebo group, but unfortunately, 51% patients suffered severe
pruritus and LDL cholesterol increases was observed in 17% patients.8
Because the predicted benefits of OCA remained uncertain and they did
not outweigh the potential risks sufficiently in the previous clinical tri-
als, Intercept company needs to submit more additional evidence to
prove the effectiveness and safety of OCA and the long-term clinical
study of OCA is still needed. In the previous studies, it was reported that
the activation of TGR5 by OCA may be responsible for the pruritus
which was observed in clinical trials of OCA.9–12 Therefore, many re-
searchers paid more attention to the discovery of novel selective non-
steroidal FXR agonists (Fig. 1) which would not activate TGR5.
GW4064 was discovered as a classical non-steroidal FXR agonist
through an iterative combinatorial library synthesis and screening
approach.13 Although GW4064 was a highly potent FXR agonist, it
showed poor pharmacokinetic properties and low metabolic stability
2. Result and discussion
2.1. Chemistry
The designed target compounds were synthesized from commercially
available 2,6-Dichlorobenzaldehyde or 2-(Trifluoromethoxy)benzalde-
hyde according to the reported routes in Schemes 1 and 2.31–34 Oxime 2a
was produced from aldehyde 1a by the condensation with hydroxyl-
amine hydrochloride. Then oxime 2a was chlorinated by NCS to
generate compound 3a. Cycloaddition of compound 3a with ethyl 3-
cyclopropyl-3-oxopropanoate provided ethyl ester 4a with a moderate
yield. Then the ethyl ester 4a was reduced by LiAlH4 to give the primary
alcohol 5a. Compound 5a was bromized via Apple reaction to generate
compound 6a. Compound 6b was synthesized via the same route.
Compounds 7a-7g were produced from compound 6a under nucleo-
philic substitution reactions. Compounds 7h-7l were synthesized from
compound 6b in the same condition. In the meantime, compounds 9a-9g
were prepared from compounds 8a-8g via the bromination with NBS.
Then 9a-9g were added to DMF with N-Hydroxyphthalimide and DIPEA
to generate compounds 10a-10g. Next, compounds 10a-10g were
treated with butan-1-amine and ethanol solution of hydrogen chloride to
give compounds 11a-11g. Finally, by base-mediated hydrolysis, com-
pound SC1 and compounds 13a-13n were generated from the
due to its stilbene group which was also
a potentially toxic
pharmacophore.14–16 In order to address these issues, researchers
attempted to replace the stilbene group with a stable functional group.17
After three rounds of optimization, GSK2324 which was synthesized by
replacing the stilbene group of GW4064 with heterocyclic ring showed
considerable improvement in pharmacokinetic properties, but its FXR
agonistic activity had not been greatly improved.18 In order to improve
the druggability, researchers from Gilead replaced the stilbene group of
GW4064 with acridine ring and synthesized GS9674 (also known as
Cilofexor) for the treatment of NASH and primary biliary cholangitis
(PBC).19–21 Meanwhile, the researchers in Eli Lily replaced the benzene
ring of stilbene group with piperidine ring and obtained LY2562175 (as
known as TERN-101). Although LY2562175 was a partial FXR agonist
(41% relative to GW4064), it represented better druggability than
GW4064 in the biological evaluations.22 On the basis of LY2562175,
researchers in Novartis replaced the piperidine ring with bicyclic [3.2.1]
2

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
which were described in the experimental section. OCA and GW4064
were used as control compounds. All of the final compounds were
evaluated and the results were shown in Tables 1 and 2.
Compound SC1 which was the first compound that we synthesized
exhibited moderate FXR activation ability with EC50 179.1 nM and
147.5% maximum efficacy relative to OCA. We initially investigated the
middle benzene ring of compound SC1 and discovered that when
chlorine, bromine or fluorine was introduced into the ortho-position of
ketoxime ether in the middle benzene ring, the FXR agonistic activity of
compounds would be improved. Compounds 13c, 13k and 13m showed
stronger activation to FXR than SC1 with EC50 values of 47.4 nM, 37.2
nM and 55.8 nM respectively. However, when the middle benzene ring
was replaced with heterocyclic rings such as pyridyl ring, the agonistic
activity would be reduced. Compound 13f displayed weaker agonistic
activity than compound SC1 with EC50 value of 233.8 nM. In the further
investigations, compounds 13d and 13e which were synthesized by
replacing the terminal benzene ring of compound 13c with furan or
pyridyl ring, showed no improvement in potency. Then we continued to
introduce new substituents into the terminal benzene ring of compound
13c and discovered that compound 13j which was the cyanogen de-
rivative of compound 13c could maintain the agonistic ability with an
EC50 of 45.2 nM. It has been reported that the pharmacokinetic prop-
erties of the isoxazole FXR agonists would be improved when the 2,6-
dichlorophenyl ring was replaced with the trifluoromethoxy benzene
ring,23 so we decided to design and synthesize a series of compounds
which contained trifluoromethoxy benzene ring. Surprisingly, among
those compounds, compound 13z which was optimized from compound
13j displayed strong FXR agonistic ability with an EC50 of 36.1 nM. Due
to their similarities in structure, both compounds 13j and 13z were
selected for the further evaluation.
2.2.2. hTGR5 activation examination
Activation of hTGR5 was supposed to be responsible for the pruritus
which was observed in the clinical trials of OCA. Thus, compounds 13j,
13z and OCA were evaluated for their hTGR5 activation effects in a cell
based reporter assay as described in the methods. As is shown in Table 3,
Ring A was represented by S1, S2, S3, S4, S5, S6 and S7
SC1: R1 = H, R2 = H, X = C, A = S2 13a: R1 = H, R2 = H, X = C, A = S1
13b: R1 = H, R2 = Cl, X = C, A = S1 13c: R1 = H, R2 = Cl, X = C, A = S2
13d: R1 = H, R2 = Cl, X = C, A = S3 13e: R1 = H, R2 = Cl, X = C, A = S4
OCA could effectively activate hTGR5 with an EC50 of 3.4 ± 0.6 μM and
a max effect of 95.3 ± 3.6%. However, compound 13j and compound
13z displayed no measurable activity on TGR5, which indicated that the
side effects of activating hTGR5 would probably be avoided.
13f: R1 = H, R2 = H, X = N, A = S2
13h: R1 = H, R2 = Cl, X = C, A = S5 13i: R1 = Cl, R2 = H, X = C, A = S2
13j: R1 = H, R2 = Cl, X = C, A = S7 13k: R1 = H, R2 = Br, X = C, A = S2
13g: R1 = H, R2 = H, X = N, A = S3
2.2.3. FXR target gene expression in primary C57 mouse hepatocytes
In order to evaluate the potential of compounds 13j and 13z on the
induction of FXR downstream genes, the mRNA levels of SHP and BSEP
which are the FXR target genes were quantified in the primary C57
mouse hepatocytes. The cells were treated with vehicle (0.5% DMSO) or
different compounds (13j, 13z or OCA) in different concentrations (0.4
13l: R1 = H, R2 = CF3, X = C, A = S2 13m: R1 = H, R2 = F, X = C, A = S2
13n: R1 = H, R2 = Cl, X = C, A = S6
μ
M, 2 μM and 10 μM). After an incubation period of 24 h, the mRNA
Scheme 1. Reagents and conditions. (a) NH2OH⋅HCl, NaOH, EtOH, H2O, 0 ◦
C
to rt, 8 h, 89%; (b) NCS, DMF, 25 ◦C, 1 h, 94%; (c) TEA, ethyl 3-cyclopropyl-3-
oxopropanoate, THF, 25 ◦C, 12 h, 59%; (d) LiAlH4, THF, 0 ◦C, 1 h, 75%; (e)
CBr4, PPh3, DCM, 0 ◦C, 0.5 h, 86%; (f) K2CO3, DMF, 25 ◦C, 8 h, 78–90%; (g)
NBS, AIBN, CCl4, 70 ◦C, 6 h, 58–72%; (h) N-Hydroxyphthalimide, DIPEA, DMF,
N2, 70 ◦C, 8 h, 58–85%; (i) Butan-1-amine, HCl (EtOH), MeOH, 25 ◦C, 12 h,
78–85%; (j) MeOH, 25 ◦C, 12 h, 60–85%; (k) LiOH⋅H2O, THF, MeOH, H2O,
40 ◦C, 3 h, 81–92%.
expressions of SHP and BSEP were analyzed by quantitative real-time
polymerase chain reaction (qRT-PCR). As is shown in Fig. 3A, com-
pounds 13j, 13z and OCA exhibited robust induction in relation to the
mRNA expression of SHP in a dose-dependent manner. The maximal fold
values of compounds 13j and 13z were greater than 40 while the
maximal fold value of OCA was less than 20. As is shown in Figure 3B,
compounds 13j, 13z and OCA also displayed strong induction in relation
to BSEP mRNA expression. The results demonstrated that compounds
13j and 13z could effectively induce the expression of FXR target genes
in the primary C57 mouse hepatocytes.
compound SC1-ME or compounds 12a-12n which were produced from
compounds 7a-7g and compounds 11a-11g in a mild condition. Com-
pounds 13o-13z were synthesized via the similar route. The specific
structures of intermediates were shown in the supporting information.
2.2.4. FXR target gene expression in C57BL/6J mouse after a single oral
dose
In order to evaluate the FXR agonistic effects of compounds 13j and
13z in vivo, the induction effects on FXR target genes in mice were
examined after a single oral dose. Compound 13j (10 mg/kg), com-
pound 13z (10 mg/kg), OCA (30 mg/kg) or vehicle (0.25% CMC-Na, wt/
vol) was orally given to C57BL/6J mice. Liver and ileum tissues were
2.2. Biological evaluation
2.2.1. FXR response element driven luciferase assay and SAR analysis
A cellular transactivation assay using the FXR response element
driven luciferase method was performed according to the methods
3

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
Ring A was represented by S2, S4, S5 and S7
13o: R1 = H, R2 = Cl, A = S4
13q: R1 = H, R2 = Cl, A = S2
13s: R1 = F, R2 = H, A = S5
13p: R1 = H, R2 = Cl, A = S5
13r: R1 = F, R2 = H, A = S4
13t: R1 = OCH3, R2 = H, A = S5
13u: R1 = CH3, R2 = H, A = S5 13v: R1 = CH3, R2 = H, A = S4
13w: R1 = F, R2 = H, A = S7 13x: R1 = OCH3, R2 = H, A = S7
13y: R1 = CH3, R2 = H, A = S7 13z: R1 = H, R2 = Cl, A = S7
Scheme 2. Reagents and conditions. (a) NH2OH⋅HCl, NaOH, EtOH, H2O, 0 ◦C to rt, 8 h, 77%; (b) NCS, DMF, 25 ◦C, 1 h, 86%; (c) TEA, ethyl 3-cyclopropyl-3-oxo-
propanoate, THF, 25 ◦C, 12 h, 57%; (d) LiAlH4, THF, 0 ◦C, 1 h, 82%; (e) CBr4, PPh3, DCM, 0 ◦C, 0.5 h, 84%; (f) K2CO3, DMF, 25 ◦C, 8 h, 68–87%; (g) MeOH, 25 ◦C, 12
h, 58–75%; (h) LiOH⋅H2O, THF, MeOH, H2O, 40 ◦C, 3 h, 80–91%.
harvested 6 h post-dose, and RNA was extracted for analyzing mRNA
levels of relevant genes.
2.2.5. Mean plasma and liver concentrations of compounds 13j and 13z in
ICR mouse (15 mg/kg)
As is shown in Figs. 4 and 5, OCA, compounds 13j and 13z all dis-
played strong induction or repression to FXR target genes in vivo. In the
liver, OCA, compounds 13j and 13z all demonstrated potent induction
to SHP with mRNA levels 2–3 fold above the vehicle treated animals. In
the BSEP gene induction results, compounds 13j and 13z represented
stronger inducement to the target gene than OCA. Meanwhile, the ex-
pressions of CYP7A1 and CYP8B1 were potently repressed by OCA,
compounds 13j and compound 13z. But OCA showed less repression to
CYP7A1 and CYP8B1 compared to compounds 13j and 13z at the mRNA
expression levels. In the ileum, OCA, compounds 13j and 13z also dis-
played robust induction to SHP with mRNA levels 20～30 fold above the
vehicle treated animals. Meanwhile, mRNA expressions of FGF15 were
potently induced by OCA, compounds 13j and 13z (5–8 fold above
vehicle). All the above results indicated that compounds 13j and 13z
could effectively induce or repress the expression of FXR target genes in
C57BL/6J mice at a single oral dose.
In order to clarify the distribution of compounds 13j and 13z in vivo,
ICR mice were treated with compounds 13j or 13z at a single oral dose
(15 mg/kg). The blood and liver samples were collected at 1.5 h, 4.0 h
and 8.0 h post-dose and the concentrations of the compounds in each
sample were analyzed separately. As is shown in Table 4, the concen-
trations of compound 13j in the livers were about 37～57 fold higher
than those in plasma at the same time point. The liver/blood ratios of
compound 13z ranged from 77 to 111. According to a previous article,
the liver/blood ratio of OCA was about 5–10.30 LJN452 which is a FXR
agonist in phase II clinical trial is an analogue of GW4064 and its highest
liver/ blood ratio is 20.23 Moreover, the absolute exposures of com-
pounds 13j and 13z in plasma were quite low. Although we need to
conduct more experiments to analyze the distribution of compounds 13j
and 13z in other organs like kidney and skin, we can preliminarily
conclude that the high liver/ blood ratio characteristic of our com-
pounds will help to reduce the potential side effects which were caused
by the prolonged systemic activation of FXR.
4

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
evaluated on FXR response element driven luciferase assay. Among
them, compounds 13j and 13z displayed robust agonistic activities on
FXR without TGR5 activation. Meanwhile, in the primary C57 mouse
hepatocytes, both compounds effectively induced the expression of
target genes SHP and BSEP which were supposed to be important for
NASH therapy. Moreover, compounds 13j and 13z were able to activate
FXR in vivo and they all displayed strong induction to the target genes of
FXR in C57BL/6J mice. More importantly, compounds 13j and 13z
showed high liver/blood ratios in the pharmacokinetic experiment,
which contribute to reducing the potential side effects which were
caused by the prolonged systemic activation of FXR. Those character-
istics indicated that our compounds 13j and 13z which provided a new
framework for FXR agonists were worth further research in the therapy
of NASH and other FXR correlative diseases.
Table 1
Agonist effects of the final compounds SC1 and 13a-13n on
FXR.
Compound
R1
R2
X
Ring A
FXR transactivationa
EC50 (nM)
Efficacy (%)b
SC1
13a
13b
13c
13d
13e
13f
H
H
H
H
H
H
H
H
H
Cl
H
H
H
H
H
H
H
C
C
C
C
C
C
N
N
C
C
C
C
C
C
C
S2
S1
S1
S2
S3
S4
S2
S3
S5
S2
S7
S2
S2
S2
S6
179.1 ± 70.4
127.9 ± 20.1
133.7 ± 72.7
47.4 ± 27.0
49.7 ± 7.6
147.5 ± 4.7
123.6 ± 21.2
125.7 ± 16.9
136.5 ± 5.7
149.1 ± 4.2
141.6 ± 17.5
126.5 ± 26.4
111.7 ± 19.5
135.5 ± 4.6
117.9 ± 12.5
125.2 ± 9.7
121.3 ± 23.1
98.5 ± 33.4
128.8 ± 9.9
120.3 ± 5.7
Cl
Cl
Cl
Cl
H
65.0 ± 27.8
233.8 ± 31.5
1387.2 ± 226.8
59.2 ± 10.6
259.1 ± 45.3
45.2 ± 19.5
37.2 ± 18.1
193.7 ± 46.4
55.8 ± 4.9
4. Experimental section
13g
13h
13i
H
Cl
H
4.1. Chemistry
13j
Cl
Br
CF3
F
All of the chemicals and solvents which were used directly without
further purification were purchased from commercial suppliers. Com-
pounds were dissolved in solvent (CDCl3, MeOH‑d4 or DMSO‑d6) with
tetramethylsilane (TMS) which was used as an internal standard. 1H
NMR spectra were recorded on a Bruker Avance III 400 or a Bruker
Avance III 500 NMR spectrometer. 13C NMR spectra were recorded on a
Bruker Avance III 126 NMR spectrometer. HR/MS (ESI) data were
recorded on the Agilent G6520 Q-TOF system. Low-resolution Mass data
were recorded using an Agilent liquid-chromatography mass spec-
trometer system that consisted of an Agilent 1260 infinity LC coupled to
Agilent 6120 Quadrupole mass spectrometer (ESI). Column chroma-
tography was performed with silica gel (200–400 mesh) or with pre-
packed silica cartridges (4–80 g) from Bonna-Agela Technologies Inc.
(Tianjin, China) and was eluted with a CombiFlash@ Rf 200 from Tel-
edyne Isco. Purity of final compounds were analyzed by HPLC and were
greater than 95%.
13k
13l
13m
13n
Cl
75.4 ± 12.5
Table 2
Agonist
effects
of
the
final
compounds
13o-13z
on
FXR.
Compound
R3
R4
Ring A
FXR transactivationa
EC50 (nM)
Efficacy (%)b
13o
13p
H
Cl
Cl
Cl
H
H
H
H
H
H
H
H
Cl
S4
S5
S2
S4
S5
S5
S5
S4
S7
S7
S7
S7
54.8 ± 4.3
158.3 ± 71.3
107.5 ± 46.2
727.8 ± 171.5
1343.7 ± 36.5
>1851.9
141.1 ± 2.6
156.4 ± 15.8
134.2 ± 26.7
125.9 ± 11.8
87.9 ± 6.3
H
H
4.1.1. (E)-2,6-dichlorobenzaldehyde oxime (2a)
13q
A solution of sodium hydroxide (1.656 g, 41.41 mmol, 10 mL H2O)
was added to a solution of NH2OH⋅HCl (3.940 g, 56.69 mmol, 20 mL
H2O) at 0 ◦C. Then, a solution of 2,6-dichlorobenzaldehyde (10.0 g,
57.14 mmol, 80 mL ethanol) was added to the mixture at 25 ◦C. After
completion, the mixture was concentrated under vacuum to give crude
product. The crude product was recrystallized in the solution (ethanol:
H2O = 1:1) to give 9.597 g of compound 2a in 89% yield as a white solid.
1H NMR (500 MHz, DMSO‑d6) δ 12.69 (s, 1H), 7.60 (dt, J = 2.3, 1.1 Hz,
1H), 7.60–7.58 (m, 1H), 7.56–7.51 (m, 1H), 3.54–3.38 (m, 1H). MS(ESI)
m/e [M+H]+: 189.9.
13r
F
13s
F
13t
OCH3
CH3
CH3
F
55.9 ± 21.7
106.1 ± 3.7
82.3 ± 19.4
134.9 ± 19.6
126.4 ± 3.2
114.3 ± 4.5
159.3 ± 8.2
102.9 ± 5.0
133.7 ± 2.7
13u
523.1 ± 181.9
1832.0 ± 978.5
346.8 ± 100.5
969.9 ± 363.0
440.2 ± 104.7
36.1 ± 4.7
13v
13w
13x
OCH3
CH3
H
13y
13z
OCA
GW4064
324.1 ± 76.9
22.3 ± 2.7
a
Data represent means ± SD of at least three independent experiments.
b
Efficacy: maximum efficacy of the test compound relative to 10 μM OCA
4.1.2. (E)-2-(trifluoromethoxy)benzaldehyde oxime (2b)
(100%).
Compound 2b (8.3 g, a white solid) was synthesized from 2-(Tri-
fluoromethoxy) benzaldehyde (10.0 g, 52.60 mmol) according to the
procedure for 2a, 77% yield. 1H NMR (400 MHz, Chloroform-d) δ 8.42
(s, 1H), 7.89 (dd, J = 7.8, 1.8 Hz, 1H), 7.43 (ddd, J = 8.2, 7.4, 1.8 Hz,
1H), 7.35–7.27 (m, 2H); MS(ESI)m/e[M+H]+: 206.0.
Table 3
The hTGR5 activation ability of compounds 13j, 13z and OCA.
Compound
EC50
(
μ
M)a
Efficacy (%)b
13j
13z
OCA
>100
>100
1.1 ± 0.7
0.6 ± 0.8
95.3 ± 3.6
4.1.3. (Z)-2,6-dichloro-N-hydroxybenzimidoyl chloride (3a)
NCS (2.124 g, 15.90 mmol) was added to the solution of compound
2a (3.0 g, 15.87 mmol, 50 mL DMF) in three portions. The mixture was
stirred for 5 h at 25 ◦C. Then the mixture was diluted with ethyl acetate
(50 mL) and washed with brine (80 mL × 3). The combined organic
layer was dried over anhydrous sodium sulfate and concentrated under
vacuum to give the crude product. The crude product was recrystallized
in hexane to give 3.478 g of compound 3a in 94% yield as a white solid.
1H NMR (500 MHz, DMSO‑d6) δ 7.64 (d, J = 1.7 Hz, 1H), 7.63 (d, J =
0.7 Hz, 1H), 7.58 (dd, J = 9.2, 6.8 Hz, 1H). MS(ESI)m/e[M+H]+: 223.9.
3.4 ± 0.6
a
b
EC50 values represent the mean ± SD of three independent experiments.
Efficacy: maximum efficacy of the test compound relative to positive control
OCA (20 μM).
3. Conclusion
We discovered a series of non-steroidal FXR agonists which con-
tained a ketoxime ether group and their agonistic activities were
5

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
Fig. 3. Induction of FXR target gene SHP (A) and BSEP (B) in the primary C57 mouse hepatocytes by compounds 13j, 13z and OCA. Primary C57 mouse hepatocytes
were treated for 24 h with vehicle only or the compounds at differing concentrations. Gene expression levels were determined by qRT-PCR. Values were shown as fold
values of the vehicle control group (mean ± S.E.M, n = 3; *p < 0.05, **p < 0.01 vs control).
Fig. 4. Induction of FXR target genes SHP, BSEP, CYP7A1 and CYP8B1 in mouse livers by compounds 13j, 13z and OCA following a single oral dose. Gene expression
levels were determined by qRT-PCR. Values were shown as a fold value in relation to the vehicle control group (mean ± S.E.M, n = 6; *p < 0.05, **p < 0.01
vs control).
4.1.4. (Z)-N-hydroxy-2-(trifluoromethoxy)benzimidoyl chloride (3b)
Compound 3b (7.0 g, a yellow oil) was synthesized from 2b (7.0 g,
34.14 mmol) according to the procedure for 3a. 86% yield. 1H NMR
(400 MHz, Chloroform-d) δ 8.29 (s, 1H), 7.61 (dd, J = 7.7, 1.8 Hz, 1H),
7.50 (td, J = 7.9, 1.8 Hz, 1H), 7.41–7.32 (m, 2H); MS(ESI)m/e[M+H]+:
240.0.
4.1.5. Ethyl 5-cyclopropyl-3-(2,6-dichlorophenyl) isoxazole-4-carboxylate
(4a)
The TEA (1.137 g, 11.15 mmol) was added to the solution of ethyl 3-
cyclopropyl-3-oxopropanoate (2.679 g, 17.16 mmol, 30 mL DMF). After
stirred for five hours, the mixture was treated with the solution of
compound 3a (1.920 g, 8.61 mmol, 10 mL DMF). After completion, the
mixture was diluted with ethyl acetate (40 mL) and washed with brine
(80 mL × 3). The combined organic layer was dried over anhydrous
6

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
Fig. 5. Induction of FXR target genes SHP and FGF15 in the mouse ileum by compounds 13j, 13z and OCA following a single oral dose. Gene expression levels were
determined by qRT-PCR. Values were shown as a fold value of the vehicle control group (mean ± SEM, n = 6; *p < 0.05, **p < 0.01 vs control).
(s, 2H), 2.22–2.20 (m, 1H), 1.71 (s, 1H) 1.11–1.28 (m, 4H); MS(ESI)m/e
[M+H]+: 300.0.
Table 4
Liver/plasma concentration (L/P) ratios in ICR mice.
Compound
Time (h)
Liver conc (ng/g)
Plasma conc (ng/mL)
L/P ratio
4.1.9. 4-(bromomethyl)-5-cyclopropyl-3-(2,6-dichlorophenyl) isoxazole
(6a)
13j
1.5
4.0
8.0
1.5
4.0
8.0
4534
2610
341
124.0
45.4
7.8
37
57
A solution of compound 5a (400.0 mg, 1.41 mmol, 30 mL DCM) was
added with PPh3 (606.6 mg, 2.12 mmol) and then stirred for 10 min.
After that, the mixture was added with CBr4 (693.5 mg, 2.12 mmol) in
three portions and stirred for another 2 h at 0 ◦C. After completion, the
mixture was concentrated under vacuum and purified by flash chro-
matography with ethyl acetate and petroleum ether (PE:EA = 8:1) to
give 420.0 mg of compound 6a in 86% yield as a white solid. 1H NMR
(400 MHz, Chloroform-d) δ 7.46 (d, J = 1.9 Hz, 1H), 7.44 (d, J = 0.7 Hz,
1H), 7.38 (dd, J = 9.3, 6.6 Hz, 1H), 4.23 (s, 2H), 2.13 (tt, J = 8.4, 5.1 Hz,
1H), 1.30 (ddd, J = 6.3, 5.0, 3.8 Hz, 2H), 1.23–1.16 (m, 2H); MS(ESI)m/
e[M+H]+: 345.9.
43
13z
4344
3579
941
56.7
45.2
8.4
77
79
111
PO, 15 mg/kg, each; male, n = 3 for each time point. l/P is short for liver/
plasma.
sodium sulfate, concentrated under vacuum, and purified by flash
chromatography with ethyl acetate and petroleum ether (PE:EA = 4:1)
to give 1.651 g of compound 4a in 59% yield as a white solid. 1H NMR
(400 MHz, Chloroform-d) δ 7.41 (d, J = 1.9 Hz, 1H), 7.39 (d, J = 0.7 Hz,
1H), 7.33 (dd, J = 9.3, 6.6 Hz, 1H), 4.12 (q, J = 7.1 Hz, 2H), 2.93 (tt, J =
8.4, 5.1 Hz, 1H), 1.45–1.36 (m, 2H), 1.36–1.23 (m, 2H), 1.02 (t, J = 7.1
Hz, 3H); MS(ESI)m/e[M+H]+: 326.0.
4.1.10. 4-(bromomethyl)-5-cyclopropyl-3-(2-(trifluoromethoxy)phenyl)
isoxazole(6b)
Compound 6b (1.52 g, a yellow oil) was synthesized from 5b (1.5 g,
5.02 mmol) according to the procedure for 6a. 84% yield. 1H NMR (400
MHz, Chloroform-d) δ 7.59 (dd, J = 7.6, 1.8 Hz, 1H), 7.54 (dd, J = 8.0,
1.9 Hz, 1H), 7.46–7.39 (m, 2H), 4.34 (s, 2H), 2.12 (tt, J = 8.4, 5.1 Hz,
1H), 1.29–1.25 (m, 2H), 1.21–1.15 (m, 2H); MS(ESI)m/e[M+H]+:
361.9.
4.1.6. Ethyl 5-cyclopropyl-3-(2-(trifluoromethoxy)phenyl)isoxazole-4-
carboxylate (4b)
Compound 4b (4.1 g, a yellow solid) was synthesized from 3b (5.0 g,
20.92 mmol) according to the procedure for 4a. 57% yield. 1H NMR
(400 MHz, Chloroform-d) δ 7.53–7.45 (m, 2H), 7.38–7.30 (m, 2H),
4.18–4.13 (m, 2H), 2.91–2.82 (m, 1H), 1.38–1.32 (m, 2H), 1.25–1.21
(m, 2H), 1.08 (t, J = 7.0 Hz, 3H); MS(ESI)m/e[M+H]+: 342.0.
4.1.11. General procedure for the synthesis of intermediates 7a-7l. 1-(4-
((5-cyclopropyl-3-(2,6-dichlorophenyl)isoxazol-4-yl)methoxy)phenyl)
ethan-1-one (7a)
4.1.7. (5-cyclopropyl-3-(2,6-dichlorophenyl) isoxazol-4-yl) methanol (5a)
A solution of LiAlH4 (128.2 mg, 3.38 mmol, 1.41 mL THF) was added
to the solution of compound 4a (1.0 g, 3.08 mmol, 20 mL THF) at 0 ◦C.
The mixture was stirred at 25 ◦C for 2 h and then quenched with a
saturated solution of NH4Cl. The mixture was filtered through celite and
extracted with ethyl acetate (30 mL × 3). The combined organic layer
was dried over anhydrous sodium sulfate and concentrated under vac-
uum to give the crude product. The crude product was recrystallized in
hexane to obtain 657.0 mg of compound 5a in 75% yield as a white
solid. 1H NMR (400 MHz, Chloroform-d) δ 7.44 (d, J = 1.6 Hz, 1H), 7.42
(d, J = 0.7 Hz, 1H), 7.36 (dd, J = 9.2, 6.8 Hz, 1H), 4.41 (d, J = 5.8 Hz,
2H), 2.19 (tt, J = 8.4, 5.1 Hz, 1H), 1.28 (ddd, J = 6.7, 5.0, 4.1 Hz, 2H),
1.18–1.10 (m, 2H); MS(ESI)m/e[M+H]+: 284.0.
A solution of compound 6a (138.0 mg, 0.40 mmol, 10 mL DMF) was
added with 4′-hydroxyacetophenone (54.4 mg, 0.40 mmol). Then the
mixture was added with K2CO3 (110.4 mg, 0.80 mmol) and stirred at
25 ◦C. After completion, the mixture was diluted with ethyl acetate (10
mL) and washed with brine (20 mL × 3). The combined organic layer
was dried over anhydrous sodium sulfate, concentrated under vacuum
and purified by flash chromatography with ethyl acetate and petroleum
ether (PE:EA = 3:1) to give 120.6 mg of compound 7a in 75% yield as a
white solid. 1H NMR (500 MHz, Chloroform-d) δ 7.89–7.83 (m, 2H),
7.39 (dd, J = 8.1, 0.9 Hz, 2H), 7.31 (dd, J = 9.0, 7.2 Hz, 1H), 6.85–6.80
(m, 2H), 4.87 (s, 2H), 2.53 (s, 3H), 2.17 (tt, J = 8.4, 5.1 Hz, 1H),
1.30–1.26 (m, 2H), 1.18–1.12 (m, 2H); MS(ESI)m/e[M+H]+: 402.0.
Synthesis of intermediates 7b-7l. Compound 6a or 6b was reacted with
the derivates of 4′-hydroxyacetophenone using a procedure similar to
the synthesis of 7a to afford 7b-7l (68–90% yield).
4.1.8. (5-cyclopropyl-3-(2-(trifluoromethoxy)phenyl)isoxazol-4-yl)
methanol (5b)
Compound 5b (2.5 g, a yellow oil) was synthesized from 4b (3.5 g,
10.26 mmol) according to the procedure for 5a. 82% yield. 1H NMR
(400 MHz, Chloroform-d) δ 7.56–7.54 (m, 2H), 7.40–7.39 (m, 2H), 4.51
7

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
4.1.12. General procedure for the synthesis of intermediates 9a-9g. Methyl
4-(bromomethyl)benzoate (9a)
Compound 12a (56.4 mg, 0.10 mol) and LiOH⋅H2O (12.5 mg, 0.30
mmol) and then stirred at 40 ◦C. Upon completion, the mixture was
concentrated under vacuum and then added with water to dissolve. The
pH was adjusted to 4 with 2 N HCl. The formed precipitate was filtered,
washed with water, and dried under vacuum below 30 ◦C to give 45.6
mg of final compound 13a in 83% yield as a white solid. The required
intermediates SC1-ME and 12b-12z were reacted using a procedure
similar to the synthesis of 13a to afford compound SC1 and 13b-13z
(80–92%).
Compound 8a (4.505 g, 30.00 mmol), NBS (5.339 g, 30.00 mmol)
and AIBN (492.6 mg, 3.00 mmol) were dissolved in CCl4 (60 mL). Then
the mixture was stirred at 70 ◦C. After completion, the mixture was
concentrated under vacuum and purified by flash chromatography with
ethyl acetate and petroleum ether (PE:EA = 8:1) to give 4.582 g of
compound 9a in 67% yield as a white solid. 1H NMR (500 MHz, Chlo-
roform-d) δ 8.02 (d, J = 1.7 Hz, 1H), 8.00 (d, J = 2.0 Hz, 1H), 7.46 (d, J
= 1.8 Hz, 1H), 7.45 (d, J = 1.9 Hz, 1H), 4.50 (s, 2H), 3.92 (s, 3H). MS
(ESI)m/e[M+H]+: 228.9. Synthesis of intermediates 9b-9g. The
required compounds 8b-8g were reacted using a procedure similar to
the synthesis of 9a to afford 9b-9g (58–72% yield).
4.1.17. (E)-3-((((1-(4-((5-cyclopropyl-3-(2,6-dichlorophenyl)isoxazol-4-
yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)benzoic acid (SC1)
White solid, 83% yield; 1H NMR (400 MHz, Chloroform-d) δ 8.14 (s,
1H, H-35), 8.04 (d, J = 7.7 Hz, 1H, H-33), 7.65 (d, J = 7.7 Hz, 1H, H-31),
7.53–7.49 (m, 2H, H-21 and H-23), 7.47 (t, J = 7.7 Hz, 1H, H-32), 7.39
(d, J = 1.4 Hz, 1H, H-12 or H-14), 7.37 (d, J = 0.6 Hz, 1H,H-12 or H-14),
7.30 (dd, J = 9.0, 7.1 Hz, 1H, H-13), 6.80–6.74 (m, 2H, H-20 and H-24),
5.25 (s, 2H, H-28), 4.80 (s, 2H, H-1), 2.23 (s, 3H, H-29), 2.15 (tt, J = 8.5,
5.1 Hz, 1H, H-7), 1.28 (dt, J = 6.9, 4.7 Hz, 2H, H-8 or H-9), 1.16–1.09
(m, 2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3) δ 172.45, 171.65,
159.35, 159.15, 154.92, 138.91, 135.75, 133.40, 131.26, 129.76,
129.57, 129.52, 129.47, 128.57, 128.09, 127.71, 127.40, 114.60,
110.44, 77.29, 77.04, 76.79, 75.30, 59.51, 12.85, 8.41, 7.78. HR/MS
(ESI): m/z calcd C29H24Cl2N2O5 (M+H+) 551.1135, found 551.1141.
4.1.13. General procedure for the synthesis of intermediates 10a-10g.
Methyl 4-(((1,3-dioxoisoindolin-2-yl)oxy)methyl)benzoate (10a)
A solution of compound 9a (1.831 g, 8.00 mol, 60 mL DMF) was
added with N-Hydroxyphthalimide (1.956 g, 12.00 mmol) and stirred
for 10 min under an inert atmosphere of nitrogen. Then, the mixture was
◦
added with DIPEA (2.067 g, 16.00 mmol) and stirred at 70 C. After
completion, the mixture was added with water. The formed precipitate
was filtered, washed with water, and then dried under vacuum at 50 ◦C
to provide 1.518 g of compound 10a in 61% yield as a white solid. 1H
NMR (400 MHz, Chloroform-d) δ 8.09–8.03 (m, 2H), 7.84–7.79 (m, 2H),
7.75 (dd, J = 5.5, 3.1 Hz, 2H), 7.62 (d, J = 8.2 Hz, 2H), 5.27 (s, 2H), 3.92
(s, 3H); MS(ESI)m/e[M+H]+: 312.0. Synthesis of intermediates 10b-
10g. The required compounds 9b-9g were reacted using a procedure
similar to the synthesis of 10a to afford 10b-10g (58–85% yield).
4.1.18. (E)-4-((((1-(4-((5-cyclopropyl-3-(2,6-dichlorophenyl)isoxazol-4-
yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)benzoic acid (13a)
White solid, 87% yield; 1H NMR (400 MHz, Chloroform-d) δ
8.12–8.05 (m, 2H, H-21 and H-23), 7.49 (t, J = 8.2 Hz, 4H, H-31, H-32,
H-34, H-35), 7.39 (d, J = 1.4 Hz, 1H, H-12 or H-14), 7.37 (s, 1H, H-12 or
H-14), 7.30 (dd, J = 9.1, 7.0 Hz, 1H, H-13), 6.81–6.72 (m, 2H, H-20 and
H-24), 5.27 (s, 2H, H-18), 4.80 (s, 2H, H-1), 2.24 (s, 3H, H-29), 2.16 (tt,
J = 8.4, 5.1 Hz, 1H, H-7), 1.31–1.26 (m, 2H, H-8 or H-9), 1.16–1.10 (m,
2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3) δ 172.41, 171.30, 159.32,
159.16, 154.95, 144.61, 135.75, 131.22, 130.27, 129.46, 128.46,
128.06, 127.70, 127.60, 127.36, 114.57, 110.38, 77.25, 77.00, 76.75,
75.18, 59.49, 12.81, 8.38, 7.76. HR/MS (ESI): m/z calcd C29H24Cl2N2O5
(M+H+) 551.1135, found 551.1124.
4.1.14. General procedure for the synthesis of intermediates 11a-11g. O-
(4-(methoxycarbonyl)benzyl)hydroxylammonium chloride (11a)
Butan-1-amine (292.5 mg, 4.00 mmol) was added to a solution of
compound 10a (1.244 g, 4.00 mmol, 60 mL MeOH) under an inert at-
mosphere of nitrogen. The mixture was stirred at 25 ◦C. Upon comple-
tion, the mixture was added with ethanolic solution of HCl at 0 ◦C until
the PH was adjusted to 3. Then, the mixture was concentrated under
◦
vacuum at 25 C to obtain the crude product. The crude product was
washed with MTBE to provide 703.0 mg of compound 11a in 81% yield
as a white solid. 1H NMR (400 MHz, DMSO‑d6) δ 8.00 (dd, J = 8.3, 4.0
Hz, 2H), 7.60–7.51 (m, 2H), 5.11 (d, J = 2.7 Hz, 2H), 3.87 (s, 3H).
Synthesis of intermediates 11b-11g. The required compounds 10b-10g
were reacted using a procedure similar to the synthesis of 11a to afford
11b-11g (78–85% yield).
4.1.19. (E)-4-((((1-(2-chloro-4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)benzoic acid
(13b)
White solid, 82% yield; 1H NMR (500 MHz, Chloroform-d) δ
8.14–8.07 (m, 2H, H-32 and H-34), 7.51–7.45 (m, 2H, H-31 and H-35),
7.40 (d, J = 1.1 Hz, 1H, H-12 or H-14), 7.38 (d, J = 0.5 Hz, 1H, H-12 or
H-14), 7.31 (dd, J = 8.9, 7.2 Hz, 1H, H-13), 7.11 (d, J = 8.5 Hz, 1H, H-
21), 6.81 (d, J = 2.5 Hz, 1H, H-24), 6.67 (dd, J = 8.6, 2.5 Hz, 1H, H-20),
5.28 (s, 2H, H-28), 4.78 (s, 2H, H-1), 2.24 (s, 3H, H-29), 2.13 (tt, J = 8.4,
5.1 Hz, 1H, H-7), 1.31–1.26 (m, 2H, H-8 or H-9), 1.18–1.13 (m, 2H, H-8
or H-9). 13C NMR (126 MHz, CDCl3) δ 172.57, 171.10, 159.26, 159.03,
156.75, 144.41, 135.71, 133.28, 131.32, 130.85, 130.29, 129.63,
128.42, 128.10, 127.56, 127.48, 116.10, 113.60, 110.00, 77.25, 77.00,
76.74, 75.14, 59.79, 29.68, 16.79, 8.42, 7.73. HR/MS (ESI): m/z calcd
4.1.15. General procedure for the synthesis of intermediates SC1-ME and
12a-12z. methyl (E)-4-((((1-(4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)benzoate
(12a)
A solution of compound 7a (60.1 mg, 0.15 mmol, 10 mL MeOH) was
added with compound 11a (39.0 mg, 0.18 mmol) and stirred at 25 ◦C.
After completion, the mixture was concentrated under vacuum and
purified by flash chromatography with ethyl acetate and petroleum
ether (PE: EA = 4:1) to provide 63.4 mg of compound 12a in 75% yield
1
as a colorless oil. H NMR (400 MHz, Chloroform-d) δ 8.08–7.97 (m,
C
29H23Cl3N2O5 (M+H+) 585.0745, found 585.0755.
2H), 7.54–7.47 (m, 2H), 7.45 (d, J = 8.1 Hz, 2H), 7.42–7.35 (m, 2H),
7.30 (dd, J = 9.0, 7.0 Hz, 1H), 6.81–6.72 (m, 2H), 5.25 (s, 2H), 4.80 (s,
2H), 3.91 (s, 3H), 2.23 (s, 3H), 2.15 (tt, J = 8.4, 5.1 Hz, 1H), 1.28–1.24
(m, 2H), 1.17–1.08 (m, 2H); MS(ESI)m/e[M+H]+: 565.1. Synthesis of
intermediates SC1-ME and 12b-12z. The required compounds 11a-11g
were reacted using a procedure similar to the synthesis of 12a to afford
compound SC1-ME and 12b-12z (58–85% yield).
4.1.20. (E)-3-((((1-(2-chloro-4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)benzoic acid
(13c)
White solid, 86% yield; 1H NMR (400 MHz, Chloroform-d) δ 8.13 (s,
1H, H-35), 8.04 (d, J = 7.8 Hz, 1H, H-33), 7.64 (d, J = 7.6 Hz, 1H, H-31),
7.47 (t, J = 7.7 Hz, 1H, H-32), 7.40 (d, J = 1.5 Hz, 1H, H-12 or H-14),
7.38 (d, J = 0.6 Hz, 1H, H-12 or H-14), 7.31 (dd, J = 9.1, 6.9 Hz, 1H, H-
13), 7.13 (d, J = 8.5 Hz, 1H, H-21), 6.81 (d, J = 2.5 Hz, 1H, H-24), 6.68
(dd, J = 8.5, 2.5 Hz, 1H, H-20), 5.26 (s, 2H, H-28), 4.78 (s, 2H, H-1),
2.23 (s, 3H, H-29), 2.17–2.09 (m, 1H, H-7), 1.31–1.27 (m, 2H, H-8 or H-
9), 1.19–1.10 (m, 2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3) δ 172.60,
4.1.16. General procedure for the synthesis of compound SC1 and 13a-
13z. (E)-4-((((1-(4-((5-cyclopropyl-3-(2,6-dichlorophenyl)isoxazol-4-yl)
methoxy)phenyl)ethylidene)amino)oxy)methyl)benzoic acid (13a)
A solution (7 mL, THF: MeOH: H2O = 3:3:1) was added with
8

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
171.41, 159.29, 159.03, 156.70, 138.72, 135.72, 133.31, 133.21,
131.36, 130.90, 129.73, 129.60, 129.53, 129.44, 128.59, 128.13,
127.56, 116.13, 113.61, 110.06, 77.28, 77.03, 76.78, 75.24, 59.80,
16.82, 8.45, 7.76. HR/MS (ESI): m/z calcd C29H23Cl3N2O5 (M+H+)
585.0745, found 585.0760.
7.30. HR/MS (ESI): m/z calcd C26H21Cl2N3O6 (M+H+) 542.0880, found
542.0873.
4.1.25. (E)-3-((((1-(2-chloro-4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)-5-
methylbenzoic acid (13h)
4.1.21. (E)-5-((((1-(2-chloro-4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)furan-2-
carboxylic acid (13d)
White solid, 89% yield; 1H NMR (500 MHz, Chloroform-d) δ 7.94 (s,
1H, H-33 or H-35), 7.86 (s, 1H, H-33 or H-35), 7.45 (s, 1H, H-31), 7.40
(d, J = 1.1 Hz, 1H, H-12 or H-14), 7.38 (s, 1H, H-12 or H-14), 7.31 (dd, J
= 8.9, 7.2 Hz, 1H, H-13), 7.14 (d, J = 8.5 Hz, 1H, H-21), 6.81 (d, J = 2.5
Hz, 1H, H-24), 6.68 (dd, J = 8.5, 2.5 Hz, 1H, H-20), 5.22 (s, 2H, H-28),
4.78 (s, 2H, H-1), 2.43 (s, 3H, H-40), 2.23 (s, 3H, H-29), 2.14 (tt, J = 8.4,
5.0 Hz, 1H, H-7), 1.31–1.26 (m, 2H, H-8 or H-9), 1.17–1.13 (m, 2H, H-8
or H-9). 13C NMR (126 MHz, CDCl3) δ 172.56, 159.27, 158.99, 156.55,
138.51, 138.45, 135.70, 134.03, 133.29, 131.32, 130.88, 130.10,
129.77, 128.10, 127.55, 126.88, 116.10, 113.58, 110.03, 77.25, 77.00,
76.74, 75.30, 59.78, 21.23, 16.81, 8.42, 8.19, 7.73. HR/MS (ESI): m/z
calcd C30H25Cl3N2O5 (M+H+) 599.0902, found 599.0916.
White solid, 81% yield; 1H NMR (400 MHz, DMSO‑d6) δ 7.62 (d, J =
1.5 Hz, 1H, H-12 or H-14), 7.60 (s, 1H, H-12 or H-14), 7.53 (dd, J = 9.2,
6.9 Hz, 1H, H-13), 7.22–7.13 (m, 2H, H-33 and H-21), 6.96 (d, J = 2.5
Hz, 1H, H-24), 6.78 (dd, J = 8.6, 2.6 Hz, 1H, H-20), 6.64 (d, J = 3.4 Hz,
1H, H-34), 5.11 (s, 2H, H-29), 4.93 (s, 2H, H-1), 2.48–2.41 (m, 1H, H-7),
2.09 (s, 3H, H-27), 1.18 (dt, J = 8.2, 2.8 Hz, 2H, H-8 or H-9), 1.14–1.08
(m, 2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3) δ 172.62, 162.73,
159.29, 159.09, 157.25, 156.93, 143.73, 135.72, 133.27, 131.37,
130.89, 129.47, 128.13, 127.55, 120.57, 116.15, 113.62, 111.55,
110.04, 77.29, 77.03, 76.78, 67.80, 59.80, 16.75, 8.46, 7.76.HR/MS
(ESI): m/z calcd C27H21Cl3N2O6 (M+H+) 575.0538, found 575.0546.
4.1.26. (E)-3-((((1-(3-chloro-4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)benzoic acid
(13i)
4.1.22. (E)-5-((((1-(2-chloro-4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)nicotinic acid
(13e)
White solid, 89% yield; 1H NMR (400 MHz, Chloroform-d) δ 8.13 (s,
1H, H-33), 8.04 (d, J = 7.9 Hz, 1H, H-31), 7.68–7.59 (m, 2H, H-21 and
H-29), 7.47 (t, J = 7.7 Hz, 1H, H-30), 7.43–7.36 (m, 3H, H-12, H-14 and
H-18), 7.32 (dd, J = 9.1, 6.9 Hz, 1H, H-13), 6.79 (d, J = 8.6 Hz, 1H, H-
19), 5.26 (s, 2H, H-26), 4.91 (s, 2H, H-1), 2.26–2.20 (m, 1H, H-7), 2.21
(s, 3H, H-27), 1.27 (dt, J = 6.2, 4.4 Hz, 2H, H-8 or H-9), 1.17–1.08 (m,
2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3) δ 172.81, 171.81, 159.02,
154.24, 153.78, 138.68, 135.78, 133.47, 131.32, 130.59, 129.79,
129.61, 129.35, 128.62, 128.19, 128.09, 127.44, 125.35, 123.65,
113.71, 110.00, 77.27, 77.02, 76.77, 75.45, 60.70, 12.67, 8.45, 7.82.
HR/MS (ESI): m/z calcd C29H23Cl3N2O5 (M+H+) 585.0745, found
585.0750.
White solid, 84% yield; 1H NMR (500 MHz, Chloroform-d) δ 9.24 (d,
J = 2.0 Hz, 1H, H-33), 8.86 (d, J = 2.2 Hz, 1H, H-31 or H-35), 8.39 (t, J
= 2.1 Hz, 1H, H-31 or H-35), 7.40 (d, J = 1.2 Hz, 1H, H-12 or H-14), 7.38
(d, J = 0.6 Hz, 1H, H-12 or H-14), 7.31 (dd, J = 9.0, 7.2 Hz, 1H, H-13),
7.11 (d, J = 8.5 Hz, 1H, H-21), 6.81 (d, J = 2.5 Hz, 1H, H-24), 6.68 (dd,
J = 8.6, 2.5 Hz, 1H, H-20), 5.29 (s, 2H, H-28), 4.78 (s, 2H, H-1), 2.23 (s,
3H, H-29), 2.16–2.10 (m, 1H, H-7), 1.30–1.26 (m, 2H, H-8 or H-9),
1.17–1.12 (m, 2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3) δ 172.58,
159.25, 159.08, 157.40, 152.21, 149.76, 137.82, 135.69, 134.29,
133.26, 131.34, 130.79, 129.37, 128.10, 127.52, 116.14, 113.61,
109.99, 77.26, 77.00, 76.75, 72.64, 59.77, 29.68, 16.84, 8.43, 7.73. HR/
MS (ESI): m/z calcd C28H22Cl3N3O5 (M+H+) 586.0698, found 586.0707.
4.1.27. (E)-3-((((1-(2-chloro-4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)-4-
cyanobenzoic acid (13j)
4.1.23. (E)-3-((((1-(5-((5-cyclopropyl-3-(2,6-dichlorophenyl)isoxazol-4-
yl)methoxy)pyridin-2-yl)ethylidene)amino)oxy)methyl)benzoic acid (13f)
White solid, 82% yield; 1H NMR (500 MHz, Chloroform-d) δ 8.17
(dd, J = 2.9, 0.6 Hz, 1H, H-24), 8.14 (d, J = 1.8 Hz, 1H, H-35), 8.05 (dt,
J = 7.8, 1.5 Hz, 1H, H-33), 7.75 (dd, J = 8.8, 0.7 Hz, 1H, H-21), 7.65 (dt,
J = 7.8, 1.4 Hz, 1H, H-31), 7.47 (t, J = 7.7 Hz, 1H, H-32), 7.39 (d, J =
1.1 Hz, 1H, H-12 or H-14), 7.37 (d, J = 0.5 Hz, 1H, H-12 or H-14), 7.30
(dd, J = 8.9, 7.2 Hz, 1H, H-13), 7.06 (dd, J = 8.8, 2.9 Hz, 1H, H-20), 5.29
(s, 2H, H-28), 4.87 (s, 2H, H-1), 2.33 (s, 3H, H-29), 2.14 (tt, J = 8.4, 5.1
Hz, 1H, H-7), 1.31–1.26 (m, 2H, H-8 or H-9), 1.18–1.12 (m, 2H, H-8 or
H-9). 13C NMR (126 MHz, CDCl3) δ 172.57, 171.05, 159.27, 155.98,
154.65, 147.33, 138.67, 136.45, 135.68, 133.25, 131.34, 129.69,
129.55, 129.51, 128.59, 128.11, 127.53, 122.14, 121.28, 109.95, 77.25,
77.00, 76.75, 75.58, 59.98, 11.47, 8.48, 7.74. HR/MS (ESI): m/z calcd
White solid, 90% yield; 1H NMR (500 MHz, Chloroform-d) δ
8.29–8.25 (m, 1H, H-33), 8.11 (dd, J = 7.9, 1.7 Hz, 1H, H-31), 7.79 (d, J
= 8.0 Hz, 1H, H-30), 7.39 (d, J = 1.1 Hz, 1H, H-12 or H-14), 7.38 (d, J =
0.6 Hz, 1H, H-12 or H-14), 7.30 (dd, J = 8.9, 7.2 Hz, 1H, H-13), 7.13 (d,
J = 8.5 Hz, 1H, H-19), 6.81 (d, J = 2.5 Hz, 1H, H-22), 6.68 (dd, J = 8.6,
2.5 Hz, 1H, H-18), 5.44 (s, 2H, H-26), 4.78 (s, 2H, H-1), 2.27 (s, 3H, H-
27), 2.18–2.08 (m, 1H, H-7), 1.30–1.26 (m, 2H, H-8 or H-9), 1.17–1.12
(m, 2H, H-8 or H-9). 13C NMR (126 MHz, DMSO) δ 172.80, 166.44,
159.53, 159.16, 156.96, 142.53, 135.20, 135.06, 134.09, 132.93,
132.49, 131.37, 130.31, 129.54, 129.10, 128.86, 127.35, 117.22,
116.14, 115.18, 114.50, 110.57, 73.06, 59.77, 17.00, 8.90, 7.70, 1.61.
HR/MS (ESI): m/z calcd C30H22Cl3N3O5 (M+H+) 610.0698, found
610.0716.
C
28H23Cl2N3O5 (M+H+) 552.1088, found 552.1090.
4.1.28. (E)-3-((((1-(2-bromo-4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)benzoic acid
(13k)
4.1.24. (E)-5-((((1-(5-((5-cyclopropyl-3-(2,6-dichlorophenyl)isoxazol-4-
yl)methoxy)pyridin-2-yl)ethylidene)amino)oxy)methyl)furan-2-carboxylic
acid (13g)
White solid, 87% yield; 1H NMR (500 MHz, Chloroform-d) δ 8.14 (d,
J = 1.7 Hz, 1H, H-33), 8.05 (dt, J = 7.8, 1.5 Hz, 1H, H-31), 7.64 (dt, J =
7.6, 1.4 Hz, 1H, H-29), 7.48 (t, J = 7.7 Hz, 1H, H-30), 7.40 (d, J = 1.1 Hz,
1H, H-12 or H-14), 7.38 (s, 1H, H-12 or H-14), 7.31 (dd, J = 8.9, 7.2 Hz,
1H, H-13), 7.10 (d, J = 8.5 Hz, 1H, H-19), 7.00 (d, J = 2.5 Hz, 1H, H-22),
6.72 (dd, J = 8.5, 2.5 Hz, 1H, H-18), 5.26 (s, 2H, H-26), 4.78 (s, 2H, H-
1), 2.23 (s, 3H, H-27), 2.17–2.11 (m, 1H, H-7), 1.30–1.27 (m, 2H, H-8 or
H-9), 1.15 (dt, J = 8.5, 3.4 Hz, 2H, H-8 or H-9). 13C NMR (151 MHz,
CDCl3) δ 172.16, 158.85, 158.37, 157.10, 137.92, 135.22, 132.15,
131.28, 130.93, 130.45, 129.05, 129.02, 127.95, 127.67, 127.05,
121.69, 118.68, 113.67, 109.57, 76.81, 76.60, 76.38, 74.86, 59.32,
White solid, 85% yield; 1H NMR (500 MHz, Chloroform-d) δ 8.18
(dd, J = 2.9, 0.7 Hz, 1H, H-24), 7.78 (dd, J = 8.8, 0.7 Hz, 1H, H-21), 7.43
(d, J = 1.2 Hz, 1H, H-12 or H-14), 7.41 (d, J = 0.6 Hz, 1H, H-12 or H-14),
7.34 (dd, J = 8.9, 7.1 Hz, 1H, H-13), 7.28 (s, 1H, H-32), 7.12–7.07 (m,
1H, H-20), 6.55 (d, J = 3.5 Hz, 1H, H-31), 5.24 (s, 2H, H-28), 4.91 (s, 2H,
H-1), 2.32 (s, 3H, H-29), 2.17 (tt, J = 8.4, 5.1 Hz, 1H, H-7), 1.35–1.30
(m, 2H, H-8 or H-9), 1.23–1.15 (m, 2H, H-8 or H-9). 13C NMR (151 MHz,
CDCl3) δ 172.55, 161.92, 158.81, 155.82, 154.91, 153.35, 144.82,
143.65, 135.17, 133.66, 131.08, 127.73, 126.89, 124.98, 122.24,
119.86, 111.59, 109.01, 76.82, 76.61, 76.40, 67.89, 59.94, 11.30, 8.25,
9

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
16.63, 8.09, 7.33. HR/MS (ESI): m/z calcd C29H23BrCl2N2O5 (M+H+)
134.21, 133.31, 131.78, 131.34, 130.82, 129.37, 127.12, 122.52,
120.92, 116.17, 113.55, 109.74, 77.25, 77.00, 76.74, 72.66, 59.86,
16.82, 8.22, 7.60. HR/MS (ESI): m/z calcd C29H23ClF3N3O6 (M+H+)
602.1300, found 602.1309.
629.0240, found 629.0225.
4.1.29. (E)-3-((((1-(4-((5-cyclopropyl-3-(2,6-dichlorophenyl)isoxazol-4-
yl)methoxy)-2-(trifluoromethyl)phenyl)ethylidene)amino)oxy)methyl)
benzoic acid (13l)
4.1.33. (E)-3-((((1-(2-chloro-4-((5-cyclopropyl-3-(2-(trifluoromethoxy)
phenyl)isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)-5-
methylbenzoic acid (13p)
White solid, 92% yield; 1H NMR (500 MHz, Chloroform-d) δ 8.11 (d,
J = 1.7 Hz, 1H, H-33), 8.04 (dt, J = 7.8, 1.5 Hz, 1H, H-31), 7.62 (dt, J =
7.6, 1.4 Hz, 1H, H-29), 7.47 (t, J = 7.7 Hz, 1H, H-30), 7.39 (d, J = 1.1 Hz,
1H, H-12 or H-14), 7.38 (s, 1H, H-12 or H-14), 7.31 (dd, J = 8.9, 7.2 Hz,
1H, H-13), 7.17 (d, J = 8.5 Hz, 1H, H-19), 7.05 (d, J = 2.7 Hz, 1H, H-22),
6.92 (dd, J = 8.5, 2.6 Hz, 1H, H-18), 5.24 (s, 2H, H-26), 4.84 (s, 2H, H-
1), 2.19 (s, 3H, H-27), 2.17–2.10 (m, 1H, H-7), 1.31–1.26 (m, 2H, H-8 or
H-9), 1.18–1.13 (m, 2H, H-8 or H-9). 13C NMR (126 MHz, Chloroform-d)
δ 172.56, 171.59, 159.26, 158.15, 156.14, 138.69, 135.68, 133.16,
131.40 (d, J = 13.8 Hz), 129.61, 129.50, 129.36, 129.29, 128.54,
128.10, 127.54, 124.55, 122.37, 117.83, 113.23–113.00 (m), 109.93,
75.21, 59.89, 17.19, 8.44, 7.72. HR/MS (ESI): m/z calcd
White solid, 80% yield; 1H NMR (500 MHz, Chloroform-d) δ 7.94 (s,
1H, H-32 or H-34), 7.87 (s, 1H, H-32 or H-34), 7.60–7.47 (m, 2H, two of
H-12, H-13, H-14, H-15), 7.44 (s, 1H, H-30), 7.39 (td, J = 7.7, 1.1 Hz,
2H, two of H-12, H-13, H-14, H-15), 7.17 (d, J = 8.5 Hz, 1H, H-20), 6.83
(d, J = 2.5 Hz, 1H, H-23), 6.69 (dd, J = 8.5, 2.5 Hz, 1H, H-19), 5.22 (s,
2H, H-27), 4.87 (s, 2H, H-1), 2.41 (s, 3H, H-43), 2.24 (s, 3H, H-28),
2.20–2.07 (m, 1H, H-7), 1.29–1.24 (m, 2H, H-8 or H-9), 1.19–1.11 (m,
2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3) δ 172.91, 159.34, 158.91,
156.46, 146.79, 138.29, 133.66, 133.32, 131.78, 131.31, 130.92,
130.09, 129.77, 127.12, 126.82, 122.56, 120.92, 116.11, 113.51,
109.76, 77.25, 76.99, 76.74, 75.38, 59.85, 21.19, 16.78, 8.20, 7.60. HR/
MS (ESI): m/z calcd C31H26ClF3N2O6 (M+H+) 615.1504, found
615.1516.
C
30H23Cl2F3N2O5 (M+H+) 619.1009, found 619.1016.
4.1.30. (E)-3-((((1-(4-((5-cyclopropyl-3-(2,6-dichlorophenyl)isoxazol-4-
yl)methoxy)-2-fluorophenyl)ethylidene)amino)oxy)methyl)benzoic acid
(13m)
4.1.34. (E)-3-((((1-(2-chloro-4-((5-cyclopropyl-3-(2-(trifluoromethoxy)
phenyl)isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)
benzoic acid (13q)
White solid, 88% yield; 1H NMR (500 MHz, Chloroform-d) δ 8.13 (s,
1H, H-33), 8.05 (d, J = 7.9 Hz, 1H, H-31), 7.64 (d, J = 7.6 Hz, 1H, H-29),
7.47 (t, J = 7.7 Hz, 1H, H-30), 7.40 (d, J = 1.1 Hz, 1H, H-12 or H-14),
7.38 (s, 1H, H-12 or H-14), 7.31 (td, J = 8.8, 8.1, 1.7 Hz, 2H, H-22 and H-
13), 6.56 (dd, J = 8.7, 2.5 Hz, 1H, H-18 or H-19), 6.50 (dd, J = 12.5, 2.4
Hz, 1H, H-18 or H-19), 5.25 (s, 2H, H-26), 4.78 (s, 2H, H-1), 2.24 (d, J =
2.6 Hz, 3H, H-27), 2.14 (tt, J = 8.3, 5.1 Hz, 1H, H-7), 1.28 (dt, J = 6.8,
4.6 Hz, 2H, H-8 or H-9), 1.18–1.10 (m, 2H, H-8 or H-9). 13C NMR (126
MHz, Chloroform-d) δ 172.53, 171.29, 162.14, 160.12, 160.03, 159.27,
153.79, 138.68, 135.71, 133.34, 131.31, 130.09 (d, J = 5.4 Hz), 129.71,
129.55, 129.36, 128.58, 128.09, 127.57, 118.09 (d, J = 12.4 Hz),
110.72, 110.01, 102.95, 102.75, 75.32, 59.78, 15.64 (d, J = 5.3 Hz),
8.42, 7.74. HR/MS (ESI): m/z calcd C29H23Cl2FN2O5 (M+H+) 569.1041,
found 569.1054.
White solid, 83% yield; 1H NMR (500 MHz, Chloroform-d) δ 8.15 (s,
1H, H-34), 8.07 (d, J = 7.7 Hz, 1H, H-32), 7.65 (d, J = 7.6 Hz, 1H, H-30),
7.54 (ddd, J = 16.3, 8.0, 1.8 Hz, 2H, two of H-12, H-13, H-14, H-15),
7.50–7.45 (m, 1H, H-31), 7.40 (td, J = 7.7, 1.1 Hz, 2H, two of H-12, H-
13, H-14, H-15), 7.17 (d, J = 8.5 Hz, 1H, H-20), 6.83 (d, J = 2.6 Hz, 1H,
H-23), 6.70 (dd, J = 8.5, 2.6 Hz, 1H, H-19), 5.27 (s, 2H, H-27), 4.87 (s,
2H, H-1), 2.26 (s, 3H, H-28), 2.14 (tt, J = 8.4, 5.1 Hz, 1H, H-7),
1.28–1.24 (m, 2H, H-8 or H-9), 1.18–1.12 (m, 2H, H-8 or H-9). 13C NMR
(151 MHz, CDCl3) δ 172.58, 171.11, 158.91, 158.51, 156.39, 146.33,
138.23, 132.92, 132.86, 131.34, 130.96, 130.47, 129.17, 129.14,
128.82, 128.18, 126.73, 122.01, 120.52, 115.66, 113.07, 109.35, 76.79,
76.58, 76.37, 74.76, 59.38, 16.43, 7.87, 7.20. HR/MS (ESI): m/z calcd
C
30H24ClF3N2O6 (M+H+) 601.1348, found 601.1355.
4.1.31. (E)-2-((((1-(2-chloro-4-((5-cyclopropyl-3-(2,6-dichlorophenyl)
isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)benzoic acid
(13n)
4.1.35. (E)-5-((((1-(4-((5-cyclopropyl-3-(2-(trifluoromethoxy)phenyl)
isoxazol-4-yl)methoxy)-3-fluorophenyl)ethylidene)amino)oxy)methyl)
nicotinic acid (13r)
White solid, 88% yield; 1H NMR (500 MHz, Chloroform-d) δ 7.93 (d,
J = 7.8 Hz, 1H, H-32), 7.54 (d, J = 5.8 Hz, 2H, H-29, H-30), 7.37 (d, J =
8.0 Hz, 3H, H-12, H-14, H-31), 7.30 (dd, J = 9.0, 7.2 Hz, 1H, H-13), 7.07
(d, J = 8.5 Hz, 1H, H-19), 6.78 (d, J = 2.5 Hz, 1H, H-22), 6.63 (dd, J =
8.6, 2.5 Hz, 1H, H-18), 5.51 (s, 2H, H-26), 4.75 (s, 2H, H-1), 2.25 (s, 3H,
H-27), 2.12 (tt, J = 8.4, 5.1 Hz, 1H, H-7), 1.31–1.26 (m, 2H, H-8 or H-9),
1.14 (dt, J = 8.4, 3.4 Hz, 2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3) δ
172.59, 159.26, 159.14, 157.03, 139.16, 135.68, 133.21, 132.36,
131.35, 131.00, 130.83, 129.12, 128.78, 128.11, 127.62, 127.51,
116.17, 113.53, 109.97, 77.25, 77.00, 76.74, 73.72, 59.75, 29.68,
16.92, 8.43, 7.72. HR/MS (ESI): m/z calcd C29H23Cl3N2O5 (M+H+)
585.0745, found 585.0748.
White solid, 91% yield; 1H NMR (500 MHz, Chloroform-d) δ 9.30 (d,
J = 2.1 Hz, 1H, H-32), 8.90 (d, J = 2.2 Hz, 1H, H-30 or H-34), 8.47 (t, J
= 2.1 Hz, 1H, H-30 or H-34), 7.55 (dd, J = 7.8, 1.8 Hz, 1H, H-12, H-13,
H-14 or H-15), 7.49 (td, J = 7.9, 1.8 Hz, 1H, H-12, H-13, H-14 or H-15),
7.40–7.32 (m, 3H, two of H-12, H-13, H-14, H-15; H-19, H-20 or H-22),
7.25–7.20 (m, 1H, H-19, H-20 or H-22), 6.79 (t, J = 8.4 Hz, 1H, H-19, H-
20 or H-22), 5.31 (s, 2H, H-27), 4.95 (s, 2H, H-1), 2.21 (s, 3H, H-28),
2.15 (tt, J = 8.4, 5.1 Hz, 1H, H-7), 1.21 (dt, J = 6.6, 3.5 Hz, 2H, H-8 or H-
9), 1.10 (dt, J = 8.5, 3.5 Hz, 2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3)
δ 173.13, 168.36, 159.33, 154.51, 152.50, 149.90, 146.77, 137.94,
134.19, 131.90, 131.28, 130.37, 127.07, 126.31, 122.47, 122.06,
120.79, 115.78, 114.13, 113.97, 109.84, 77.25, 76.99, 76.74, 72.85,
61.25, 12.61, 8.24, 7.61. HR/MS (ESI): m/z calcd C29H23F4N3O6
(M+H+) 586.1596, found 586.1594.
4.1.32. (E)-5-((((1-(2-chloro-4-((5-cyclopropyl-3-(2-(trifluoromethoxy)
phenyl)isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)
nicotinic acid (13o)
White solid, 88% yield; 1H NMR (500 MHz, Chloroform-d) δ 9.30 (s,
1H, H-32), 8.91 (s, 1H, H-30 or H-34), 8.46 (s, 1H, H-30 or H-34), 7.54
(ddd, J = 15.8, 7.8, 1.8 Hz, 2H, two of H-12, H-13, H-14, H-15), 7.40 (tt,
J = 7.7, 1.7 Hz, 2H, two of H-12, H-13, H-14, H-15), 7.17 (d, J = 8.5 Hz,
1H, H-20), 6.84 (d, J = 2.4 Hz, 1H, H-23), 6.71 (dd, J = 8.5, 2.5 Hz, 1H,
H-19), 5.33 (s, 2H, H-27), 4.88 (s, 2H, H-1), 2.27 (s, 3H, H-28),
2.21–2.09 (m, 1H, H-7), 1.27 (dt, J = 7.0, 4.5 Hz, 2H, H-8 or H-9),
1.21–1.11 (m, 2H, H-8 or H-9). 13C NMR (126 MHz, CDCl3) δ 172.95,
168.40, 159.33, 159.03, 157.40, 152.40, 149.88, 146.79, 137.72,
4.1.36. (E)-3-((((1-(4-((5-cyclopropyl-3-(2-(trifluoromethoxy)phenyl)
isoxazol-4-yl)methoxy)-3-fluorophenyl)ethylidene)amino)oxy)methyl)-5-
methylbenzoic acid (13s)
White solid, 81% yield; 1H NMR (500 MHz, Chloroform-d) δ 7.86 (s,
1H, H-32 or H-34), 7.79 (s, 1H, H-32 or H-34), 7.53 (dd, J = 7.9, 1.7 Hz,
1H, H-12, H-13, H-14 or H-15), 7.47 (td, J = 7.7, 7.2, 1.7 Hz, 1H, H-12,
H-13, H-14 or H-15), 7.33 (ddd, J = 10.4, 6.6, 2.6 Hz, 4H, two of H-12,
H-13, H-14, H-15; H-30; H-19, H-20 or H-22), 7.20 (d, J = 8.5 Hz, 1H, H-
19, H-20 or H-22), 6.76 (t, J = 8.5 Hz, 1H, H-19, H-20 or H-22), 5.13 (s,
10

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
2H, H-27), 4.92 (s, 2H, H-1), 2.31 (s, 3H, H-43), 2.24–1.94 (m, 4H, H-7
and H-28), 1.21 (dt, J = 6.6, 4.4 Hz, 2H, H-8 or H-9), 1.14–1.04 (m, 2H,
H-8 or H-9). 13C NMR (126 MHz, Chloroform-d) δ 173.11, 159.34,
153.78, 153.44, 151.82, 146.76, 146.66 (d, J = 11.1 Hz), 138.06 (d, J =
16.2 Hz), 133.36, 131.89, 131.24, 130.81 (d, J = 6.5 Hz), 127.06,
122.49, 121.94, 120.78, 115.78, 113.95 (d, J = 20.0 Hz), 109.86, 75.71,
61.24, 21.13, 12.49, 8.23, 7.59. HR/MS (ESI): m/z calcd C31H26F4N2O6
(M+H+) 599.1800, found 599.1800.
1H, H-33), 8.11 (dd, J = 8.0, 1.7 Hz, 1H, H-31), 7.80 (d, J = 8.1 Hz, 1H,
H-30), 7.54 (dd, J = 7.9, 1.8 Hz, 1H, H-12, H-13, H-14 or H-15),
7.52–7.46 (m, 1H, H-12, H-13, H-14 or H-15), 7.39–7.33 (m, 3H, two of
H-12, H-13, H-14, H-15; H-18, H-19 or H-21), 7.24 (s, 1H, H-18, H-19 or
H-21), 6.79 (t, J = 8.5 Hz, 1H, H-18, H-19 or H-21), 5.42 (s, 2H, H-26),
4.95 (s, 2H, H-1), 2.24 (s, 3H, H-27), 2.15 (tt, J = 8.4, 5.0 Hz, 1H, H-7),
1.24–1.19 (m, 2H, H-8 or H-9), 1.14–1.07 (m, 2H, H-8 or H-9). 13C NMR
(126 MHz, Chloroform-d) δ 173.16, 169.51, 159.33, 154.82, 153.79,
151.83, 146.92 (d, J = 11.2 Hz), 146.77, 142.44, 133.17, 133.02,
131.90, 131.29, 130.78, 130.27 (d, J = 6.5 Hz), 129.64, 127.08, 122.45,
122.13 (d, J = 3.2 Hz), 120.80, 116.71, 116.47, 115.80, 114.11 (d, J =
20.3 Hz), 109.85, 73.12, 61.24, 12.55, 8.25, 7.61. HR/MS (ESI): m/z
calcd C31H23F4N3O6 (M+H+) 610.1596, found 610.1593.
4.1.37. (E)-3-((((1-(4-((5-cyclopropyl-3-(2-(trifluoromethoxy)phenyl)
isoxazol-4-yl)methoxy)-3-methoxyphenyl)ethylidene)amino)oxy)methyl)-
5-methylbenzoic acid (13t)
White solid, 83% yield; 1H NMR (500 MHz, Chloroform-d) δ 7.98 (d,
J = 1.7 Hz, 1H, H-32 or H-34), 7.87 (t, J = 1.3 Hz, 1H, H-32 or H-34),
7.56 (dd, J = 7.6, 1.8 Hz, 1H, H-12, H-13, H-14 or H-15), 7.47 (tt, J =
3.1, 1.5 Hz, 2H, H-12, H-13, H-14 or H-15; H-30), 7.35 (ddd, J = 8.5, 3.0,
1.3 Hz, 2H, two of H-12, H-13, H-14, H-15), 7.22 (d, J = 2.0 Hz, 1H, H-
22), 7.03 (dd, J = 8.3, 2.1 Hz, 1H, H-20), 6.72 (d, J = 8.4 Hz, 1H, H-19),
5.23 (s, 2H, H-27), 4.93 (s, 2H, H-1), 3.77 (s, 3H, H-43), 2.51–2.41 (m,
3H, H-44), 2.23 (s, 3H, H-28), 2.22–2.15 (m, 1H, H-7), 1.24–1.20 (m,
2H, H-8 or H-9), 1.10–1.05 (m, 2H, H-8 or H-9). 13C NMR (126 MHz,
Chloroform-d) δ 172.86, 171.60, 159.38, 154.77, 150.00, 148.46,
146.83, 138.55 (d, J = 17.9 Hz), 134.39, 132.03, 131.05, 130.66,
130.15, 129.26, 127.27, 126.92, 122.69, 120.68, 118.99, 114.74,
110.34, 109.37, 75.46, 60.98, 55.73, 21.24, 12.80, 8.21, 7.66. HR/MS
(ESI): m/z calcd C32H29F3N2O7 (M+H+) 611.2000, found 611.2006.
4.1.41. (E)-4-cyano-3-((((1-(4-((5-cyclopropyl-3-(2-(trifluoromethoxy)
phenyl)isoxazol-4-yl)methoxy)-3-methoxyphenyl)ethylidene)amino)oxy)
methyl)benzoic acid (13x)
White solid, 91% yield; 1H NMR (500 MHz, Chloroform-d) δ 8.31 (d,
J = 1.6 Hz, 1H, H-33), 8.11 (dd, J = 8.1, 1.7 Hz, 1H, H-31), 7.80 (d, J =
8.0 Hz, 1H, H-30), 7.55 (dd, J = 7.6, 1.8 Hz, 1H, H-12, H-13, H-14 or H-
15), 7.51–7.45 (m, 1H, H-12, H-13, H-14 or H-15), 7.37–7.30 (m, 2H,
two of H-12, H-13, H-14, H-15), 7.24 (d, J = 2.1 Hz, 1H, H-21), 7.01 (dd,
J = 8.3, 2.1 Hz, 1H, H-19), 6.71 (d, J = 8.4 Hz, 1H, H-18), 5.43 (s, 2H, H-
26), 4.93 (s, 2H, H-1), 3.76 (s, 3H, H-41), 2.25 (s, 3H, H-27), 2.19 (tt, J
= 8.4, 5.1 Hz, 1H, H-7), 1.24–1.18 (m, 2H, H-8 or H-9), 1.10–1.04 (m,
2H, H-8 or H-9). 13C NMR (126 MHz, Chloroform-d) δ 172.91, 169.56,
159.36, 155.77, 150.02, 148.64, 146.81, 142.56, 133.08, 133.01,
132.01, 131.07 (d, J = 5.0 Hz), 130.09, 129.61, 126.93, 122.62, 120.68,
119.08, 116.91, 116.58, 114.63, 110.31, 109.31, 72.95, 60.94, 55.79,
12.64, 8.22, 7.66. HR/MS (ESI): m/z calcd C32H26F3N3O7 (M+H+)
622.1796, found 622.1793.
4.1.38. (E)-3-((((1-(4-((5-cyclopropyl-3-(2-(trifluoromethoxy)phenyl)
isoxazol-4-yl)methoxy)-3-methylphenyl)ethylidene)amino)oxy)methyl)-5-
methylbenzoic acid (13u)
White solid, 85% yield; 1H NMR (500 MHz, Chloroform-d) δ 7.95 (d,
J = 1.7 Hz, 1H, H-32 or H-34), 7.86 (d, J = 2.0 Hz, 1H, H-32 or H-34),
7.55 (dd, J = 7.7, 1.8 Hz, 1H, H-12, H-13, H-14 or H-15), 7.52–7.45 (m,
2H, H-12, H-13, H-14 or H-15; H-30), 7.41 (dd, J = 2.3, 0.9 Hz, 1H, H-
22), 7.35 (tdd, J = 7.9, 4.0, 1.3 Hz, 3H, two of H-12, H-13, H-14, H-15;
H-20), 6.73 (d, J = 8.5 Hz, 1H, H-19), 5.22 (s, 2H, H-27), 4.90 (s, 2H, H-
1), 2.43 (s, 3H, H-43), 2.23 (s, 3H, H-28), 2.14 (tt, J = 8.4, 5.1 Hz, 1H, H-
7), 1.96 (s, 3H, H-42), 1.26–1.23 (m, 2H, H-8 or H-9), 1.15–1.07 (m, 2H,
H-8 or H-9). 13C NMR (126 MHz, Chloroform-d) δ 172.39, 171.59,
159.39, 157.20, 155.08, 146.87, 138.57 (d, J = 35.8 Hz), 134.21,
131.75, 131.17, 130.07, 129.26, 129.09, 128.49, 127.03 (d, J = 3.4 Hz),
124.78, 122.88, 120.78, 110.63, 110.46, 75.34, 59.65, 21.24, 15.90,
12.91, 8.08, 7.63. HR/MS (ESI): m/z calcd C32H29F3N2O6 (M+H+)
595.2050, found 595.2051.
4.1.42. (E)-4-cyano-3-((((1-(4-((5-cyclopropyl-3-(2-(trifluoromethoxy)
phenyl)isoxazol-4-yl)methoxy)-3-methylphenyl)ethylidene)amino)oxy)
methyl)benzoic acid (13y)
White solid, 88% yield; 1H NMR (500 MHz, Chloroform-d) δ 8.32 (d,
J = 1.7 Hz, 1H, H-33), 8.13 (dd, J = 8.0, 1.7 Hz, 1H, H-31), 7.82 (d, J =
8.0 Hz, 1H, H-30), 7.57 (dd, J = 7.6, 1.8 Hz, 1H, H-12, H-13, H-14 or H-
15), 7.52 (td, J = 8.0, 1.8 Hz, 1H, H-12, H-13, H-14 or H-15), 7.43 (d, J
= 2.3 Hz, 1H, H-21), 7.38 (tt, J = 8.0, 3.7 Hz, 3H, two of H-12, H-13, H-
14, H-15; H-19), 6.75 (d, J = 8.5 Hz, 1H, H-18), 5.46 (s, 2H, H-26), 4.93
(s, 2H, H-1), 2.29 (s, 3H, H-27), 2.17 (tt, J = 8.4, 5.1 Hz, 1H, H-7), 1.98
(s, 3H, H-40), 1.29–1.26 (m, 2H, H-8 or H-9), 1.14 (dt, J = 8.4, 3.5 Hz,
2H, H-8 or H-9). 13C NMR (126 MHz, Chloroform-d) δ 172.43, 169.58,
159.37, 157.36, 156.14, 146.86, 142.78, 133.09, 132.97, 131.73,
131.19, 130.69, 129.48, 128.56 (d, J = 4.5 Hz), 127.04 (d, J = 4.8 Hz),
124.87, 122.83, 120.78, 116.53 (d, J = 9.0 Hz), 110.63, 110.42, 72.89,
59.64, 15.88, 12.82, 8.09, 7.62. HR/MS (ESI): m/z calcd C32H26F3N3O6
(M+H+)606.1846, found 606.1856.
4.1.39. (E)-5-((((1-(4-((5-cyclopropyl-3-(2-(trifluoromethoxy)phenyl)
isoxazol-4-yl)methoxy)-3-methylphenyl)ethylidene)amino)oxy)methyl)
nicotinic acid (13v)
White solid, 89% yield; 1H NMR (500 MHz, Chloroform-d) δ 9.27 (s,
1H, H-32), 8.92–8.82 (m, 1H, H-30 or H-34), 8.45 (s, 1H, H-30 or H-34),
7.54 (dd, J = 7.6, 1.8 Hz, 1H, H-12, H-13, H-14 or H-15), 7.48 (td, J =
7.9, 1.8 Hz, 1H, H-12, H-13, H-14 or H-15), 7.35 (ddd, J = 18.9, 9.2, 2.1
Hz, 4H, two of H-12, H-13, H-14, H-15; H-20 and H-22), 6.72 (d, J = 8.6
Hz, 1H, H-19), 5.29 (s, 2H, H-27), 4.90 (s, 2H, H-1), 2.22 (s, 3H, H-28),
2.14 (tt, J = 8.4, 5.1 Hz, 1H, H-7), 1.94 (s, 3H, H-42), 1.23 (td, J = 4.7,
4.1.43. (E)-3-((((1-(2-chloro-4-((5-cyclopropyl-3-(2-(trifluoromethoxy)
phenyl)isoxazol-4-yl)methoxy)phenyl)ethylidene)amino)oxy)methyl)-4-
cyanobenzoic acid (13z)
1
White solid, 84% yield; H NMR (500 MHz, Chloroform-d) δ 8.31
(dd, J = 1.7, 0.7 Hz, 1H, H-34), 8.14 (dd, J = 8.0, 1.7 Hz, 1H, H-32), 7.82
(d, J = 8.0 Hz, 1H, H-31), 7.57–7.51 (m, 2H, two of H-12, H-13, H-14, H-
15), 7.40 (tt, J = 7.7, 1.4 Hz, 2H, two of H-12, H-13, H-14, H-15), 7.18
(d, J = 8.5 Hz, 1H, H-20), 6.83 (d, J = 2.5 Hz, 1H, H-23), 6.71 (dd, J =
8.6, 2.5 Hz, 1H, H-19), 5.47 (s, 2H, H-27), 4.87 (s, 2H, H-1), 2.32 (s, 3H,
H-28), 2.17–2.10 (m, 1H, H-7), 1.26 (dt, J = 5.1, 3.1 Hz, 2H, H-8 or H-9),
1.16 (dt, J = 8.4, 3.5 Hz, 2H, H-8 or H-9). 13C NMR (126 MHz, DMSO‑d6)
δ 173.22, 166.44, 159.40, 159.24, 156.98, 146.38, 142.54, 135.21,
134.08, 132.53, 132.42, 132.10, 131.42, 130.30, 129.54, 129.13,
128.28, 122.59, 121.87, 117.22, 116.28, 115.17, 114.53, 110.22, 73.07,
59.83, 16.99, 8.69, 7.57. HR/MS (ESI): m/z calcd C31H23ClF3N3O6
(M+H+) 626.1300, found 626.1294.
1.7 Hz, 2H, H-8 or H-9), 1.11 (dt, J = 8.4, 3.4 Hz, 2H, H-8 or H-9). 13
C
NMR (151 MHz, Chloroform-d) δ 171.99, 168.68, 162.59, 158.94,
156.89, 155.41, 149.84, 146.39, 138.17, 131.27, 130.78, 128.12,
128.02, 126.61, 124.41, 122.38, 120.70, 120.35, 118.98, 110.02 (d, J =
22.2 Hz), 75.13, 59.17, 15.43, 12.49, 7.71, 7.19. HR/MS (ESI): m/z
calcd C30H26F3N3O6 (M+H+) 582.1846, found 582.1851.
4.1.40. (E)-4-cyano-3-((((1-(4-((5-cyclopropyl-3-(2-(trifluoromethoxy)
phenyl)isoxazol-4-yl)methoxy)-3-fluorophenyl)ethylidene)amino)oxy)
methyl)benzoic acid (13w)
White solid, 91% yield; 1H NMR (500 MHz, Chloroform-d) δ 8.27 (s,
11

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
4.2. Biological studies
Table 5
Primers used for qRT-PCR analysis.
Gene
Forward (5′–3′)
Reverse (5′–3′)
4.2.1. FXR activation assay
The Huh7 cells were kindly provided by stem cell bank, Chinese
Academy of Sciences. Cells were grown in DMEM supplemented with
10% FBS, 1% glutamax, 1% non-essential amino acids at 37 ◦C in a
humidified atmosphere of 5% CO2. The cells were seeded in 100-mm
dish one day before the transfection. The expression plasmid encoding
human FXR (Genecopoeia, Guangdong, China) and FXR response
element (FXRE)-Luc reporter plasmid (Genomeditech, Shanghai, China)
were transiently co-transfected according to the manufacturer’s in-
struction of FuGENE 6. Six hours after transfection, medium was
replaced with Phenol-Red-free DMEM supplemented with 10% charcoal
stripped FBS (Biological Industries, Kibbutz Beit-Haemek, Israel), 1%
glutamax, 1% non-essential amino acids and incubated overnight. Cells
were then planted into 96-well plates with a density of 2 × 104 cells per
well. Six hours after plating, cells were treated with vehicle (0.5%
DMSO) or different concentrations of compounds for another 16 h.
Subsequently, luciferase activity was determined by using Steady-Glo
luciferase assay system (Promega, WI, USA). The efficacy of OCA (10
SHP
TGAGCTGGGTCCCAAGGA
TCTGACTCAGTGATTCTTCGCA
CAAGAACCTGTACATGAGGGAC
CCTCTGGACAAGGGTTTTGTG
GAGGACCAAAACGAACGAAATT
AGGTCGGTGTGAACGGATTTG
CCTGGCACATCTGGGTTGA
CCCATAAACATCAGCCAGTTGT
CACTTCTTCAGAGGCTGCTTTC
GCACCGTGAAGACATCCCC
ACGTCCTTGATGGCAATCG
BSEP
CYP7A1
CYP8B1
FGF15
GAPDH
TGTAGACCATGTAGTTGAGGTCA
was normalized to the expression of GAPDH mRNA using the ΔΔCt
method. The primer sequences used in this study were listed in Table 5.
4.2.7. Pharmacokinetics
Compound 13j and 13z (15 mg/kg) were orally administrated to
overnight-fasted ICR mice (male, n = 3 per time point) separately. 2 h
after the administration, the mice were refed. Blood samples were
collected before oral administration and 1.5 h, 4 h and 8 h after oral
administration, and then centrifuged at 4500 rpm for 10 min at 4 ◦C to
obtain serums. Livers were collected before oral administration and 1.5
μ
M) is set as 100%. Experiments were performed in triplicate. EC50 of
h, 4 h and 8 h after oral administration. Liver samples were then snap-
◦
final compounds were determined by nonlinear regression analysis
(Graphpad Prism, CA, USA).
frozen and stored at ꢀ 80 C. 100
μ
L of methanol/acetonitrile (1:1, v/
v) was added to 10
vortex for 1 min, and centrifuged (11,000 rpm) for 5 min to obtain the
supernatant. After that, 20 L of supernatant was redissolved in 20 L of
μL of serum. Then the mixture was precipitated,
4.2.2. hTGR5 agonist assay
μ
μ
Agonistic effect of compounds on hTGR5 were evaluated by TGR5-
CRE-driven luciferase assay. hTGR5/CRE/HEK293 stable cell line was
obtained by transfection of HEK293 cells with hTGR5-pcDNA3.1 and
CRE-driven luciferase reporter plasmid (pGL4.29, Promega, Madison,
WI, USA). Cells were plated into 96-well plates and incubated at 37 ◦C,
5% CO2 overnight. Then, cells were treated with fresh medium which
contained different concentrations of compounds, positive control (20
ACN/H2O (1:1, v/v) and the mixture was analyzed in LC-MS/MS. Liver
sample was added with ten times the weight of methanol/acetonitrile
(1:1, v/v) and the mixture was homogenized at 50 Hz for 120 s in ho-
mogenizer to obtain the homogenate. The homogenate was cen-
trifugated (11,000 rpm) for 5 min and the supernatant was collected.
Then 20 μL of supernatant was redissolved in 20 μL of ACN/H2O (1:1, v/
v) and the mixture was analyzed in LC-MS/MS.
μ
M INT-777) or vehicle control (0.5% DMSO) for 5.5 h. Luciferase ac-
tivity of each well was then determined by Steady-Glo luciferase assay
system. Value of the vehicle control was set as 0%, and value of positive
control was set as 100%. EC50 was determined by nonlinear regression
analysis (Graphpad Prism).
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
4.2.3. Animals
The animals were housed under a 12-h light and 12-h dark cycle and
were allowed free access to regular chow and water. Animal experi-
ments were approved by the Institutional Animal Care and Use Com-
mittee (IACUC), Shanghai Institute of Materia Medica, Chinese Academy
of Sciences.
Acknowledgements
This work was financially supported by a grant from Science and
Technology Commission of Shanghai Municipality (STCSM)
(No.19431900900), a grant from the National Natural Science Foun-
dation of China (No.82073683) and a grant from State Key laboratory of
Drug Research, Shanghai Institute of Materia Medica, Chinese Academy
of Sciences (No.SIMM2103ZZ-04).
4.2.4. FXR target gene expression in primary mouse hepatocytes
Primary mouse hepatocytes were isolated from overnight-fasted
male C57BL/6J mice (8–12 weeks old) using a previously described
protocol.35 Isolated hepatocytes were then plated in 24 well plates and
incubated 4 h to allow their adhesion. Cells were then treated with
vehicle (0.5% DMSO) or different doses of compounds for 24 h.
Author contributions
All authors participated in this study and they approved to the final
version. There is no conflict of interest.
4.2.5. FXR target gene expression in mouse liver and intestine
Male C57BL/6J mice (7–8 weeks) mice were fasted for 3 h before
oral dosing with compound 13j (10 mg/kg), 13z (10 mg/kg), OCA (30
mg/kg) or vehicle (0.25% CMC-Na, wt/vol). Animals were sacrificed six
hours after dosing, and the samples of liver and ileum were collected,
snap-frozen and stored at ꢀ 80 ◦C for gene expression analysis.
Appendix A. Supplementary material
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.bmc.2021.116280.
References
4.2.6. RNA isolation and quantitative real-time polymerase chain reaction
(qRT-PCR) analysis
1 Chiang JYL. Bile acids: regulation of synthesis. J Lipid Res. 2009;50:1955–1966.
2 Makishima M, Okamoto AY, Repa JJ, et al. Identification of a nuclear receptor for
bile acids. Science. 1999;284:1362–1365.
RNA was extracted from the primary hepatocytes or tissues using
TRIzol reagent (Life Technologies, CA, USA). The cDNA was generated
by a Primer Script RT reagent kit with gDNA eraser (TaKaRa Biotech-
nology, Dalian, China) and analyzed via quantitative real-time PCR
using SYBR Premix Ex Taq Kit. The relative amount of individual mRNA
3 Parks DJ, Blanchard SG, Bledsoe RK, et al. Bile acids: natural ligands for an orphan
nuclear receptor. Science. 1999;284:1365–1368.
4 Goodwin B, Jones SA, Price RR, et al. A regulatory cascade of the nuclear receptors
FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell. 2000;6:517–526.
12

X. Tang et al.
Bioorganic & Medicinal Chemistry 43 (2021) 116280
5 Ji S, Liu Q, Zhang S, et al. FGF15 Activates Hippo Signaling to Suppress Bile Acid
Metabolism and Liver Tumorigenesis. Dev Cell. 2019;48:460–474.e9.
6 Jonker JW, Liddle C, Downes M. FXR and PXR: Potential therapeutic targets in
cholestasis. J Steroid Biochem Mol Biol. 2012;130:147–158.
22 Genin MJ, Bueno AB, Agejas Francisco J, et al. Discovery of 6-(4-{[5-Cyclopropyl-3-
(2,6-dichlorophenyl)isoxazol-4-yl]methoxy}piperidin-1-yl)-1-methyl-1H-indole-3-
carboxylic acid: a novel FXR agonist for the treatment of dyslipidemia. J Med Chem.
2015;58:9768–9772.
7 Zhou J, Cui S, He Q, et al. SUMOylation inhibitors synergize with FXR agonists in
combating liver fibrosis. Nat Commun. 2020;11. https://doi.org/10.1038/s41467-
019-14138-6.
23 Tully DC, Rucker PV, Chianelli D, et al. Discovery of tropifexor. J Med Chem. 2017;
60:9960–9973.
24 Claassen V, Davies JE, Hertting G, Placheta P. Fluvoxamine, a specific 5-hydroxy-
tryptamine uptake inhibitor. Br J Pharmacol. 1977;60:505–516.
25 Pan S, Gray NS, Gao W, et al. Discovery of BAF312 (Siponimod), a potent and
selective S1P receptor modulator. ACS Med Chem Lett. 2013;4:333–337.
26 Macchia B, Balsamo A, Breschi MC, et al. The [(methyloxy)imino]methyl moiety as a
bioisoster of aryl. A novel class of completely aliphatic beta-adrenergic receptor
antagonists. J Med Chem. 1994;37:1518–1525.
8 Younossi ZM, Ratziu V, Loomba R, et al. Obeticholic acid for the treatment of non-
alcoholic steatohepatitis: interim analysis from a multicentre, randomised, placebo-
controlled phase 3 trial. Lancet. 2019;394:2184–2196.
9 Pathak P, Liu HL, Boehme S, et al. Farnesoid X receptor induces Takeda G-protein
receptor 5 cross-talk to regulate bile acid synthesis and hepatic metabolism. J Biol
Chem. 2017;292:11055–11069.
10 Bergasa NV. The pruritus of cholestasis: from bile acids to opiate agonists: Relevant
after all these years. Med Hypotheses. 2018;110:86–89.
27 Balsamo A, Lapucci A, Macchia M, et al. 2-(Methyleneaminoxy)methylmorpholine
derivatives. Synthesis and antidepressant activity. Farmaco. 1994;49:77–82.
28 Macchia B, Balsamo A, Lapucci A, et al. Molecular design, synthesis, and
antiinflammatory activity of a series of beta-aminoxypropionic acids. J Med Chem.
1990;33:1423–1430.
11 Lieu T, Jayaweera G, Zhao PS, et al. The bile acid receptor TGR5 activates the TRPA1
channel to induce itch in mice. Gastroenterology. 2014;147:1417–1428.
12 Alemi F, Kwon E, Poole DP, et al. The TGR5 receptor mediates bile acid-induced itch
and analgesia. J Clin Invest. 2013;123:1513–1530.
29 Akwabi-Ameyaw A, Caravella JA, Chen L, et al. Conformationally constrained
farnesoid X receptor (FXR) agonists: alternative replacements of the stilbene. Bioorg
Med Chem Lett. 2011;21:6154–6160.
13 Maloney PR, Parks DJ, Haffner CD, et al. Identification of a chemical tool for the
orphan nuclear receptor FXR. J Med Chem. 2000;43:2971–2974.
14 Bass JY, Caldwell RD, Caravella JA, et al. Substituted isoxazole analogs of farnesoid
X receptor (FXR) agonist GW4064. Bioorg Med Chem Lett. 2009;19:2969–2973.
15 Sugihara K, Kitamura S, Sanoh S, et al. Metabolic activation of the proestrogens
trans-stilbene and trans-stilbene oxide by rat liver microsomes. Toxicol Appl
Pharmacol. 2000;167:46–54.
30 Xiao H, Li P, Li X, et al. Synthesis and biological evaluation of a series of bile acid
derivatives as FXR agonists for treatment of NASH. ACS Med Chem Lett. 2017;8:
1246–1251.
31 Genin MJ, Bueno AB, Francisco JA, et al. Discovery of 6-(4-{ 5-Cyclopropyl-3-(2,6-
dichlorophenyl)isoxazol-4-yl methoxy}piperid in-1-yl)-1-methyl-1H-indole-3-
carboxylic acid: a novel FXR agonist for the treatment of dyslipidemia. J Med Chem.
2015;58:9768–9772.
16 Kuo CH, Hook JB, Bernstein J. Induction of drug-metabolizing-enzymes and toxicity
of trans-stilbene oxide in rat-liver and kidney. Toxicology. 1981;22:149–160.
17 Akwabi-Ameyaw A, Bass JY, Caldwell RD, et al. Conformationally constrained
farnesoid X receptor (FXR) agonists: naphthoic acid-based analogs of GW 4064.
Bioorg Med Chem Lett. 2008;18:4339–4343.
32 Kang J-H, Lee H-S, Lee Y-S, et al. Preparation of isoxazole derivs. as activators of
Farnesoid X receptor for treatment and prevention of diseases (Il Dong
Pharmaceutical Co., Ltd., S. Korea). Application: WO WO; 2018. 170pp.
33 Liu G, Yu H, Yang D, et al. Azabicycle derivatives useful in treatment of FXR-
mediated diseases and preparation, (Sichuan Kelun-Biotech Biopharmaceutical Co.,
Ltd., Peop. Rep. China). Application: WO c WO; 2018. 100pp.
18 Bass JY, Caravella JA, Chen L, et al. Conformationally constrained farnesoid X
receptor (FXR) agonists: heteroaryl replacements of the naphthalene. Bioorg Med
Chem Lett. 2011;21:1206–1213.
19 Kinzel O, Steeneck C, Kremoser C. Novel FXR (NR1H4) binding and activity modulating
compounds. Germany: Phenex Pharmaceuticals AG; 2013:55.
34 Y. Wu, FXR receptor agonist and its preparation, (Xuanzhu Pharma Co., Ltd., Peop.
Rep. China). Application: CN CN, 2017, pp. 35pp.
20 Loomba R, Noureddin M, Kowdley KV, et al. Combination therapies including
cilofexor and firsocostat for bridging fibrosis and cirrhosis attributable to NASH.
Hepatology. 2021;73:625–643.
35 Xie W, Ye Y, Feng Y, et al. Linderane suppresses hepatic gluconeogenesis by
inhibiting the cAMP/PKA/CREB pathway through indirect activation of PDE 3 via
ERK/STAT3. Front Pharmacol. 2018;9. https://doi.org/10.3389/fphar.2018.00476.
21 Patel K, Harrison SA, Elkhashab M, et al. Cilofexor, a nonsteroidal FXR agonist, in
patients with noncirrhotic NASH: a phase 2 randomized controlled trial. Hepatology.
2020;72:58–71.
13