Diazirine-containing RNA photo-cross-linking probes for capturing microRNA targets

Article abstract of DOI:10.1021/jo402738t

Here, we report the applicability of diazirine-containing RNA photo-cross-linking probes for the identification of microRNA (miRNA) targets. The RNA cross-linking probes were synthesized by substituting the RNA nucleobases with nucleoside analogues such as 1-O-[3-(3-trifluoromethyl-3H- diazirin-3-yl)]benzyl-β-d-ribofuranose or 1-O-[4-(3-trifluoromethyl-3H- diazirin-3-yl)]benzyl-β-d-ribofuranose that carry aryl trifluoromethyl diazirine moieties. The probes were successfully cross-linked with synthetic RNAs containing the four natural nucleosides on the opposite site of the nucleoside analogues. Furthermore, it was found that miRNAs containing these analogues were effective in regulating the expression of their target genes. Thus, RNAs containing the nucleoside analogues are promising candidates as photo-cross-linking probes to identify the target mRNAs of miRNAs.

Full text of DOI:10.1021/jo402738t

Article
pubs.acs.org/joc
Diazirine-Containing RNA Photo-Cross-Linking Probes for Capturing
microRNA Targets
Kosuke Nakamoto† and Yoshihito Ueno*,†,‡
‡
†Course of Applied Life Science, Faculty of Applied Biological Sciences and United Graduate School of Agricultural Science, Gifu
University, 1-1 Yanagido, Gifu 501-1193, Japan
S
* Supporting Information
ABSTRACT: Here, we report the applicability of diazirine-
containing RNA photo-cross-linking probes for the identi-
fication of microRNA (miRNA) targets. The RNA cross-
linking probes were synthesized by substituting the RNA
nucleobases with nucleoside analogues such as 1-O-[3-(3-
trifluoromethyl-3H-diazirin-3-yl)]benzyl-β-D-ribofuranose or
1-O-[4-(3-trifluoromethyl-3H-diazirin-3-yl)]benzyl-β-D-ribo-
furanose that carry aryl trifluoromethyl diazirine moieties. The
probes were successfully cross-linked with synthetic RNAs
containing the four natural nucleosides on the opposite site of
the nucleoside analogues. Furthermore, it was found that miRNAs containing these analogues were effective in regulating the
expression of their target genes. Thus, RNAs containing the nucleoside analogues are promising candidates as photo-cross-linking
probes to identify the target mRNAs of miRNAs.
processes.9−11 Thus far, many miRNA targets have been
INTRODUCTION
■
computationally predicted.10−15 However, only a limited
Micro ribonucleic acids (miRNAs) are small noncoding RNAs
that modulate the function of specific mRNA targets by
number of these have been experimentally validated. Thus,
the development of methods to accurately and conveniently
promoting their degradation and/or inhibiting their transla-
identify the target mRNAs for all miRNAs is currently one of
tional.1 miRNAs are initially produced as long primary miRNAs
the most important subjects in this field.
(pri-miRNAs) that consist of several hundred to several
thousand bases. pri-miRNAs are then processed in the nucleus
into precursor miRNAs (pre-miRNAs) that have a stem-loop
structure comprising 60−70 bases. pre-miRNAs are then
transported from the nucleus to the cytoplasm where the
Recently, Rana and co-workers reported a chemical method
called miR-TRAP (miRNA target RNA affinity purification) to
identify miRNA targets.16 They incorporated a psoralen (pso)
residue into the miRNA, which, upon ultraviolet (UV)-A
irradiation, couples with uridine on the target mRNA, and they
loop moiety of the pre-miRNA is cleaved and eliminated by the
conjugated a biotin residue at the 3′ end of the miRNA. Thus,
dicer enzyme to create an miRNA duplex composed of 20−23
base pairs. One of the strands from the miRNA duplex (the
guide strand) is incorporated into the RNA-induced silencing
complex (RISC), leading to the formation of a mature,
the pso-modified miRNA not only can cross-link to its target
RNAs but can also be purified by biotin−streptavidin affinity
column chromatography after UV-A irradiation. Thus, using
this modified miRNA method, they successfully identified the
functional mRNA targets for miRNA-135b and miRNA-29a.
However, among the four natural nucleosides, the psoralen
residue is able to react only with uridine, which limits the ability
to capture all of its mRNA targets. Therefore, the development
of photo-cross-linking miRNA probes that react efficiently with
functional miRNA that regulates the functioning of multiple
mRNA targets.2−4 Currently, in the human genome, more than
1500 mature miRNA transcripts have been identified. Some of
these are known to play important roles in crucial biological
processes, including development, differentiation, apoptosis,
and proliferation.5−7
all four natural nucleosides is necessary for the comprehensive
analysis of their mRNA targets.
The UV-A irradiation of aromatic diazirines leads to the
miRNAs usually bind to their targets with incomplete
complementarity, which allows the formation of short stretches
of mismatched base pairs, resulting in bulges and interior
generation of carbenes, which possess the ability to react with
looping. For this reason, an individual miRNA is able to bind to
various chemical groups, including those containing the
more than one target mRNA and consequently is able to inhibit
the expression of multiple target genes. It has been considered
generally inactive C−H bond.17,18 We recently reported the
synthesis of small interfering RNAs (siRNAs) carrying an aryl
that miRNAs potentially control the expression of about one-
third of all human mRNAs.8 Defining the functional mRNA
targets for each individual miRNA is crucial in understanding
the RNA-based mechanisms that regulate several biological
Received: December 10, 2013
Published: February 26, 2014
© 2014 American Chemical Society
2463
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472

The Journal of Organic Chemistry
Article
trifluoromethyldiazirine moiety (1) in the 3′-overhang region
trifluoroacetate (Scheme 1). The resulting trifluoroacetophe-
none (6) was converted to a stereoisomeric (E/Z) mixture of
oximes by treatment with HONH2·HCl. The crude mixture of
oximes was tosylated to generate a mixture of tosyl-oximes (7).
Upon addition of ammonia, this mixture was converted to
diaziridine (8), which was oxidized to the corresponding
diazirine by I2 treatment. The deprotection of the silyl ether
using tetra-n-butylammonium fluoride (TBAF) afforded the
benzylic alcohol (10). In a similar manner, 3-[(4-
hydroxymethyl)phenyl]-3-trifluoromethyldiazirine (17) was
synthesized from 4-iodobenzyl alcohol in 79% yield (Scheme
2).
(Figure 1).19 By using this photo-cross-linking siRNA probe,
Glycosydation of benzylic alcohol 10 with 1-O-acetyl-2,3,5-
tri-O-benzoyl-β-D-ribofuranose (18), which is commercially
available, in the presence of TMSOTf at −30 °C in CH2Cl2
afforded an 89% yield of β-anomer 19 (Scheme 3).
Subsequently, it was debenzoylated in the presence of a
catalytic amount of NaOCH3 in CH3OH, and the primary
hydroxy group of 20 was protected by a 4,4′-dimethoxytrityl
(DMTr) group to produce 5-O-DMTr derivative 21.
Compound 21 was treated with TBDMSCl to afford 3-O-
TBDMS and 2-O-TBDMS derivatives 22 and 23 in 30 and 32%
yields, respectively. 2-O-TBDMS derivative 23 was phosphity-
lated by a standard procedure to give the corresponding
phosphoramidite 24. In a similar manner, phosphoramidite 30
with a 4-diazirinylbenzyl group was synthesized from 3-[(4-
hydroxymethyl)phenyl]-3-trifluoromethyldiazirine (17) with a
final yield of 23% (Scheme 4).
All of the RNAs were synthesized using a DNA/RNA
synthesizer (Tables 1−3). Sequence of RNA 1 corresponds to
that of let-7 miRNA. Fully protected RNAs (0.2 μmol each)
linked to solid supports were treated with concentrated
NH4OH/EtOH (3:1 v/v) at 55 °C for 4 h and then with
Et3N·3HF in DMSO at 65 °C for 90 min. The RNAs released
after the treatment were purified using denaturing 20%
polyacrylamide gel electrophoresis (PAGE) to afford depro-
tected RNAs 1−15 carrying the aryl diazirine in 5−12 OD260
absorbance units. These RNAs were analyzed by matrix-assisted
laser desorption/ionization time-of-flight mass spectrometry
(MALDI-TOF/MS), and the observed molecular weights were
in agreement with their structures.
Figure 1. Structures of the diazirine derivatives.
we succeeded in capturing the argonaute (Ago) protein, a key
component of RISC, which catalyzes the cleavage of target
mRNAs. So far, a number of 2′-deoxyribonucleoside analogues
with diazirinyl residues have been synthesized.20−25 However,
to the best of our knowledge, the synthesis of an
oligoribonucleotide containing a ribonucleoside analogue with
a diazirinyl residue has not been reported. From these
experimental results and the literature, we designed photo-
cross-linking miRNA probes consisting of nucleoside analogues,
1-O-[3-(3-trifluoromethyl-3H-diazirin-3-yl)]benzyl-β-D-ribofur-
anose (2) or 1-O-[4-(3-trifluoromethyl-3H-diazirin-3-yl)]-
benzyl-β-D-ribofuranose (3), in which the natural bases were
substituted with diazirine residues via acetal linkages (Figure 1).
We envisioned that the diazirine moieties on the benzyl
residues would cross-link more efficiently with opposite bases
in RNA duplexes than those on natural bases because those on
benzyl residues are in closer proximity to the opposite bases in
RNA duplexes than those on the natural bases.
In this article, we report the synthesis of photo-cross-linking
miRNA probes containing diazirine-modified nucleoside
analogues, 2 or 3, and their abilities to capture RNA targets.
In addition, we examined the gene-silencing activities of these
diazirine-modified miRNA duplexes using a dual-luciferase
reporter assay.
RESULTS AND DISCUSSION
■
Thermal Stabilities of Duplexes. The thermal stabilities
of the RNA duplexes containing analogue 2 or 3 were studied
by evaluating their thermal denaturation in 0.01 M sodium
phosphate buffer (pH 7.0) containing 0.1 M NaCl (Tables 1
and 2). The UV absorbance of these RNA duplexes was
measured at 260 nm. The Tm value of the complementary
Synthesis. The synthesis of 3-iodo-1-[(tert-
butyldimethylsilyl)oxymethyl]benzene (5) was achieved by
reaction between 3-iodobenzyl alcohol (4) and tert-butyldime-
thylsilyl chloride (TBDMSCl) in the presence of imidazole and
was further trifluoroacetylated by lithium−halogen exchange at
−78 °C using n-BuLi followed by the addition of ethyl
Scheme 1
2464
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472

The Journal of Organic Chemistry
Article
Scheme 2
Scheme 3
duplex (duplex 1) between RNA 1 and RNA 5 was 70.7 °C,
whereas the Tm of the duplexes 2−4 containing analogue 2
were from 59.8 to 63.3 °C. The ΔTm values [Tm (each duplex)
− Tm (duplex 1)] of duplexes 2−4 were from −7.4 to −10.9 °C
(Table 1). It was found that analogue 2 thermally destabilizes
the RNA duplexes. The ΔTm value (−10.9 °C) of duplex 2
containing a 2:rC base pair instead of the rG:rC base pair was
smaller than those (−7.9 and −7.4 °C) of duplexes 3 and 4
containing a 2:rA or 2:rU base pair instead of the rU:rA base
pair, respectively. Because analogue 2 does not pair with natural
nucleosides, this difference in the ΔTm values should be
attributed to the stabilization effects of the duplexes by the base
pairs that were lost as a result of the introduction of analogue 2.
The loss of the rG:rC base pair with three hydrogen bonds
would more significantly reduce the thermal stability of the
duplex than that of the rA:rU base pair with two hydrogen
bonds.
of the rG:rG mismatched base pair (duplex 6, ΔTm = −2.6 °C)
or a 2:rA base pair next to the rG:rG mismatched base pair
(duplex 8, ΔTm = −3.8 °C) were found to be smaller than
those of other duplexes. miRNAs usually bind to their targets
with incomplete complementarity. Thus, the introduction of
analogue 2 near mismatched base pairs of miRNAs might not
significantly reduce the thermal stabilities of the miRNA
duplexes. This might be advantageous in terms of biological
activities of miRNA duplexes, and perhaps the introduction of
analogue 2 near a mismatched base pair might not significantly
reduce the gene-silencing abilities of the miRNA duplexes. A
similar tendency was observed with analogue 3. However, the
destabilization of the RNA duplexes by analogue 3 was smaller
than that by analogue 2 (Table 2).
Photo-Cross-Linking. Next, we examined the photo-cross-
linking abilities of the RNAs containing analogues 2 or 3. The
RNAs containing analogue 2 or 3 were annealed with the target
RNAs, which were labeled with fluorescein at their 5′ end. The
mixtures were irradiated with 365 nm UV-A for 30 min and
then 302 nm UV-B for 10 min at 0 °C, and the cross-linked
RNAs were separated by 20% polyacrylamide gel electro-
phoresis (PAGE) under denaturing conditions (Figure 2a,b).
However, the Tm value of duplex 5 containing a single
mismatched base pair (duplex 5) between RNA 1 and RNA 6
was 63.0 °C, whereas the Tm of duplexes 6−8 containing
analogue 2 were from 56.8 to 60.4 °C. The ΔTm values of
duplexes 6−8 were from −2.6 to −6.2 °C. Destabilization of
these duplexes by the introduction of a 2:rG base pair instead
2465
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472

The Journal of Organic Chemistry
Article
Scheme 4
Table 1. Sequences of RNAs, Tm Values, and Photo-Cross-Linking Yields of RNA/RNA Duplexes Containing 2
a
b
abbreviation of duplex
abbreviation of RNA
sequence
Tm (°C)
ΔTm (°C)
cross-linking yield (%)
duplex 1
RNA 1
RNA 5
RNA 2
RNA 5
RNA 3
RNA 5
RNA 4
RNA 5
RNA 1
RNA 6
RNA 2
RNA 6
RNA 3
RNA 6
RNA 4
RNA 6
5′-r(UGAGGUAGUAGGUUGUAUAGU)-3′
3′-r(ACUCCAUCAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUA2UAGGUUGUAUAGU)-3′
3′-r(ACUCCAUCAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAG2AGGUUGUAUAGU)-3′
3′-r(ACUCCAUCAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAGU2GGUUGUAUAGU)-3′
3′-r(ACUCCAUCAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAGUAGGUUGUAUAGU)-3′
3′-r(ACUCCAUGAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUA2UAGGUUGUAUAGU)-3
3′-r(ACUCCAUGAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAG2AGGUUGUAUAGU)-3′
3′-r(ACUCCAUGAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAGU2GGUUGUAUAGU)-3′
70.7
duplex 2
duplex 3
duplex 4
duplex 5
duplex 6
duplex 7
duplex 8
59.8
62.8
63.3
63.0
60.4
59.2
56.8
−10.9
−7.9
−7.4
5.9
18.0
13.1
−2.6
−3.8
−6.2
6.0
10.6
7.2
3′-r(ACUCCAUGAUCCAACAUAUCA)-5′-F
a
b
Underlined letters indicate mismatched bases. F denotes fluorescein. ΔTm = Tm (each duplex) − Tm (duplex 1 or duplex 5).
The results for the RNA photo-cross-linking probes
mobility than that of single-stranded RNA 6 observed in the
containing analogue 2 are shown in Figure 2a. For all probes
containing analogue 2, bands with slower mobilities than that of
single-stranded RNA 5 or 6 were observed on the gels. The
band with slower mobility observed in the reaction between
RNA 3 and RNA 5 was excised, extracted from the gel, and
analyzed by electrospray ionization time-of-flight mass
spectrometry (ESI-TOF/MS). The observed molecular weight
was in agreement with the cross-linked structure. The net
photo-cross-linking yields were 6−18% for the reactions
between RNAs 2−4 and target RNA 5 and 6−11% for
reactions with target RNA 6. The yields for the duplexes with
RNA 5 composed of complementary sequences were slightly
higher than those with RNA 6 with mismatched base pairs. The
yield for the duplex involving the 2:rA base pair (18%) was the
highest in the tested sequences.
reaction between RNA 6 and RNA 7 was also analyzed by ESI-
TOF/MS. The observed molecular weight supported the cross-
linked structure. The photo-cross-linking yields were 13−32%
for the reactions between RNAs 7−9 and target RNA 5 and 9−
29% for the reactions with target RNA 6. The photo-cross-
linking yields with RNA probes 7−9 containing analogue 3
were higher than those with the corresponding RNA probes
containing analogue 2. The yield for the duplex with the 3:rC
base pair (32%) was the highest in the tested sequences. From
these results, it was found that RNA probes 2−4 containing
analogue 2 or 3 can photo-cross-link to the target RNAs with
all four natural nucleosides complementary to that of analogue
2 or 3.
Dual-Luciferase Assay. Lastly, we investigated the ability
of miRNAs modified with analogue 3 to suppress gene
expression using a dual-luciferase reporter assay. The
psiCHECK-2 vector encoding Renilla and firefly luciferase
Similar results were observed for the RNA probes 7−9
containing analogue 3 (Figure 2b). The band with slower
2466
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472

The Journal of Organic Chemistry
Article
Table 2. Sequences of RNAs, Tm Values, and Photo-Cross-Linking Yields of RNA/RNA Duplexes Containing 3
a
b
abbreviation of duplex
abbreviation of RNA
sequence
Tm (°C)
ΔTm (°C)
cross-linking yield (%)
duplex 1
RNA 1
RNA 5
RNA 7
RNA 5
RNA 8
RNA 5
RNA 9
RNA 5
RNA 1
RNA 6
RNA 7
RNA 6
RNA 8
RNA 6
RNA 9
RNA 6
5′-r(UGAGGUAGUAGGUUGUAUAGU)-3′
3′-r(ACUCCAUCAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUA3UAGGUUGUAUAGU)-3′
3′-r(ACUCCAUCAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAG3AGGUUGUAUAGU)-3′
3′-r(ACUCCAUCAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAGU3GGUUGUAUAGU)-3′
3′-r(ACUCCAUCAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAGUAGGUUGUAUAGU)-3′
3′-r(ACUCCAUGAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUA3UAGGUUGUAUAGU)-3
3′-r(ACUCCAUGAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAG3AGGUUGUAUAGU)-3′
3′-r(ACUCCAUGAUCCAACAUAUCA)-5′-F
5′-r(UGAGGUAGU3GGUUGUAUAGU)-3′
70.7
duplex 9
61.0
64.1
64.4
63.0
61.3
59.6
57.6
−9.7
−6.6
−6.3
32.1
24.9
13.0
duplex 10
duplex 11
duplex 5
duplex 12
duplex 13
duplex 14
−1.7
−3.4
−5.4
28.8
15.2
9.0
3′-r(ACUCCAUGAUCCAACAUAUCA)-5′-F
a
b
Underlined letters indicate mismatched bases. F denotes fluorescein. ΔTm = Tm (each duplex) − Tm (duplex 1 or duplex 5).
Table 3. Sequences of miRNAs and Their Ability to Suppress Gene Expression
abbreviation of
duplex
abbreviation of
RNA
5p vector (%) (upper, 1 nM;
3p vector (%) (upper, 1 nM;
a
b
c
sequence
lower, 10 nM)
lower, 10 nM)
duplex 15
RNA 10
miR-199a-5p
5′-r(CCCAGUGUUCAGACUACCUGUUC)-3′
19.1 3.5
10.4 1.5
RNA 11
3′-r(AUUGGUUACACGUCUGAUG ACA)-5′
14.8 2.2
6.5 1.0
miR-199a-3p
duplex 16
duplex 17
duplex 18
duplex 19
RNA 12
RNA 11
RNA 13
RNA 11
RNA 10
RNA 14
RNA 10
RNA 15
5′-r(CCCAGUG3UCAGACUACCUGUUC)-3′
3′-r(AUUGGUUACACGUCUGAUG ACA)-5′
5′-r(CCCAGUGU3CAGACUACCUGUUC)-3′
3′-r(AUUGGUUACACGUCUGAUG ACA)-5′
5′-r(CCCAGUGUUCAGACUACCUGUUC)-3′
3′-r(AUUGGUUACACGUC3GAUG ACA)-5′
5′-r(CCCAGUGUUCAGACUACCUGUUC)-3′
54.6 5.3
23.7 3.0
69.0 6.3
63.1 5.2
43.2 4.5
33.7 4.2
92.2 2.7
26.0 1.8
11.8 1.0
19.3 2.9
11.1 1.4
53.9 7.4
21.7 3.5
62.2 2.2
26.7 3.4
3′-r(AUUGGUUACACGU3UGAUG ACA)-5′
45.7 4.2
a
b
c
Underlined letters indicate mismatched bases. Luciferase activity (%) of the psi-199a-5p vector. Luciferase activity (%) of the psi-199a-3p vector.
genes was used as the reporter. miR-199a has been known to
exhibit aberrant expression patterns in human cancer and
infection.26−28 Thus, we selected miR-199a as a target
candidate for the novel photo-cross-linking probe. To examine
the ability of each strand of a miRNA duplex to suppress gene
expression, psi-199a-5p and psi-199a-3p vectors were con-
structed by inserting sequences complementary to the miR-
199a-5p and miR-199a-3p strands in the Luc 3′-UTR region of
the psiCHECK-2 vectors according to a reported method.29
The miRNA duplexes and the psi-199a-5p or psi-199a-3p
vector were cotransfected into HeLa cells with the TransFast
transfection reagent. After 24 h, luciferase activities were
Figure 2. Polyacrylamide gel electrophoresis (PAGE) of the photo-
cross-linked products. The mixtures of the target RNAs and the RNA
probes were irradiated with 365 nm UV-A for 30 min and then 302
nm UV-B for 10 min at 0 °C, and the products were analyzed by 20%
PAGE under denaturing conditions. (a) Photo-cross-linking to target
RNAs 5 or 6 by the RNA probes containing analogue 2. Lanes 1 and 5,
target RNA; lanes 2 and 6, target RNA + RNA 2; lanes 3 and 7, target
RNA + RNA 3; and lanes 4 and 8, target RNA + RNA 4. (b) Photo-
cross-linking to target RNAs 5 or 6 by the RNA probes containing
analogue 3. Lanes 1 and 5, target RNA; lanes 2 and 6, target RNA +
RNA 7; lanes 3 and 7, target RNA + RNA 8; and lanes 4 and 8, target
RNA + RNA 9.
measured. The signals of Renilla luciferase were normalized to
those of firefly luciferase (Table 3).
An unmodified miR-199a duplex, duplex 15, effectively
suppressed the expression of Renilla luciferase in both the psi-
199a-5p and psi-199a-3p vectors in a dose-dependent manner.
Renilla luciferase activity of the psi-199a-5p vector decreased
from 19 to 15% and that of the psi-199a-3p vector decreased
from 10 to 7%. The region encompassing the first−seventh
positions at the 5′ terminus of each strand of the miRNA
duplex is known as the seed region, which is important for
binding to target mRNAs. Therefore, we introduced analogue 3
next to the seed region. The gene-silencing activities of the
modified miRNAs were dependent on the positions of analogue
2467
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472

The Journal of Organic Chemistry
Article
added to the mixture, and the mixture was stirred for 10 min. The
mixture was partitioned between EtOAc and H2O. The organic layer
was washed with aqueous NaHCO3 (saturated) and brine, dried
(Na2SO4), and concentrated. The residue was purified by column
chromatography (SiO2, 1% EtOAc in hexane) to give 5 (1.38 g, 3.96
3 and the kind of vectors used. When duplexes 16 and 17,
modified with analogue 3 at the eighth or ninth position from
the 5′ termini of miR-199a-5p strands, were transfected, the
Renilla luciferase activity of the psi-199a-5p vector (24 and 63%
at 10 nM for duplexes 16 and 17, respectively) was higher than
that of the psi-199a-3p vector (12 and 11% at 10 nM for
duplexes 16 and 17, respectively). Thus, it was found that the
modifications on the miR-199a-5p strands exhibited a more
significant influence on the expression of the Renilla luciferase
of the psi-199a-5p vector than that of the psi-199a-3p vector.
However, duplex 16, with analogue 3 on the miR-199a-5p
strand, still exhibited sufficient gene-silencing activity at 10 nM
for the psi-199a-5p vector, although the gene-silencing activity
of duplex 17 for the psi-199a-5p vector was markedly
decreased.
In contrast, when duplexes 18 and 19, modified with
analogue 3 at the eighth or ninth position from the 5′ termini
of miR-199a-3p strands, were transfected, it was intriguing to
note that the Renilla luciferase activity of the psi-199a-3p vector
(22 and 27% at 10 nM for duplexes 18 and 19, respectively)
was lower than that of the psi-199a-5p vector (34 and 46% at
10 nM for duplexes 18 and 19, respectively). It has been
reported that strand selectivity of an miRNA duplex depends
on the thermodynamic stability of the duplex.30,31 Furthermore,
it has been reported that loading and unwinding of miRNAs in
RISCs are dependent on the positions of the mismatched base
pairs and bulge bases in the miRNAs. A mismatched base pair
at a central region promotes loading of the miRNA into RISC,
whereas the same at a seed region enhances unwinding of the
miRNA.32 Thus, the result may reflect the change in the
thermodynamic features of the miRNAs caused by the
introduction of analogue 3 into each strand. These results
indicate that the modified miRNAs with their guide strands
carrying analogue 3 still exhibit sufficient gene-silencing activity,
although the gene-silencing activity of the modified miRNAs
are slightly lower compared with the unmodified miRNA.
1
mmol, 92%). H NMR (400 MHz, CDCl3) δ 0.11 (s, 6H), 0.95 (s,
9H), 4.68 (s, 2H), 7.06 (t, 1H, J = 7.6), 7.28 (d, 1H, J = 7.8), 7.57 (d,
1H, J = 7.8), 7.67 (s, 1H). 13C NMR (151 MHz, CDCl3) δ −5.3, 18.4,
25.9, 64.1, 94.2, 126.0, 135.0, 135.9, 143.9. Anal. Calcd for
C13H21IOSi·1/10H2O: C, 44.60; H, 6.10. Found: C, 44.42; H, 5.94.
1-[(tert-Butyldimethylsilyl)oxymethyl]-3-trifluoroacetylben-
zene (6). To a solution of 5 (1.44 g, 4.13 mmol) in THF (30 mL) at
−78 °C was added dropwise over 30 min n-BuLi (1.64 M in hexane,
5.3 mL, 8.67 mmol). The solution was stirred for 15 min, and then
ethyl trifluoroacetate (1.0 mL, 8.67 mmol) was added over 15 min.
The resulting mixture was stirred at −78 °C for 1 h, quenched at −78
°C using saturated NaHCO3 (15 mL), and then extracted three times
with hexane. The combined organic layer was washed with saturated
NaHCO3 and brine, dried (Na2SO4), and concentrated. The residue
was purified by column chromatography (SiO2, 33% EtOAc in hexane)
1
to give 6 (1.25 g, 3.93 mmol, 95%). H NMR (400 MHz, CDCl3) δ
0.12 (s, 6H), 0.96 (s, 9H), 4.81 (s, 2H), 7.52 (t, 1H, J = 7.8), 7.67 (d,
1H, J = 8.2), 7.96 (d, 1H, J = 7.8), 8.05 (s, 1H). 13C NMR (151 MHz,
CDCl3) δ −5.4, 18.3, 25.8, 64.0, 116.7 (q, 1JC−F = 292.0), 127.4, 128.6,
2
129.0, 129.9, 133.0, 142.9, 180.6 (q, JC−F = 34.7). 19F NMR (376
MHz, CDCl3) δ 5.1. Anal. Calcd for C15H21F3O2Si·3/20H2O: C,
56.11; H, 6.69. Found: C, 55.90; H, 6.39.
3-[3-[(tert-Butyldimethylsilyl)oxymethyl]phenyl]-3-trifluoro-
methyldiaziridine (8). To a solution of 6 (1.07 g, 3.36 mmol) in
pyridine (10 mL) and EtOH (10 mL) was added HONH2·HCl (0.35
g, 5.04 mmol). The resulting mixture was stirred at 60 °C overnight,
cooled to room temperature, and concentrated. The residual oil was
dissolved in CHCl3. The organic layer was washed with H2O and
brine, dried (Na2SO4), and concentrated. The residual oil was
dissolved in CH2Cl2 (10 mL), and then Et3N (1.72 mL, 12.43
mmol), a catalytic amount of DMAP, and p-toluenesulfonyl chloride
(1.28 g, 6.72 mmol) were added. The final mixture was allowed to
react at room temperature overnight. The volatiles were evaporated,
and the residue was dissolved in CHCl3. The organic layer was washed
with saturated NaHCO3 and brine, dried (Na2SO4), and concentrated.
The residue was purified by column chromatography (SiO2, 7% EtOAc
in hexane) to give oxime 7 (1.34 g, 4.02 mmol, 82%, two
CONCLUSIONS
■
1
stereoisomers). H NMR (400 MHz, CDCl3) δ 0.10 (s, 6H), 0.94
We have successfully synthesized RNA probes substituted with
photoactivatable residues, 1-O-[3-(3-trifluoromethyl-3H-diazir-
in-3-yl)]benzyl-β-D-ribofuranose (2) or 1-O-[4-(3-trifluoro-
methyl-3H-diazirin-3-yl)]benzyl-β-D-ribofuranose (3), instead
of the natural nucleosides in their strands. It was revealed that
the RNAs containing analogue 2 or 3 can photo-cross-link to
the target RNAs with four natural nucleosides complementary
to analogue 2 or 3. Furthermore, it turned out that in some
cases the miRNAs modified with analogue 3 have sufficient
gene-silencing activity even if the guide strands of the miRNAs
are modified with analogue 3. Therefore, the RNA containing
analogue 3 is a promising candidate for use as a photo-cross-
linking probe to identify the target mRNAs for each miRNA.
(s, 9H), 2.46−2.49 (m, 3H), 4.72−4.76 (m, 2H), 7.35−7.91 (m, 8H).
Oxime 7 (1.13 g, 2.32 mmol) was dissolved in a 7 M methanolic
ammonia solution (17.0 mL) in a stainless steel portable reactor at
−78 °C. The portable reactor was sealed, and the resulting solution
was stirred at room temperature for 2 days. After cooling the mixture,
the tube was opened, and the excess NH3 was allowed to escape
slowly. The mixture was partitioned between EtOAc and H2O. The
organic layer was washed with aqueous NaHCO3 (saturated) and
brine, dried (Na2SO4), and concentrated. The residue was purified by
column chromatography (SiO2, 5% EtOAc in hexane) to give 8 (0.38
g, 1.14 mmol, 49%). 1H NMR (400 MHz, CDCl3) δ 0.10 (s, 6H), 0.94
(s, 9H), 2.22 (d, 1H, J = 8.7), 2.79 (d, 1H, J = 8.7), 4.77 (s, 2H), 7.36−
7.42 (m, 2H), 7.49 (d, 1H, J = 6.4), 7.59 (s, 1H). 13C NMR (151
MHz, CDCl3) δ −5.3, 18.4, 25.9, 58.1 (q, 2JC−F = 36.1), 64.4, 123.5 (q,
1JC−F = 277.6), 125.6, 126.6, 127.7, 128.6, 131.6, 142.3. 19F NMR (376
EXPERIMENTAL SECTION
General Remarks. CDCl3 (CIL) or DMSO-d6 (CIL) was used as
the solvent for obtaining NMR spectra. Chemical shifts (δ) are given
MHz, CDCl3) δ 0.9. Anal. Calcd for C15H23F3N2OSi: C, 54.19; H,
6.97; N, 8.43. Found: C, 54.06; H. 6.80; N, 8.41.
■
3-[3-[(tert-Butyldimethylsilyl)oxymethyl]phenyl]-3-trifluoro-
methyl-3H-diazirine (9). To a solution of diaziridine 8 (0.42 g, 1.25
mmol) in MeOH (5 mL) were added Et3N (0.43 mL, 3.13 mmol) and
I2 (0.35 g, 1.38 mmol). The mixture was stirred overnight at room
temperature. The mixture was partitioned between EtOAc and
aqueous Na2S2O3. The organic layer was washed with brine, dried
(Na2SO4), and concentrated. The residue was purified by column
chromatography (SiO2, 17% EtOAc in hexane) to give 9 (0.60 g, 2.78
1
in parts per million (ppm) downfield from (CH3)4Si (δ 0.00 for H
NMR in CDCl3), CF3CO2H (δ 0.00 for 19F NMR), or solvent (for 13
C
NMR and 1H NMR in DMSO-d6) as an internal reference with
coupling constants (J) in Hz. The abbreviations s, d, and q signify
singlet, doublet, and quartet, respectively.
3-Iodo-1-[(tert-butyldimethylsilyl)oxymetyl]benzene (5). A
mixture of 3-iodobenzylalchol (4) (1.00 g, 4.27 mmol), TBDMSCl
(0.708 g, 4.70 mmol), and imidazole (0.639 g, 9.39 mmol) in DMF
(10 mL) was stirred at room temperature for 2 h. EtOH (1 mL) was
1
mmol, 78%). H NMR (400 MHz, CDCl3) δ 0.01 (s, 6H), 0.95 (s,
9H), 4.73 (s, 2H), 7.04 (s, 1H), 7.20 (s, 1H), 7.35 (d, 2H, J = 4.6). 13C
2468
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472

The Journal of Organic Chemistry
Article
2
NMR (151 MHz, CDCl3) δ −5.3, 18.3, 25.9, 28.5 (q, JC−F = 40.5),
64.3, 122.2 (q, 1JC−F = 274.7), 123.9, 124.9, 127.0, 128.7, 129.1, 142.5.
19F NMR (376 MHz, CDCl3) δ 11.2. Anal. Calcd for C15H21F3N2OSi·
was washed with aqueous NaHCO3 (saturated) and brine, dried
(Na2SO4), and concentrated. The residue was purified by column
chromatography (SiO2, 5% EtOAc in hexane) to give 15 (0.48 g, 1.44
1
mmol 88%). H NMR (400 MHz, CDCl3) δ 0.11 (s, 6H), 0.95 (s,
3/10H2O: C, 53.65; H, 6.48; N, 8.34. Found: C, 53.52; H, 6.20; N,
8.32.
9H), 2.20 (d, 1H, J = 8.7), 2.78 (d, 1H, J = 8.2), 4,76 (s, 2H), 7.38 (d,
2H, J = 8.5), 7.58 (d, 2H, J = 8.5). 13C NMR (151 MHz, CDCl3) δ
−5.3, 18.4, 25.9, 57.9 (q, 2JC−F = 34.7), 123.6 (q, 2JC−F = 279.0), 126.2,
128.0, 130.2, 143.8. 19F NMR (376 MHz, CDCl3) δ 0.7. Anal. Calcd
for C15H23F3N2OSi: C, 54.19; H, 6.97; N, 8.43. Found: C, 54.07; H.
6.77; N, 8.21.
3-[(3-Hydroxymethyl)phenyl]-3-trifluoromethyl-3H-diazirine
(10). To a solution of diazirine 9 (1.07 g, 3.24 mmol) in THF (10 mL)
was added TBAF (1 M in THF, 3.6 mL), and the mixture was stirred
at room temperature for 1 h. The solvent was evaporated in vacuo, and
the resulting residue was purified by column chromatography (SiO2,
17% EtOAc in hexane) to give 10 (0.60g, 2.78 mmol, 86%). 1H NMR
(400 MHz, CDCl3) δ 1.57−1.77 (m, 1H), 4.70−4.72 (m, 2H), 7.18−
7.43 (m, 4H). 13C NMR (151 MHz, CDCl3) δ 28.4 (q, 2JC−F = 40.5),
64.6, 122.1 (q, 1JC−F = 274.7), 124.7, 125.7, 128.0, 129.1, 129.4, 141.7.
19F NMR (376 MHz, CDCl3) δ 11.2. Anal. Calcd for C9H7F3N2O·1/
3-[4-[(tert-Butyldimethylsilyl)oxymethyl]phenyl]-3-trifluoro-
methyl-3H-diazirine (16). To a solution of diaziridine 15 (1.48 g,
4.46 mmol) in MeOH (15 mL) was added Et3N (1.5 mL, 11.15
mmol) and I2 (1.25 g, 4.91 mmol). The mixture was stirred overnight
at room temperature. The mixture was partitioned between EtOAc
and aqueous Na2S2O3. The organic layer was washed with brine, dried
(Na2SO4), and concentrated. The residue was purified by column
chromatography (SiO2, 2% EtOAc in hexane) to give 16 (1.41 g, 4.27
5H2O: C, 49.19; H, 3.39; N, 12.75. Found: C, 49.21; H, 3.23; N,
12.78.
4-Iodo-1-[(tert-butyldimethylsilyl)oxymetyl]benzene (12). A
mixture of 4-iodobenzylalchol (11) (2.00 g, 8.58 mmol), TBDMSCl
(1.42 g, 9.44 mmol), and imidazole (1.29 g, 18.88 mmol) in DMF (20
mL) was stirred at room temperature for 2 h. EtOH (1 mL) was added
to the mixture, and the mixture was stirred for 10 min. The mixture
was partitioned between EtOAc and H2O. The organic layer was
washed with aqueous NaHCO3 (saturated) and brine, dried (Na2SO4),
and concentrated. The residue was purified by column chromatog-
raphy (SiO2, 3% EtOAc in hexane) to give 12 (2.98 g, 8.56 mmol,
1
mmol, 96%). H NMR (400 MHz, CDCl3) δ 0.01 (s, 6H), 0.94 (s,
9H), 4.74 (s, 2H), 7.17 (d, 2H, J = 8.2), 7.35 (d, 2H, J = 8.2). 13C
2
NMR (151 MHz, CDCl3) δ −5.3, 18.4, 28.4 (q, JC−F = 40.5), 64.2,
1
122.2 (q, JC−F = 274.7), 126.2, 126.4, 127.6, 143.3. 19F NMR (376
MHz, CDCl3) δ 11.1. Anal. Calcd for C15H21F3N2OSi·3/10H2O: C,
53.94; H, 6.46; N, 8.39. Found: C, 53.81; H, 6.24; N, 8.43.
3-[(4-Hydroxymethyl)phenyl]-3-trifluoromethyl-3H-diazirine
(17). To a solution of diazirine 16 (0.78 g, 2.36 mmol) in THF (10
mL) was added TBAF (1 M in THF, 2.6 mL), and the mixture was
stirred at room temperature for 1 h. The solvent was evaporated in
vacuo, and the resulting residue was purified by column chromatog-
raphy (SiO2, 25% EtOAc in hexane) to give 17 (0.47 g, 2.18 mmol,
1
quant.). H NMR (400 MHz, CDCl3) δ 0.09 (s, 6H), 0.93 (s, 9H),
4.68 (s, 2H), 7.07 (d, 2H, J = 8.2), 7.65 (d, 2H, J = 8.2). 13C NMR
(151 MHz, CDCl3) δ −5.3, 18.4, 25.9, 64.4, 92.0, 128.0, 137.2, 141.2.
Anal. Calcd for C13H21IOSi: C, 44.83; H, 6.08. Found: C, 44.68; H,
5.99.
1
92%). H NMR (400 MHz, CDCl3) δ 1.70−1.73 (m, 1H), 4.73 (d,
2H, J = 5.6), 7.20 (d, 2H, J = 7.8), 7.40 (d, 2H, J = 8.2). 13C NMR
1-[(tert-Butyldimethylsilyl)oxymethyl]-4-trifluoroacetylben-
zene (13). To a solution of 12 (2.98 g, 8.56 mmol) in THF (30 mL)
at −78 °C was added dropwise over 30 min n-BuLi (1.64 M in hexane,
11.0 mL, 17.98 mmol). The solution was stirred for 15 min, and then
ethyl trifluoroacetate (2.2 mL, 17.98 mmol) was added over 15 min.
The resulting mixture was stirred at −78 °C for 1 h, quenched at −78
°C using saturated NaHCO3 (15 mL), and then extracted three times
with hexane. The combined organic layer was washed with saturated
NaHCO3 and brine, dried (Na2SO4), and concentrated. The residue
was purified by column chromatography (SiO2, 3% EtOAc in hexane)
2
1
(151 MHz, CDCl3) δ 28.3 (q, JC−F = 40.5), 64.2, 122.1 (q, JC−F
=
274.7), 126.7, 127.1, 128.3, 142.5. 19F NMR (376 MHz, CDCl3) δ
11.1. Anal. Calcd for C9H7F3N2O·3/20H2O: C, 49.39; H, 3.36; N,
12.80. Found: C, 49.26; H, 3.31; N, 12.66.
2,3,5-Tri-O-benzoyl-1-O-[3-(3-trifluoromethyl-3H-diazirine-
3-yl)]benzyl-β-D-ribofuranose (19). To a solution of 1-O-acetyl-
2,3,5-tri-O-benzoyl-β-D-ribofuranose (18) (0.32 g, 0.63 mmol) in
CH2Cl2 (3 mL) at −30 °C was added dropwise TMSOTf (0.14 mL,
0.76 mmol) followed by a solution of diazirine 10 (0.17 g, 0.79 mmol)
in CH2Cl2 (2 mL). The resulting mixture was stirred at −30 °C for 2
h, quenched at −30 °C using aqueous NaHCO3 (saturated) (10 mL),
then partitioned between EtOAc and H2O. The organic layer was
washed with brine, dried (Na2SO4), and concentrated. The residue
was purified by column chromatography (SiO2, 13% EtOAc in hexane)
1
to give 13 (2.69 g, 8.46 mmol, 99%). H NMR (400 MHz, CDCl3) δ
0.12 (s, 6H), 0.96 (s, 9H), 4.83 (s, 2H), 7.50 (d, 2H, J = 8.2), 8.05 (d,
2H, J = 8.2). 13C NMR (151 MHz, CDCl3) δ −5.4, 18.4, 25.9, 64.3,
1
2
116.7 (q, JC−F = 292.0), 126.2, 128.6, 130.2, 150.1, 180.2 (q, JC−F
=
34.7). 19F NMR (376 MHz, CDCl3) δ 5.1. Anal. Calcd for
C15H21F3O2Si: C, 56.58; H, 6.65. Found: C, 56.62; H, 6.55.
1
to give 19 (0.37 g, 0.56 mmol, 89%). H NMR (400 MHz, CDCl3) δ
3-[4-[(tert-Butyldimethylsilyl)oxymethyl]phenyl]-3-trifluoro-
methyldiaziridine (15). To a solution of 13 (2.18 g, 6.85 mmol) in
pyridine (10 mL) and EtOH (10 mL) was added HONH2·HCl (0.71
g, 10.28 mmol). The resulting mixture was stirred at 60 °C overnight,
cooled to room temperature, and concentrated. The residual oil was
dissolved in CHCl3. The organic layer was washed with H2O and
brine, dried (Na2SO4), and concentrated. The residual oil was
dissolved in CH2Cl2 (10 mL), and then Et3N (3.5 mL, 25.35
mmol), a catalytic amount of DMAP, and p-toluenesulfonyl chloride
(2.61 g, 13.70 mmol) were added. The final mixture was allowed to
react at room temperature overnight. The volatiles were evaporated,
and the residue was dissolved in CHCl3. The organic layer was washed
with saturated NaHCO3 and brine, dried (Na2SO4), and concentrated.
The residue was purified by column chromatography (SiO2, 6% EtOAc
in hexane) to give oxime 14 (3.01 g, 6.17 mmol, 90%, two
4.52−4.58 (m, 2H), 4.74−4.80 (m, 3H), 5.31 (s, 1H), 5.77 (d, 1H, J =
4.6), 5.92 (t, 1H, J = 5.7), 7.05−8.02 (m, 16H). 13C NMR (151 MHz,
CDCl3) δ 14.2, 21.1, 28.3 (q, 2JC−F = 40.5), 60.4, 64.4, 69.0, 72.1, 75.5,
1
76.8, 79.3, 104.7, 122.0 (q, JC−F = 274.7), 125.4, 126.0, 128.3, 128.4,
128.5, 128.8, 128.9, 129.0, 129.1, 129.3, 129.5, 129.7, 129.7, 129.8,
133.1, 133.4, 133.5, 137.9, 165.2, 165.4, 166.2, 171.1. 19F NMR (376
MHz, CDCl3) δ 11.3. Anal. Calcd for C35H27F3N2O8: C, 63.64; H,
4.12; N, 4.24. Found: C, 63.41; H, 3.95; N, 4.24.
1-O-[3-(3-Trifluoromethyl-3H-diazirin-3-yl)]benzyl-β-D-ribo-
furanose (20). To a solution of 19 (0.37 g, 0.56 mmol) in MeOH (5
mL) was added a catalytic amount of a 28% MeOH solution of sodium
methoxide. The mixture was stirred at room temperature for 2 h and
quenched using aqueous NH4Cl (saturated) (1 mL). The solvent was
evaporated in vacuo, and the resulting residue was purified by column
chromatography (SiO2, 9% MeOH in CHCl3) to give 20 (0.18 g, 0.52
1
stereoisomers). H NMR (400 MHz, CDCl3) δ 0.11 (s, 6H), 0.95
(s, 9H), 2.47 (m, 3H), 4.77 (m, 2H), 7.36−7.91 (m, 8H).
1
mmol, 95%). H NMR (400 MHz, CDCl3) δ 2.01 (s, 1H), 2.52 (d,
1H, J = 6.4), 2.71 (d, 1H, J = 3.7), 3.81 (s, 2H), 4.01−4.15 (m, 2H),
4.40−4.41 (m, 1H), 4.54 (d, 1H, J = 12.4), 4.75 (d, 1H, J = 12.4), 5.04
(s, 1H), 7.12−7.18 (m, 2H), 7.38−7.39 (m, 2H). 13C NMR (151
Oxime 14 (0.80 g, 1.64 mmol) was dissolved in conc. NH3(aq) (10
mL) and THF (8 mL) in a stainless steel portable reactor at −78 °C.
The portable reactor was sealed, and the resulting solution was stirred
at room temperature for 2 days. After cooling the mixture, the tube
was opened, and the excess NH3 was allowed to escape slowly. The
mixture was partitioned between EtOAc and H2O. The organic layer
2
MHz, CDCl3) δ 28.3 (q, JC−F = 40.5), 63.1, 67.4, 71.1, 74.6, 84.0,
1
106.5, 122.1 (q, JC−F = 274.7), 125.4, 125.7, 127.8, 129.6, 129.7,
140.0. 19F NMR (376 MHz, CDCl3) δ 11.3. Anal. Calcd for
2469
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472

The Journal of Organic Chemistry
Article
C14H15F3N2O5: C, 48.28; H, 4.34; N, 8.04. Found: C, 48.17; H, 4.26;
N, 8.01.
2,3,5-Tri-O-benzoyl-1-O-[4-(3-trifluoromethyl-3H-diazirin-3-
yl)]benzyl-β-D-ribofuranose (25). To a solution of 1-O-acetyl-2,3,5-
tri-O-benzoyl-β-D-ribofuranose (18) (0.46 g, 0.91 mmol) in CH2Cl2 (5
mL) at −30 °C was added dropwise TMSOTf (0.14 mL, 0.76 mmol)
followed by a solution of diazirine 17 (0.18 g, 0.83 mmol) in CH2Cl2
(3 mL). The resulting mixture was stirred at −30 °C for 2 h, quenched
at −30 °C using aqueous NaHCO3 (saturated) (10 mL), then
partitioned between CHCl3 and H2O. The organic layer was washed
with aqueous NaHCO3 (saturated) and brine, dried (Na2SO4), and
concentrated. The residue was purified by column chromatography
(SiO2, 13% EtOAc in hexane) to give 25 (0.50 g, 0.76 mmol, 92%). 1H
NMR (400 MHz, CDCl3) δ 4.49−4.59 (m, 2H), 4.76−4.81 (m, 3H),
5.31 (s, 1H), 5.77 (d, 1H, J = 4.6), 5.93 (t, 1H, J = 6.0), 7.11−8.02 (m,
1-O-[3-(3-Trifluoromethyl-3H-diazirin-3-yl)]benzyl-5-O-(4,4-
dimethoxy)trityl-β-D-ribofuranose (21). A mixture of 20 (0.36 g,
1.03 mmol) and DMTrCl (0.42 g, 1.24 mmol) in pyridine (4 mL) was
stirred at room temperature. After 3 h, the mixture was partitioned
between EtOAc and aqueous NaHCO3 (saturated). The organic layer
was washed with brine, dried (Na2SO4), and concentrated. The
residue was purified by column chromatography (SiO2, 33% EtOAc in
1
hexane) to give 21 (0.61 g, 0.94 mmol, 91%). H NMR (400 MHz,
CDCl3) δ 2.27−2.54 (m, 2H), 3.29−3.35 (m, 2H), 3.77−3.80 (m,
7H), 4.12−4.14 (m, 1H), 4.33 (s, 1H), 4.43 (d, 1H, J = 11.9), 4.70 (d,
1H, J = 11.9), 5.03 (s, 1H), 6.78−7.46 (m, 17H). 13C NMR (151
2
2
16H). 13C NMR (151 MHz, CDCl3) δ 28.3 (q, JC−F = 40.5), 64.2,
MHz, CDCl3) δ 14.2, 21.0, 28.4 (q, JC−F = 40.5), 55.2, 60.4, 64.8,
1
1
68.7, 72.7, 75.3, 82.2, 86.1, 106.3, 113.1, 122.0 (q, JC−F = 274.7),
68.7, 72.0, 75.5, 79.3, 104.6, 122.1 (q, JC−F = 274.7), 126.5, 128.0,
125.5, 125.8, 126.8, 127.8, 128.1, 128.9, 129.0, 129.2, 130.0, 135.9,
138.5, 144.7, 158.4. 19F NMR (376 MHz, CDCl3) δ 11.3. Anal. Calcd
for C35H33F3N2O7: C, 64.61; H, 5.11; N, 4.31. Found: C, 64.47; H,
5.10; N, 4.24.
128.3, 128.4, 128.5, 128.8, 129.1, 129.5, 129.7, 129.7, 129.8, 133.1,
133.4, 133.5, 138.6, 165.2, 165.4, 166.2. 19F NMR (376 MHz, CDCl3)
δ 11.2. Anal. Calcd for C28H22F3N2O6: C, 63.64; H, 4.12; N, 4.24.
Found: C, 63.66; H, 4.12; N, 4.15.
3-O-(tert-Butyldimethyl)silyl-1-O-[3-(3-trifluoromethyl-3H-
diazirin-3-yl)]benzyl-5-O-(4,4′-dimethoxy)trityl-β-D-ribofura-
nose (22) and 2-O-(tert-Butyldimethyl)silyl-1-O-[3-(3-trifluor-
omethyl-3H-diazirin-3-yl)]benzyl-5-O-(4,4′-dimethoxy)trityl-β-
D-ribofuranose (23). A mixture of 21 (1.30 g, 2.00 mmol), Et3N
(0.92 mL, 6.75 mmol), and TBDMSCl (0.47 g, 3.15 mmol) in DMF
(15 mL) was stirred at room temperature. After 12 h, the mixture was
partitioned between EtOAc and aqueous NaHCO3 (saturated). The
organic layer was washed with brine, dried (Na2SO4), and
concentrated. The residue was purified by column chromatography
(SiO2, 17% EtOAc in hexane) to give 22 (0.46 g, 0.60 mmol, 30%)
and 23 (0.48 g, 0.63 mmol, 32%). Physical data for 22: 1H NMR (400
MHz, CDCl3) δ −0.13 (s, 3H), 0.00 (s, 3H), 0.81 (s, 9H), 2.75 (d,
1H, J = 1.8), 3.08 (dd, 2H, J = 5.0 and 10.1), 3.38 (dd, 2H, J = 2.8 and
10.1), 3.76−3.80 (m, 6H), 3.97−3.98 (m, 1H), 4.12−4.13 (m, 1H),
4.35−4.38 (m, 1H), 4.51 (d, 1H, J = 11.9), 4.78 (d, 1H, J = 11.9), 5.09
(s, 1H), 6.76−7.50 (m, 17H). 13C NMR (151 MHz, CDCl3) δ −4.9,
17.9, 25.6, 28.4 (q, 2JC−F = 40.5), 55.2, 63.8, 68.8, 72.3, 75.4, 82.9, 85.9,
1-O-[4-(3-Trifluoromethyl-3H-diazirin-3-yl)]benzyl-β-D-ribo-
furanose (26). To a solution of 25 (1.22 g, 1.85 mmol) in MeOH (5
mL) was added a catalytic amount of a 28% MeOH solution of sodium
methoxide. The mixture was stirred at room temperature for 2 h and
quenched using aqueous NH4Cl (saturated) (1 mL). The solvent was
evaporated in vacuo, and the resulting residue was purified by column
chromatography (SiO2, 9% MeOH in CHCl3) to give 26 (0.61 g, 1.75
1
mmol, 95%). H NMR (400 MHz, CDCl3) δ 1.99 (s, 1H), 2.44 (d,
1H, J = 6.0), 2.65 (s, 1H), 3.68 (d, 1H, J = 11.5), 3.82 (dd, 1H, J = 3.2
and 12.0), 4.09−4.12 (m, 2H), 4.41 (d, 1H, J = 5.5), 4.55 (d, 1H, J =
12.4), 4.66 (d, 1H, J = 12.4), 5.04 (s, 1H), 7.19 (d, 2H, J = 7.8), 7.35
2
(d, 2H, J = 8.2). 13C NMR (151 MHz, CDCl3) δ 28.2 (q, JC−F
=
1
40.5), 63.9, 68.9, 71.9, 75.2, 83.6, 106.6, 122.0 (q, JC−F = 274.7),
126.6, 128.0, 128.8, 138.7. 19F NMR (376 MHz, CDCl3) δ 11.7. Anal.
Calcd for C14H15F3N2O5: C, 48.28; H, 4.34; N, 8.04. Found: C, 48.35;
H, 4.33; N, 7.95.
1-O-[4-(3-Trifluoromethyl-3H-diazirin-3-yl)]benzyl-5-O-(4,4′-
dimethoxy)trityl-β-D-ribofuranose (27). A mixture of 26 (1.01 g,
2.90 mmol) and DMTrCl (1.18 g, 3.48 mmol) in pyridine (15 mL)
was stirred at room temperature. After 3 h, the mixture was partitioned
between EtOAc and aqueous NaHCO3 (saturated). The organic layer
was washed with brine, dried (Na2SO4), and concentrated. The
residue was purified by column chromatography (SiO2, 33% EtOAc in
1
106.4, 113.0, 122.1 (q, JC−F = 274.7), 125.6, 125.8, 126.7, 127.6,
127.7, 128.3, 128.9, 129.2, 129.2, 129.5, 130.0, 136.1, 136.1, 138.7,
144.7, 158.4. 19F NMR (376 MHz, CDCl3) δ 11.2. Anal. Calcd for
C41H47F3N2O7Si: C, 64.38; H, 6.19; N, 3.66. Found: C, 64.16; H, 6.27;
1
N, 3.57. Physical data for 23: H NMR (400 MHz, CDCl3) δ 0.10−
0.12 (m, 6H), 0.90−0.92 (m, 9H), 2.46 (d, 1H, J = 7.4), 3.06 (dd, 1H,
J = 4.6 and 10.1), 3.26 (dd, 1H, J = 3.2 and 10.1), 3.76 (s, 6H), 4.11−
4.13 (m, 2H), 4.19−4.20 (m, 1H), 4.47 (d, 1H, J = 12.4), 4.76 (d, 1H,
J = 12.4), 4.94 (d, 1H, J = 1.8), 6.78−7.47 (m, 17H). 13C NMR (151
MHz, DMSO-d6) δ −5.0, −4.7, 25.7, 28.4 (q, 2JC−F = 40.5), 55.1, 64.6,
1
hexane) to give 27 (1.77 g, 2.72 mmol, 93%). H NMR (400 MHz,
CDCl3) δ 2.24 (d, 1H, J = 6.0), 2.52 (d, 1H, J = 3.2), 3.27−3.32 (m,
2H), 3.77 (s, 6H), 4.11−4.15 (m, 2H), 4.32−4.36 (m, 1H), 4.42 (d,
1H, J = 12.4), 4.70 (d, 1H, J = 11.9), 5.03 (s, 1H), 6.77−7.46 (m,
2
17H). 13C NMR (151 MHz, CDCl3) δ 28.3 (q, JC−F = 40.5), 55.2,
1
68.8, 72.2, 76.5, 83.8, 85.9, 106.6, 113.0, 122.1 (q, JC−F = 274.7),
64.7, 68.6, 72.8, 75.4, 82.3, 86.2, 106.4, 113.1, 122.5 (q, 1JC−F = 274.7),
126.5, 126.8, 127.8, 128.1, 128.2, 128.4, 130.0, 135.9, 139.3, 144.7,
158.5. 19F NMR (376 MHz, CDCl3) δ 11.3. Anal. Calcd for
C35H33F3N2O7·1/10H2O: C, 64.43; H, 5.13; N, 4.29. Found: C,
64.25; H, 5.14; N, 4.32.
125.4, 125.8, 126.7, 127.7, 128.2, 128.9, 129.0, 129.2, 130.1, 130.1,
136.1, 136.1, 138.7, 144.9, 158.3. 19F NMR (376 MHz, CDCl3) δ 11.3.
Anal. Calcd for C41H47F3N2O7Si·1/5H2O: C, 63.63; H, 6.25; N, 3.62.
Found: C, 63.38; H, 6.03; N, 3.53.
2-O-(tert-Butyldimethyl)silyl-1-O-[3-(3-trifluoromethyl-3H-
diazirin-3-yl)]benzyl-5-O-(4,4′-dimethoxy)trityl-3-O-[(2-
cyanoethoxy)(N,N-diisopropyamino)]phosphanyl-β-D-ribofura-
nose (24). A mixture of 23 (0.50 g, 0.65 mmol), N,N-
diisopropylethylamine (0.55 mL, 3.25 mmol), and chloro(2-
cyanoethoxy)(N,N-diisopropylamino)phosphine (0.29 mL, 1.30
mmol) in THF (3.3 mL) was stirred at room temperature for 1 h.
The mixture was partitioned between CHCl3 and aqueous NaHCO3
(saturated). The organic layer was washed with brine, dried (Na2SO4),
and concentrated. The residue was purified by column chromatog-
raphy (a neutralized SiO2, 50% EtOAc in hexane) to give 24 (0.39 g,
0.40 mmol, 62%). 1H NMR (400 MHz, CDCl3) δ 0.06−0.10 (m, 6H),
0.88−0.90 (m, 9H), 0.96−1.13 (m, 12H), 2.32 (t, 1H, J = 6.9), 2.56−
2.61 (m, 1H), 3.09 (dd, J = 3.2 and 10.1), 3.37−3.39 (m, 1H), 3.47−
3.67 (m, 4H), 3.74−3.75 (m, 6H), 4.09−4.15 (m, 1H), 4.20−4.22 (m,
1H), 4.24−4.30 (m, 1H), 4.49 (dd, J = 7.8 and 12.4), 4.81 (d, J =
12.4), 4.93 (d, J = 8.7), 6.74−7.51 (m, 17H). 31P NMR (162 MHz,
CDCl3) δ 149.5, 150.0. HRMS (ESI-TOF) m/z: [M + H]+ calcd for
C50H65F3N4O8PSi, 965.4261; found, 965.4243.
3-O-(tert-Butyldimethyl)silyl-1-O-[4-(3-trifluoromethyl-3H-
diazirin-3-yl)]benzyl-5-O-(4,4′-dimethoxy)trityl-β-D-ribofura-
nose (28) and 2-O-(tert-Butyldimethyl)silyl-1-O-[4-(3-trifluor-
omethyl-3H-diazirin-3-yl)]benzyl-5-O-(4,4′-dimethoxy)trityl-β-
D-ribofuranose (29). A mixture of 27 (2.01 g, 3.09 mmol), Et3N (1.3
mL, 9.27 mmol), and TBDMSCl (0.93 g, 6.18 mmol) in DMF (20
mL) was stirred at room temperature. After 12 h, the mixture was
partitioned between EtOAc and aqueous NaHCO3 (saturated). The
organic layer was washed with brine, dried (Na2SO4), and
concentrated. The residue was purified by column chromatography
(SiO2, 17% EtOAc in hexane) to give 28 (1.07 g, 1.40 mmol, 45%)
and 29 (0.71 g, 0.93 mmol, 30%). Physical data for 28: 1H NMR (400
MHz, CDCl3) δ −0.03 (s, 3H), 0.01 (s, 3H), 0.91 (s, 9H), 2.85 (d,
1H, J = 2.3), 3.17 (dd, 1H, J = 5.0 and 10.1), 3.49 (dd, 1H, J = 3.2 and
10.1), 3.86−3.90 (m, 6H), 4.06−4.08 (m, 1H), 4.19−4.23 (m, 1H),
4.48 (q, 1H, J = 1.8 and 4.6), 4.60 (d, 1H, J = 11.9), 4.89 (d, 1H, J =
11.9), 5.19 (s, 1H), 6.86−7.59 (m, 17H). 13C NMR (151 MHz,
CDCl3) δ −4.9, 17.9 25.6, 28.1 (q, 2JC−F = 40.5), 55.2, 63.7, 68.8, 72.2,
2470
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472

The Journal of Organic Chemistry
Article
2
75.4, 82.3, 85.9, 106.6, 113.0, 122.1 (q, JC−F = 274.7), 125.6, 126.5,
study. The thermal-induced transition of each mixture was monitored
at 260 nm on UV−vis spectrophotometer fitted with a temperature
controller in quartz cuvettes with a path length of 1.0 cm and a 3.0 μM
duplex concentration in a buffer of 10 mM sodium phosphate (pH
7.0) and 0.1 M NaCl. The sample temperature was increased by 0.5
°C/min.
Photo-Cross-Linking. The RNA probes containing the analogue 2
or 3 were annealed with the target RNAs, which were labeled with
fluorescein at their 5′ end, in a buffer of 10 mM Tris-HCl (pH 7.2)
and 0.1 M NaCl. The mixtures were irradiated with 365 nm UV-A for
30 min and then 302 nm UV-B for 10 min at 0 °C (∼1 cm under 6 W
UV-B or UV-A bulb), and the photo-cross-linked products were
analyzed by 20% polyacrylamide gel electrophoresis (PAGE) under
denaturing conditions.
127.7, 128.3, 128.4, 128.9, 130.0, 136.1, 139.4, 144.7, 158.4. Anal.
Calcd for C41H47F3N2O7Si: C, 64.38; H, 6.19; N, 3.66. Found: C,
64.09; H, 6.22; N, 3.50. Physical data for 29: H NMR (400 MHz,
1
CDCl3) δ 0.09−0.11 (m, 6H), 0.91 (d, 9H, J = 4.6), 2.45 (d, 1H, J =
7.8), 3.15 (dd, 1H, J = 5.0 and 10.1), 3.35 (dd, 1H, J = 3.2 and 10.1),
3.76 (d, 6H, J = 1.4), 4.10−4.20 (m, 3H), 4.46 (d, 1H, J = 12.4), 4.78
(d, 1H, J = 11.9), 4.95 (d, 1H, J = 1.4), 6.76−7.49 (m, 17H). 13C
2
NMR (151 MHz, CDCl3) δ −5.0, −4.7, 18.1, 25.7, 28.3 (q, JC−F
=
40.5), 55.1, 64.6, 68.8, 72.2, 76.5, 83.8, 85.9, 106.7, 113.0, 122.1 (q,
1JC−F = 274.7), 126.5, 126.7, 127.7, 128.1, 128.2, 128.3, 130.1, 136.0,
136.1, 139.4, 144.9. 19F NMR (376 MHz, CDCl3) δ 11.1. Anal. Calcd
for C41H47F3N2O7Si: C, 64.38; H, 6.19; N, 3.66. Found: C, 64.39; H,
6.22; N, 3.61.
ESI-TOF/MS Analysis of Photo-Cross-Linked Products. The
band containing the photo-cross-linked product was excised from the
gel, crushed, and then soaked at room temperature for 12 h in 10 mM
TEAA buffer (pH 7.0). The resulting solution was desalted on a
SepPak C18 cartridge to afford the cross-linked RNA. Spectra were
obtained with a mass spectrometry system UPLC-MS. Data of the
photo-cross-linked products: RNA 3 + RNA 5 m/z = 13 952.5 ([M −
H]−, calcd 13 951.6; C431H519F3N154O298P41); RNA 6 + RNA 7 m/z =
13 953.0 ([M − H]−, calcd 13 952.6; C431H518F3N153O299P41).
Dual-Luciferase Assay. HeLa cells were grown at 37 °C in a
humidified atmosphere of 5% CO2 in air in minimum essential
medium (MEM) supplemented with 10% fetal bovine serum (FBS).
Twenty-four hours before transfection, HeLa cells (4 × 104/mL) were
transferred to 96-well plates (100 μL per well). They were transfected
using TransFast according to the manufacturer’s instructions for the
transfection of adherent cell lines. Cells in each well were transfected
with a solution (35 μL) of 20 ng of psiCHECK-2 vector, the indicated
amounts of miRNAs, and 0.3 μg of TransFast in Opti-MEM I reduced-
serum medium and incubated at 37 °C. Transfection without miRNA
was used as a control. After 1 h, MEM (100 μL) containing 10% FBS
and antibiotics was added to each well, and the cells were further
incubated at 37 °C. After 24 h, cell extracts were prepared in passive
lysis buffer. Activity of firefly and Renilla luciferases in cell lysates was
determined with a dual-luciferase assay system according to the
manufacturer’s protocol. The results were confirmed by at least three
independent transfection experiments with two cultures each and are
expressed as the average from four experiments as the mean SD.
2-O-(tert-Butyldimethyl)silyl-1-O-[4-(3-trifluoromethyl-3H-
diazirin-3-yl)]benzyl-5-O-(4,4′-dimethoxy)trityl-3-O-[(2-
cyanoethoxy)(N,N-diisopropyamino)]phosphanyl-β-D-ribofura-
nose (30). A mixture of 29 (0.75 g, 0.98 mmol), N,N-
diisopropylethylamine (0.85 mL, 4.90 mmol), and chloro(2-
cyanoethoxy)(N,N-diisopropylamino)phosphine (0.43 mL, 1.96
mmol) in THF (4.9 mL) was stirred at room temperature for 1 h.
The mixture was partitioned between CHCl3 and aqueous NaHCO3
(saturated). The organic layer was washed with brine, dried (Na2SO4),
and concentrated. The residue was purified by column chromatog-
raphy (neutralized SiO2, 50% EtOAc in hexane) to give 30 (0.90 g,
1
0.93 mmol, 95%). H NMR (600 MHz, CDCl3) δ 0.06−0.0.11 (m,
6H), 0.87−1.17 (m, 21H), 2.30 (t, J = 6.9), 2.56−2.60 (m, 1H), 3.06−
3.10 (m, 1H), 3.39 (d, 1H, J = 10.3), 3.49−3.63 (m, 4H), 4.14−4.15
(m, 1H), 4.19−4.20 (m, 1H), 4.25−4.32 (m, 1H), 4.50 (dd, 1H, J =
16.6 and 18.5), 4.83 (dd, 1H, J = 7.6 and 12.4), 4.94 (d, 1H, J = 10.3),
6.74−7.50 (m, 17H). 31P NMR (162 MHz, CDCl3) δ 149.1, 149.8.
HRMS (ESI-TOF) m/z: [M + H]+ calcd for C50H65F3N4O8PSi,
965.4261; found, 965.4264.
RNA Synthesis. Synthesis was carried out with a DNA/RNA
synthesizer by the phosphoramidite method. Deprotection of bases
and phosphates was performed in concentrated NH4OH/EtOH (3:1
v/v) at 55 °C for 4 h. 2′-O-TBDMS groups were removed by Et3N·
3HF (125 μL) in DMSO (100 μL) at 65 °C for 90 min. The reaction
was quenched with 0.1 M TEAA buffer (pH 7.0) and desalted on a
Sep-Pak C18 cartridge. Deprotected RNAs were purified by 20%
PAGE containing 7 M urea to give highly purified RNA 1 (5), RNA 2
(7), RNA 3 (5), RNA 4 (4), RNA 5 (8), RNA 6 (8), RNA 7 (12),
RNA 8 (8), RNA 9 (10), RNA 10 (7), RNA 11 (6), RNA 12 (7),
RNA 13 (7), RNA 14 (7), and RNA 15 (8). The yields are indicated
in parentheses as OD units at 260 nm starting from 0.2 μmol scale.
MALDI-TOF/MS Analysis of RNAs. Spectra were obtained with a
time-of-flight mass spectrometer equipped with a nitrogen laser (337
nm, 3 ns pulse). A solution of 3-hydroxypicolinic acid (3-HPA) and
diammonium hydrogen citrate in H2O was used as the matrix. Data for
synthetic RNAs: RNA 1 m/z = 6791.5 ([M − H]−, calcd 6794.1;
C202H244N81O148P20); RNA 2 m/z = 6854.6 ([M − H]−, calcd 6859.1;
C206H246F3N78O148P20); RNA 3 m/z = 6897.7 ([M − H]−, calcd
6898.2; C207H247F3N81O147P20); RNA 4 m/z = 6875.9 ([M − H]−,
calcd 6875.1; C206H246F3N78O149P20); RNA 5 m/z = 7079.1 ([M −
H]−, calcd 7080.4; C224H271N75O151P21); RNA 6 m/z = 7118.0 ([M −
H]−, calcd 7120.5; C225H271N77O151P21); RNA 7 m/z = 6790.0 ([M −
H]−, calcd 6859.1; C206H246F3N78O148P20); RNA 8 m/z = 6897.7 ([M
− H]−, calcd 6898.2; C207H247F3N81O147P20); RNA 9 m/z = 6875.9
([M − H]−, calcd 6875.1; C206H246F3N78O149P20); RNA 10 m/z =
7219.3 ([M − H]−, calcd 7219.3; C215H269N78O162P22); RNA 11 m/z
= 7000.6 ([M − H]−, calcd 7002.2; C209H257N81O153P21); RNA 12 m/
z = 7324.5 ([M − H]−, calculated 7323.4; C220H272F3N78O161P22);
ASSOCIATED CONTENT
■
S
* Supporting Information
1H NMR spectra of compounds 5−10, 12−17, 19−24, and
25−30; 13C NMR spectra of compounds 5−10, 12−17, 19−
23, and 25−29; 19F NMR spectra of compounds 6−10, 13−17,
19−23, and 25−29; 31P NMR spectra of compounds 24 and
30; H−H COSY spectra of compounds 22, 23, 28, and 29; and
ESI-TOF/MS spectra of photo-cross-linked products. This
material is available free of charge via the Internet at http://
pubs.acs.org.
AUTHOR INFORMATION
■
Corresponding Author
*Phone: +81-58-293-2919; Fax: +81-58-293-2919; E-mail:
uenoy@gifu-u.ac.jp
Notes
RNA 13 m/z
= 7322.2 ([M −
H]− , calcd 7323.4;
The authors declare no competing financial interest.
C220H272F3N78O161P22); RNA 14 m/z = 7106.2 ([M − H]−, calcd
7106.3; C214H260F3N81O152P21); and RNA 15 m/z = 7104.8 ([M −
H]−, calcd 7107.3; C214H259F3N80O153P21).
ACKNOWLEDGMENTS
■
This research was partially supported by the Ministry of
Education, Culture, Sports, Science, and Technology in Japan
[Grant-in-Aid for Exploratory Research, 24659045] and the
C19 Kiyomi Yoshizaki research grant.
Thermal Denaturation Study. The solution containing the
duplex in a buffer comprising 10 mM sodium phosphate (pH 7.0) and
0.1 M NaCl was heated at 95 °C for 3 min, cooled gradually to an
appropriate temperature, and then used for the thermal denaturation
2471
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472

The Journal of Organic Chemistry
Article
REFERENCES
■
(1) Winter, J.; Jung, S.; Keller, S.; Gregory, R. I.; Diederichs, S. Nat.
Cell Biol. 2009, 11, 228−234.
(2) Tang, G. Trends Biochem. Sci. 2005, 30, 106−114.
(3) Pritchard, C. C.; Cheng, H. H.; Tewari, M. Nat. Rev. Genet. 2012,
13, 358−369.
(4) Meister, G. Nat. Rev. Genet. 2013, 14, 447−457.
(5) Esquela-Kerscher, A.; Slack, F. J. Nat. Rev. Cancer 2006, 6, 259−
269.
(6) Iorio, M. V.; Croce, C. M. EMBO Mol. Med. 2012, 4, 143−159.
(7) Baumjohann, D.; Ansel, K. M. Nat. Rev. Immunol. 2013, 13, 666−
678.
(8) Bartel, D. P. Cell 2009, 136, 215−233.
(9) Ørom, U. A.; Lund, A. H. Gene 2010, 451, 1−5.
(10) Witkos, T. M.; Koscianska, E.; Krzyzosiak, W. J. Curr. Mol. Med.
2011, 11, 93−109.
(11) Martinez-Sanchez, A.; Murphy, C. L. Biology 2013, 2, 189−205.
(12) Friedman, R. C.; Farh, K. K.; Burge, C. B.; Bartel, D. P. Genome
Res. 2009, 19, 92−105.
(13) Betel, D.; Wilson, M.; Gabow, A.; Marks, D. S.; Sander, C.
Nucleic Acids Res. 2008, 36, D149−D153.
(14) Griffiths-Jones, S.; Saini, H. K.; van Dongen, S.; Enright, A. J.
Nucleic Acids Res. 2008, 36, D154−D158.
(15) Lall, S.; Grun, D.; Krek, A.; Chen, K.; Wang, Y. L.; Dewey, C.
N.; Sood, P.; Colombo, T.; Bray, N.; Macmenamin, P.; Kao, H. L.;
Gunsalus, K. C.; Pachter, L.; Piano, F.; Rajewsky, N. Curr. Biol. 2006,
16, 460−471.
(16) Baigude, H.; Ahsanullah, L. Z.; Zhou, Y.; Rana, T. M. Angew.
Chem., Int. Ed. 2012, 51, 5880−5883.
(17) Smith, R. A. G.; Knowles, J. R. J. Am. Chem. Soc. 1973, 95,
5072−5073.
(18) Dubinsky, L.; Krom, B. P.; Meijler, M. M. Bioorg. Med. Chem.
2012, 20, 554−570.
(19) Kuboe, S.; Yoda, M.; Ogata, A.; Kitade, Y.; Tomari, Y.; Ueno, Y.
Chem. Commun. 2010, 46, 7367−7369.
(20) Yamaguchi, T.; Suyama, K.; Narita, K.; Kohgo, S.; Tomikawa,
A.; Saneyoshi, M. Nucleic Acids Res. 1997, 25, 2352−2358.
(21) Liebmann, M.; Di Pasquale, F.; Marx, A. ChemBioChem 2006, 7,
1965−1969.
(22) Winnacker, M.; Breeger, S.; Strasser, R.; Carell, T.
ChemBioChem 2009, 10, 109−118.
(23) Shigdel, U. K.; Zhang, J.; He, C. Angew. Chem., Int. Ed. 2008, 47,
90−93.
(24) Qiu, Z.; Lu, L.; He, C. J. Am. Chem. Soc. 2008, 130, 14398−
14399.
(25) Song, C.-X.; He, C. Acc. Chem. Res. 2011, 44, 709−717.
(26) Murakami, Y.; Yasuda, T.; Saigo, K.; Urashima, T.; Toyoda, H.;
Okanoue, T.; Shimotohno, K. Oncogene 2006, 25, 2537−2545.
(27) Iorio, M. V.; Visone, R.; Di Leva, G.; Donati, V.; Petrocca, F.;
Casalini, P.; Taccioli, C.; Volinia, S.; Liu, C.-G.; Alder, H.; Calin, G. A.;
́
Menard, S.; Croce, C. M. Cancer Res. 2007, 67, 8699−8707.
(28) Lee, J.-W.; Choi, C. H.; Choi, J.-J.; Park, Y.-A.; Kim, S.-J.;
Hwang, S. Y.; Kim, W. Y.; Kim, T.-J.; Lee, J.-H.; Kim, B.-G.; Bae, D.-S.
Clin. Cancer Res. 2008, 14, 2535−2542.
(29) Ogata, A.; Furukawa, C.; Sakurai, K.; Iba, H.; Kitade, Y.; Ueno,
Y. Bioorg. Med. Chem. Lett. 2010, 20, 7299−7302.
(30) Schwarz, D. S.; Hutvagner, G.; Du, T.; Xu, Z.; Aronin, N.;
Zamore, P. D. Cell 2003, 115, 199−208.
(31) Khvorova, A.; Reynolds, A.; Jayasena, S. D. Cell 2003, 115, 209−
216.
(32) Kawamata, T.; Seitz, H.; Tomari, Y. Nat. Struct. Mol. Biol. 2009,
16, 953−960.
2472
dx.doi.org/10.1021/jo402738t | J. Org. Chem. 2014, 79, 2463−2472