6-(Hetero)Arylpurine nucleotides as inhibitors of the oncogenic target DNPH1: Synthesis, structural studies and cytotoxic activities

Article abstract of DOI:10.1016/j.ejmech.2014.07.110

The 2′-deoxynucleoside 5′-phosphate N-hydrolase 1 (DNPH1) has been proposed as a new molecular target for cancer treatment. Here, we describe the synthesis of a series of novel 6-aryl- and 6-heteroarylpurine riboside 5′-monophosphates via Suzuki-Miyaura c

Full text of DOI:10.1016/j.ejmech.2014.07.110

European Journal of Medicinal Chemistry 85 (2014) 418e437
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Original article
6-(Hetero)Arylpurine nucleotides as inhibitors of the oncogenic target
DNPH1: Synthesis, structural studies and cytotoxic activities
,
b
,
,
,
e
f, g
Claire Amiable a c, Julie Paoletti a b, Ahmed Haouz d , Andre Padilla
,
ꢀ
Gilles Labesse f g, Pierre-Alexandre Kaminski a 1, Sylvie Pochet a
,
,
b
,
, b, *
a
ꢀ
Institut Pasteur, Unite de Chimie et Biocatalyse, 28 rue du Dr Roux, 75724 Paris Cedex 15, France
b CNRS, UMR3523, Paris, France
c
ꢀ
ꢀ
Universite Paris Descartes, Sorbonne Paris Cite, Paris, France
d Institut Pasteur, Plateforme de Cristallographie, 25 rue du Dr Roux, 75724 Paris Cedex 15, France
e CNRS, UMR3528, Paris, France
f
ꢀ
CNRS, UMR5048, Universites Montpellier 1 et 2, Centre de Biochimie Structurale, 29, route de Navacelles, 34090 Montpellier, France
g INSERM, U1054, Montpellier, France
a r t i c l e i n f o
a b s t r a c t
The 20-deoxynucleoside 50-phosphate N-hydrolase 1 (DNPH1) has been proposed as a new molecular
target for cancer treatment. Here, we describe the synthesis of a series of novel 6-aryl- and 6-
heteroarylpurine riboside 50-monophosphates via SuzukieMiyaura cross-coupling reactions, and their
ability to inhibit recombinant rat and human DNPH1. Enzymatic inhibition studies revealed competitive
inhibitors in the low micromolar range. Crystal structures of human and rat DNPH1 in complex with one
nucleotide from this series, the 6-naphthylpurine derivative, provided detailed structural information, in
particular regarding the possible conformations of a long and flexible loop wrapping around the large
hydrophobic substituent. Taking advantage of these high-resolution structures, we performed virtual
docking studies in order to evaluate enzymeeinhibitor interactions for the whole compound series.
Among the synthesized compounds, several molecules exhibited significant in vitro cytotoxicity against
human colon cancer (HCT15, HCT116) and human promyelocytic leukemia (HL60) cell lines with IC50
values in the low micromolar range, which correlated with in vitro DNPH1 inhibitory potency.
© 2014 Published by Elsevier Masson SAS.
Article history:
Received 30 May 2014
Received in revised form
23 July 2014
Accepted 31 July 2014
Available online 1 August 2014
Keywords:
Nucleoside analogues
Cross-coupling reaction
DNPH1
Inhibitor
Crystal structure
Cancer
1. Introduction
connecting rcl to breast tumorigenesis [6]. However, direct evi-
dence for its role in cancer development is still lacking [5].
Deregulated expression of c-myc plays a significant role in hu-
man cancer development [1]. The mechanisms by which c-Myc
induces neoplastic transformation and apoptosis have been the
subject of several studies. As a result, a growing number of genes
with different functional classes have been identified as targets for
regulation by c-Myc [1e3]. Among the putative c-Myc-responsive
genes, rcl (C6orf108) has been recognized as a growth-related gene
[4,5]. Up-regulation of rcl has been observed in various human
cancers, including breast [4,6], prostate [7] and colon carcinoma [8],
as well as chronic lymphocytic leukemia [9]. In addition, rcl
expression increases significantly with the tumor grade, strongly
The rcl encoded protein, recently renamed DNPH1, was identi-
fied as an original nucleotide hydrolase that catalyzes the N-
glycosidic cleavage of a 20-deoxynucleoside 50-monophosphate into
a free base and 2-deoxyribose-5-phosphate, while the corre-
sponding ribonucleotide acts as competitive inhibitor [10]. The
NMR solution structures of rat DNPH1, in the apo form [11] and in
complex with guanosine 50-monophosphate GMP [12], gave the
first structural insights into the substrate recognition. In addition,
the substrate specificity was analyzed using rational site-directed
mutagenesis and a first set of nucleotide nucleotide analogues
[13,14].
We previously studied a series of N6-substituted adenosine 50-
monophosphate (AMP) derivatives including some cytokinin ribo-
sides known to inhibit proliferation of cancer cells and to induce
apoptosis [15e17]. The pro-apoptotic effect of some N6-substituted
adenosine derivatives has been related to their intracellular con-
version and accumulation as the corresponding nucleosides 50-
ꢀ
* Corresponding author. Institut Pasteur, Unite de Chimie et Biocatalyse, 28 rue
du Dr Roux, 75724 Paris Cedex 15, France.
E-mail address: sylvie.pochet@pasteur.fr (S. Pochet).
1
ꢀ
ꢀ
ꢁ
ꢁ
Present address: Institut Pasteur, Unite de Biologie des Bacteries Pathogenes a
Gram Positif, 28 rue du Dr Roux, 75724 Paris Cedex 15, France.
http://dx.doi.org/10.1016/j.ejmech.2014.07.110
0223-5234/© 2014 Published by Elsevier Masson SAS.

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
419
monophosphates in HL60 cells [18]. Our results indicated that N6-
substituted AMP derivatives inhibit DNPH1 in the micromolar
range, supporting a possible implication of DNPH1 in their activity
[19]. The crystallographic data of an engineered variant of rat
DNPH1 (shortened and inactive form) bound to three N6-
substituted AMP derivatives (N6-cyclopentyl, N6-isopentenyl, N6-
furfuryl) [19,20] revealed tight interactions with the phosphate
group and the ribose moiety of the co-crystallized ligands, while
the modified nucleobases showed little interactions with the pro-
tein, the 6-alkyl substituents being mobile or in alternating con-
formations with apparently few van der Waals contacts [19].
Moreover the active site appeared to be largely open as the central
loop (residues 47e59 in rat enzyme) lying at the entrance of the
cavity was disordered.
With the aim of developing effective chemical tools for studying
the biological role of DNPH1, we pursued the structureeactivity
relationships at the 6 position of the purine core by introducing less
flexible substituents such as arenes and heteroarenes of various
ring size and bearing diverse functional groups or different elec-
tronic characteristics to maximize additional interactions. In this
paper, we describe the synthetic access to a series of C-6 aryl- and
heteroarylpurine nucleosides as 50-monophosphate derivatives
(1aex, Fig.1), their inhibitory activities against recombinant rat and
human DNPH1 and their cytotoxicity in vitro. Finally, we report the
first crystal structure of human DNPH1 bound to a nucleotide from
this series.
appropriate commercially available aryl- and heteroarylboronic
acids. This key intermediate 3 was readily obtained in two steps
from 6-chloropurine riboside (2) by isopropylidenation of the 20,30-
diol [21], followed by 50-phosphorylation with diethyl-
chlorophosphate in anhydrous pyridine (65% overall yield).
Cross-coupling reactions of 3 with arylboronic acids were first
attempted under conditions reported by Hocek et al. using 20,30,50-
triacetylated 6-chloropurine riboside [22e24]. As anticipated, re-
action of 3 with 2-naphthylboronic acid in anhydrous conditions
using Pd(PPh3)4/K2CO3 in toluene afforded compound 4a in good
yield (Table 1, entry 1). In the case of 3-cyanophenylboronic acid,
the desired product 4b was not formed under these conditions and
only the oxygen-insertion product [25,26] 4c was isolated (entry 2),
while under aqueous conditions using dioxane/1 M aq. Cs2CO3
compound 4b was obtained in 50% yield (entry 3). The use of a
more efficient catalytic system based on Pd(OAc)2 and 2-(dicyclo-
hexylphosphino)biphenyl ligand (CyJohnPhos) [27] in dioxane/
K3PO4 reduced the reaction time but gave similar yields in 4b and
4c (entry 4). When this catalytic system was used in aqueous
conditions, both reaction time and yield were significantly
improved and only the cross-coupling product 4b was isolated in
70% yield (entry 5). A similar observation was done with 3-
biphenylboronic acid as the reaction was complete in 80 min and
4d formed in 71% yield (entries 6 & 7). These optimized conditions
were successfully applied to the preparation of diverse substituted
6-phenylpurine derivatives 4eek (entries 8e14).
We next examined the SuzukieMiyaura reaction of chloride 3
with heteroarylboronic acids. Reactions did not proceed well since
compound 4l was only isolated in 37% yield, even under an active
catalyst system (Table 1, entry 15). Indeed, the intermediate 3
appeared to be substantially less reactive toward cross-coupling
reaction with heteroarylboronic acids than triacetylated 6-
chloropurine riboside [28]. The introduction of heteroarylboronic
acids was successfully achieved starting from unprotected 6-
chloropurine riboside (2) under aqueous Suzuki coupling
2. Results and discussion
2.1. Chemistry
The target nucleotides 1 were obtained following the synthetic
routes illustrated in Scheme 1. Our initial strategy (route A)
involved the palladium-catalyzed SuzukieMiyaura cross-coupling
reaction of 50-phosphorylated 6-chloropurine derivative 3 with
Fig. 1. Structures of 6-aryl and 6-heteroarylpurine ribonucleotides 1aex.

420
C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
Scheme 1. Synthetic routes to the title nucleotides 1. Reagents and conditions: (a) 2,2-dimethoxypropane, PTSA, acetone, rt, 3 h (85%); (b) chloro-diethylphosphate, pyridine,
0
ꢀC, 2 h (76%); (c) ReB(OH)2, catalyst, base, solvent, 100 ꢀC, see Table 1 for conditions and yields; (d) TFA/H2O (90/10), rt, 1 h (62e95%); (e) TMSBr, DMF, rt, 36 h (31e67%);
(f) ReB(OH)2, Pd(OAc)2, TPPTS, H2O/CH3CN, 100 ꢀC, 1e5 h (57e75%); (g) POCl3, PO(OEt)3, 4 ꢀC, overnight (38e57%); (h) from 1s, ReB(OH)2, Pd(OAc)2, TPPTS, H2O/CH3CN,
80 ꢀC, 1e2 h (47e66%).
conditions [29,30] using Pd(OAc)2 and a water-soluble phosphine
(triphenylphosphine-3,30,300-trisulfonic acid trisodium salt, TPPTS)
in the presence of aqueous Na2CO3 (Scheme 1, route B). The 6-
heteroarylpurine ribosides 5leq were thus isolated in 40e75%
yields (Table 2). While 3-bromophenylboronic acid failed to react
with intermediate 3 under the conditions used above, reaction with
2 afforded the desired 5s as the major product together with 5t
resulting from the self-condensation of the boronic acid.
The next steps in the synthetic path from compounds 4aek
(Scheme 1, route A) were the removal of isopropylidene group by
treatment with 90% aqueous TFA, followed by the cleavage of the
ethyl esters with an excess of TMSBr in DMF to give the target
nucleotides 1aek in 27e61% overall yields. For compound 4f, the
methyl ester was first removed by saponification (KOH/CH3OH) to
afford in three steps the 6-(3-carboxyphenyl)purine derivative 1x.
Following route B, selective phosphorylation [31] of nucleosides
5les with POCl3 in PO(OEt)3 at 4 ꢀC afforded the corresponding 50-
monophosphate derivatives 1les in 38e57% yields. In addition,
compound 1s having a bromine atom was used as substrate for
SuzukieMiyaura reactions with boronic acids of medium to large
ring sizes, providing bulky nucleotides 1uew (Table 2, entries
8e10). All the synthesized nucleotides 1 were purified by reverse
phase high-performance liquid chromatography and isolated as
sodium salts. The purity of all tested compounds was greater than
97%.
Table 1
SuzukieMiyaura cross-coupling reactions of 3 with ReB(OH)2.
Entry
R
Conditiona Reaction Product Yield %
time
1
2
3
4
5
6
7
8
2-Naphthyl
A
A
B
C
D
B
D
D
D
D
D
D
D
D
D
12 h
66 h
24 h
7 h
4a
62
3-Cyanophenyl
3-Cyanophenyl
3-Cyanophenyl
3-Cyanophenyl
3-Biphenyl
4b/4c
4b/4c
4b/4c
4b/4c
4d
4d
4e
4f
4g
4h
4i
4j
4k
0/49b
50/21
52/11
70/0
44
4 h
Table 2
12 h
1 h 20
1 h 30
4 h
1 h 30
1 h
2 h
5 h
1 h 30
30 h
SuzukieMiyaura cross coupling reactions of 2 and 1s with ReB(OH)2.
3-Biphenyl
Phenyl
71
76
74
79
75
83
Entry
R
Starting
material
Reaction
timea
Product (yield)
9
3-Methoxycarbonylphenyl
4-Cyanophenyl
3-Nitrophenyl
4-Carboxyphenyl
4-Hydroxyphenyl
4-Succinamidophenyl
3-Furanyl
10
11
12
13
14
15
1
2
3
3-Furanyl
2
2
2
4 h
2 h
5 h
4 h
5l (60%)
5m (57%)
5n (68%)
5o (75%)
5-Formyl-2-furanyl
5-Chloro-2-thienyl
8-Quinolinyl
56
49c
37d
4
2
4l
5
6-Indolyl
2
1 h
5p (73%)
6
7
8
9
5-Bromo-3-pyridinyl
3-Bromophenyl
4-Carboxyphenyl
6-Methoxy-2-naphthyl
4-Dibenzothienyl
2
2
1s
1s
1s
1 h 30b
2 hb
1 hb
2 hb
2 hb
5q (40%), 5r (9%)
5s (65%), 5t (16%)
1u (47%)c
a
Reagents and conditions: Method A: ReB(OH)2 (1.5 equiv), Pd(PPh3)4
(0.06 equiv), K2CO3 (1.5 equiv), anhydrous toluene, 100 ꢀC; Method B: ReB(OH)2
(1.2 equiv), Pd(PPh3)4 (0.06 equiv), 1 M aq. Cs2CO3 (2.4 equiv), dioxane, 100 ꢀC;
Method C: ReB(OH)2 (1.5 equiv), Pd(OAc)2 (0.10 equiv), CyJohnPhos (0.15 equiv),
K3PO4 (2.0 equiv), anhydrous dioxane, 100 ꢀC; Method D: ReB(OH)2 (1.5 equiv),
Pd(OAc)2 (0.10 equiv), CyJohnPhos (0.15 equiv), 1 M aq. Cs2CO3 (2.0 equiv), dioxane,
100 ꢀC.
1v (66%)c
10
1w (50%)c
a
Reagents and conditions: ReB(OH)2 (1.25 equiv), Pd(OAc)2 (0.05 equiv), TPPTS
(0.15 equiv), Na2CO3 (3 equiv), H2O/CH3CN (2:1) at 100 ꢀC.
b
b
With 34% recovered starting material 3.
With 20% recovered 3.
With 25% recovered 3.
Reagents and conditions: ReB(OH)2 (1.25 equiv), Pd(OAc)2 (0.05 equiv), TPPTS
c
(0.15 equiv), Na2CO3 (3 equiv), H2O/CH3CN (2:1) at 80 ꢀC.
d
c
Yields after HPLC purification.

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
421
2.2. Inhibition of human and rat DNPH1
enzyme), suggesting that the binding pocket can adapt to bulkier
hydrophobic substituents. These results extend those previously
obtained in the N6-substituted AMP series and underlined the
favorable contribution of hydrophobic substituents [19].
We also evaluated the impact of substituents as proton donors
or acceptors on the aryl. There was no further improvement in af-
finity by introducing functional groups (COOH, CN, OH, NO2, Br …)
in meta or para position of the phenyl ring, suggesting the absence
of favorable interactions with the protein (discussed later, docking
studies). It was noteworthy that the presence of an oxygen atom at
position 6 of the purine in the O-phenyl derivative 1c led to a
The target 6-(hetero)aryl purine nucleotides 1aex (Fig. 1) were
tested for their ability to inhibit both rat and human DNPH1 en-
zymes using 20-deoxyguanosine 50-monophosphate (dGMP) as
substrate. The Ki values were determined according to previously
reported procedures [10,19] and summarized in Table 3. Data ob-
tained with two representative N6-substituted AMP previously
studied [19], N6-phenyl and N6-benzyl derivatives, were included
for comparison. All tested compounds were found to be competi-
tive inhibitors of dGMP binding with micromolar affinity (except
for the O-arylated compound 1c). The 6-(hetero)arylpurine de-
significantly reduced inhibitory activity (Ki of 107
DNPH1) compared to 3-cyanophenyl 1b (Ki of 12.0
phenyl AMP (Ki of 10.6 M [19]). This could be explained by steric
m
M against rat
m
rivatives were more potent than AMP (40
from 0.9 to 12 M for rat enzyme (Table 3). The Ki values obtained
with human DNPH1 were in a similar range (0.5e26 M), con-
m
M) [13] with Ki ranging
M) and N6-
m
m
m
hindrance between the m-cyano group on the phenyl ring and the
firming that the rat enzyme is a relevant model for the determi-
nation of the kinetic parameters.
two isoleucines (I18 and I65) in the vicinity of the purine moiety.
To assess whether the binding pocket can tolerate large sub-
stituents at the 6-position of the purine, we introduced different
(hetero)aryls of various ring sizes. From this series, it appears that
the phenyl group (compound 1e) can be replaced with other aro-
matic systems such as 3-furanyl (1l), 2-naphthyl (1a), 3-biphenyl
(1d) and 6-indolyl (1p) without significant loss of inhibitory po-
2.3. Crystal structures of human and rat DNPH1 in complex with
compound 1a
In order to understand the binding mode of this new series of
inhibitors, we have undertaken their co-crystallization with
DNPH1. This was performed using a variant of rat DNPH1 harboring
truncated N- and C-termini as well as a point mutation (D69N) of a
catalytic aspartate as previously [19,20], and also a new recombi-
nant variant of the human DNPH1. Indeed, the enhanced affinity
and stability of the new inhibitors allowed us to attempt at crys-
tallizing a shortened form of the human enzyme bearing no mu-
tation in its active site.
High-resolution crystal structures of rat and human DNPH1
bound to compound 1a (PDB 4P5D and PDB 4P5E, respectively)
were solved by molecular replacement using a previous crystal
structure of the rat DNPH1 (PDB 4FYI) and refined at high resolu-
tion (2.11 and 1.35 Å, respectively) (Table 4). As expected the overall
structure of human DNPH1 closely resembles that of rat enzyme
(RMSD ~ 0.6 Å over 134 aligned residues; Fig. 2A) and the observed
binding mode of 1a appears highly similar in both proteins (Fig. 2B).
Despite their distinct crystal packing environment, the two inde-
pendent monomers in each structure build up similar dimers
(Fig. 2A) stabilized by a large interface (~1460 Å2) made of the three
tency (Ki ranging from 0.9 to 1.5
mM for rat enzyme and from 0.5 to
2.8 M for human enzyme). The best compound of this series was
m
the biphenyl derivative (1d), which was 40-fold more potent than
AMP for both enzymes. The 8-quinolinyl derivative (1p) was less
potent with Ki of 12 mM and 26 mM for rat and human enzymes,
respectively. One possible explanation could be that the ortho po-
sition of the diaryl (compared to 2-naphthyl 1a) and/or the relative
position of the nitrogen is able to orient the 6-substituent in a less
favorable conformation in the binding pocket compared to the
other aryls (discussed later, docking studies). Moreover, the
enlargement of the substituent size as for compounds 1uew led to
still potent inhibitors (Ki ranging from 0.5 to 2.9 mM for human
Table 3
Ki values of nucleotides 1aex against rat and human DNPH1.
Compound
R
Ki (
m
M) rat
Ki (mM)
helices a2, a3 and a4. The phosphate and ribose moieties are bound
DNPH1
human
DNPH1
in the same orientation in these crystal structures despite the slight
variations in protein sequence (rat vs. human), the distinct crys-
tallization conditions and also the point mutation D69N in the
active site of the rat protein. The high-resolution of the human
enzyme structure allows a fine analysis of the protein-ligand con-
tacts. As previously described for the rat counterpart [20], an
intricate network of hydrogen bonding involving four backbone
amino groups (I29, R30, G31 and G100 in the human enzyme;
Fig. 2C), two serine hydroxyl groups (S98 and S1280, where the
AMP
NH2
40.0 1.0 [13] 19.2 3.9
BAMP [19]
NHCH2Ph
1.8 0.2
10.6 0.5
1.5 0.1
12.0 1.0
107.0 1.0
1.2 0.1
1.4 0.1
4.8 0.3
4.5 0.4
4.2 0.7
7.4 4.7
1.5 0.2
1.7 0.2
1.8 0.5
5.9 0.2
1.4 0.4
12.0 0.5
0.9 0.1
3.9 1.0
1.4 0.1
3.0 0.5
1.6 0.4
2.3 1.0
5.3 0.6
1.9 0.1
11.2 0.5
2.8 0.1
4.2 1.0
93.0 4.0
0.5 0.1
1.5 0.2
2.4 0.1
2.1 0.4
5.3 1.2
2.7 1.0
1.5 0.3
3.7 0.5
1.7 0.1
3.8 1.2
1.3 0.2
25.9 1.5
2.5 0.5
1.6 0.4
1.1 0.3
1.5 0.3
0.5 0.2
1.4 0.3
2.9 0.5
N6-Ph-AMP [19] NHPh
1a
1b
1c
1d
1e
1f
1g
1h
1i
2-Naphthyl
3-Cyanophenyl
O-(3-Cyanophenyl)
3-Biphenyl
Phenyl
3-Methoxycarbonylphenyl
4-Cyanophenyl
3-Nitrophenyl
4-Carboxyphenyl
4-Hydroxyphenyl
4-Succinamidophenyl
3-Furanyl
5-Formyl-2-furanyl
5-Chloro-2-thienyl
8-Quinolinyl
6-Indolyl
5-Bromo-3-pyridinyl
3-Bromophenyl
3-(4-Carboxyphenyl)phenyl
3-(6-Methoxy-2-naphthyl)phenyl
3-(4-Dibenzothienyl)phenyl
3-Carboxyphenyl
0
symbol means residue from the second subunit) and two water
molecules, maintains tightly the phosphate group. The ribose
moiety is bound with its five-atom heterocyclic ring almost
perfectly planar (Fig. 2D). Close contacts are currently observed
1j
1k
1l
between the ribose oxygen O40 and the methylene group C
g of the
1m
1n
1o
1p
1q
1s
1u
1v
1w
1x
methionine M1190 (dist.: 3.18 Å) suggesting the formation of an
unusual hydrogen bond. The catalytic glutamate points its side-
chain carboxylate group toward the C10 and C40 atoms (dist.: 3.27
and 3.45 Å, respectively) and is also hydrogen bonded to the hy-
droxyl O20 (dist.: 2.61 Å). Close contacts are also observed between
the backbone nitrogen and oxygen atoms of G27 with the hydroxyl
O30 and the carbon C30 of the ribose moiety (dist.: 3.03 and 3.19 Å,
respectively). In parallel, the two other catalytic residues (tyrosine
Y24 and aspartate D80) are in contact with glutamate E104 (dist.:
2.53 Å) and the ribose C10 atom (dist.: 3.31 Å), respectively.
Enzyme assays according to published procedures [13,19]. Ki values are the average
of three independent experiments with standard deviations.

422
C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
Table 4
orientations occur in each subunit (at least in the human counter-
part; see Fig. 2C and D). Indeed, depending on the monomer, a
different part of this loop is almost invisible due to its high flexi-
bility (from 60 to 65 in monomer A and from 63 to 71 in monomer B
of the human enzyme). In all previously solved structures of rat
DNPH1, this long loop (residues 47e59) was too flexible to be
modeled with only very weak electron density visible in the vi-
cinity of the ligand [20]. This apparent flexibility was in agreement
with our former NMR studies [12]. Accordingly, the large and hy-
drophobic naphthyl ring seems to stabilize this long loop that now
covers up the active site. A similar phenomenon appeared in the
human enzyme crystallized in the presence of 1a, although the loop
58e70 is not fully resolved (especially in its central part, residues
63e65). In agreement with the important flexibility of this part of
the protein, various or large substituents can be afforded at C6
position of the purine with little changes on the measured affinity.
Data collection, phasing, and refinement statistics for DNPH1 structures.
Rat DNPH1-1a
Human DNPH1-1a
Beamline
No. of crystals
Space group
Unit-cell parameters
a (Å)
ID29
1
P6122
Proxima 1
1
P1211
178.2
178.2
56.9
90, 90, 120
2
49.0
52.3
54.5
90, 104.8, 90
2
b (Å)
c (Å)
a,
b
,
g
(ꢀ)
No. molecules in asymmetric unit
Wavelength (Å)
0.9793
0.8103
Resolution (Å)
2.11 (2.22e2.11)
6.5 (11.5)
15.9 (3.9)
99.5 (99.4)
6.5 (6.9)
35.3
1.35 (1.41e1.35)
8.1 (49.3)
9.6 (2.6)
100.0 (100.0)
4.5 (4.5)
10.4
Rmerge (%)a
<I/sI>
Completeness (%)b
Multiplicityb
Wilson B factor (Å2)
Refinement
Resolution (Å)
No. of reflections
Rwork/Rfree (%)c
No. Atoms
2.4. Ligand docking in silico
38.59e2.11
30,858
17.2/19.2
47.36e1.35
58,477
15.6/18.3
These two new crystal structures were then used to dock the
whole series of nucleotide analogues into their active site using the
software PLANTS [32]. A primary and naive screening without any
water molecules or pharmacophoric restraints suggested a major
binding mode corresponding to a syn-conformation of the adeno-
sine moiety. The phosphate group was perfectly positioned but the
ribose was slightly shifted. Only a few ligands adopt an anti-
conformation resembling the one observed for compound 1a in the
crystal structures (see Fig. 3A and B). The particular geometry of the
active site in the crystal structure (e.g., a very short contact between
the ribose O40 of 1a and the methionine M1190; see above) may
explain in part the discrepancies between the virtual screening and
the known mode of binding. The rigid conformation of the ribose
(in North conformation) does not allow reproducing its perfectly
planar heterocyclic moiety. Noteworthy, the alternate South
conformation of the ribose does not allow correct docking in the
active site of DNPH1, indicating a tight recognition of the ribose in
agreement with results obtained from crystal structures analysis.
Importantly, in most cases the predicted binding modes favor a
conformation with the nucleobase and the aryl substituent almost
coplanar. However, the mostly incorrect positioning of the ribose
and the nucleobase prevents further analysis of the protein-ligand
interactions. In order to circumvent these difficulties, we resumed
the screening with a pharmacophoric restraint deduced from the
shape of the bound conformation of compound 1a. This led to
oversampling the anti-conformation instead of the syn-one. The
phosphate group, the ribose and the nucleobase of most ligands can
perfectly match the crystal binding mode in this case (mostly as the
best pose in this screen as shown in Fig. 3C and D). Surprisingly, two
ligands, 1a and 1c, failed to behave properly and seemed to be
attracted ‘upward’ by the wrapping-up loop. Nevertheless, the
restrained docking allows a better analysis of the potential in-
teractions of the variable aryl substitutions. Most of them appear to
be forming weak van der Waals interactions with the few hydro-
phobic residues of the flexible loop (e.g., L51, P53 and A58 in the rat
DNPH1). The polar substituents of the aryl rings attempt to form
hydrogen bonds with the conserved arginine (R19 and R30 in rat
and human enzyme, respectively). This is predicted to be the best
binding mode for the phenyl-substituted compounds bearing a
cyano (1b), a nitro (1h), a bromo (1s), a carboxyl (1x) in meta po-
sition or the furanyl- and thienyl-substituted compounds bearing a
carbonyl (1m) or a chloro (1n) group, respectively. However sta-
bilization of the flexible loop on top of the arginine R19, as observed
in the crystal structure of rat DNPH1 bound to 1a, may prevent
proper orientation toward the guanidinium group of the conserved
arginine and the formation of a favorable hydrogen bond. The large
Protein
Ligand
Ions
2230
64
5
2347
64
1
Water
140
373
B factors (Å2)
Protein
46.9
12.6
109.9
52.0
15.8
12.5
24.3
31.6
Ligand
Ions
Water
R.m.s deviationsd
Bond lengths (Å)
Bond angles (ꢀ)
Ramachandran (%)
Most favored
Additional allowed
Disallowed regions
0.008
1.19
0.008
1.22
93.3
5.0
1.8
97.0
2.6
0.4
a
ShklSirIhkl,i ꢁ Iaverage, hklr/rShklSirIhkl,ir ꢂ 100.
b
c
Values in parenthesis stands for the outer shell of resolution range.
Deviation from ideal values.
d
Rfree is calculated on a subset of reflections that are not used in the refinement
(5%).
The purine moiety is stacked into the active site and sandwiched
by two isoleucines (in human, I29 and I74; Fig. 2C and D) as pre-
viously observed for N6-alkyl-AMP derivatives bound to the rat
enzyme [19,20]. In the vicinity, a leucine (L62 in human, L51 in rat)
is now stacked onto the large and aromatic naphthyl ring. In the rat
enzyme, additional van der Waals contacts are also observed be-
tween the naphthyl ring and the backbone atoms (mainly E56, E57
and A58 in the rat protein) of the flexible loop (residues 47e59 and
58e70 in rat and human proteins, respectively) as well as some
side-chains including one conserved arginine (R19 and R30, in rat
and human, respectively; Fig. 2E). Despite the higher local flexi-
bility, some of the contacts observed in the rat structure, are pre-
sent in at least one of the two independent monomers of the
human structure (e.g., L62 in human). In fact, most of the residues
neighboring the naphthyl moiety are rather well conserved in
sequence although some substitutions distinguish the human and
rat counterparts (e.g., P53 vs. A64 in rat and human, respectively).
Accordingly, the recognition of the aryl moiety should be highly
similar in both proteins. However, a variation exists in the orien-
tation of the 6-aryl group in the crystallographically independent
subunits. While this group adopts apparently only one orientation
in rat structure, two orientations exist in the human enzyme. The
detected orientations may be partially influenced by the crystal
packing, but it is likely that they exist in equilibrium in solution. The
residual electron density suggests that the two alternating

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
423
Fig. 2. Panels A and B: Superimposition of the rat and human DNPH1 structures bound to 1a. Two independent subunits are observed in the crystal structures and the reconstituted
dimers were superimposed in Coot (A: top view and B: side-view). The proteins are shown as colored ribbons with the ligand in sticks (cyan and green for the human enzyme;
orange and brown for the rat enzyme). Panels C, D and E: Closer view of the ligand binding site of the human structure with a zoom on the phosphate group (C), the ribose moiety
(D) and the naphthyl group (E). Both protein residues and the ligands are shown in sticks. Residues discussed in the text are labeled according to the human numbering. The
2Fo ꢁ Fc electron density map of the ligand molecule is shown in cyan mesh and surface. Map is contoured at 0.9
s. These pictures are generated by the program PYMOL (http://
pymol.sourceforge.net). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
hydrophobic substitutions may form other interactions with the
flexible loop without supporting further stabilizations in absence of
a buried sub-pocket.
at 10 mM and 100 mM) are given as supplementary material
(Fig. S1eS5). Similar levels of inhibition were observed for a given
nucleoside and the corresponding nucleotide (Fig. S1eS5). For the
The screening of the human enzyme structure revealed a similar
behavior compared to its rat orthologous enzyme. This suggested
that the main variations observed in the ligand affinities might
rather come from the general features of the long and flexible loop.
Indeed, a slight variation in the local sequence (proline P53 vs.
alanine A64 or leucine L54 vs. arginine R65 in the rat sequence
versus the human one) certainly affects both the conformational
stability of this loop and also its overall charge. Indeed, the nega-
tively charged aryls show slightly better affinity for the human
enzyme compared to the rat counterpart. However, the intrinsic
flexibility of this loop and its particular conformation in the rat
enzyme prevented further refinement in this analysis and addi-
tional works will be necessary.
most active molecules (>90% inhibition at 10 mM), the IC50 values
(concentration inhibiting the cell growth by 50%) were determined
from cell viability measurements at final concentrations ranging
from 0.005 mM to 100 mM (ten dilutions). The data are summarized
in Table 5. Thus, six nucleotides (1e, 1j, 1l, 1n, 1p, 1s) exhibited
significant cytotoxicity against HCT15 cells with IC50 values ranging
from 0.3 to 1.4
most potent inhibitors of human DNPH1 (Table 3) with the
exception of 1d and 1v (<50% inhibition at 10 M). As previously
mM (Table 5). These nucleotides were among the
m
observed with a series of 6-phenylpurine nucleosides [24,28], nu-
cleosides bearing bulky substituents at position 6 (compounds 1d
and 1ue1w) were significantly less active (Fig. S1eS5). This might
reflect a difference in the transport mechanism of these com-
pounds and/or rephosphorylation efficiency. These nucleotides
were also active on the other cancer cell lines, in particular on
HCT116 and HL60 [28], but generally with a slightly reduced po-
2.5. Cytotoxicity evaluation
tency with IC50 values from 0.5 to 15.4 mM (Table 5). This apparent
The 22 nucleotides 1aex (Fig. 1) as well as the nucleosides 5
synthesized in this study [33] were tested for their in vitro cytotoxic
activity against five human cell lines from solid tumors including
colon (HCT15 and HCT116), breast (MCF7), prostate (PC3) carci-
nomas, and promyelocytic leukemia cells (HL60). DNPH1 over-
expression has been previously reported in these cancer cell lines
[9]. N6-benzyladenosine 50-monophosphate (BAMP) and its corre-
sponding nucleoside (BAR), known to exhibit strong cytotoxicity
against HL60 cell lines and solid tumors [16,18,34], were included to
these assays as internal control.
specificity could be explained in part by a well-known lower
expression of DNPH1 in these cells [9] (and corroborated by
Western-blot analysis, data not shown).
In order to gain insight into the mechanism of action of these
compounds, the effect of an adenosine kinase (AK) inhibitor on the
growth of cells treated with DNPH1 inhibitors was next examined.
Treatment with the AK inhibitor A-134974 completely counter-
acted the inhibitory effect of all tested compounds, as illustrated in
Fig. 4 with the most active molecules. These results indicate that
the active metabolite is the monophosphate form. Thus, the 6-
arylpurine nucleotides are converted to the corresponding nucle-
osides by extracellular nucleotidases, transported across the
Cell viability was determined following a 3-day treatment using
a quantitative metabolic assay with MTT. The complete data (% cell
growth inhibition in the presence of nucleosides 5 or nucleotides 1

424
C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
Fig. 3. Ligand docking into the rat DNPH1 structure solved in complex with 1a. Results of naive docking are shown in panels A and B, while those obtained using a pharmacophoric
restraint (compound 1a) are shown in panels C and D. The protein is shown as colored ribbons with the important side-chains and the ligand in sticks. Residues discussed in the text
are labeled according to the rat numbering. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
membrane and then re-phosphorylated in the cell by adenosine
kinase. Comparable cytotoxicity patterns were obtained after
treatment of cell lines by nucleosides 5 in the presence of adeno-
sine kinase inhibitor (data not shown).
crystallized with DNPH1 leading to the first crystal structure of the
human enzyme (PDB 4P5E). This structure solved at atomic reso-
lution in the absence of any mutation within the catalytic triad
allowed very precise analysis of the ligand binding site. In addition,
in the rat counterpart also co-crystallized with 1a, we could also
observe stabilization of the long loop wrapping over the active site
(PDB 4P5D). The newly solved structures bring insights for the
further development of inhibitors of DNPH1. Indeed the binding
pocket affords large variation in the size and the nature of the 6-
aryl substituent, and this novel series of inhibitors provides a
slight improvement over the N6-alkyl derivatives previously stud-
ied [19]. Virtual docking of the whole series of 6-aryl derivatives
3. Conclusion
A series of 6-(hetero)arylpurine ribonucleotides was synthe-
sized as potential DNPH1 inhibitors. Two synthetic routes based on
SuzukieMiyaura cross-coupling reactions were investigated
providing the title compounds in good overall yields. Most of these
nucleotides showed good inhibitory potency in the low to sub-
micromolar range against both rat and human enzymes. One
compound of this series, compound 1a, was successfully co-
Table 5
In vitro cytostatic activity of representative nucleotides 1 on cancer cell lines HCT15,
HCT116 and HL60.
Compound
IC50
HCT15
(m
M)a
HCT116
HL60
BAMP
1e
1j
0.8 0.1
0.7 0.1
0.3 0.1
1.3 0.1
1.0 0.3
1.4 0.4
0.6 0.1
7.7 0.8
3.2 0.1
4.1 1.0
5.5 2.5
nd
5.0 0.5
1.7 0.3
0.5 0.1
15.4 2.0
6.5 2.8
0.5 0.2
3.9 0.6
1l
1n
1p
1s
>80
nd
The values are averages of two independent experiments with standard deviations.
nd: not determined.
Concentration of compound needed to reduce cell growth by 50% after 72 h
incubation.
Fig. 4. Growth inhibition of HCT116, HCT15 and HL60 cells after 72 h treatment with
DNPH1 inhibitors in the absence or in the presence of an adenosine kinase inhibitor
(A-134974).
a

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
425
into the active site of rat and human DNPH1 was analyzed in view
of the experimental affinities. This suggested that none of the
electronegative substituent (cyano, carboxyl, bromo …) in meta
position of the (hetero)aryl ring, managed to interact efficiently
with the arginine (R30 and R19 in human and rat, respectively)
despite the expected formation of a hydrogen bond. The knowledge
of the major conformation of the long and flexible loop should help
in deriving new aryl moieties to potentially better interact with this
loop. Similarly, constraining the co-planarity of the aryl moiety and
the nucleobase should enhance the affinity by reducing the entropy
cost of ligand binding. The combination of these two derivatization
strategies should bring better ligands but currently this stands
beyond the scope of this article. More importantly, six potent in-
hibitors among this series of nucleotides showed significant cyto-
toxicity against human cancer cell lines that overexpressed DNPH1
[8]. Some discrepancies between measured DNPH1 inhibition and
cytotoxic activity may be due to other properties of compounds
such as cell penetration and enzyme activation.
Hocek et al. [35,36] have recently described the cytostatic ac-
tivity of a series of 6-aryl and 6-heteroaryl-7-deazapurine ribonu-
cleosides, compounds substituted with furan-2-yl and thienyl-2-yl
being the most active with nanomolar cytostatic activity in multi-
ple cancer cell lines. The authors have demonstrated intracellular
phosphorylation to mono- and triphosphate metabolites, together
with a potent inhibition of total RNA synthesis. Several 6-aryl and
6-heteroarylpurine nucleosides have already been reported to
exhibit significant cytotoxic activity [28]. However little is known
about the mechanism of action of these later 6-modified purines.
Our results showed that the cytotoxicity of some molecules from
these series relies on their phosphorylation by adenosine kinase,
and probably their accumulation as monophosphorylated form, as
shown previously for active cytokinins [18] and triciribine [37]. This
common dependency (monophosphorylation) and the shared af-
finity for DNPH1, despite significant chemical variations, support
that the anticancer effects observed in vivo could rely on common
inhibition of DNPH1. This suggests that DNPH1 should be included
in other evaluations as a new anticancer target.
Q-Tof Micro MS instrument using a mobile phase of acetonitrile/
water with 0.1% formic acid (positive ion mode) or 10 mM
ammonium formate (negative ion mode). The purity of all tested
compounds was greater than 97% as determined by HPLC using a
Agilent 1100 system equipped with a diode array detector and a
reverse phase column (C18 Kromasil, 3.5
m
m, 30 ꢂ 4.6 mm) using a
linear gradient of acetonitrile in 10 mM TEAA buffer over 20 min at
a flow rate of 1 mL/min. Retention time (Rt) and gradient are given
for each compound.
4.2. Synthesis of target nucleotides 1ae1k and 1x according to
Scheme 1 route A
4.2.1. General procedures for SuzukieMiyaura cross-coupling
reactions
4.2.1.1. Method A. Arylboronic acid (1.5 equiv) and anhydrous po-
tassium carbonate (1.5 equiv) were added to a stirred solution of 3
(1 equiv) in anhydrous toluene (10 mL/mmol). The reaction mixture
was purged three times with argon, then Pd(PPh3)4 (0.06 equiv)
was introduced. The mixture was warmed to 100 ꢀC. When the
reaction was judged complete (monitoring by LCeMS and TLC), the
mixture was cooled to room temperature and filtered through a pad
of Celite. Concentration of the filtrate and purification of the crude
mixture by silica gel chromatography yielded the title compound.
4.2.1.2. Method B. Similar to method A except that aqueous cesium
carbonate (1 M, 2.4 equiv) was used instead of potassium
carbonate.
4.2.1.3. Method C. All solutions were deoxygenated before addition
to the reaction mixture. Pd(OAc)2 (0.10 equiv) and CyJohnPhos
(0.15 equiv) in anhydrous dioxane (1 mL/mmol) were stirred at
room temperature for 15 min under argon atmosphere. Then, a
solution of 3 (1 equiv) in anhydrous dioxane (10 mL/mmol), aryl-
boronic acid (1.5 equiv) and anhydrous tripotassium phosphate
(2 equiv) were added. The reaction was warmed to 100 ꢀC. When
the reaction was judged complete (monitoring by LCeMS and TLC),
the mixture was cooled to room temperature and filtered through a
pad of celite. Concentration of the filtrate and purification of the
crude mixture by silica gel chromatography yielded the title
compound.
4. Experimental section
4.1. Chemicals and general synthetic methods
All commercial chemicals and solvents, unless otherwise stated,
were reagent grade and were used without further purification.
Anhydrous reactions were carried out under argon atmosphere.
Thin layer chromatography (TLC) was performed using silica gel
60F254 plates (Merck). Visualization was made with UV light
(254 nm) and by spraying with a mixture of ethanol/anisaldehyde/
sulfuric acid/acetic acid (90/5/4/1) followed by heating. Reactions
were also monitored using an HPLC system (Agilent 1100 equipped
with a C18 reverse phase column) coupled to a mass spectrometer
(ESI source). Flash chromatography was performed using silica gel
60 (230e400 mesh, Merck). HPLC purification was carried out on an
Agilent system (1100 Series) equipped with a diode array detector
4.2.1.4. Method D. Similar to method C except that aqueous cesium
carbonate (1 M, 2 equiv) was used instead of anhydrous tripotas-
sium phosphate.
4.2.2. General procedure for removal of the isopropylidene group of
compounds 4
A solution of nucleotide 4 in TFA/H2O (90/10, 10 mL/mmol) was
stirred at room temperature. After completion of the reaction (1 h),
the resulting solution was concentrated to dryness, coevaporated
with toluene and purified by silica gel column chromatography to
afford the unprotected compound 6.
using a C18 reverse phase column (Kromasil, 5
m
m, 100 Å,
4.2.3. General procedure for removal of ethyl group of compounds 6
To a stirred solution of the phosphotriester 6 (1 equiv) in
anhydrous DMF (4 mL), bromotrimethylsilane (0.5 mL, ~20 equiv)
was added at 0 ꢀC under argon atmosphere. The mixture was then
allowed to warm to room temperature and stirred for 36 h
(monitoring by LCeMS). Then, the volatiles were removed and the
mixture was diluted with NH4OH (1.5 mL) and concentrated to
dryness. The resulting white solid was taken up in 20 mM TEAA
buffer (pH 7) and purified by preparative HPLC using a linear
gradient of CH3CN in 20 mM TEAA buffer as indicated. A final
Dowex ion exchange led to the 50-monophosphate derivative 1 as
150 ꢂ 4.5 mm) and a linear gradient of acetonitrile in 20 mM
triethylammonium acetate (TEAA) buffer over 20 min at a flow rate
of 4 mL/min. NMR spectra were recorded on Bruker Avance 400 (1H
at 400.13 MHz, 13C at 100.62 MHz, 31P at 161.62 MHz). The complete
assignment of 1H and 13C signals was performed by analysis of the
correlated homonuclear H,H-COSY and heteronuclear H,C-HMBC,
H,C-HSQC spectra. Chemical shifts (d) are reported in ppm rela-
tive to the solvent deuterated signals or to H3PO4 (0 ppm) as
external standard for 31P. Coupling constants (J values) are reported
in Hertz. High-resolution mass spectra were measured on a Waters

426
C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
sodium salt. For poorly-water-soluble compounds, no ion exchange
was performed.
according to the General Procedure Method D. Purification by flash
column chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 98/2)
afforded 4b (159 mg, 70%).
4.2.4. 6-Chloro-9-(5-O-diethylphosphate-2,3-O-isopropylidene-
4.2.6.1. Compound 4b. 1H NMR (400.13 MHz, DMSO-d6):
d 1.13
ß-
D
-ribofuranosyl)-9H-purine (3)
(2xtd, 4JH,P ¼ 0.9, J ¼ 7.0, 2 ꢂ 3H, OeCH2eCH3), 1.37 (s, 3H, (CH3)2C),
To a solution of 6-chloro-9-(2,3-O-isopropylidene-ß-
D
-ribofur-
anosyl)-9H-purine [21] (2.56 g, 7.83 mmol) in anhydrous pyridine
(32 mL), diethylchlorophosphate (2.8 mL, 19.58 mmol) was added
dropwise at 0 ꢀC under argon atmosphere. The resulting solution
was stirred at this temperature. After completion (2 h), MeOH
(10 mL) was added and the solvents were removed under reduced
pressure. The crude product was purified by flash column chro-
matography (200 g SiO2, CH2Cl2/MeOH: 100/0 to 98/2) to afford
compound 3 (2.76 g, 76%) as a yellow oil. 1H NMR (400.13 MHz,
1.58 (s, 3H, (CH3)2C), 3.86e3.96 (m, 4H, OeCH2eCH3), 4.09e4.22
(m, 2H, H-50), 4.43e4.47 (m, 1H, H-40), 5.13 (dd, J3 ,4 ¼ 3.2,
0
0
0
0
0
0
0
0
0
0
J2 ,3 ¼ 6.2,1H, H-3 ), 5.57 (dd, J1 ,2 ¼ 2.1, J2 ,3 ¼ 6.2,1H, H-2 ), 6.42 (d,
0
0
0
J1 ,2 ¼ 2.1,1H, H-1 ), 7.82 (t, J ¼ 7.9,1H, H-5 Arom.), 8.04 (dt, J ¼ 1.3, J4
¼ 7.7, 1H, H-4 Arom.), 8.88 (s, 1H, H-8), 9.04e9.06 (m,
Arom., 5 Arom.
2H, H-2, H-6 Arom.), 9.14 (t, J ¼ 1.5, 1H, H-2 Arom.); 13C NMR
(100.62 MHz, DMSO-d6):
d
15.7 (d, 3JC,P ¼ 6.4, 2C, OeCH2eCH3), 25.1
((CH3)2C), 26.9 ((CH3)2C), 63.3 (d, 2JC,P ¼ 5.9, 2C, OeCH2eCH3), 66.3
(d, 2JC,P ¼ 5.6, C-50), 80.8 (C-30), 83.3 (C-20), 85.0 (d, 3JC,P ¼ 7.6, C-40),
89.7 (C-10), 112.0 (C-3 Arom.), 113.5 ((CH3)2C), 118.4 (CN), 130.1 (C-5
Arom.), 131.0 (C-5), 132.6 (C-2 Arom.), 133.4 (C-6 Arom.), 134.4 (C-4
Arom.), 136.1 (C-1 Arom.), 145.9 (C-8), 150.5 (C-6), 151.8 (C-4), 151.9
DMSO-d6):
d
1.14 (2td, 4JH,P ¼ 0.9, J ¼ 7.1, 2 ꢂ 3H, CH3), 1.35 (s, 3H,
(CH3)2C), 1.57 (s, 3H, (CH3)2C), 3.85e3.94 (m, 4H, OeCH2),
4.05e4.19 (m, 2H, H-50), 4.42e4.46 (m, 1H, H-40), 5.08 (dd,
0
0
0
0
0
0
0
0
0
J3 ,4 ¼ 3.1, J2 ,3 ¼ 6.2, 1H, H-3 ), 5.53 (dd, J1 ,2 ¼ 2.0, J2 ,3 ¼ 6.2, 1H, H-
20), 6.38 (d, J1 ,2 ¼ 2.1, 1H, H-10), 8.84 (s, 2H, H-2, H-8); 13C NMR
0
0
(C-2); 31P NMR (161.62 MHz, DMSO-d6):
d
ꢁ0.07; HRMS (ESI-TOF):
3
(100.62 MHz, DMSO-d6):
d
16.3 (d, JC,P ¼ 6.4, 2C, CH3), 25.6
m/z calcd for [C24H28N5O7P þ H]þ 530.1805, found 530.1831.
((CH3)2C), 27.3 ((CH3)2C), 63.3 (d, 2JC,P ¼ 5.7, 2C, OeCH2eCH3), 66.8
(d, 2JC,P ¼ 5.3, C-50), 81.2 (C-30), 83.8 (C-20), 85.6 (d, 3JC,P ¼ 7.7, C-40),
90.5 (C-10), 114.0 ((CH3)2C), 132.0 (C-5), 146.5 (C-8), 149.9 (C-6),
4.2.6.2. Compound 4c. 1H NMR (400.13 MHz, DMSO-d6):
d 1.17 (2td,
4JH,P ¼ 1.0, J ¼ 7.1, 2 ꢂ 3H, OeCH2eCH3), 1.36 (s, 3H, (CH3)2C), 1.56 (s,
151.6 (C-4), 152.2 (C-2); 31P NMR (161.62 MHz, DMSO-d6):
d
ꢁ0.90;
35
3H, (CH3)2C), 3.89e3.95 (m, 4H, OeCH2eCH3), 4.14e4.20 (m, 2H, H-
HRMS (ESI-TOF): m/z calcd for [C
found 463.1168.
H
ClN4O7P þ H]þ 463.1149,
17 24
50), 4.40e4.46 (m, 1H, H-40), 5.09 (dd, J3 ,4 ¼ 3.2, J2 ,3 ¼ 6.2, 1H, H-
0
0
0
0
30), 5.61 (dd, J1 ,2 ¼ 2.3, J2 ,3 ¼ 6.2, 1H, H-20), 6.37 (d, J1 ,2 ¼ 2.3, 1H,
H-10), 7.69e7.72 (m, 2H, H-4 Arom., H-5 Arom.), 7.79e7.82 (m, 1H,
H-6 Arom.), 7.90e7.92 (m, 1H, H-2 Arom.) 8.54 (s, 1H, H-2), 8.70 (s,
0
0
0
0
0
0
4.2.5. 6-(2-Naphthyl)-9-(5-O-diethylphosphate-2,3-O-
isopropylidene- -ribofuranosyl)-9H-purine (4a)
b-D
1H, H-8); 13C NMR (100.62 MHz, DMSO-d6):
d
15.7 (d, 3JC,P ¼ 6.3, 2C,
Synthesized from compound 3 (350 mg, 0.76 mmol) and 2-
naphtalene boronic acid (195 mg, 1.14 mmol) according to the
General Procedure Method A. Compound 4a (258 mg, 62%) was
obtained as colorless crystals after 12 h of reaction and two suc-
cessive flash column chromatographies (30 g SiO2, CH2Cl2/MeOH:
OeCH2eCH3), 25.1 ((CH3)2C), 26.9 ((CH3)2C), 63.4 (d, 2JC,P ¼ 5.6, 2C,
OeCH2eCH3), 66.2 (d, 2JC,P ¼ 5.7, C-50), 80.8 (C-30), 83.3 (C-20), 84.8
3
(d, JC,P ¼ 8.3, C-40), 89.6 (C-10), 112.5 (C-3 Arom.), 113.6 ((CH3)2C),
117.9 (CN), 121.4 (C-5), 125.7 (C-2 Arom.), 127.3 (C-4 Arom.), 129.7
(C-6 Arom.), 131.1 (C-5 Arom.), 144.0 (C-8), 152.5 (C-2), 152.3 (C-1
Arom.), 152.5 (C-4), 158.9 (C-6); 31P NMR (161.62 MHz, DMSO-d6):
100/0 to 99/1). 1H NMR (400.13 MHz, DMSO-d6):
d 1.13 (2xtd,
4JH,P ¼ 0.9, J ¼ 7.1, 2 ꢂ 3H, OeCH2eCH3), 1.38 (s, 3H, (CH3)2C), 1.59 (s,
d
ꢁ0.05; HRMS (ESI-TOF): m/z calcd for [C24H28N5O8P þ H]þ
3H, (CH3)2C), 3.86e3.97 (m, 4H, OeCH2eCH3), 4.11e4.25 (m, 2H, H-
546.1754, found 546.1739.
50), 4.44e4.48 (m, 1H, H-40), 5.15 (dd, J3 ,4 ¼ 3.2, J2 ,3 ¼ 6.2, 1H, H-
0
0
0
0
30), 5.61 (dd, J1 ,2 ¼ 2.1, J2 ,3 ¼ 6.2,1H, H-2 ), 6.43 (d, J1 ,2 ¼ 2.1,1H, H-
0
0
0
0
0
0
0
10), 7.58e7.67 (m, 2H, H-6 Arom., H-7 Arom.), 8.01 (dd, J6 Arom., 8
4.2.7. 6-(3-Biphenyl)-9-(5-O-diethylphosphate-2,3-O-
¼1.3, J7 Arom., 8 Arom. ¼ 7.6, 1H, H-8 Arom.), 8.14e8.11 (m, 2H, H-
isopropylidene-b-D-ribofuranosyl)-9H-purine (4d)
Arom.
4 Arom., H-5 Arom.), 8.88 (s, 1H, H-8), 8.91 (dd, J1 Arom., 3 Arom. ¼ 1.7,
J3 Arom., 4 Arom. ¼ 8.8, 1H, H-3 Arom.), 9.08 (s, 1H, H-2), 9.49 (bs, 1H,
Synthesized from compound 3 (139 mg, 0.30 mmol) and 3-
biphenylboronic acid (89 mg, 0.45 mmol) according to the Gen-
eral Procedure Method D. Purification by flash column chroma-
tography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 98/2) afforded 4d as a
white powder (123 mg, 71%). 1H NMR (400.13 MHz, DMSO-d6):
H-1 Arom.); 13C NMR (100.62 MHz, DMSO-d6):
d
15.7 (3JC,P ¼ 6.3,
OeCH2eCH3), 25.2 ((CH3)2C), 26.9 ((CH3)2C), 63.4 (2JC,P ¼ 5.7,
OeCH2eCH3), 66.4 (2JC,P ¼ 5.3, C-50), 80.8 (C-30), 83.4 (C-20), 84.9
(3JC,P ¼ 7.8, C-40), 89.7 (C-10), 113.5 ((CH3)2C), 125.6 (C-3 Arom.),
127.7 (2C, C-6 Arom., C-7 Arom.), 128.2 (C-8 Arom.), 128.8 (C-5
Arom.), 129.2 (C-4 Arom.), 130.2 (C-1 Arom.), 131.4 (C-5), 132.7 (C-
8a Arom.), 133.3 (C-4a Arom.), 134.2 (C-2 Arom.), 145.3 (C-8), 151.7
(C-4), 152.0 (C-2), 153.0 (C-6); 31P NMR (161.62 MHz, DMSO-d6):
d
1.10e1.15 (m, 6H, OeCH2eCH3), 1.37 (s, 3H, (CH3)2C), 1.59 (s, 3H,
(CH3)2C), 3.87e3.94 (m, 4H, OeCH2eCH3), 4.12e4.21 (m, 2H, H-50),
4.45e4.46 (m, 1H, H-40), 5.14 (dd, 1H, J3 ,4 ¼ 3.2, J2 ,3 ¼ 6.2, H-30),
0
0
0
0
5.59 (dd, 1H, J1 ,2 ¼ 2.2, J2 ,3 ¼ 6.2, H-20), 6.43 (d, 1H, J1 ,2 ¼ 2.2, H-
10), 7.43 (dt, 1H, J ¼ 1.2, J ¼ 7.3, H-40 Arom.), 7.55 (t, 2H, J ¼ 7.3, H-30
Arom., H-50 Arom.), 7.69e7.77 (m, 3H, H-5 Arom., H-20 Arom., H-60
Arom.), 7.88 (dq, 1H, J ¼ 1.2, J5 Arom., 6 Arom. ¼ 7.7, H-6 Arom.), 8.80
(dt, 1H, J ¼ 1.3, J4 Arom., 5 Arom. ¼ 7.8, H-4 Arom.), 8.86 (s, 1H, H-8),
9.06 (s, 1H, H-2), 9.15 (t, 1H, J ¼ 1.7, H-2 Arom.); 13C NMR
0
0
0
0
0
0
d
ꢁ0.08; HRMS (ESI-TOF): m/z calcd for [C27H31N4O7P þ H]þ
555.2009, found 555.2021.
4.2.6. 6-(3-Cyanophenyl)-9-(5-O-diethylphosphate-2,3-O-
isopropylidene-
cyanophenoxy)-9-(5-O-diethylphosphate-2,3-O-isopropylidene-
-ribofuranosyl)-9H-purine (4c)
Synthesized from compound 3 (200 mg, 0.43 mmol) and 3-
b
-D-ribofuranosyl)-9H-purine (4b) and 6-(3-
(100.62 MHz, DMSO-d6):
d
15.7 (d, 3JC,P ¼ 6.7, 2C, OeCH2eCH3), 25.2
b-
((CH3)2C), 26.9 ((CH3)2C), 63.3 (d, 2JC,P ¼ 5.9, 2C, OeCH2eCH3), 66.3
(d, 2JC,P ¼ 5.6, C-50), 80.8 (C-30), 83.3 (C-20), 85.0 (d, 3JC,P ¼ 6.9, C-40),
89.6 (C-10), 113.5 ((CH3)2C), 126.7 (2C, C-20 Arom., C-60 Arom.), 127.7
(C-2 Arom.), 127.8 (C-40 Arom.), 128.2 (C-4 Arom.), 129.1 (2C, C-30
Arom., C-50 Arom.), 129.4 (C-5 Arom.), 129.5 (C-6 Arom.), 131.0 (C-
5), 135.8 (C-3 Arom.), 139.8 (C-10 Arom.), 140.6 (C-1 Arom.), 145.3
(C-8), 151.7 (C-4), 151.9 (C-2), 152.9 (C-6); 31P NMR (161.62 MHz,
D
cyanophenylboronic acid (95 mg, 0.65 mmol) according to the
General Procedure Method C. Purification by flash column chro-
matography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 98/2) afforded 4b
(116 mg, 52%) as a yellow oil together with the by-product 4c
(30 mg,11%) as a brown oil. Synthesized from compound 3 (200 mg,
0.43 mmol) and 3-cyanophenylboronic acid (95 mg, 0.65 mmol)
DMSO-d6):
d
ꢁ0.09; HRMS (ESI-TOF): m/z calcd for
[C29H33N4O7P þ H]þ 581.2165, found 581.2180.

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
427
4.2.8. 6-Phenyl-9-(5-O-diethylphosphate-2,3-O-isopropylidene-
-ribofuranosyl)-9H-purine (4e)
Synthesized from compound 3 (200 mg, 0.43 mmol) and phe-
nylboronic acid (80 mg, 0.65 mmol) according to the General Pro-
cedure Method D. Purification by flash column chromatography
(30 g SiO2, CH2Cl2/MeOH: 100/0 to 98/2) afforded 4e as a yellow oil
b
-
89.7 (C-10), 113.3 (C-4 Arom.), 113.5 ((CH3)2C), 118.5 (CN), 129.8 (2C,
C-2 Arom., C-6 Arom.), 131.4 (C-5), 132.7 (2C, C-3 Arom., C-5 Arom.),
139.3 (C-1 Arom.), 146.0 (C-8), 150.8 (C-6), 152.0 (C-4), 152.1 (C-2);
D
31P NMR (161.62 MHz, DMSO-d6):
d
ꢁ0.08; HRMS (ESI-TOF): m/z
calcd for [C24H28N5O7P þ H]þ 530.1805, found 530.1818.
(164 mg, 76%). 1H NMR (400.13 MHz, DMSO-d6):
d
1.10 (2td,
4.2.11. 6-(3-Nitrophenyl)-9-(5-O-diethylphosphate-2,3-O-
isopropylidene-b-D-ribofuranosyl)-9H-purine (4h)
4JH,P ¼ 0.8, J ¼ 7.1, 2 ꢂ 3H, OeCH2eCH3), 1.36 (s, 3H, (CH3)2C), 1.58 (s,
3H, (CH3)2C), 3.86e3.93 (m, 4H, OeCH2eCH3), 4.08e4.21 (m, 2H, H-
Synthesized from compound 3 (200 mg, 0.43 mmol) and 3-
nitrophenylboronic acid (108 mg, 0.65 mmol) according to the
General Procedure Method D. Purification by flash column chro-
matography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 98/2) afforded 4h
50), 4.47e4.51 (m, 1H, H-40), 5.13 (dd, J3 ,4 ¼ 3.2, J2 ,3 ¼ 6.2, 1H, H-3 ),
0
0
0
0
0
5.58 (dd, J1 ,2 ¼ 2.2, J2 ,3 ¼ 6.2, 1H, H-20), 6.41 (d, J1 ,2 ¼ 2.2, 1H, H-
10), 7.57e7.64 (m, 3H, H-3 Arom., H-4 Arom., H-5 Arom.), 8.81e8.83
(m, 3H, H-8, H-2 Arom., H-6 Arom.), 9.03 (s, 1H, H-2); 13C NMR
0
0
0
0
0
0
as an orange solid (176 mg, 75%). 1H NMR (400.13 MHz, DMSO-d6):
4
(100.62 MHz, DMSO-d6):
d
15.7 (d, 3JC,P ¼ 6.4, 2C, OeCH2eCH3), 25.2
d
1.12 (2td, JH,P ¼ 0.9, J ¼ 7.1, 2 ꢂ 3H, OeCH2eCH3), 1.37 (s, 3H,
((CH3)2C), 26.9 ((CH3)2C), 63.3 (d, 2JC,P ¼ 5.8, 2C, OeCH2eCH3), 66.3
(d, 2JC,P ¼ 5.5, C-50), 80.7 (C-30), 83.3 (C-20), 84.8 (d, 3JC,P ¼ 7.8, C-40),
89.6 (C-10), 113.5 ((CH3)2C), 128.7 (C-4 Arom.), 129.3 (2C, C-2 Arom.,
C-6 Arom.), 130.9 (C-5), 131.7 (2C, C-3 Arom., C-5 Arom.), 135.1 (C-1
Arom.), 144.8 (C-8), 151.6 (C-4), 151.9 (C-2), 153.1 (C-6); 31P NMR
(CH3)2C), 1.58 (s, 3H, (CH3)2C), 3.86e3.95 (m, 4H, OeCH2eCH3),
4.11e4.23 (m, 2H, H-50), 4.44e4.48 (m,1H, H-40), 5.13 (dd, 0J3 ,4 ¼ 3.1,
0
0
0
0
0
0
0
0
0
J2 ,3 ¼ 6.2,1H, H-3 ), 5.58 (dd, J1 ,2 ¼ 2.1, J2 ,3 ¼ 6.3,1H, H-2 ), 6.43 (d,
J1 ,2 ¼ 2.1, 1H, H-10), 7.92 (t, J ¼ 8.0, 1H, H-5 Arom.), 8.43 (ddd, J4
0
0
¼ 1.1, J2 Arom., H-4 Arom. ¼ 2.4, J4 Arom., 5 Arom. ¼ 8.3, 1H, H-4
Arom., 6 Arom
(161.62 MHz, DMSO-d6):
d
ꢁ0.10; HRMS (ESI-TOF): m/z calcd for
Arom.), 8.92 (s, 1H, H-8), 9.10 (s, 1H, H-2), 9.22 (dt, J ¼ 1.3, J5 Arom., 6
[C23H29N4O7P þ H]þ 505.1852, found 505.1870.
¼ 7.8, 1H, H-6 Arom.), 9.68 (t, J ¼ 2.0, 1H, H-2 Arom.); 13C NMR
Arom.
(100.62 MHz, DMSO-d6):
d
15.7 (d, 3JC,P ¼ 6.3, 2C, OeCH2eCH3), 25.2
4.2.9. 6-(3-Methoxycarbonylphenyl)-9-(5-O-diethylphosphate-2,3-
O-isopropylidene-b-D-ribofuranosyl)-9H-purine (4f)
((CH3)2C), 26.9 ((CH3)2C), 63.7 (d, 2JC,P ¼ 5.7, 2C, OeCH2eCH3), 66.3
(d, 2JC,P ¼ 5.5, C-50), 80.8 (C-30), 83.3 (C-20), 85.0 (d, 3JC,P ¼ 7.7, C-40),
89.8 (C-10), 113.5 ((CH3)2C), 123.7 (C-2 Arom.), 125.6 (C-4 Arom.),
130.5 (C-5 Arom.), 131.1 (C-5), 135.1 (C-6 Arom.), 136.6 (C-1 Arom.),
Synthesized from compound 3 (300 mg, 0.65 mmol) and 3-
methoxycarbonylphenylboronic acid (175 mg, 0.97 mmol) accord-
ing to the General Procedure Method D. Purification by flash col-
umn chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 99/1)
afforded 4f as a white powder (270 mg, 74%). 1H NMR (400.13 MHz,
146.0 (C-8), 148.2 (C-3 Arom.), 150.2 (C-6), 152.0 (2C, C-2, C-4); 31
P
NMR (161.62 MHz, DMSO-d6):
d
ꢁ0.07; HRMS (ESI-TOF): m/z calcd
for [C23H28N5O9P þ H]þ 550.1703, found 550.1705.
DMSO-d6):
d
1.13 (2td, 4JH,P ¼ 0.9, J ¼ 7.2, 2 ꢂ 3H, OeCH2eCH3), 1.37
(s, 3H, (CH3)2C), 1.59 (s, 3H, (CH3)2C), 3.86e3.92 (m, 4H,
4.2.12. 6-(4-Carboxyphenyl)-9-(5-O-diethylphosphate-2,3-O-
isopropylidene-b-D-ribofuranosyl)-9H-purine (4i)
OeCH2eCH3), 3.93 (s, 3H, CO2CH3), 4.15e4.18 (m, 2H, H-50),
4.45e4.50 (m, 1H, H-40), 5.13 (dd, J3 ,4 ¼ 3.2, J2 ,3 ¼ 6.2, 1H, H-300),
Synthesized from compound 3 (200 mg, 0.43 mmol) and 4-
carboxyphenylboronic acid (108 mg, 0.65 mmol) according to the
General Procedure Method D. When the reaction was complete
(2 h), the reaction mixture was acidified to pH 2 with 1 M HCl, then
extracted with CH2Cl2 (3 times). Purification by flash column
chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 98/6 þ 0.5%
0
0
0
0
0
0
0
0
0
0
0
5.59 (dd, J1 ,2 ¼ 2.1, J2 ,3 ¼ 6.2,1H, H-2 ), 6.43 (d, J1 ,2 ¼ 2.1, 1H, H-1 ),
7.78 (t, J ¼ 7.8, 1H, H-5 Arom.), 8.16 (dt, J ¼ 1.4, J4 Arom., 5 Arom. ¼ 7.8,
1H, H-4 Arom.), 8.88 (s, 1H, H-8), 9.08 (s, 1H, H-2), 9.10 (dt, J ¼ 1.5, J5
¼ 8.0, 1H, H-6 Arom.), 9.44 (t, J ¼ 1.8, 1H, H-2 Arom.);
Arom., 6 Arom.
13C NMR (100.62 MHz, DMSO-d6):
3
d
15.7 (d, JC,P ¼ 6.4, 2C,
OeCH2eCH3), 25.2 ((CH3)2C), 26.9 ((CH3)2C), 52.3 (CO2CH3), 63.3 (d,
AcOH) gave 4i as a white powder (196 mg, 83%). 1H NMR
2JC,P ¼ 6.0, 2C, OeCH2eCH3), 66.3 (d, JC,P ¼ 5.5, C-50), 80.8 (C-30),
(400.13 MHz, DMSO-d6):
d
1.11 (2td, JH,P ¼ 0.9, J ¼ 7.1, 2 ꢂ 3H,
2
4
3
83.3 (C-20), 85.0 (d, JC,P ¼ 8.0, C-40), 89.7 (C-10), 113.5 ((CH3)2C),
OeCH2eCH3), 1.36 (s, 3H, (CH3)2C), 1.58 (s, 3H, (CH3)2C), 3.89e3.93
129.3 (C-2 Arom.), 129.9 (C-5 Arom.), 130.2 (C-3 Arom.), 131.0 (C-5),
131.6 (C-4 Arom.), 133.8 (C-1 Arom.), 135.6 (C-6 Arom.), 145.6 (C-8),
151.7 (C-4), 151.8 (C-6), 152.0 (C-2), 165.9 (CO2CH3); 31P NMR
(m, 4H, OeCH2eCH3), 4.06e4.22 (m, 2H, H-50), 4.48e4.51 (m, 1H,
H-40), 5.13 (dd, J3 ,4 ¼ 3.2, J2 ,3 ¼ 6.2, 1H, H-30), 5.58 (dd, J1 ,2 ¼ 2.2,
0
0
0
0
0
0
0
0
0
0
0
0
J2 ,3 ¼ 6.1, 1H, H-2 ), 6.43 (d, J1 ,2 ¼ 2.1, 1H, H-1 ), 8.16 (d, J ¼ 8.6, 2H,
H-3 Arom., H-5 Arom.), 8.87 (s, 1H, H-8), 8.92 (d, J ¼ 8.6, 2H, H-2
(161.62 MHz, DMSO-d6):
d
ꢁ0.09; HRMS (ESI-TOF): m/z calcd for
[C25H31N7O9P þ H]þ 563.1907, found 563.1974.
Arom., H-6 Arom.), 9.08 (s, 1H, H-2); 13C NMR (100.62 MHz, DMSO-
3
d6):
d
16.2 (d, JC,P ¼ 6.5, 2C, OeCH2eCH3), 25.7 ((CH3)2C), 27.4
4.2.10. 6-(4-Cyanophenyl)-9-(5-O-diethylphosphate-2,3-O-
isopropylidene-b-D-ribofuranosyl)-9H-purine (4g)
((CH3)2C), 63.8 (d, 2JC,P ¼ 5.6, 2C, OeCH2eCH3), 66.8 (d, 2JC,P ¼ 6.3, C-
50), 81.3 (C-30), 83.8 (C-20), 84.5 (d, 3JC,P ¼ 7.5, C-40), 90.2 (C-10), 114.0
((CH3)2C), 129.9 (2C, C-2 Arom., C-6 Arom.), 130.1 (2C, C-3 Arom., C-
5 Arom.), 131.7 (C-5), 133.8 (C-4 Arom.), 139.6 (C-1 Arom.), 146.2 (C-
8), 152.3 (C-4), 152.4 (C-2), 152.5 (C-6), 167.5 (COOH); 31P NMR
Synthesized from compound 3 (200 mg, 0.43 mmol) and 4-
cyanophenylboronic acid (95 mg, 0.65 mmol) according to the
General Procedure Method D. Purification by flash column chro-
matography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 98/2) afforded 4g as
(161.62 MHz, DMSO-d6):
d
ꢁ0.09; HRMS (ESI-TOF): m/z calcd for
a white powder (179 mg, 79%). 1H NMR (400.13 MHz, DMSO-d6):
[C24H29N4O9P þ H]þ 549.1750, found 549.1766.
4
d
1.11 (2td, JH,P ¼ 0.9, J ¼ 7.0, 2 ꢂ 3H, OeCH2eCH3), 1.36 (s, 3H,
(CH3)2C), 1.58 (s, 3H, (CH3)2C), 3.85e3.95 (m, 4H, OeCH2eCH3),
4.2.13. 6-(4-Hydroxyphenyl)-9-(5-O-diethylphosphate-2,3-O-
isopropylidene-b-D-ribofuranosyl)-9H-purine (4j)
4.11e4.19 (m, 2H, H-50), 4.45e4.52 (m,1H, H-40), 5.12 (dd, J3 ,4 ¼ 3.2,
0
0
J2 ,3 ¼ 6.2, 1H, H-30),05.58 (dd, J1 ,2 ¼ 2.2, J2 ,3 ¼ 6.2, 1H, H-20), 6.43
Synthesized from compound 3 (200 mg, 0.43 mmol) and 4-
hydroxyphenylboronic acid (108 mg, 0.65 mmol) according to the
General Procedure Method D. Purification by flash column chro-
matography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 96/4) afforded 4j as
0
0
0
0
0
0
0
0
(d, J1 ,2 ¼ 2.1, 1H, H-1 ), 8.08 (d, J ¼ 1.8, 1H, H-3 Arom. or H-5 Arom.),
8.09 (d, J ¼ 1.8, 1H, H-3 Arom. or H-5 Arom.), 8.90 (s, 1H, H-8), 8.96
(d, J ¼ 1.8, 1H, H-2 Arom. or H-6 Arom.), 8.98 (d, J ¼ 1.7, 1H, H-2
Arom. or H-6 Arom.), 9.10 (s, 1H, H-2); 13C NMR (100.62 MHz,
a white powder (123 mg, 56%). 1H NMR (400.13 MHz, DMSO-d6):
3
4
DMSO-d6):
d
15.7 (d, JC,P ¼ 6.6, 2C, OeCH2eCH3), 25.2 ((CH3)2C),
d
1.11 (2td, JH,P ¼ 0.8, J ¼ 7.1, 2 ꢂ 3H, OeCH2eCH3), 1.36 (s, 3H,
2
26.9 ((CH3)2C), 63.3 (d, JC,P ¼ 5.9, 2C, OeCH2eCH3), 66.3 (d,
(CH3)2C), 1.57 (s, 3H, (CH3)2C), 3.86e4.00 (m, 4H, OeCH2eCH3),
4.06e4.13 (m, 1H, H-50), 4.15e4.20 (m, 1H, H-500), 4.40e4.43 (m, 1H,
2JC,P ¼ 5.4, C-50), 80.8 (C-30), 83.3 (C-20), 84.9 (d, JC,P ¼ 7.7, C-40),
3

428
C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
H-40), 5.12 (dd, J3 ,4 ¼ 3.2, J2 ,3 ¼ 6.2, 1H, H-30), 5.56 (dd, J1 ,2 ¼ 2.2,
4.2.16. 6-(3-Cyanophenyl)-9-(5-O-diethylphosphate-
ribofuranosyl)-9H-purine (6b)
Starting from 4b (125 mg, 0.24 mmol), 6b (69 mg, 62%) was
obtained as a brown oil after purification by flash column chro-
matography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 97/3). 1H NMR
b-D-
0
0
0
0
0
0
J2 ,3 ¼ 6.1, 1H, H-20), 6.38 (d, J1 ,2 ¼ 2.1, 1H, H-10), 6.95e6.98 (m, 2H,
0
0
0
0
H-3 Arom., H-5 Arom.), 8.73e8.76 (m, 3H, H-8, H-2 Arom., H-6
Arom.), 8.91 (s, 1H, H-2), 10.12 (s, 1H, OH); 13C NMR (100.62 MHz,
3
DMSO-d6):
d
15.7 (d, JC,P ¼ 6.5, 2C, OeCH2eCH3), 25.2 ((CH3)2C),
2
26.9 ((CH3)2C), 63.3 (d, JC,P ¼ 5.8, 2C, OeCH2eCH3), 66.3 (d,
(400.13 MHz, DMSO-d6): d 1.17e1.21 (m, 6H, OeCH2eCH3),
3
2JC,P ¼ 5.4, C-50), 80.8 (C-30), 83.3 (C-20), 84.8 (d, JC,P ¼ 7.7, C-40),
3.94e4.03 (m, 4H, OeCH2eCH3), 4.15e4.34 (m, 4H, H-30, H-40, H-
89.5 (C-10), 113.5 ((CH3)2C), 115.5 (2C, C-3 Arom., C-5 Arom.), 126.1
(C-1 Arom.), 129.9 (2C, C-2. Arom, C-6 Arom.), 131.3 (C-5), 144.3 (C-
8), 151.2 (C-4), 151.9 (C-2), 153.3 (C-6), 160.5 (C-4 Arom.); 31P NMR
50), 4.75 (q, J ¼ 5.1, 1H, H-20), 5.46 (d, J3 ,OH ¼ 5.5, 1H, OH-30), 5.69 (d,
0
J2 ,OH ¼ 5.1, 1H, OH-20), 6.15 (d, J1 ,2 ¼ 4.9, 1H, H-10), 7.85 (t, J ¼ 7.8,
1H, H-5 Arom.), 8.06 (dt, J ¼ 1.5, J4 Arom., 5 Arom. ¼ 7.6, 1H, H-4 Arom.),
8.92 (s, 1H, H-8), 9.08e9.10 (m, 2H, H-2, H-6 Arom.), 9.18 (t, J ¼ 1.39,
0
0
0
(161.62 MHz, DMSO-d6):
d
ꢁ0.11; HRMS (ESI-TOF): m/z calcd for
[C23H29N4O8P þ H]þ 521.1801, found 521.1800.
1H, H-2 Arom.); 13C NMR (100.62 MHz, DMSO-d6):
d
15.8 (d,
2
3JC,P ¼ 6.4, 2C, OeCH2eCH3), 63.4 (d, JC,P ¼ 5.6, 2C, OeCH2eCH3),
66.5 (d, 2JC,P ¼ 5.8, C-50), 69.9 (C-30), 73.1 (C-20), 82.6 (d, 3JC,P ¼ 7.4, C-
40), 88.0 (C-10), 112.0 (C-3 Arom.), 118.5 (CN), 119.5 (C-5 Arom.),
130.2 (C-5), 131.0 (C-6), 132.6 (C-2 Arom.), 133.5 (C-6 Arom.), 134.4
(C-4 Arom.), 136.3 (C-1 Arom.), 145.7 (C-8), 150.5 (C-2), 152.0 (C-4),
4.2.14. 6-(4-Anilino-4-oxobutanoic acid)-9-(5-O-diethylphosphate-
2,3-O-isopropylidene-b-D-ribofuranosyl)-9H-purine (4k)
Synthesized from compound 3 (200 mg, 0.43 mmol) and N-(4-
phenylboronic)succinamic acid (152 mg, 0.65 mmol) according to
the General Procedure Method D. When the reaction was complete,
the reaction mixture was acidified to pH 2 with 1 M HCl, then
extracted with CH2Cl2 (3 times). Purification by flash column
chromatography (30 g SiO2, CH2Cl2/MeOH: 96/4 to 90/10/0.5%
AcOH) afforded 4k as an orange powder (130 mg, 49%) together
with the starting material 3 (40 mg, 20%). 1H NMR (400.13 MHz,
152.4 (C-6); 31P NMR (161.62 MHz, DMSO-d6):
d 0.12; HRMS (ESI-
TOF): m/z calcd for [C21H24N5O7P þ H]þ 490.1492, found 490.1492.
4.2.17. 6-(3-Cyanophenoxy)-9-(5-O-diethylphosphate-b-D-
ribofuranosyl)-9H-purine (6c)
Starting from 4c (104 mg, 0.19 mmol), 6c (67 mg, 70%) was
obtained as a white solid after purification by flash column chro-
matography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 97/3). 1H NMR
CD3OD):
d
1.26 (2td, 4JH,P ¼ 1.0, J ¼ 7.1, 2 ꢂ 3H, OeCH2eCH3), 1.48 (s,
3H, (CH3)2C), 1.69 (s, 3H, (CH3)2C), 2.73e2.80 (m, 4H, NHCO-
(CH2)2eCOOH), 4.01e4.08 (m, 4H, OeCH2eCH3), 4.26e4.36 (m, 2H,
(400.13 MHz, DMSO-d6):
d 1.19e1.23 (m, 6H, OeCH2eCH3),
H-50), 4.54e4.58 (m,1H, H-40), 5.26 (dd, J3 ,4 ¼ 3.2, J2 ,3 ¼ 6.3,1H, H-
3.96e4.06 (m, 4H, OeCH2eCH3), 4.13e4.20 (m, 2H, H-50),
4.22e4.25 (m, 1H, H-40), 4.27e4.30 (m, 1H, H-30), 4.69 (q, J ¼ 5.2, 1H,
0
0
0
0
30), 5.65 (dd, J1 ,2 ¼ 2.2, J2 ,3 ¼ 6.3, 1H, H-20), 6.43 (d, J1 ,2 ¼ 2.1, 1H,
H-10), 7.80e7.85 (m, 2H, H-3 Arom., H-5 Arom.), 8.63 (s, 1H, H-8),
8.73e8.76 (m, 2H, H-2 Arom., H-6. Arom.), 8.98 (s, 1H, H-2); 13C
0
0
0
0
0
0
H-20), 5.44 (d, J3 ,OH ¼ 5.4,1H, OH-30), 5.65 (d, J2 ,OH ¼ 5.2,1H, OH-20),
0
0
6.09 (d, J1 ,2 ¼ 5.2, 1H, H-10), 7.69e7.72 (m, 2H, H-4 Arom., H-5
Arom.), 7.79e7.81 (m,1H, H-6 Arom.), 7.91e7.93 (m,1H, H-2 Arom.),
8.53 (s, 1H, H-2), 8.72 (s, 1H, H-8); 13C NMR (100.62 MHz, DMSO-
0
0
NMR (100.62 MHz, CD3OD):
25.7 ((CH3)2C), 27.7 ((CH3)2C), 30.6 (NHCOeCH2), 32.8
d
16.3 (d, 3JC,P ¼ 6.4, 2C, OeCH2eCH3),
2
3
2
(CH2eCOOH), 65.8 (d, JC,P ¼ 5.9, 2C, OeCH2eCH3), 68.3 (d,
d6):
d
15.8 (d, JC,P ¼ 6.4, 2C, OeCH2eCH3), 63.4 (d, JC,P ¼ 3.1,
2JC,P ¼ 5.7, C-50), 83.0 (C-30), 85.4 (C-20), 87.0 (d, 3JC,P ¼ 7.9, C-40), 92.3
(C-10), 115.9 ((CH3)2C), 120.6 (2C, C-3 Arom., C-5 Arom.), 129.9 (C-1
Arom.), 131.8 (2C, C-2 Arom., C-6 Arom.), 132.3 (C-5), 140.1 (C-4
Arom.), 146.2 (C-8), 153.0 (C-2), 153.5 (C-4), 155.8 (C-6), 173.5
OeCH2eCH3), 66.6 (2JC,P ¼ 5.4, C-50), 69.9 (C-30), 73.1 (C-20), 82.6 (d,
3JC,P ¼ 7.5, C-40), 88.1 (C-10), 112.4 (C-3 Arom.), 117.9 (CN), 121.3 (C-
5), 125.7 (C-2 Arom.), 127.4 (C-4 Arom.), 129.7 (C-6 Arom.), 131.1 (C-
5 Arom.), 143.7 (C-8), 151.5 (C-2), 152.4 (C-1 Arom.), 153.1 (C-4),
(COOH), 177.2 (NHCO); 31P NMR (161.62 MHz, CD3OD):
d
ꢁ0.36;
158.9 (C-6); 31P NMR (161.62 MHz, DMSO-d6):
d 0.12; HRMS (ESI-
HRMS (ESI-TOF): m/z calcd for [C27H34N5O10P þ H]þ 620.2122,
TOF): m/z calcd for [C21H24N5O8P þ H]þ 506.1441, found 506.1425.
found 620.2047.
4.2.18. 6-(3-Biphenyl)-9-(5-O-diethylphosphate-b-D-
4.2.15. 6-(2-Naphthyl)-9-(5-O-diethylphosphate-
b
-D
-
ribofuranosyl)-9H-purine (6d)
ribofuranosyl)-9H-purine (6a)
Starting from 4d (85 mg, 0.15 mmol), 6d (70 mg, 89%) was
obtained as a pale yellow oil after purification by flash column
Starting from 4a (65 mg, 0.12 mmol), 6a (54 mg, 90%) was
obtained as a white powder after purification by flash column
chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 96/4). 1H
chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 97/3). 1H
4
NMR (400.13 MHz, DMSO-d6):
d
1.20 (td, JH,P ¼ 0.9, J ¼ 7.1, 6H,
NMR (400.13 MHz, DMSO-d6):
d
1.19e1.22 (m, 6H, OeCH2eCH3),
OeCH2eCH3), 3.95e4.03 (m, 4H, OeCH2eCH3), 4.17e4.23 (m, 2H,
H-40, H-50), 4.26e4.35 (m, 2H, H-30, H-500), 4.76 (q, 1H, J ¼ 5.0, H-
3.97e4.04 (m, 4H, OeCH2eCH3), 4.18e4.21 (m, 2H, H-50),
4.23e4.30 (m, 1H, H-40), 4.33e4.37 (m, 1H, H-30), 4.78 (q, J ¼ 5.2,
20), 5.46 (d, 1H, J3 ,OH ¼ 5.3, OH-30), 5.70 (d, 1H, J2 ,OH ¼ 5.5, OH-20),
0
0
1H, H-20), 5.47 (d, J3 ,OH ¼ 5.5, 1H, OH-30), 5.71 (d, J ¼ 5.6, 1H, OH-
6.17 (d, 1H, J1 ,2 ¼ 4.8, H-10), 7.41e7.45 (m, 1H, H-40 Arom.),
7.51e7.55 (m, 2H, H-30 Arom., H-50 Arom.), 7.69e7.77 (m, 3H, H-5
Arom., H-20 Arom., H-60 Arom.), 7.87e7.89 (m, 1H, H-6 Arom.),
8.80 (dt, 1H, J ¼ 1.4, J4 Arom., 5 Arom. ¼ 7.8, H-4 Arom.), 8.88 (s, 1H, H-
0
0
0
20), 6.17 (d, J1 ,2 ¼ 4.9, 1H, H-10), 7.60e7.67 (m, 2H, H-6 Arom., H-7
Arom.), 8.02 (dd, J6 Arom.,8 Arom. ¼ 1.4, J7 Arom.,8 Arom. ¼ 7.5, 1H, H-8
Arom.), 8.12e8.15 (m, 2H, H-4 Arom., H-5 Arom.), 8.90 (s, 1H, H-8),
8.92 (dd, J1 Arom., 3 Arom ¼ 1.6, J3 Arom., 4 Arom. ¼ 8.8, 1H, H-3 Arom.),
0
0
8), 9.06 (s, 1H, H-2), 9.16 (t, 1H, J ¼ 1.8, H-2 Arom.); 13C NMR
9.08 (s, 1H, H-2), 9.50 (bs, 1H, H-1 Arom.); 13C NMR (100.62 MHz,
(100.62 MHz, DMSO-d6):
d
15.8 (d, JC,P ¼ 6.5, 2C, OeCH2eCH3),
3
3
DMSO-d6):
d
15.8 (d, JC,P ¼ 6.0, 2C, OeCH2eCH3), 63.3 (d,
63.3 (d, 2JC,P ¼ 4.0, OeCH2eCH3), 63.4 (d, 2JC,P ¼ 4.1, OeCH2eCH3),
66.5 (d, 2JC,P ¼ 5.6, C-50), 69.9 (C-30), 73.1 (C-20), 82.6 (d, 3JC,P ¼ 7.5,
C-40), 88.0 (C-10), 126.7 (2C, C-20 Arom., C-60 Arom.), 127.7 (2C, C-2
Arom., C-40 Arom.), 128.2 (C-4 Arom.), 128.3 (2C, C-30 Arom., C-50
Arom.), 129.1 (C-5 Arom.), 129.4 (C-6 Arom.), 131.0 (C-5), 135.8 (C-
3 Arom.), 139.8 (C-10 Arom.), 140.6 (C-1 Arom.), 145.0 (C-8), 152.0
(C-2), 152.2 (C-4), 152.8 (C-6); 31P NMR (161.62 MHz, DMSO-d6):
2JC,P ¼ 5.3, 2C, OeCH2eCH3), 66.6 (d, JC,P ¼ 5.6, C-50), 69.9 (C-30),
73.0 (C-20), 82.6 (d, 3JC,P ¼ 7.5, C-40), 88.0 (C-10), 125.6 (C-3 Arom.),
126.7 (2C, C-6 Arom., C-7 Arom.), 127.8 (C-8 Arom.), 128.2 (C-5
Arom.), 129.2 (C-4 Arom.), 130.2 (C-1 Arom.), 131.1 (C-8a Arom.),
132.6 (C-5), 132.7 (C-4a Arom.), 134.1 (C-2 Arom.), 145.0 (C-8),
152.0 (C-2), 152.2 (C-4), 152.9 (C-6); 31P NMR (161.62 MHz, DMSO-
2
d6):
d
0.13; HRMS (ESI-TOF): m/z calcd for [C24H27N4O7P þ H]þ
d
0.12; HRMS (ESI-TOF): m/z calcd for [C26H29N4O7P þ H]þ
515.1696, found 515.1694.
541.1852, found 541.1804.

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
429
4.2.19. 6-Phenyl-9-(5-O-diethylphosphate-
purine (6e)
Starting from 4e (149 mg, 0.30 mmol), 6e (122 mg, 89%) was
obtained as a yellow oil after purification by flash column chro-
matography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 94/6). 1H NMR
b
-
D
-ribofuranosyl)-9H-
chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 96/4). 1H NMR
4
(400.13 MHz, DMSO-d6):
d
1.19 (td, JH,P ¼ 0.9, J ¼ 7.1, 6H,
OeCH2eCH3), 3.95e4.03 (m, 4H, OeCH2eCH3), 4.16e4.21 (m, 2H,
H-40, H-50), 4.22e4.28 (m, 1H, H-500), 4.31 (q, J ¼ 4.9, 1H, H-30), 4.74
(q, J ¼ 4.9, 1H, H-20), 5.46 (d, J3 ,OH ¼ 5.4, 1H, OH-30), 5.70 (d,
0
J2 ,OH ¼ 5.4, 1H, OH-20), 6.15 (d, J1 ,2 ¼ 4.7, 1H, H-10), 7.92 (t, J ¼ 8.0,
1H, H-5 Arom.), 8.44 (ddd, J4 Arom., 6 Arom ¼ 1.1, J2 Arom., 4 Arom. ¼ 2.4,
J4 Arom., 5 Arom. ¼ 8.3, 1H, H-4 Arom.), 8.95 (s, 1H, H-8), 9.09 (s, 1H, H-
2), 9.23 (dt, J ¼ 1.3, J5 Arom., 6 Arom. ¼ 7.9, 1H, H-6 Arom.), 9.68 (t,
0
0
0
(400.13 MHz, DMSO-d6):
d
1.19 (t, J ¼ 7.1, 6H, OeCH2eCH3),
3.94e4.02 (m, 4H, OeCH2eCH3), 4.16e4.22 (m, 2H, H-50),
4.25e4.33 (m, 2H, H-30, H-40), 4.75 (q, J ¼ 5.2, 1H, H-20), 5.45 (d,
J3 ,OH ¼ 5.4, 1H, OH-30), 5.68 (d, J2 ,OH ¼ 5.6, 1H, OH-20), 6.14 (d,
0
0
J1 ,2 ¼ 4.9, 1H, H-10), 7.56e7.64 (m, 3H, H-3 Arom., H-4 Arom., H-5
J ¼ 2.3, 1H, H-2 Arom.); 13C NMR (100.62 MHz, DMSO-d6):
d
15.9 (d,
0
0
Arom.), 8.81e8.84 (m, 2H, H-2 Arom., H-6 Arom.), 8.87 (s, 1H, H-8),
3JC,P ¼ 6.5, 2C, OeCH2eCH3), 63.3 (d, 2JC,P ¼ 3.9, OeCH2eCH3), 63.4
9.02 (s, 1H, H-2); 13C NMR (100.62 MHz, DMSO-d6):
d
15.8 (d,
(d, JC,P ¼ 4.1, OeCH2eCH3), 66.6 (d, JC,P ¼ 5.8, C-50), 69.9 (C-30),
2
2
3JC,P ¼ 6.3, 2C, OeCH2eCH3), 63.4 (2d, 2JC,P ¼ 4.1, 2C, OeCH2eCH3),
66.6 (d, 2JC,P ¼ 5.3, C-50), 69.9 (C-30), 73.0 (C-20), 82.6 (d, 3JC,P ¼ 7.1, C-
40), 87.9 (C-10), 128.7 (C-4 Arom.), 129.4 (2C, C-2 Arom., C-6 Arom.),
130.8 (C-5), 131.1 (2C, C-3 Arom., C-5 Arom.), 135.2 (C-1 Arom.),
144.9 (C-8), 152.0 (C-4), 152.2 (C-2), 153.0 (C-6); 31P NMR
73.1 (C-20), 82.7 (d, JC,P ¼ 7.5, C-40), 88.1 (C-10), 123.7 (C-2 Arom.),
3
125.6 (C-4 Arom.), 130.5 (C-5 Arom.), 131.0 (C-5), 135.1 (C-6 Arom.),
136.7 (C-1 Arom.), 145.8 (C-8), 148.2 (C-3 Arom.), 150.2 (C-6), 152.1
(C-4), 152.5 (C-2); 31P NMR (161.62 MHz, DMSO-d6):
d 0.12; HRMS
(ESI-TOF): m/z calcd for [C20H24N5O9P þ H]þ 510.1390, found
(161.62 MHz, DMSO-d6):
d
0.11; HRMS (ESI-TOF): m/z calcd for
510.1420.
[C20H25N4O7P þ H]þ 465.1539, found 465.1561.
4.2.23. 6-(4-Carboxyphenyl)-9-(5-O-diethylphosphate-b-D-
4.2.20. 6-(3-Methoxycarbonylphenyl)-9-(5-O-diethylphosphate-
b
-
ribofuranosyl)-9H-purine (6i)
D
-ribofuranosyl)-9H-purine (6f)
Starting from 4f (200 mg, 0.36 mmol), 6f (153 mg, 83%) was
Starting from 4i (148 mg, 0.27 mmol), 6i (140 mg, 95%) was
obtained as a white powder after a purification by flash column
chromatography (30 g SiO2, CH2Cl2/MeOH: 98/2 to 88/12). 1H NMR
obtained as a white powder after a purification by flash column
chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 97/3). 1H NMR
(400.13 MHz, DMSO-d6):
d
1.18 (t, J ¼ 7.1, 6H, OeCH2eCH3),
(400.13 MHz, DMSO-d6):
d
1.19 (t, J ¼ 7.0, 6H, OeCH2eCH3), 3.94 (s,
3.94e4.02 (m, 4H, OeCH2eCH3), 4.14e4.29 (m, 3H, H-40, H-50), 4.32
(t, J ¼ 4.6, 1H, H-30), 4.75 (t, J ¼ 5.0, 1H, H-20), 6.15 (d, J1 ,2 ¼ 4.8, 1H,
H-10), 8.17 (d, J ¼ 8.3, 2H, H-3 Arom. H-5 Arom.), 8.87e8.89 (m, 3H,
H-8, H-2 Arom, H-6 Arom.), 9.05 (s,1H, H-2); 13C NMR (100.62 MHz,
0
0
3H, CO2CH3), 3.94e4.03 (m, 4H, OeCH2eCH3), 4.16e4.33 (m, 4H, H-
30, H-40, H-50), 4.75 (q, J ¼ 5.0, 1H, H-20), 5.47 (d, J3 ,OH ¼ 5.4, 1H, OH-
0
30), 5.70 (d, J2 ,OH ¼ 5.4, 1H, OH-20), 6.15 (d, J1 ,2 ¼ 4.8, 1H, H-1 ), 7.79
(t, J ¼ 7.8,1H, H-5 Arom.), 8.17 (dt, J ¼ 1.5, J4 Arom., 5 Arom. ¼ 7.8, 1H, H-
4 Arom.), 8.90 (s, 1H, H-8), 9.07 (s,1H, H-2), 9.10 (dt, J ¼ 1.5, J5 Arom., 6
0
0
0
0
DMSO-d6):
d
15.8 (d, 3JC,P ¼ 6.3, 2C, OeCH2eCH3), 63.4 (d, 2JC,P ¼ 4.3,
2
2C, OeCH2eCH3), 66.6 (d, JC,P ¼ 5.6, C-50), 69.9 (C-30), 73.1 (C-20),
¼ 8.0, 1H, H-6 Arom.), 9.45 (t, J ¼ 1.8, 1H, H-2 Arom.); 13C NMR
82.7 (d, JC,P ¼ 7.4, C-40), 88.0 (C-10), 129.1 (2C, C-2 Arom., C-6
3
Arom.
3
(100.62 MHz, DMSO-d6):
d
2
15.8 (d, JC,P ¼ 5.5, 2C, OeCH2eCH3),
Arom.), 129.4 (2C, C-3 Arom., C-5 Arom.), 131.1 (C-5), 136.1 (C-4
Arom.), 138.4 (C-1 Arom.), 145.2 (C-8), 152.0 (C-2), 152.2 (C-4), 152.4
52.3 (CO2CH3), 63.4 (d, JC,P ¼ 4.1, 2C, OeCH2eCH3), 66.5 (d,
2JC,P ¼ 5.3, C-50), 69.9 (C-30), 73.1 (C-20), 82.6 (d, 3JC,P ¼ 7.7, C-40), 88.0
(C-10), 129.4 (C-2 Arom.), 129.9 (C-5 Arom.), 130.2 (C-3 Arom.), 130.9
(C-5), 131.5 (C-4 Arom.), 133.8 (C-1 Arom.), 135.7 (C-6 Arom.), 145.4
(C-8), 151.7 (C-4), 152.0 (C-6), 152.4 (C-2), 165.9 (CO2CH3); 31P NMR
(C-6), 169.7 (COOH); 31P NMR (161.62 MHz, DMSO-d6):
d 0.09;
HRMS (ESI-TOF): m/z calcd for [C21H25N4O9P þ H]þ 509.1437, found
509.1435.
(161.62 MHz, DMSO-d6):
d
0.11; HRMS (ESI-TOF): m/z calcd for
4.2.24. 6-(4-Hydroxyphenyl)-9-(5-O-diethylphosphate-b-D-
ribofuranosyl)-9H-purine (6j)
Starting from 4j (108 mg, 0.21 mmol), 6j (89 mg, 89%) was ob-
tained as a white powder after a purification by flash column
chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 94/6). 1H NMR
[C22H27N4O9P þ H]þ 523.1594, found 523.1586.
4.2.21. 6-(4-Cyanophenyl)-9-(5-O-diethylphosphate-b-D-
ribofuranosyl)-9H-purine (6g)
Starting from 4g (164 mg, 0.31 mmol), 6g (109 mg, 72%) was
obtained as a white powder after purification by flash column
chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 96/4). 1H NMR
(400.13 MHz, DMSO-d6):
d
1.19 (t, J ¼ 7.0, 6H, OeCH2eCH3),
3.94e4.02 (m, 4H, OeCH2eCH3), 4.14e4.20 (m, 2H, H-50),
4.24e4.31 (m, 2H, H-30, H-40), 4.72 (t, J ¼ 4.9, 1H, H-20), 5.44 (bs, 1H,
OH-30), 5.66 (bs, 1H, OH-20), 6.10 (d, J1 ,2 ¼ 4.9, 1H, H-10), 6.94e6.98
(m, 2H, H-3 Arom., H-5 Arom.), 8.73e8.76 (m, 3H, H-8, H-2 Arom.,
H-6 Arom.), 8.90 (s, 1H, H-2), 10.13 (s, 1H, OH); 13C NMR
0
0
(400.13 MHz, DMSO-d6):
d
1.19 (t, J ¼ 7.0, 6H, OeCH2eCH3),
3.94e4.02 (m, 4H, OeCH2eCH3), 4.15e4.33 (m, 4H, H-30, H-40, H-
50), 4.75 (q, J ¼ 5.2, H-20), 5.46 (d, J3 ,OH ¼ 5.5, 1H, OH-30), 5.69 (d,
0
J2 ,OH ¼ 5.6, OH-20), 6.15 (d, J1 ,2 ¼ 4.9, 1H, H-10), 8.07e8.10 (m, 2H,
H-3 Arom., H-5 Arom.), 8.92 (s, 1H, H-8), 8.96e8.99 (m, 2H, H-2
Arom., H-6 Arom.), 9.09 (s, 1H, H-2); 13C NMR (100.62 MHz, DMSO-
(100.62 MHz, DMSO-d6):
d
15.8 (d, 3JC,P ¼ 6.1, 2C, OeCH2eCH3), 63.3
0
0
0
(d, 2JC,P ¼ 3.9, OeCH2eCH3), 63.4 (d, 2JC,P ¼ 4.0, OeCH2eCH3), 66.6
(d, 2JC,P ¼ 5.7, C-50), 69.9 (C-30), 73.0 (C-20), 82.5 (d, 3JC,P ¼ 7.7, C-40),
87.8 (C-10), 115.5 (2C, C-3 Arom., C-5 Arom.), 126.1 (C-1 Arom.),
129.9 (2C, C-2. Arom, C-6 Arom.), 131.3 (C-5), 144.0 (C-8), 151.8 (C-
4), 151.9 (C-2), 153.2 (C-6), 160.5 (C-4 Arom.); 31P NMR (161.62 MHz,
3
2
d6):
d
15.8 (d, JC,P ¼ 6.4, 2C, OeCH2eCH3), 63.3 (d, JC,P ¼ 4.1,
OeCH2eCH3), 63.4 (d, 2JC,P ¼ 4.2, OeCH2eCH3), 66.5 (d, 2JC,P ¼ 5.3,
3
C-50), 69.9 (C-30), 73.1 (C-20), 82.6 (d, JC,P ¼ 7.6, C-40), 88.0 (C-10),
113.2 (C-4 Arom.),118.5 (CN),129.8 (2C, C-2 Arom., C-6 Arom.),131.3
(C-5), 132.6 (2C, C-3 Arom., C-5 Arom.), 139.3 (C-1 Arom.), 145.7 (C-
8), 150.8 (C-6), 152.0 (C-4), 152.5 (C-2);31P NMR (161.62 MHz,
DMSO-d6):
d
0.09; HRMS (ESI-TOF): m/z calcd for
[C20H25N4O8P þ H]þ 481.1488, found 481.1467.
DMSO-d6):
d
0.12; HRMS (ESI-TOF): m/z calcd for
4.2.25. 6-(4-Anilino-4-oxobutanoic acid)-9-(5-O-
diethylphosphate-b-D-ribofuranosyl)-9H-purine (6k)
[C21H24N5O7P þ H]þ 490.1492, found 490.1468.
Starting from 4k (112 mg, 0.18 mmol), 6k (78 mg, 75%) was
obtained as a white powder after a purification by flash column
chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 90/10 þ 0.5%
4.2.22. 6-(3-Nitrophenyl)-9-(5-O-diethylphosphate-b-D-
ribofuranosyl)-9H-purine (6h)
Starting from 4h (152 mg, 0.28 mmol), 6h (128 mg, 91%) was
obtained as a white powder after purification by flash column
AcOH). 1H NMR (400.13 MHz, CD3OD):
OeCH2eCH3), 2.62e2.73 (m, 4H, NHCO-(CH2)2eCOOH), 4.04e4.12
d
1.27 (t, J ¼ 7.1, 6H,

430
C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
(m, 4H, OeCH2eCH3), 4.27e4.41 (m, 3H, H-40, H-50), 4.51 (t, J ¼ 5.0,
152.7 (C-6); 31P NMR (161.62 MHz, DMSO-d6):
d 1.07; HRMS (ESI-
1H, H-20), 4.82e4.85 (m, 1H, H-20), 6.19 (d, J1 ,2 ¼ 4.4, 1H, H-10),
7.74e7.78 (m, 2H, H-3 Arom., H-5 Arom.), 8.58 (s, 1H, H-8),
8.65e8.68 (m, 2H, H-2 Arom., H-6. Arom.), 8.88 (s, 1H, H-2); 13C
TOF): m/z calcd for [C20H19N4O7P þ H]þ459.1070, found 459.1038.
0
0
4.2.28. 6-(3-Cyanophenyl)-9-(b-D
-ribofuranosyl)-9H-purine 50-
monophosphate (1b)
Starting from 6b (52 mg, 0.11 mmol), 1b was obtained as a white
powder (32 mg, 63%) after HPLC purification (10e50% of CH3CN in a
20 mM TEAA). Rt ¼ 8.36 min (10e50% of CH3CN in 10 mM TEAA); 1H
NMR (100.62 MHz, CD3OD):
d
16.4 (d, 3JC,P ¼ 6.7, 2C, OeCH2eCH3),
2
32.0 (NHCOeCH2), 33.5 (CH2eCOOH), 65.7 (d, JC,P ¼ 6.2, 2C,
OeCH2eCH3), 68.1 (d, 2JC,P ¼ 5.7, C-50), 71.5 (C-30), 75.1 (C-20), 84.2
3
(d, JC,P ¼ 7.6, C-40), 90.5 (C-10), 120.4 (2C, C-3 Arom., C-5 Arom.),
131.7 (2C, C-2 Arom., C-6 Arom.), 131.8 (C-1 Arom.), 132.2 (C-5),
143.0 (C-4 Arom.), 145.4 (C-8), 153.3 (C-2), 153.4 (C-4), 155.5 (C-6),
173.7 (COOH), 175.4 (NHCO); 31P NMR (161.62 MHz, CD3OD):
NMR (400.13 MHz, DMSO-d6):
þNHe(CH2eCH3)3), 3.07 (q,
d
1.19 (t,
J
¼
7.1, 16H,
J
¼
7.1, 11H, þNHe(CH2eCH3)3),
3.91e4.00 (m, 2H, H-50), 4.14e4.15 (m, 1H, H-40), 4.28 (t, J ¼ 5.4, 1H,
H-30), 4.72 (t, 1H, J ¼ 5.4, H-2), 6.15 (d, J ¼ 5.4, 1H, H-10), 7.82 (t, 1H,
J ¼ 7.9, H-5 Arom.), 8.05 (dt, J ¼ 1.3, J ¼ 7.7, 1H, H-4 Arom.), 9.04 (s,
1H, H-8), 9.07e9.09 (m, 2H, H-2, H-6 Arom.), 9.14 (t, J ¼ 1.3, 1H, H-2
d
ꢁ0.20; HRMS (ESI-TOF): m/z calcd for [C24H30N5O10P þ H]þ
580.1808, found 580.1819.
Arom.);
13C
NMR (100.62 MHz, DMSO-d6):
d
8.5
4.2.26. 6-(3-Carboxyphenyl)-9-(5-O-diethylphosphate-b-D-
ribofuranosyl)-9H-purine (6x)
(þNHe(CH2eCH3)3), 45.5 (þNHe(CH2eCH3)3), 64.3 (d, 2JC,P ¼ 4.8, C-
50), 70.8 (C-30), 74.2 (C-20), 84.3 (d, 3JC,P ¼ 7.6, C-40), 87.3 (C-10), 111.9
(C-3 Arom.), 118.5 (CN), 130.1 (C-5 Arom.), 130.7 (C-5), 132.5 (C-2
Arom.), 133.5 (C-6 Arom.), 134.2 (C-4 Arom.), 136.3 (C-1 Arom.),
145.4 (C-8), 150.2 (C-4), 152.0 (C-2), 152.7 (C-6); 31P NMR
To a stirred solution of 4f (130 mg, 0.23 mmol) in MeOH
(0.40 mL) was added KOH (26 mg, 0.46 mmol, 2 equiv) and the
reaction mixture was warmed for 10 min at 35 ꢀC. MeOH was then
evaporated and the crude mixture was diluted in CH2Cl2. Water was
added and acidified (pH ¼ 2). The layers were separated and the
aqueous layer was then extracted three times with CH2Cl2. The
combined organic layers were dried over sodium sulfate, filtered
and concentrated to dryness to afford a crude oil. Purification by
flash column chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to
94/6 þ 0.5% AcOH) afforded 4x (90 mg) as a white powder. Removal
of isopropylidene according to the General Procedure afforded 6x
(73 mg, 63%) as a white powder after purification by flash column
chromatography (30 g SiO2, CH2Cl2/MeOH: 96/4 to 87/13 þ 0.5%
(161.62 MHz, DMSO-d6):
d 0.78; HRMS (ESI-TOF): m/z calcd for
[C17H16N5O7P þ H]þ 434.0866, found 434.0881.
4.2.29. 6-(3-Cyanophenoxy)-9-(b-D
-ribofuranosyl)-9H-purine 50-
monophosphate (1c)
Starting from 6c (58 mg, 0.11 mmol), 1c was obtained as a white
powder (29 mg, 54%) after HPLC purification (10e50% of CH3CN in
20 mM TEAA). Rt ¼ 7.49 min (10e50% of CH3CN in 10 mM TEAA); 1H
NMR (400.13 MHz, DMSO-d6):
d
1.19 (t,
J
¼
7.1, 15H,
þNHe(CH2eCH3)3), 3.08 (q,
J
¼
7.1, 10H, þNHe(CH2eCH3)3),
AcOH). 1H NMR (400.13 MHz, DMSO-d6):
d
1.16 (t, J ¼ 7.1, 6H,
3.93e4.02 (m, 2H, H-50), 4.14 (q, J ¼ 3.4, 1H, H-40), 4.25 (dd,
OeCH2eCH3), 3.94e4.02 (m, 4H, OeCH2eCH3), 4.14e4.26 (m, 3H,
H-40, H-50), 4.32 (t, J ¼ 4.6, 1H, H-40), 4.75 (t, J ¼ 4.9, 1H, H-20), 6.14
J3 ,4 ¼ 3.3, J2 ,3 ¼ 5.0, 1H, H-30), 4.69 (t, J ¼ 5.0, 1H, H-20), 6.08 (d,
0
0
0
J1 ,2 ¼ 5.0, 1H, H-10), 7.69e7.71 (m, 2H, H-4 Arom., H-5 Arom.),
0
0
0
0
0
(d, J1 ,2 ¼ 4.9,1H, H-1 ), 7.66 (t, J ¼ 7.7,1H, H-5 Arom), 8.16 (d, J4 Arom.,
7.78e7.81 (m, 1H, H-6 Arom.), 7.92e7.93 (m, 1H, H-2 Arom.), 8.52 (s,
¼ 7.8, 1H, H-4 Arom.), 8.86 (s, 1H, H-8), 8.95e8.97 (m,1H, H-6
5 Arom.
1H, H-2), 8.79 (s, 1H, H-8);13C NMR (100.62 MHz, DMSO-d6):
d 8.5
Arom.), 9.04 (s, 1H, H-2) 9.42 (bs, 1H, H-2 Arom.); 13C NMR
(þNHe(CH2eCH3)3), 45.4 (þNHe(CH2eCH3)3), 64.5 (d, 2JC,P ¼ 5.4, C-
50), 70.8 (C-30), 74.0 (C-20), 84.1 (d, 3JC,P ¼ 7.5, C-40), 87.4 (C-10), 112.4
(C-3 Arom.), 118.0 (CN), 121.0 (C-5), 125.7 (C-2 Arom.), 127.4 (C-4
Arom.),129.6 (C-6 Arom.), 131.1 (C-5 Arom.),143.4 (C-8), 151.5 (C-2),
152.5 (C-1 Arom.), 153.4 (C-4), 158.8 (C-6); 31P NMR (161.62 MHz,
(100.62 MHz, DMSO-d6):
d
15.8 (d, 3JC,P ¼ 6.5, 2C, OeCH2eCH3), 63.3
(d, 2JC,P ¼ 3.4, OeCH2eCH3), 63.4 (d, 2JC,P ¼ 4.4, OeCH2eCH3), 66.7
(d, 2JC,P ¼ 5.4, C-50), 69.9 (C-30), 73.1 (C-20), 82.6 (d, 3JC,P ¼ 7.4, C-40),
88.0 (C-10), 128.4 (C-2 Arom.), 130.3 (C-5 Arom.), 130.9 (C-3 Arom.),
131.8 (C-5), 132.0 (C-4 Arom.), 132.1 (C-1 Arom.), 135.0 (C-6 Arom.),
145.0 (C-8), 152.0 (C-4), 152.3 (C-2), 152.8 (C-6), 168.5 (COOH); 31P
DMSO-d6):
d
0.89; HRMS (ESI-TOF): m/z calcd for
[C17H16N5O8P þ H]þ 450.0815, found 450.0807.
NMR (161.62 MHz, DMSO-d6): d 0.09; HRMS (ESI-TOF): m/z calcd for
[C21H25N4O9P þ H]þ 509.1437, found 509.1420.
4.2.30. 6-(3-Biphenyl)-9-(b-D
-ribofuranosyl)-9H-purine 50-
monophosphate (1d)
4.2.27. 6-(2-Naphthyl)-9-(
monophosphate (1a)
b
-
D
-ribofuranosyl)-9H-purine 50-
Starting from 6d (28 mg, 0.05 mmol),1d was obtained as a white
powder (13 mg, 50%) after HPLC purification (10%e50% of CH3CN in
20 mM TEAA). Rt ¼ 12.07 min (10e50% of CH3CN in 10 mM TEAA);
Starting from 6a (45 mg, 0.09 mmol), 1a was obtained as a white
powder (28 mg, 63%) after HPLC purification (10e50% of CH3CN in
20 mM TEAA). Rt ¼ 12.32 min (10e50% of CH3CN in 10 mM TEAA);
1H NMR (400.13 MHz, DMSO-d6):
d
1.16 (t,
J
¼
6.8, 10H,
þNHe(CH2eCH3)3), 3.06 (q,
J
¼
6.8, 7H, þNH-(CH2eCH3)3),
1H NMR (400.13 MHz, DMSO-d6):
d
1.15 (t,
J
¼
7.1, 9H,
3.97e4.09 (m, 2H, H-50), 4.15 (bs, 1H, H-40), 4.26 (bs, 1H, H-30), 4.71
þNHe(CH2eCH3)3), 2.97 (q,
J
¼
7.1, 6H, þNH-(CH2eCH3)3),
(t, J ¼ 5.9, 1H, H-20), 6.15 (d, J1 ,2 ¼ 5.9, 1H, H-10), 7.41e7.44 (m, 1H,
H-40 Arom.), 7.54 (t, J ¼ 7.8, 2H, H-30 Arom., H-50 Arom.), 7.70 (t, J4
0
0
3.93e3.96 (m, 2H, H-50), 4.14e4.16 (m, 1H, H-40), 4.30e4.32 (m, 1H,
H-30), 4.81 (t, J ¼ 5.3, 1H, H-20), 6.17 (d, J1 ,2 ¼ 5.3, 1H, H-10),
¼ 7.8, 1H, H-5 Arom.), 7.75 (d, J ¼ 7.3, 2H, H-20 Arom., H-
0
0
Arom., 5 Arom.
7.57e7.65 (m, 2H, H-6 Arom., H-7 Arom.), 8.00 (dd, J6
60 Arom.), 7.86 (d, J5 Arom., 6 Arom. ¼ 7.8, 1H, H-6 Arom.), 8.81 (d, J4
Arom.,8
¼1.4, J7 Arom.,8 Arom. ¼ 7.5,1H, H-8 Arom.), 8.10 (d, J ¼ 8.9,1H, H-
¼ 7.7, 1H, H-4 Arom.), 8.93 (s, 1H, H-8), 9.04 (s, 1H, H-2),
Arom.
Arom., 5 Arom.
4 Arom.), 8.14 (d, J ¼ 7.9, 1H, H-5 Arom.) 8.89 (dd, J1
9.12 (bs, 1H, H-2 Arom.); 13C NMR (100.62 MHz, DMSO-d6):
d 8.5
Arom.,
3
¼1.7, J3 Arom., 4 Arom. ¼ 8.7,1H, H-3 Arom.), 9.03 (s,1H, H-2), 9.10
(þNHe(CH2eCH3)3), 45.5 (þNH-(CH2eCH3)3), 64.9 (d, J ¼ 4.9, C-50),
70.7 (C-30), 74.0 (C-20), 84.8 (d, J ¼ 8.0, C-40), 87.3 (C-10),126.8 (2C, C-
20 Arom., C-60 Arom.), 127.6 (C-40 Arom.), 127.7 (C-2 Arom.), 128.4
(C-4 Arom.), 129.1 (2C, C-30 Arom., C-50 Arom.), 129.4 (2C, C-5
Arom., C-6 Arom.), 130.8 (C-5), 135.9 (C-3 Arom.), 139.9 (C-10
Arom.), 140.6 (C-1 Arom.), 144.7 (C-8), 152.0 (C-2), 152.5 (C-4), 152.7
Arom.
(s, 1H, H-8), 9.49 (bs,1H, H-1 Arom.); 13C NMR (100.62 MHz, DMSO-
d6):
d
8.6 (þNHe(CH2eCH3)3), 45.2 (þNH-(CH2eCH3)3), 64.1 (d,
2JC,P ¼ 5.2, C-50), 71.2 (C-30), 74.4 (C-20), 84.7 (d, 3JC,P ¼ 7.1, C-40), 87.0
(C-10), 125.6 (C-3 Arom.), 126.7 (C-6 Arom. or C-7 Arom.), 127.6 (C-6
Arom. or C-7 Arom.), 127.8 (C-8 Arom.), 128.1 (C-5 Arom.), 129.2 (C-
4 Arom.), 130.2 (C-1 Arom.), 130.7 (C-8a Arom.), 132.7 (C-5), 132.8
(C-4a Arom.), 134.1 (C-2 Arom.), 144.9 (C-8), 152.0 (C-2), 152.6 (C-4),
(C-6); 31P NMR (161.62 MHz, DMSO-d6):
d 0.49; HRMS (ESI-TOF): m/
z calcd for [C22H21N4O7P þ H]þ 485.1226, found 485.1190.

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
431
4.2.31. 6-Phenyl-9-(
monophosphate (1e)
b
-
D
-ribofuranosyl)-9H-purine 50-
73.0 (C-30), 77.2 (C-20), 86.8 (d, 3JC,P ¼ 8.8, C-40), 90.2 (C-10), 126.2 (C-
2 Arom.), 128.3 (C-4 Arom.), 132.6 (C-5 Arom.), 132.8 (C-5), 137.5 (C-
6 Arom.), 137.7 (C-1 Arom.), 147.6 (C-8), 150.1 (C-3 Arom.), 154.0 (C-
Starting from 6e (98 mg, 0.21 mmol), 1e was obtained as a white
powder (44 mg, 47%) after HPLC purification (10e40% of CH3CN in
20 mM TEAA). Rt ¼ 10.06 min (10e40% of CH3CN in 10 mM TEAA);
6), 154.3 (C-4), 154.4 (C-2); 31P NMR (161.62 MHz, D2O):
d 2.35;
HRMS (ESI-TOF): m/z calcd for [C16H16N5O9P þ H]þ 454.0764, found
1H NMR (400.13 MHz, DMSO-d6):
d
3.85e3.95 (m, 2H, H-50), 4.14
454.0722.
(bs, 1H, H-40), 4.35 (bs, 1H, H-30), 4.85 (t, J ¼ 5.4, 1H, H-20), 6.14 (d,
J1 ,2 ¼ 6.1, 1H, H-10), 7.56e7.59 (m, 3H, H-3 Arom., H-4 Arom., H-5
Arom.), 8.80e8.82 (m, 2H, H-2 Arom., H-6 Arom.), 8.97 (s, 1H, H-2),
4.2.35. 6-(4-Carboxyphenyl)-9-(
b-D
-ribofuranosyl)-9H-purine 50-
0
0
monophosphate (1i)
9.06 (s, 1H, H-8); 13C NMR (100.62 MHz, DMSO-d6):
d
63.9 (d,
Starting from 6i (90 mg, 0.18 mmol), 1i was obtained as a white
powder (35 mg, 44%) after HPLC purification (0e15% of CH3CN in
20 mM TEAA). Rt ¼ 14.47 min (0e15% of CH3CN in 10 mM TEAA); 1H
2JC,P ¼ 4.9, C-50), 71.4 (C-30), 74.3 (C-20), 85.0 (d, 3JC,P ¼ 6.2, C-40), 86.8
(C-10), 128.6 (C-4 Arom.), 129.3 (2C, C-2 Arom., C-6 Arom.), 130.4 (C-
5), 130.9 (2C, C-3 Arom., C-5 Arom.), 135.3 (C-1 Arom.), 144.9 (C-8),
151.9 (C-2), 152.7 (2C, C-4, C-6); 31P NMR (161.62 MHz, DMSO-d6):
NMR (400.13 MHz, DMSO-d6):
d
3.84e3.93 (m, 2H, H-50), 4.12 (bs,
1H, H-40), 4.26e4.47 (m, 1H, H-30), 4.84 (t, J ¼ 5.5, 1H, H-20), 6.14 (d,
2.27; HRMS (ESI-TOF): m/z calcd for [C16H17N4O7P þ H]þ
J1 ,2 ¼ 6.1, 1H, H-1 ), 8.06 (d, J ¼ 8.0, 2H, H-3 Arom., H-5 Arom.), 8.78
(d, J ¼ 8.0, 2H, H-2 Arom., H-6 Arom.), 8.98 (s, 1H, H-8), 9.08 (s, 1H,
0
0
0
d
409.0913, found 409.0906.
H-2); 13C NMR (100.62 MHz, DMSO-d6):
d
64.0 (d, 2JC,P ¼ 4.7, C-50),
3
4.2.32. 6-(3-Methoxycarbonylphenyl)-9-(
purine 50-monophosphate (1f)
b
-D-ribofuranosyl)-9H-
71.5 (C-30), 74.4 (C-20), 85.1 (d, JC,P ¼ 7.3, C-40), 86.8 (C-10), 128.6
(2C, C-2 Arom., C-6 Arom.), 129.1 (2C, C-3 Arom., C-5 Arom.), 130.5
(C-5), 135.9 (C-4 Arom.), 141.9 (C-1 Arom.), 144.8 (C-8), 151.9 (C-2),
152.7 (2C, C-4, C-6), 169.1 (COO); 31P NMR (161.62 MHz, DMSO-d6):
Starting from 6f (105 mg, 0.20 mmol),1f was obtained as a white
powder (68 mg, 67%) after HPLC purification (10e50% of CH3CN in
20 mM of TEAA). Rt ¼ 9.60 min (10e50% of CH3CN in 10 mM TEAA);
d
1.92; HRMS (ESI-TOF): m/z calcd for [C17H17N4O9P þ H]þ 453.0811,
1H NMR (400.13 MHz, D2O):
d
4.04 (s, 3H, CO2CH3), 4.18e4.32 (m,
found 453.0871.
2H, H-50), 4.21e4.30 (m,1H, H-40), 4.62 (dd, J3 ,4 ¼ 4.0, J2 ,3 ¼ 5.1,1H,
0
0
0
0
H-30), 4.88 (t, J ¼ 5.2, 1H, H-20), 6.32 (d, J1 ,2 ¼ 5.3, 1H, H-10), 7.66 (t,
J ¼ 7.8, 1H, H-5 Arom.), 8.09 (dt, J ¼ 1.3, J5 Arom., 6 Arom. ¼ 7.9, 1H, H-6
Arom.), 8.43 (d, J4 Arom., 5 Arom. ¼ 7.8, 1H, H-4 Arom.), 8.74 (t, J ¼ 1.7,
4.2.36. 6-(4-Hydroxyphenyl)-9-(
b-D
-ribofuranosyl)-9H-purine 50-
0
0
monophosphate (1j)
Starting from 6j (90 mg, 0.18 mmol), 1j was obtained as a yellow
powder (45 mg, 59%) after HPLC purification (10e30% of CH3CN in
20 mM TEAA). Rt ¼ 6.09 min (10e30% of CH3CN in 10 mM TEAA); 1H
1H, H-2 Arom.), 8.85 (s, 1H, H-8), 8.90 (s, 1H, H-2); 13C NMR
2
(100.62 MHz, D2O):
d
55.3(CO2CH3), 66.9 (d, JC,P ¼ 4.8, C-50), 72.9
3
(C-30), 77.2 (C-20), 86.3 (d, JC,P ¼ 8.6, C-40), 90.2 (C-10), 131.1 (C-2
Arom.), 131.3 (C-5 Arom.), 132.1 (C-3 Arom.), 132.2 (2C, C-4 Arom.,
C-5), 133.9 (C-1 Arom.), 135.9 (C-6 Arom), 146.6 (C-8), 153.7 (C-6),
153.9 (C-2), 154.7 (C-4), 170.1 (CO2CH3); 31P NMR (161.62 MHz,
NMR (400.13 MHz, D2O): d
4.17e4.24 (m, 2H, H-50), 4.46e4.47 (m,
1H, H-40), 4.59 (t, J ¼ 4.7, 1H, H-30), 4.71 (overlapped peak with D2O,
0
1H, H-20), 6.22 (d, J1 ,2 ¼ 5.0, 1H, H-1 ), 6.88e6.91 (d, 2H, J ¼ 8.7, H-3
0
0
Arom., H-5 Arom.), 7.96 (d, J ¼ 8.6, 2H, H-2 Arom., H-6 Arom.), 8.65
D2O):
d
1.10; HRMS (ESI-TOF): m/z calcd for [C18H19N4O9P þ H]þ
(s, 1H, H-2), 8.75 (s, 1H, H-8);13C NMR (100.62 MHz, D2O):
d 66.4 (d,
467.0968, found 467.0936.
2JC,P ¼ 4.2, C-50), 73.0 (C-30), 77.2 (C-20), 86.8 (d, 3JC,P ¼ 8.8, C-40), 90.1
(C-10), 118.1 (2C, C-3 Arom., C-5 Arom.), 128.3 (C-1 Arom.), 132.2 (C-
5), 133.9 (2C, C-2. Arom, C-6 Arom.), 146.4 (C-8), 153.7 (C-4), 154.2
(C-2), 157.1 (C-6), 161.5 (C-4 Arom.); 31P NMR (161.62 MHz, D2O):
4.2.33. 6-(4-Cyanophenyl)-9-(b-D
-ribofuranosyl)-9H-purine 50-
monophosphate (1g)
Starting from 6g (95 mg, 0.19 mmol), 1g was obtained as a white
powder (35 mg, 38%) after HPLC purification (10e40% of CH3CN in
20 mM TEAA). Rt ¼ 9.46 min (10e40% of CH3CN in 10 mM aq TEAA
d
3.51; HRMS (ESI-TOF): m/z calcd for [C16H17N4O8P þ H]þ
425.0862, found 425.0861.
buffer); 1H NMR (400.13 MHz, DMSO-d6):
d
3.84e3.94 (m, 2H, H-
4.2.37. 6-(4-Anilino-4-oxobutanoic acid)-9-(b-D-ribofuranosyl)-
9H-purine 50-monophosphate (1k)
50), 4.13 (bs, 1H, H-40), 4.34 (bs, 1H, H-30), 4.85 (t, J ¼ 5.4, 1H, H-20),
6.14 (d, J1 ,2 ¼ 6.0, 1H, H-10), 8.03 (d, J ¼ 8.1, 2H, H-3 Arom., H-5
Arom.), 8.96 (d, J ¼ 8.1, 2H, H-2 Arom., H-6 Arom.), 9.02 (s, 1H, H-2),
Starting from 6k (63 mg, 0.11 mmol), 1k was obtained as a white
powder (36 mg, 56%) after HPLC purification (0e30% of CH3CN in
20 mM TEAA). Rt ¼ 11.46 min (0e30% of CH3CN in 10 mM TEAA); 1H
0
0
9.15 (s, 1H, H-8); 13C NMR (100.62 MHz, DMSO-d6):
d 63.8 (d,
2JC,P ¼ 4.4, C-50), 71.4 (C-30), 74.5 (C-20), 85.1 (d, 3JC,P ¼ 7.0, C-40), 87.0
(C-10), 113.0 (C-4 Arom.), 118.6 (CN), 129.8 (2C, C-2 Arom., C-6
Arom.), 130.9 (C-5), 132.5 (2C, C-3 Arom., C-5 Arom.), 139.4 (C-1
Arom.), 145.7 (C-8), 150.3 (C-6), 152.0 (C-2), 153.0 (C-4); 31P NMR
NMR (400.13 MHz, D2O): d 2.66e2.79 (m, 4H, NHCO-(CH2)2eCOO),
4.19e4.29 (m, 2H, H-50), 4.44e4.47 (m, 1H, H-40), 4.58 (t, J ¼ 4.7, 1H,
H-30), 4.78 (overlapped peak with D2O, 1H, H-20), 6.22 (d, J1 ,2 ¼ 5.2,
1H, H-10), 7.53e7.57 (m, 2H, H-3 Arom., H-5 Arom.), 8.10e8.14 (m,
2H, H-2 Arom., H-6 Arom.), 8.77 (s, 1H, H-2), 8.78 (s, 1H, H-8); 13C
0
0
(161.62 MHz, DMSO-d6):
d 1.89; HRMS (ESI-TOF): m/z calcd for
[C17H16N5O7P þ H]þ 434.0866, found 434.0883.
NMR (100.62 MHz, D2O): d 34.3 (NHCOeCH2), 35.3 (CH2eCOO), 67.0
(d, 2JC,P ¼ 4.8, C-50), 72.9 (C-30), 77.2 (C-20), 86.5 (d, 3JC,P ¼ 8.7, C-40),
90.1 (C-10), 122.8 (2C, C-3 Arom., C-5 Arom.), 132.3 (2C, C-2 Arom.,
C-6 Arom.), 132.6 (C-1 Arom.), 132.9 (C-5), 142.8 (C-4 Arom.), 146.7
(C-8), 154.0 (C-6), 154.4 (C-2), 156.8 (C-4), 176.8 (NHCO), 182.7
4.2.34. 6-(3-Nitrophenyl)-9-(b-D
-ribofuranosyl)-9H-purine 50-
monophosphate (1h)
Starting from 6h (108 mg, 0.21 mmol), 1h was obtained as a
white powder (70 mg, 67%) after HPLC purification (15e50% of
CH3CN in 20 mM TEAA). Rt ¼ 8.91 min (15e50% of CH3CN in 10 mM
(COO); 31P NMR (161.62 MHz, D2O):
d 1.73; HRMS (ESI-TOF): m/z
calcd for [C20H22N5O10P þ H]þ 524.1182, found 524.1228.
TEAA); 1H NMR (400.13 MHz, D2O):
d
4.18e4.28 (m, 2H, H-50),
4.46e4.49 (m, 1H, H-40), 4.60 (t, J ¼ 4.6, 1H, H-30), 4.82 (t, J ¼ 5.2, 1H,
4.2.38. 6-(3-Carboxyphenyl)-9-(b-D
-ribofuranosyl)-9H-purine 50-
monophosphate (1x)
H-20), 6.20 (d, J1 ,2 ¼ 5.3, 1H, H-10), 7.58 (t, J ¼ 8.0, 1H, H-5 Arom.),
0
0
8.17 (ddd, J4
¼ 1.1, J2
¼ 2.4, J4
Starting from 6x (54 mg, 0.10 mmol), 1x (16 mg, 31%) was ob-
tained as a white powder after HPLC purification (0e20% of CH3CN
in 20 mM TEAA). Rt ¼ 13.66 min (0e20% of CH3CN in 10 mM TEAA);
Arom.,
6
Arom.
Arom.,
4
Arom.
Arom., 5
¼ 8.2, 1H, H-4 Arom.), 8.37 (dt, J ¼ 1.3, J5 Arom., 6 Arom. ¼ 7.9, 1H,
Arom.
H-6 Arom.), 8.69 (s, 1H, H-2), 8.72 (t, J ¼ 2.0, 1H, H-2 Arom.), 8.75 (s,
1H, H-8); 13C NMR (100.62 MHz, D2O):
d
66.9 (d, JC,P ¼ 4.8, C-50),
1H NMR (400.13 MHz, DMSO-d6): 3.92 (bs, 2H, H-50), 4.13 (bs, 1H,
d
2

432
C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
H-40), 4.35 (bs, 1H, H-30), 4.82 (bs, 1H, H-20), 6.13 (d, J1 ,2 ¼ 5.7, 1H,
H-10), 7.50 (t, J ¼ 7.8,1H, H-5 Arom.), 8.05 (d, J4 Arom., 5 Arom. ¼ 7.6,1H,
H-4 Arom.), 8.75 (bs, 1H, H-6 Arom.), 8.94 (s, 1H, H-2), 9.06 (s, 1H,
H-8), 9.42 (s, 1H, H-2 Arom.); 13C NMR (100.62 MHz, DMSO-d6):
chromatography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 90/10) afforded
5m (137 mg, 57%) as a brown powder. Rt ¼ 8.72 min (10e20% of
CH3CN in 10 mM TEAA); 1H NMR (400.13 MHz, DMSO-d6):
0
0
d
3.58e3.63 (m, 1H, H-50), 3.70e3.75 (m, 1H, H-500), 4.01 (q, J ¼ 4.9,
d
63.9 (d, 2JC,P ¼ 4.8, C-50), 71.2 (C-30), 74.5 (C-20), 84.9 (C-40), 87.0 (C-
1H, H-40), 4.22 (q, J ¼ 4.8, 1H, H-30), 4.66 (q, J ¼ 5.4, 1H, H-20), 5.09 (t,
10), 127.7 (C-5 Arom.), 130.4 (2C, C-2 Arom., C-6 Arom.), 130.7 (C-4
Arom.),131.5 (C-5),131.6 (C-3 Arom.),134.6 (C-1 Arom.),144.7 (C-8),
151.8 (C-4), 152.6 (C-2), 152.9 (C-6), 169.3 (COO); 31P NMR
J5 ,OH ¼ 5.5, 1H, OH-50), 5.23 (d, J3 ,OH ¼ 5.1, 1H, OH-30), 5.55 (d,
0
0
J2 ,OH ¼ 5.8, 1H, OH-20), 6.10 (d, J1 ,2 ¼ 5.4, 1H, H-1 ), 7.77 (d, J3 Arom., 4
0
0
0
0
¼ 3.8, 1H, H-3 Arom.), 8.02 (d, J3 Arom., 4 Arom. ¼ 3.7, 1H, H-4
Arom.
(161.62 MHz, DMSO-d6):
d
2.18; HRMS (ESI-TOF): m/z calcd for
Arom.), 8.99 (s, 1H, H-8), 9.03 (s, 1H, H-2), 9.81 (s, 1H, CHO); 13C
[C17H17N4O9P þ H]þ 453.0811, found 453.0835.
NMR (100.62 MHz, DMSO-d6): d
61.6 (C-50), 70.6 (C-30), 74.3 (C-20),
86.2 (C-40), 88.3 (C-10), 118.9 (C-4 Arom.), 124.0 (C-3 Arom.), 130.3
(C-5), 144.0 (C-6), 146.6 (C-8), 152.6 (2C, C-2, C-4), 153.3 (C-5
Arom.), 153.7 (C-2 Arom.), 179.8 (CHO); HRMS (ESI-TOF): m/z calcd
for [C15H14N4O6þH]þ 347.0992, found 347.0962.
4.3. Synthesis of target nucleotides 1le1w according to Scheme 1
route B
4.3.1. General procedures for SuzukieMiyaura cross-coupling
reactions
4.3.5. 6-(5-Chlorothienyl-2-yl)-9-(b-D-ribofuranosyl)-9H-purine
Method E. To a stirred solution of 6-chloropurine riboside (2)
(1 equiv) in H2O/CH3CN (2:1, 6 mL/mmol), Pd(OAc)2 (0.05 equiv),
TPPTS (0.15 equiv), arylboronic acid (1.25 equiv) and sodium car-
bonate (3 equiv) were added under argon atmosphere. The reaction
mixture was warmed to 100 ꢀC (or 80 ꢀC when mentioned) and
monitored by LCeMS and TLC. When the reaction was complete,
the mixture was cooled to room temperature, neutralized by
addition of 1 M aqueous HCl, and concentrated under reduce
pressure. The residue was purified by silica gel chromatography or
by preparative HPLC on a C18 reverse-phase column to yield the
title compound 5.
(5n)
Synthesized from 2 (200 mg, 0.70 mmol) and 5-chloro-2-
thiopheneboronic acid (125 mg, 0.87 mmol) according to the
General Procedure Method E. Purification by flash column chro-
matography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 95/5) afforded 5n
(152 mg, 68%) as a yellow powder. Rt ¼ 6.47 min (40e60% of CH3CN
in a 10 mM TEAA buffer); 1H NMR (400.13 MHz, DMSO-d6):
d
3.57e3.61 (m, 1H, H-50), 3.69e3.74 (m, 1H, H-500), 4.00 (q, J ¼ 3.9,
1H, H-40), 4.19e4.23 (m, 1H, H-30), 4.64 (q, J ¼ 5.3, 1H, H-20), 5.09 (t,
J5 ,OH ¼ 5.6, 1H, OH-50), 5.22 (bs, 1H, OH-30), 5.53 (d, J2 ,OH ¼ 4.1, 1H,
0
0
OH-20), 6.07 (d, J1 ,2 ¼ 5.3, 1H, H-1 ), 7.37 (d, J3 Arom., 4 Arom. ¼ 4.1, 1H,
0
0
0
H-4 Arom.), 8.45 (d, J3 Arom., 4 Arom. ¼ 4.1, 1H, H-3 Arom.), 8.88 (s, 1H,
4.3.2. General procedure for phosphorylation of nucleosides 5
To a stirred solution of nucleoside 5 (1 equiv) in triethylphos-
phate (1 mL), phosphoryl chloride (3 equiv) was added at 0 ꢀC
under argon atmosphere. The reaction mixture was stirred at 4 ꢀC
overnight (monitoring by LCeMS).
H-2), 8.93 (s, 1H, H-8); 13C NMR (100.62 MHz, DMSO-d6):
d 61.2 (C-
50), 70.2 (C-30), 73.8 (C-20), 85.7 (C-40), 87.8 (C-10), 128.6 (C-5), 129.1
(C-4 Arom.),132.2 (C-3 Arom.),134.2 (C-5 Arom.),138.6 (C-2 Arom.),
145.4 (C-8), 147.5 (C-6), 151.7 (C-4), 152.0 (C-2); HRMS (ESI-TOF): m/
z calcd for [C14H13ClN4O4S þ H]þ 369.0424, found 369.0459.
The reaction was quenched by addition of 10 mM TEAA buffer at
0
ꢀC, neutralized by addition of Et3N and diluted with water. The
4.3.6. 6-(Quinolin-8-yl)-9-(b-D-ribofuranosyl)-9H-purine (5o)
resulting solution was purified by preparative HPLC on a C18
reverse-phase column using a linear gradient of CH3CN in 20 mM
TEAA buffer and then exchanged on a Dowex ion resin to afford the
nucleoside 50-monophosphate 1 as a sodium salt. For poorly-water-
soluble compounds, no ion exchange was performed.
Synthesized from 2 (287 mg, 1.00 mmol) and quinoline-8-
boronic acid (216 mg, 1.25 mmol) according to the General Proce-
dure Method E. Purification by flash column chromatography (30 g
SiO2, CH2Cl2/MeOH: 100/0 to 94/6) afforded 5o (283 mg, 75%) as a
white powder. Rt ¼ 9.00 min (20e50% of CH3CN in 10 mM TEAA);
1H NMR (400.13 MHz, DMSO-d6):
d
3.60 (dd, J4 ,5 ¼ 4.1, J5 ,5 ¼ 12.0,
0
0
0
00
00
1H, H-50), 3.71 (dd, J4 ,5 ¼ 4.2, J5 ,5 ¼ 12.0, 1H, H-5 ), 4.02 (q, J ¼ 3.9,
0
00
0
00
4.3.3. 6-(Furan-3-yl)-9-(b-D-ribofuranosyl)-9H-purine (5l)
1H, H-40), 4.23 (dd, J3 ,4 ¼ 3.4, J2 ,3 ¼ 4.9, 1H, H-30), 4.75 (dd,
0
0
0
0
Synthesized from 2 (200 mg, 0.70 mmol) and 3-furanylboronic
acid (98 mg, 0.87 mmol) according to the General Procedure
Method E. Purification by flash column chromatography (30 g SiO2,
CH2Cl2/MeOH: 100/0 to 96/4) afforded 5l (134 mg, 60%) as a white
powder [23]. Rt ¼ 12.66 min (10e40% of CH3CN in a 10 mM TEAA
J2 ,3 ¼ 4.9, J1 ,2 ¼ 5.8, 1H, H-20), 5.09 (t, J5 ,OH ¼ 5.7, 1H, OH-50), 5.26
0
0
0
0
0
(d, J3 ,OH ¼ 4.6, 1H, OH-30), 5.57 (d, J2 ,OH ¼ 5.8, 1H, OH-20), 6.12 (d,
0
0
J1 ,2 ¼ 5.8, 1H, H-10), 7.67 (dd, J2
¼ 4.3, J3
0
0
Arom.,
3
Arom.
Arom., 4
¼ 8.3, 1H, H-3 Arom.), 7.85 (dd, J ¼ 7.1, J ¼ 8.2, 1H, H-6 Arom.),
Arom.
buffer); 1H NMR (400.13 MHz, DMSO-d6):
d
3.57e3.62 (m, 1H, H-50),
8.14e8.27 (m, 2H, H-5 Arom., H-7 Arom.), 8.62 (dd, J2
Arom.,
4
3.69e3.74 (m, 1H, H-500), 4.00 (q, J ¼ 3.9, 1H, H-40), 4.22 (td, J ¼ 3.7,
¼ 1.8, J3 Arom., 4 Arom. ¼ 8.4, 1H, H-4 Arom.), 8.80 (s, 1H, H-8),
Arom.
J3 ,OH ¼ 5.0, 1H, H-30), 4.65 (q, J ¼ 5.5, 1H, H-20), 5.10 (t, J5 ,OH ¼ 5.6,
8.78 (dd, J2 Arom., 4 Arom. ¼ 1.8, J2 Arom., 3 Arom. ¼ 4.4, 1H, H-2 Arom.),
0
0
1H, OH-50), 5.21 (d, J3 ,OH ¼ 5.0, 1H, OH-30), 5.52 (d, J2 ,OH ¼ 5.9, 1H,
9.05 (s, 1H, H-2); 13C NMR (100.62 MHz, DMSO-d6): 61.4 (C-50),
d
0
0
0
OH-20), 6.06 (d, J1 ,2 ¼ 5.5, 1H, H-1 ), 7.39 (d, J4 Arom., 5 Arom. ¼ 2.0, 1H,
H-4 Arom.),7.93 (t, J ¼ 1.7, 1H, H-5 Arom.),8.78e8.84 (m, 1H, H-2
Arom.),8.86 (s, 1H, H-8), 8.89 (s, 1H, H-2); 13C NMR (100.62 MHz,
70.5 (C-30), 73.6 (C-20), 85.9 (C-40), 87.6 (C-10), 121.7 (C-3 Arom.),
126.1 (C-6 Arom.), 127.9 (C-4a Arom.), 129.8 (C-5 Arom. or C-7
Arom.), 130.6 (C-5 Arom. or C-7 Arom.), 133.6 (C-5), 135.2 (C-8
Arom.), 136.2 (C-4 Arom.), 144.8 (C-8a Arom.), 145.7 (C-8), 150.5 (C-
2 Arom.), 150.9 (C-4), 151.7 (C-2), 157.4 (C-6); HRMS (ESI-TOF): m/z
calcd for [C19H17N5O4þH]þ 380.1359, found 380.1306.
0
0
DMSO-d6): d
61.8 (C-50), 70.8 (C-30), 74.2 (C-20), 86.2 (C-40), 88.2 (C-
10), 109.7 (C-4 Arom.), 123.4 (C-3 Arom.), 130.4 (C-5), 145.1 (C-8),
145.2 (C-5 Arom.),146.8 (C-2 Arom.), 149.3 (C-6), 151.7 (C-4), 152.6
(C-2); HRMS (ESI-TOF): m/z calcd for [C14H14N4O5þH]þ 319.1042,
found 319.1028.
4.3.7. 6-(Indol-6-yl)-9-(b-D-ribofuranosyl)-9H-purine (5p)
Synthesized from 2 (287 mg, 1.00 mmol) and indole-6-boronic
acid (200 mg, 1.25 mmol) according to the General Procedure
Method E. Purification by flash column chromatography (30 g SiO2,
CH2Cl2/MeOH: 100/0 to 90/10) afforded 5p (269 mg, 73%) as a white
powder. Rt ¼ 10.50 min (20e40% of CH3CN in a 10 mM TEAA
4.3.4. 6-(5-Formylfuran-2-yl)-9-(b-D-ribofuranosyl)-9H-purine
(5m)
Synthesized from 2 (200 mg, 0.70 mmol) and 5-formyl-2-
furanylboronic acid (122 mg, 0.87 mmol) according to the Gen-
eral Procedure Method E. Purification by flash column
buffer); 1H NMR (400.13 MHz, DMSO-d6): 3.60e3.64 (m,1H, H-50),
d

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
433
3.72e3.76 (m, 1H, H-500), 4.04 (q, J ¼ 3.8, 1H, H-40), 4.25 (td,
4.3.9.1. Compound 5s. Rt ¼ 6.58 min (40e60% of CH3CN in 10 mM
J3 ,4 ¼ 3.7, J ¼ 5.0, 1H, H-30), 4.69 (q, J ¼ 5.5, 1H, H-20), 5.17 (bs, 1H,
TEAA buffer); 1H NMR (400.13 MHz, DMSO-d6):
d 3.59e3.64 (m, 1H,
0
0
OH-50), 5.32 (bs, 1H, OH-30), 5.62 (bs, 1H, OH-20), 6.11 (d, J1 ,2 ¼ 5.5,
1H, H-10), 6.52e6.54 (m, 1H, H-3 Arom.), 7.55 (t, J ¼ 2.7, 1H, H-2
Arom.), 7.71 (d, J4 Arom., 5 Arom. ¼ 8.5, 1H, H-4 Arom.), 8.57 (dd, J5
H-50), 3.71e3.75 (m, 1H, H-500), 4.01 (q, J ¼ 3.9, 1H, H-40), 4.23 (t,
J ¼ 4.3, 1H, H-30), 4.66 (t, J ¼ 5.1, 1H, H-20), 5.10 (bs, 1H, OH-50), 5.24
0
0
(bs, 1H, OH-30), 5.55 (bs, 1H, OH-20), 6.11 (d, J1 ,2 ¼ 5.4, 1H, H-10),
7.58 (t, J ¼ 7.9, 1H, H-5 Arom.), 7.79 (ddd, J ¼ 1.0, J ¼ 2.1, J4 Arom., 5
0
0
¼ 1.5, J4 Arom., 5 Arom. ¼ 8.5, 1H, H-5 Arom.), 8.90 (s, 1H,
Arom., 7 Arom.
H-8), 8.96 (s, 1H, H-2), 9.17 (t, J ¼ 1.1, 1H, H-7 Arom.), 11.50 (bs, 1H,
¼ 8.0, 1H, H-4 Arom.), 8.83 (dt, J ¼ 1.3, J5 Arom., 6 Arom. ¼ 7.9, 1H,
Arom.
NH); 13C NMR (100.62 MHz, DMSO-d6):
d
61.3 (C-50), 70.3 (C-30),
H-6 Arom.), 8.97 (s, 1H, H-8), 9.02 (t, J ¼ 1.7, 1H, H-2 Arom.), 9.04 (s,
73.7 (C-20), 85.6 (C-40), 87.7 (C-10), 101.5 (C-3 Arom.), 114.0 (C-7
Arom.), 119.9 (2C, C-4 Arom., C-5 Arom.), 128.0 (C-6 Arom.), 128.4
(C-2 Arom.), 130.1 (C-3a Arom.), 130.4 (C-5), 135.9 (C-7a Arom.),
144.1 (C-8), 151.8 (C-2), 151.9 (C-4), 154.6 (C-6); HRMS (ESI-TOF): m/
z calcd for [C18H17N5O4þH]þ 368.1359, found 368.1328.
1, H-2); 13C NMR (100.62 MHz, DMSO-d6): 61.1 (C-50), 70.2 (C-30),
d
73.8 (C-20), 85.7 (C-40), 87.8 (C-10), 122.0 (C-5), 128.1 (C-6 Arom.),
130.9 (C-5 Arom.), 131.7 (C-2 Arom.), 133.7 (C-4 Arom.), 137.4 (C-1
Arom.), 145.4 (C-8), 151.0 (C-6), 151.9 (C-2), 152.4 (C-4); HRMS (ESI-
79
TOF): m/z calcd for [C
H
BrN4O4þH]þ 407.0355, found 407.0322.
16 15
4.3.8. 6-(5-Bromopyridin-3-yl)-9-(
b
-
D
-ribofuranosyl)-9H-purine
4.3.9.2. Compound 5t. Rt ¼ 14.74 min (40e60% of CH3CN in 10 mM
(5q) and 6-(50-bromo-3,30-bipyridin-5-yl)-9-(
9H-purine (5r)
b
-D
-ribofuranosyl)-
TEAA buffer); 1H NMR (400.13 MHz, DMSO-d6):
d 3.58e3.66 (m, 1H,
H-50), 3.68e3.76 (m, 1H, H-5000), 4.02 (q, J ¼ 3.6, 1H, H-40), 4.24 (dd,
0
0
0
0
0
Synthesized from 2 (200 mg, 0.70 mmol) and 5-bromopyridine-
3-boronic acid (175 mg, 0.87 mmol) according to the General Pro-
cedure Method E. Purification by flash column chromatography
(30 g SiO2, CH2Cl2/MeOH: 100/0 to 94/6) afforded a mixture of 5q
(110 mg, 40%) and the by-product 5r (32 mg, 9%). Compounds 5q
and 5r were further separated by preparative HPLC (20%e40% of
CH3CN in 20 mM TEAA).
J3 ,4 ¼ 3.8, J2 ,3 ¼ 5.0, 1H, H-3 ), 4.68 (q, J ¼ 4.9, 1H, H-2 ), 5.12 (t, 1H,
J5 ,OH ¼ 5.5, 1H, OH-50), 5.24 (d, J3 ,OH ¼ 5.0, 1H, OH-30), 5.55 (d,
0
0
J2 ,OH ¼ 5.7, 1H, OH-20), 6.13 (d, J1 ,2 ¼ 5.5, 1H, H-10), 7.51 (t, J ¼ 7.9,
0
0
0
1H, H-50 Arom.), 7.62e7.67 (m, 1H, H-40 Arom.), 7.74 (t, J ¼ 7.8, 1H,
0
Arom., 60 Arom.
H-5 Arom.), 7.79 (dt, J ¼ 1.3, J5
¼ 7.7, 1H, H-60 Arom.),
7.91e7.95 (m, 2H, H-20 Arom., H-4 Arom.), 8.85 (dt, J ¼ 1.3, J5 Arom., 6
¼ 7.8,1H, H-6 Arom.), 8.97 (s,1H, H-8), 9.06 (s,1H, H-2), 9.13 (t,
Arom.
J ¼ 1.8, 1H, H-2 Arom.); 13C NMR (100.62 MHz, DMSO-d6):
d 61.1 (C-
4.3.8.1. Compound 5q. Rt ¼ 11.5 min (20e40% of CH3CN in 10 mM
50), 70.2 (C-30), 73.7 (C-20), 85.6 (C-40), 87.7 (C-10), 122.5 (C-30
Arom.), 125.9 (C-60 Arom.), 127.8 (C-2 Arom.), 128.9 (C-6 Arom.),
129.3 (2C, C-4 Arom., C-20 Arom.) 129.6 (C-5 Arom.), 131.0 (C-5),
131.3, (2C, C-40 Arom., C-50 Arom.), 136.0 (C-3 Arom.), 139.1 (C-1
TEAA); 1H NMR (400.13 MHz, DMSO-d6): 3.58e3.64 (m, 1H, H-50),
d
3.70e3.76 (m, 1H, H-500), 4.02 (q, J ¼ 3.9, 1H, H-40), 4.23 (q, J ¼ 4.6,
1H, H-30), 4.66 (q, J ¼ 5.3, 1H, H-20), 5.10 (t, J5 ,OH ¼ 5.5, 1H, OH-50),
0
5.24 (d, J3 ,OH ¼ 5.1, 1H, OH-30), 5.56 (d, J2 ,OH ¼ 5.8, 1H, OH-20), 6.12
Arom.), 142.3 (C-10 Arom.), 145.2 (C-8), 152.0 (C-2), 152.3 (C-4),
0
0
79
(d, J1 ,2 ¼ 5.3, 1H, H-10), 8.91 (d, J ¼ 2.3, 1H, H-6 Arom), 9.02 (s, 1H,
152.6 (C-6); HRMS (ESI-TOF): m/z calcd for [C
483.0668, found 483.0666.
H
BrN4O4þH]þ
0
0
22 19
H-8), 9.08 (s, 1H, H-2), 9.26 (t, J ¼ 2.1, 1H, H-4 Arom), 9.88 (d, J ¼ 1.8,
1H, H-2 Arom); 13C NMR (100.62 MHz, DMSO-d6): 61.1 (C-50), 70.1
d
(C-30), 73.8 (C-20), 85.7 (C-40), 87.8 (C-10), 120.3 (C-5 Arom),131.2 (C-
5), 132.7 (C-3 Arom), 138.4 (C-4 Arom), 145.9 (C-8), 148.4 (C-2
4.3.10. 6-(Furan-3-yl)-9-(b-D
-ribofuranosyl)-9H-purine 50-
monophosphate (1l)
Arom),149.1 (C-6),152.0 (C-2 or C-6 Arom),152.1 (C-2 or C-6 Arom),
Starting from 5l (75 mg, 0.24 mmol), 1l (54 mg, 52%) was ob-
tained as a yellow powder after HPLC purification (5e20% of CH3CN
in 20 mM TEAA). Rt ¼ 15.38 min (5e20% of CH3CN in 10 mM TEAA);
79
152.3 (C-4); HRMS (ESI-TOF): m/z calcd for [C
H
15 14
BrN5O4þH]þ
408.0307, found 408.0318.
1H NMR (400.13 MHz, D2O):
d
4.17e4.27 (m, 2H, H-50), 4.46e4.49
4.3.8.2. Compound 5r. Rt ¼ 10.2 min (20e40% of CH3CN in 10 mM
(m, 1H, H-40), 4.59 (t, J ¼ 4.4, 1H, H-30), 4.84 (t, J ¼ 5.1, 1H, H-20), 6.24
TEAA buffer); 1H NMR (400.13 MHz, DMSO-d6): 3.62 (m, 1H, H-50),
d
(d, J1 ,2 ¼ 5.3, 1H, H-10), 7.04 (d, J ¼ 1.8, 1H, H-4 Arom.), 7.71 (t,
J ¼ 1.7, H-5 Arom.), 8.41 (bs, 1H, H-2 Arom.), 8.66 (s, 1H, H-2), 8.75
0
0
3.74 (m, 1H, H-500), 4.03 (q, J ¼ 3.9, 1H, H-40), 4.24 (q, J ¼ 4.3, 1H, H-
30), 4.67 (q, J ¼ 5.0, 1H, H-20), 5.11 (t, J5 ,OH ¼ 5.5, 1H, OH-50), 5.26 (d,
(s, 1H, H-8); 13C NMR (100.62 MHz, D2O):
d
66.8 (d, 2JC,P ¼ 4.7, C-50),
0
J3 ,OH ¼ 5.0, 1H, OH-30), 5.57 (d, J2 ,OH ¼ 5.7, 1H, OH-20), 6.13 (d,
73.0 (C-30), 77.1 (C-20), 86.7 (d, 3JC,P ¼ 8.1, C-40), 90.0 (C-10),111.0 (C-4
Arom.),123.8 (C-3 Arom.),131.8 (C-5),146.6 (C-8),147.2 (C-5 Arom.),
149.3 (C-2 Arom.), 152.0 (C-6), 153.3 (C-4), 154.5 (C-2); 31P NMR
0
0
J1 ,2 ¼ 5.3, 1H, H-10), 8.53 (t, J ¼ 2.0, 1H, H-40 Arom), 8.80 (d, J ¼ 2.2,
1H, H-60 Arom), 9.01 (m, 2H, H-20 Arom, H-8), 9.09 (s, 1H, H-2), 9.14
(d, J ¼ 2.3, 1H, H-2 Arom), 9.30 (t, J ¼ 2.2, 1H, H-4 Arom), 9.93 (d,
0
0
(161.62 MHz, D2O):
d 2.23; HRMS (ESI-TOF): m/z calcd for
J ¼ 2.0, 1H, H-6 Arom); 13C NMR (100.62 MHz, DMSO-d6):
d
61.1 (C-
[C14H15N4O8P þ H]þ 399.0706, found 399.0711.
50), 70.2 (C-30), 73.9 (C-20), 85.7 (C-40), 87.8 (C-10),120.7 (C-50 Arom),
131.1 (C-5), 131.2 (C-5 Arom), 131.4 (C-3 Arom), 134.3 (C-30 Arom),
134.7 (C-4 Arom), 136.9 (C-40 Arom), 145.7 (C-8), 146.4 (C-20 Arom),
149.9 (C-2 Arom, or C-6 Arom or C-60 Arom), 150.0 (C-2 Arom, or C-
6 Arom or C-60 Arom), 150.1 (C-2 Arom, or C-6 Arom or C-60 Arom),
4.3.11. 6-(5-Formylfuran-2-yl)-9-(b-D
-ribofuranosyl)-9H-purine 50-
monophosphate (1m)
Starting from 5m (88 mg, 0.25 mmol), 1m (54 mg, 52%) was
obtained as a brown powder after HPLC purification (5e20% of
CH3CN in 20 mM TEAA). Rt ¼ 13.19 min (5e20% of CH3CN in 10 mM
150.4 (C-6), 152.1 (C-2), 152.3 (C-4); HRMS (ESI-TOF): m/z calcd for
79
[C
H
BrN6O4þH]þ 485.0573, found 485.0594.
TEAA); 1H NMR (400.13 MHz, D2O): 4.18e4.27 (m, 2H, H-50),
d
20 17
4.47e4.49 (m, 1H, H-40), 4.61 (t, J ¼ 4.5, 1H, H-30), 4.87 (t, J ¼ 5.1, 1H,
H-20), 6.27 (d, J1 ,2 ¼ 5.1, 1H, H-10), 7.59 (d, J3 Arom., 4 Arom. ¼ 3.7, 1H,
H-3 Arom.), 7.65 (d, J3 Arom., 4 Arom. ¼ 3.7, 1H, H-4 Arom.), 8.80 (s, 1H,
0
0
4.3.9. 6-(3-Bromophenyl)-9-(
and 6-[3-(3-bromobiphenyl)]-9-(
Synthesized from (200 mg, 0.70 mmol) and 3-
b-D-ribofuranosyl)-9H-purine (5s)
b-D-ribofuranosyl)-9H-purine (5t)
2
H-2), 8.88 (s, 1H, H-8), 9.67 (s, 1H, CHO); 13C NMR (100.62 MHz,
2
bromophenylboronic acid (175 mg, 0.87 mmol) according to the
General Procedure Method E. Purification by flash column chro-
matography (30 g SiO2, CH2Cl2/MeOH: 100/0 to 94/6) afforded a
mixture of 5s (185 mg, 65%) and 5t (55 mg,16%). Compounds 5s and
5t were further separated by preparative HPLC (40%e60% of CH3CN
in 20 mM TEAA buffer).
D2O):
d
66.8 (d, JC,P ¼ 3.6, C-50), 73.1 (C-30), 77.2 (C-20), 86.9 (d,
3JC,P ¼ 8.7, C-40), 90.3 (C-10), 120.7 (C-3 Arom.), 127.7 (C-4 Arom.),
131.3 (C-5), 145.9 (C-6), 148.4 (C-8), 154.5 (C-2), 154.6 (C-4), 155.5
(C-2 Arom.), 155.7 (C-5 Arom.), 183.9 (CHO); 31P NMR (161.62 MHz,
D2O):
d
1.74; HRMS (ESI-TOF): m/z calcd for [C15H15N4O9P þ H]þ
427.0655, found 427.0668.

434
C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
4.3.12. 6-(5-Chlorothien-2-yl)-9-(
monophosphate (1n)
b-D
-ribofuranosyl)-9H-purine 50-
4.3.15. 6-(5-Bromopyridin-3-yl)-9-(b-D-ribofuranosyl)-9H-purine
50-monophosphate (1q)
Starting from 5n (138 mg, 0.37 mmol), 1n (104 mg, 57%) was
obtained as a yellow powder after HPLC purification (20e40% of
CH3CN in a 20 mM TEAA). Rt ¼ 10.20 min (10e40% of CH3CN in
Starting from compound 5q (82 mg, 0.20 mmol),1q (37 mg, 35%)
was obtained as a white powder after HPLC purification (15e30% of
CH3CN in 20 mM TEAA). Rt ¼ 10.9 min (10e40% of CH3CN in 10 mM
10 mM TEAA); 1H NMR (400.13 MHz, D2O):
d
4.20e4.31 (m, 2H, H-
aq TEAA buffer); 1H NMR (400.13 MHz, D2O):
d 4.14e4.24 (m, 2H, H-
50), 4.46e4.49 (m, 1H, H-40), 4.60 (t, J ¼ 4.7, 1H, H-30), 4.80 (over-
50), 4.43e4.46 (m,1H, H-40), 4.57 (dd, J3 ,4 ¼ 3.9, J2 ,3 ¼ 5.1,1H, H-3 ),
0
0
0
0
0
lapped peak with D2O, 1H, H-20), 6.19 (d, J1 ,2 ¼ 5.0, 1H, H-10), 6.78
(d, J3 Arom., 4 Arom. ¼ 4.1, 1H, H-4 Arom.), 7.55 (d, J3 Arom., 4 Arom. ¼ 4.1,
1H, H-3 Arom.), 8.44 (s, 1H, H-2), 8.68 (s, 1H, H-8); 13C NMR
4.82 (t, J ¼ 5.2, 2H, H-20), 6.23 (d, J1 ,2 ¼ 5.4, 1H, H-1 ), 8.52 (t, J ¼ 2.0,
0
0
0
0
0
1H, H-6 Arom), 8.55 (d, J ¼ 2.2, 1H, H-4 Arom), 8.76 (s,1H, H-2), 8.81
(s, 1H, H-8), 9.05 (d, J ¼ 1.9, 1H, H-2 Arom); 13C NMR (100.62 MHz,
2
(100.62 MHz, D2O):
d
66.9 (d, 2JC,P ¼ 5.3, C-50), 73.0 (C-30), 77.3 (C-
D2O):
d
66.8 (d, JC,P ¼ 5.1, C-50), 73.1 (C-30), 77.2 (C-20), 86.9 (d,
3
20), 86.5 (d, JC,P ¼ 8.3, C-40), 90.2 (C-10), 130.1 (C-5), 130.8 (C-4
Arom.), 134.7 (C-3 Arom.), 138.5 (C-2 Arom.), 138.9 (C-5 Arom.),
146.6 (C-8), 150.3 (C-6), 153.4 (C-4), 154.1 (C-2); 31P NMR
3JC,P ¼ 8.5, C-40), 90.1 (C-10),123.1 (C-5 Arom),132.9 (C-5),134.0 (C-3
Arom), 142.0 (C-6 Arom), 148.0 (C-8), 149.6 (C-2 Arom), 152.3 (C-6),
154.2 (C-4 Arom), 154.3 (C-4), 154.5 (C-2); 31P NMR (161.62 MHz,
79
(161.62 MHz, D2O):
d
1.95; HRMS (ESI-TOF): m/z calcd for
D2O):
d
2.40; HRMS (ESI-TOF): m/z calcd for [C15
H
15
BrN5O7P þ H]þ
[C14H14ClN4O7PS þ H]þ 449.0088, found 449.0056.
487.9971, found 487.9949.
4.3.16. 6-(3-Bromophenyl)-9-(b-D
-ribofuranosyl)-9H-purine 50-
monophosphate (1s)
4.3.13. 6-(Quinolin-8-yl)-9-(
b-
D
-ribofuranosyl)-9H-purine 50-
monophosphate (1o)
Starting from 5s (80 mg, 0.20 mmol), 1s (39 mg, 38%) was ob-
tained as a white powder after HPLC purification (20e30% of CH3CN
in 20 mM TEAA). Rt ¼ 12.12 min (20e30% of CH3CN in 10 mM
Starting from 5o (220 mg, 0.56 mmol), 1o (34 mg, 12%) was
obtained as a white powder after HPLC purification (15e30% of
CH3CN in 20 mM TEAA), together with starting compound 5o
(75 mg, 34%). Rt ¼ 4.33 min (15e30% of CH3CN in 10 mM TEAA); 1H
TEAA); 1H NMR (400.13 MHz, D2O):
d
4.19e4.23 (m, 2H, H-50),
4.47e4.48 (m, 1H, H-40), 4.61 (t, J ¼ 4.6, 1H, H-30), 4.86 (t, J ¼ 5.2, 1H,
NMR (400.13 MHz, DMSO-d6): d
3.99e4.04 (m, 1H, H-50), 4.08e4.14
H-20), 6.27 (d, J1 ,2 ¼ 5.3, 1H, H-10), 7.29 (t, J ¼ 7.9, 1H, H-5 Arom.),
7.53e7.55 (m, 1H, H-4 Arom.), 8.00 (dt, J ¼ 1.3, J5 Arom., 6-Arom. ¼ 8.0,
1H, H-6 Arom.), 8.13 (t, J ¼ 1.8,1H, H-2 Arom.), 8.79 (s,1H, H-2), 8.84
0
0
(m, 1H, H-500), 4.16 (q, J ¼ 4.0, 1H, H-40), 4.25 (dd, J3 ,4 ¼ 4.0,
0
0
0
0
0
0
0
0
J2 ,3 ¼ 5.5, 1H, H-3 ), 4.75 (t, J ¼ 5.5, 1H, H-2 ), 6.16 (d, J1 ,2 ¼ 5.5, 1H,
H-10), 7.58 (dd, J2 Arom., 3 Arom. ¼ 4.2, J3 Arom., 4 Arom. ¼ 8.3, 1H, H-3
Arom.), 7.79 (dd, J5 Arom., 6 Arom. ¼ 7.1, J 6 Arom., 7 Arom. ¼ 8.2, 1H, H-6
Arom.), 7.93 (dd, J ¼ 1.5, J5 Arom., 6 Arom. ¼ 7.1, 1H, H-5 Arom.), 8.19
(dd, J5 Arom., 6 Arom. ¼ 1.5, J6 Arom., 7 Arom. ¼ 8.2, 1H, H-7 Arom.), 8.49
(dd, J ¼ 1.8, J3 Arom., 4 Arom. ¼ 8.3, 1H, H-4 Arom.), 8.68 (s, 1H, H-8),
8.79 (dd, J2 Arom., 4 Arom. ¼ 1.8, J2 Arom., 3 Arom. ¼ 4.2, 1H, H-2 Arom.),
(s, 1H, H-8); 13C NMR (100.62 MHz, D2O):
d
66.7 (d, 2JC,P ¼ 4.8, C-50),
73.0 (C-30), 77.1 (C-20), 86.8 (d, 3JC,P ¼ 8.7, C-40), 90.0 (C-10), 124.5 (C-
3 Arom.), 130.4 (C-6 Arom.), 132.7 (C-5 Arom.), 132.8 (C-5), 134.2 (C-
2 Arom.), 136.5 (C-4 Arom.), 138.0 (C-1 Arom.), 147.3 (C-8), 154.2 (C-
6), 154.4 (C-2), 155.5 (C-4); 31P NMR (161.62 MHz, D2O):
d 2.90;
79
HRMS (ESI-TOF): m/z calcd for [C
found 487.0030.
H
BrN4O7P þ H]þ 487.0018,
16 16
9.06 (s, 1H, H-2); 13C NMR (100.62 MHz, DMSO-d6):
d
65.3 (d,
2JC,P ¼ 4.8, C-50), 70.6 (C-30), 73.3 (C-20), 83.5 (d, JC,P ¼ 8.0, C-40),
87.2 (C-10), 121.7 (C-3 Arom.), 126.0 (C-6 Arom.), 127.9 (C-4a Arom.),
129.8 (C-7 Arom.), 130.6 (C-5 Arom.), 133.4 (C-5), 135.1 (C-8 Arom.),
136.2 (C-4 Arom.), 144.4(C-8), 145.6 (C-8a Arom.), 150.4 (C-2
Arom.), 151.0 (C-4), 151.8 (C-2), 157.3 (C-6); 31P NMR (161.62 MHz,
3
4.3.17. 6-[3-(40-Carboxy)-biphenyl]-9-(
b-D-ribofuranosyl)-9H-
purine 50-monophosphate (1u)
Synthesized from 1s (55 mg, 0.09 mmol) and 4-
carboxyphenylboronic acid (20 mg, 0.12 mmol) according to the
General Procedure Method E. Purification by reverse-phase HPLC
(10e40% of CH3CN in 20 mM TEAA) followed by an exchange on a
sodium Dowex resin, afforded 1u (26 mg, 47%) as a white powder.
Rt ¼ 9.50 min (10e40% of CH3CN in 10 mM aq TEAA buffer); 1H
DMSO-d6):
d
0.06; HRMS (ESI-TOF): m/z calcd for
[C19H18N5O7P þ H]þ 460.1022, found 460.1024.
4.3.14. 6-(Indol-6-yl)-9-(
monophosphate (1p)
b-
D
-ribofuranosyl)-9H-purine 50-
NMR (400.13 MHz, D2O): d
4.16e4.26 (m, 2H, H-50), 4.44 (bs, 1H, H-
40), 4.55 (t, J ¼ 4.4, 1H, H-30), 4.72 (t, J ¼ 5.4, 1H, H-20), 6.14 (d,
J1 ,2 ¼ 4.9, 1H, H-10), 7.35e7.49 (m, 4H, H-20 Arom., H-5 Arom., H-6
Arom., H-60 Arom.), 7.81 (d, J ¼ 7.9, 2H, H-30 Arom., H-50 Arom.),
0
0
Starting from 5p (70 mg, 0.19 mmol) and POCl3 (53
0.57 mmol), LCeMS showed only 50% of conversion after one night
m
L,
of reaction at 4 ꢀC. POCl3 (53
m
L, 0.38 mmol) was added and the
7.96e7.99 (m, 2H, H-2 Arom., H-4 Arom.), 8.61 (s, 1H, H-2), 8.67 (s,
2
mixture was stirred for 18 h at 4 ꢀC. Compound 1p (38 mg, 41%) was
obtained as a yellow powder after HPLC purification (10e50% of
CH3CN in 20 mM TEAA). Rt ¼ 9.88 min (10e50% of CH3CN in 10 mM
1H, H-8); 13C NMR (100.62 MHz, D2O):
d
66.9 (d, JC,P ¼ 4.7, C-50),
3
73.0 (C-30), 77.1 (C-20), 86.4 (d, JC,P ¼ 8.1, C-40), 90.3 (C-10), 128.7
(2C, C-20 Arom., C-60 Arom.), 129.5 (C-2 Arom.), 131.7 (C-4 Arom.),
131.7, 131.9, 132.0 (4C, C-30 Arom., C-50 Arom., C-5 Arom., C-6
Arom.), 132.8 (C-5), 136.7 (C-1 Arom.), 137.4 (C-40 Arom.), 141.7 (C-3
Arom.),144.1 (C-10 Arom.),146.8 (C-8),153.8 (C-4), 154.2 (C-2),157.0
TEAA); 1H NMR (400.13 MHz, D2O):
d
4.07e4.19 (m, 2H, H-50),
4.32e4.35 (m, 1H, H-40), 4.41 (t, J ¼ 4.9, 1H, H-30), 4.51 (t, J ¼ 4.8, 1H,
H-20), 5.89 (d, J1 ,2 ¼ 4.5, 1H, H-1 ), 6.27 (d, J2 Arom., NH ¼ 2.9, 1H, NH),
7.18 (d, J4 Arom., 5 Arom. ¼ 8.3, 1H, H-4 Arom.), 7.26 (d, J ¼ 3.0, 1H, H-2
Arom.), 7.44 (dd, J5 Arom., 7 Arom. ¼ 1.6, J4 Arom., 5 Arom. ¼ 8.4, 1H, H-5
Arom.), 7.79 (s, 1H, H-7 Arom.), 8.24 (s, 1H, H-2), 8.45 (s, 1H, H-8).
0
0
0
(C-6), 177.3 (COO); 31P NMR (161.62 MHz, D2O):
d 2.13; HRMS (ESI-
TOF): m/z calcd for [C23H21N4O9P þ H]þ 529.1124, found 529.1132.
Peak missing : H-3 Arom; 13C NMR (100.62 MHz, DMSO-d6):
d
66.7
4.3.18. 6-[3-(6-Methoxy-2-naphtyl)phenyl]-9-(b-D-ribofuranosyl)-
9H-purine 50-monophosphate (1v)
(d, 2JC,P ¼ 4.5, C-50), 72.7 (C-30), 77.1 (C-20), 86.1 (d, 3JC,P ¼ 8.7, C-40),
90.1 (C-10), 115.7 (C-7 Arom.), 122.2 (2C, C-4 Arom., C-5 Arom.),
129.0 (C-6 Arom.),131.0 (C-2 Arom.),131.9 (C-5),132.2 (C-3a Arom.),
137.4 (C-7a Arom.), 145.4 (C-8), 152.9 (C-4), 153.5 (C-2), 157.8 (C-6).
Synthesized from 1s (32 mg, 0.07 mmol) and 6-methoxy-2-
naphtalene boronic acid (21 mg, 0.11 mmol) according to the
General Procedure Method E. Purification by reverse-phase HPLC
(20e40% of CH3CN in 20 mM TEAA), followed by an exchange on a
sodium Dowex resin, afforded 1v (28 mg, 66%) as a white powder.
Rt ¼ 14.20 min (20e40% of CH3CN in 10 mM TEAA); 1H NMR
Peak missing C-3 Arom; 31P NMR (161.62 MHz, D2O):
d 2.22; HRMS
(ESI-TOF): m/z calcd for [C18H18N5O7P þ H]þ 448.1022, found
448.1035.

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
435
(400.13 MHz, DMSO-d6):
d
3.90 (s, 3H, OeCH3), 3.92e3.95 (m, 2H,
flow rate of 0.25 mL/min and a 1e12% linear gradient of acetonitrile
in 20 mM TEAA buffer at pH 7 over 3.50 min. The retention times of
G and dGMP are 1 min and 2.8 min, respectively. The initial velocity
of the reaction was measured at a fixed concentration of dGMP and
variable concentrations of inhibitors.
H-50), 4.14e4.16 (m, 1H, H-40), 4.35 (t, J ¼ 3.8, 1H, H-30), 4.88 (t,
J ¼ 5.4, 1H, H-20), 6.17 (d, J1 ,2 ¼ 5.8, 1H, H-10), 7.21 (dd, J ¼ 2.5,
J ¼ 8.9, 1H, H-7 Arom.Naph), 7.37 (d, J ¼ 2.6, 1H, H-5 Arom.Naph), 7.71
(t, J ¼ 7.8, 1H, H-5 Arom.), 7.88 (dd, J ¼ 1.9, J ¼ 8.5, 1H, H-3
Arom.Naph), 7.95e7.97 (m, 3H, H-4 Arom.Ph, H-4 Arom.Naph, H-8
Arom.Naph), 8.23 (bs, 1H, H-1 Arom.Naph), 8.85 (d, J ¼ 7.9, 1H, H-6
Arom.Ph), 9.03 (s, 1H, H-2), 9.09 (s, 1H, H-8), 9.17 (bs, 1H, H-2
0
0
7. Crystallization and data collection
Arom.Ph); 13C NMR (100.62 MHz, DMSO-d6):
d
55.2 (OeCH3), 64.2
Crystal growth conditions for rat DNPH1 have been described
previously [20] and are briefly reported here. Crystals of liganded
DNPH1 were grown in high-salt concentrations (1.1e1.3 M LiSO4
or NH4SO4) in mild basic buffer (100 mM Tris pH 7.4e8.0) at a
protein concentration of 12 mg/mL in 50 mM citrate buffer pH 7.2.
It gave rise to diffracting crystals of rat DNPH1 in complex with
compound 1a (Synchrotron beamlines at the ESRF, Grenoble).
Identification of crystallization conditions for human DNPH1 was
carried out using the vapor diffusion method with a Mosquito (TTP
Labtech) nanolitre dispensing system. Sitting drops were set using
400 nL of 1:1 mixture of truncated human DNPH1 protein at
7.5 mg/mL in complex with compound 1a at 5 mM and a crys-
tallization solution (672 different conditions, commercially avail-
(d, 2JC,P ¼ 4.2, C-50), 71.2 (C-30), 74.3 (C-20), 84.7 (d, 3JC,P ¼ 7.2, C-40),
87.0 (C-10), 105.8 (C-5 Arom.Naph), 119.0 (C-7 Arom.Naph), 125.2 (C-1
Arom.Naph), 125.4 (C-3 Arom.Naph), 127.4, 127.6 (2C, C-Arom), 128.3
(C-6 Arom.Naph), 128.8 (C-8a Arom.Naph), 129.4, 129.5 (2C, C-Arom.),
129.8 (C-Arom.), 130.6 (C-5), 133.7 (C-4a Arom.Naph), 134.9 (C-2
Arom.Naph), 136.0 (C-1 Arom.Ph), 140.6 (C-3 Arom.Naph), 145.0 (C-8),
152.0 (C-2), 152.6 (C-4), 152.8 (C-6), 157.5 (C-6 Arom.Naph); 31P NMR
(161.62 MHz, DMSO-d6):
d 1.96; HRMS (ESI-TOF): m/z calcd for
[C27H25N4O8P þ H]þ 565.1488, found 565.1510.
4.3.19. 6-[3-(Dibenzothiophenyl)phenyl]-9-(b-D-ribofuranosyl)-9H-
purine 50-monophosphate (1w)
Synthesized from 1s (28 mg, 0.05 mmol) and 4-
dibenzothienylboronic acid (0.06 mmol, 14 mg) according to the
General Procedure Method E. Purification by preparative HPLC
(30%e50% of CH3CN in 20 mM TEAA), followed by an ion exchange
on a sodium Dowex resin, afforded 1w (16 mg, 50%) as a white
powder. Rt ¼ 12.71 min (30e50% of CH3CN in 10 mM TEAA); 1H
able), equilibrating against 150 mL reservoir in a Greiner plate. The
best crystals appeared directly in Greiner plate within one week
and had dimensions of up to 0.1 mm ꢂ 0.1 mm ꢂ 0.2 mm. The
condition of crystallization was 20% (w/v) PEG-3000, 0.1 M
TriseHCl pH 7 and 0.2 M calcium acetate at 18 ꢀC (condition F6
from commercial kit wizard II, Emerald Biosystems). The single
crystals of this complex were flash-frozen in liquid nitrogen using
NMR (400.13 MHz, DMSO-d6):
1H, H-40), 4.31 (bs, 1H, H-30), 4.81e4.84 (m, 1H, H-20), 6.15 (d,
d
3.85e3.87 (m, 2H, H-50), 4.11 (bs,
paratone-paraffin oil (50%/50%) as
a cryoprotectant. X-ray
0
0
0
J1 ,2 ¼ 6.0, 1H, H-1 ), 7.52e7.75 (m, 6H, H-Arom), 8.40e8.44 (m, 5H,
diffraction data were collected from human DNPH1 in complex
with 1a crystal on the beamline PROXIMA 1 at synchrotron SOLEIL
(St Aubin, France). Diffraction images were collected with PILATUS
detector 6 M with a rotation of 0.2ꢀ per image at a wavelength of
0.81035 Å (see Table 4).
H-Arom), 9.09 (s, 1H, H-2), 9.23 (s, 1H, H-8); 13C NMR (100.62 MHz,
DMSO-d6):
d
64.4 (C-50), 72.2 (C-30), 75.3 (C-20), 85.7 (C-40), 87.3 (C-
10), 121.1, 122.8, 125.5, 128.1, 129.1 (11CeH Arom.), 141.1 (C-8), 152.1
(C-2) Peaks missing: Cq; 31P NMR (161.62 MHz, DMSO-d6):
d 1.68;
HRMS (ESI-TOF): m/z calcd for [C28H23N4O7PS þ H]þ 591.1104,
found 591.1094.
8. Structure refinement
5. Expression and purification of recombinant rat and human
DNPH1s
The new crystal structures were solved by molecular
replacement using Molrep [38] and the recently solved structure
of rat DNPH1 (PDB4FYI [20]) as a template. The first refinement
steps of the structures of rat DNPH1 and human in complex with
1a were performed using Refmac5 with iterative model building
of the protein alone using Coot [38]. The ligand chemical struc-
tures were designed using the PRODRG server [39] and were
placed in the density. Water molecules were added automatically
using Coot and the structures of the complexes were further
refined using Phenix. Space groups and refinement statistics are
given in Table 4.
Wild type rat and human DNPH1s as well as truncated rat
DNPH1 D69N were expressed and purified as described [19]. A
truncated human DNPH1 was amplified using oligonucleotides
AGCTCATATGCGCCCGGCCCTGTACTTCTGC
and
AGCTCTCGA-
GAGGATCAGCCTCGAAGTATCGATCCAG with plasmid pET28a hu-
man dnph1 as DNA template in a standard PCR reaction. The
amplified DNA fragment was digested with NcoI and XhoI restric-
tion enzymes, gel purified and ligated to pET24a digested with the
same restriction enzymes. The ligation mixture was used to
transform strain DH5a. Plasmid with the correct DNA sequence was
9. Ligand docking in silico
used to transform strain Bli5. Expression and purification of the
truncated human DNPH1-His was as described previously [19]. The
resulting protein contains a His tag at its C terminus and is deleted
from 19 to 12 amino acids at the N and C terminus, respectively.
The new crystal structures afforded the docking of the series of
compounds described in this series using the program PLANTS [32].
The ligand 3D coordinates in mol2 format were generated from 1D
smile files using the software OpenBabel [40]. The binding site was
defined as a sphere of 14 Å diameter around the N7 atom of bound
ligand in the crystal structure (or, alternatively with a 12 Å diam-
eter sphere around the C6 atom). The docking was run into the two
crystallographically independent monomers for both the human
and rat enzymes. In absence of pharmacophoric restraint, the li-
gands bind frequently into the pocket with the purine moiety in the
syn-conformation while the phosphate is perfectly placed as in the
crystal structures. In between, the ribose ring is slightly distorted
compared to the crystal structure. However, among the ten best
poses, anti-conformation is also observed and shows a similar
6. Inhibitory potency against rat and human DNPH1s
The Ki values were determined as described previously [10,19].
Briefly, enzymatic activity of rat DNPH1 (5
mM) was measured by
incubating the enzyme with dGMP (100 M) and by following the
m
production of 2-deoxyribose 5-phosphate spectrophotometrically
[10]. The activity of human DNPH1 was determined by incubating
the enzyme (14
production of guanine (G) by RR-HPLC on a C18 reverse phase
column (ZORBAX Eclipse XDB-C18, 2.1 ꢂ 50 mm, 1.8 m) using a
mM) with dGMP (200 mM) and by following the
m

436
C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
mode of binding as that observed in the known crystal structures.
Nevertheless, in most of these cases, the ribose and the nucleobase
are shifted out (by 1 or 2 Å). To better characterize the possible
impact of each chemical substitution, we used the known binding
mode of 1a to restrain the docking searches (using default value
of ꢁ3.0 for the pharmacophoric restraint). Taking advantage of the
web server @TOME-2 [41], we resumed also the docking onto
models deduced from the various crystal structures of the rat
DNPH1 previously published [19]. This allowed us to evaluate the
impact of slight conformational changes and of the variation in the
co-crystallized ligands used a pharmacophoric restraint (data not
shown). In general, this computation reproduced the results ob-
tained on the two crystal structures described in this study.
References
[1] C.V. Dang, c-Myc target genes involved in cell growth, apoptosis, and meta-
bolism, Mol. Cell. Biol. 19 (1999) 1e11.
[2] G.C. Prendergast, Mechanisms of apoptosis by c-Myc, Oncogene 18 (1999)
2967e2987.
[3] A. Menssen, H. Hermeking, Characterization of the c-MYC-regulated tran-
scriptome by SAGE: identification and analysis of c-MYC target genes, Proc.
Natl. Acad. Sci. U. S. A. 99 (2002) 6274e6279.
[4] B.C. Lewis, H. Shim, Q. Li, C.S. Wu, L.A. Lee, A. Maity, C.V. Dang, Identification of
putative c-Myc-responsive genes: characterization of rcl, a novel growth-
related gene, J. Mol. Biol. 17 (1997) 4967e4978.
[5] B.C. Lewis, J.E. Prescott, S.E. Campbell, H. Shim, R.Z. Orlowski, C.V. Dang, Tumor
induction by the c-Myc target genes Rcl and lactate dehydrogenase A, Cancer
Res. 60 (2000) 6178e6183.
[6] S. Shin, D.G. Bosc, J.N. Ingle, T.C. Spelsberg, R. Janknecht, Rcl is a novel ETV1/
ER81 target gene upregulated in breast tumors, J. Cell. Biochem. 105 (2008)
866e874.
[7] D.R. Rhodes, T.R. Barrette, M.A. Rubin, D. Ghosh, A.M. Chinnaiyan, Meta-
analysis of microarrays: interstudy validation of gene expression profiles re-
veals pathway dysregulation in prostate cancer, Cancer Res. 62 (2002)
4427e4433.
[8] M. Uhlen, P. Oksvold, L. Fagerberg, E. Lundberg, K. Jonasson, M. Forsberg,
M. Zwahlen, C. Kampf, K. Wester, S. Hober, H. Wernerus, L. Bjorling, F. Ponten,
Towards a knowledge-based human protein atlas, Nat. Biotechnol. 28 (2010)
1248e1250.
[9] C. Wu, C. Orozco, J. Boyer, M. Leglise, J. Goodale, S. Batalov, C.L. Hodge, J. Haase,
J. Janes, J.W. Huss 3rd, A.I. Su, BioGPS: an extensible and customizable portal
for querying and organizing gene annotation resources, Genome Biol. 10
(2009) R130.
[10] Y.K. Ghiorghi, K.I. Zeller, C.V. Dang, P.A. Kaminski, The c-Myc target gene Rcl
(C6orf108) encodes a novel enzyme, deoxynucleoside 50-monophosphate N-
glycosidase, J. Biol. Chem. 282 (2007) 8150e8156.
[11] K. Doddapaneni, B. Mahler, R. Pavlovicz, A. Haushalter, C. Yuan, Z. Wu, Solu-
tion structure of RCL, a novel 20-deoxyribonucleoside 50-monophosphate N-
glycosidase, J. Mol. Biol. 394 (2009) 423e434.
[12] Y. Yang, A. Padilla, C. Zhang, G. Labesse, P.A. Kaminski, Structural character-
ization of the mammalian deoxynucleotide N-hydrolase Rcl and its stabilizing
interactions with two inhibitors, J. Mol. Biol. 394 (2009) 435e447.
[13] C. Dupouy, C. Zhang, A. Padilla, S. Pochet, P.A. Kaminski, Probing the active site
of the deoxynucleotide N-hydrolase Rcl encoded by the rat gene c6orf108,
J. Biol. Chem. 285 (2010) 41806e41814.
[14] K. Doddapaneni, W. Zahurancik, A. Haushalter, C. Yuan, J. Jackman, Z. Wu, RCL
hydrolyzes 20-deoxyribonucleoside 50-monophosphate via formation of a re-
action intermediate, Biochemistry 50 (2011) 4712e4719.
[15] P. Mlejnek, P. Kuglik, Induction of apoptosis in HL-60 cells by N(6)-benzyla-
denosine, J. Cell. Biochem. 77 (2000) 6e17.
[16] J. Voller, M. Zatloukal, R. Lenobel, K. Dolezal, T. Beres, V. Krystof, L. Spichal,
P. Niemann, P. Dzubak, M. Hajduch, M. Strnad, Anticancer activity of natural
cytokinins: a structureeactivity relationship study, Phytochemistry 71 (2010)
1350e1359.
[17] M. Rajabi, J. Mehrzad, E. Gorincioi, E. Santaniello, Antiproliferative activity of
N(6)-isopentenyladenosine on HCT-15 colon carcinoma cell line, Nucleic Acid.
Ther. 21 (2011) 355e358.
[18] P. Mlejnek, P. Dolezel, Apoptosis induced by N6-substituted derivatives of
adenosine is related to intracellular accumulation of corresponding mono-
nucleotides in HL-60 cells, Toxicol. In Vitro 19 (2005) 985e990.
[19] C. Amiable, S. Pochet, A. Padilla, G. Labesse, P.A. Kaminski, N(6)-substituted
AMPs inhibit mammalian deoxynucleotide N-hydrolase DNPH1, PLoS One 8
(2013) e80755.
[20] A. Padilla, C. Amiable, S. Pochet, P.A. Kaminski, G. Labesse, Structure of the
oncoprotein Rcl bound to three nucleotide analogues, Acta Cryst. D69 (2013)
247e255.
10. Cytotoxicity assays
Cytotoxicityof synthesized compounds was assessed on a panel of
humantumorcelllines usinga quantitativemetabolic assaywithMTT
(3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazoliumbromide)
(Imagif, CNRS, Gif/Yvette, France). Cell viability was determined using
MTT assay following a 3-day treatment. Measurements were per-
formed in triplicate with a Biomek workstation (Beckman) in 96-well
plates. HCT15 and HCT116 cells (colon adenocarcinoma) and HL60
cells (human promyelocytic leukemia cell lines) were grown in RPMI
1640 with
L-Glutamine medium supplemented with 10% (v/v) fetal
calf serum, 100 UI penicillin, 100
m
g/mL streptomycin and 1.5 mg/mL
fungizone and kept under 5% CO2 at 37 ꢀC. 96 well plates were seeded
with 2000 cells per well for HL60 and HCT116, or with
600 cells per well for HCT15, in 200
pounds dissolved in dimethylsulfoxide (DMSO) were added at a final
concentration of 100 M or 10 M in a fixed volume of DMSO (1% final
mL medium. After 24 h, com-
m
m
concentration). Controls received an equal volume of DMSO. After
72 h incubation, the number of viable cells was measured at 490 nm
with the MTS reagent (Promega, Madison, WI). IC50 (concentration
required to inhibit cell proliferation by 50%) was determined for the
most active compounds at final concentrations ranging from
0.005
assay, adenosine kinase inhibitor (A-134974, Aldrich) was added to
the cells at a final concentration of 5 M before incubationwith tested
compounds (at a final concentration of 100 M or 10 M). Incubation
mM to 100 mM (10 different dilutions in duplicate). For the AK
m
m
m
in the presence of A-134974 alone in DMSO was used as a control.
After 72 h incubation, the number of viable cells was measured at
490 nm and IC50 was determined as above.
Acknowledgments
This work was supported by grants from the Fondation pour la
[21] F. Kappler, A. Hampton, Approaches to isozyme-specific inhibitors. 17.
Attachment of a selectivity-inducing substituent to a multisubstrate adduct.
Implications for facilitated design of potent, isozyme-selective inhibitors,
J. Med. Chem. 33 (1990) 2545e2551.
[22] M. Havelkova, M. Hocek, M. Cesnek, D. Dvorak, The SuzukieMiyaura cross-
coupling reactions of 6-halopurines with boronic acids leading to 6-aryl-
and 6-alkenylpurines, Synlett 1999 (1999) 1145e1147.
ꢀ
Recherche Medicale (DCM20111223063 to S. Pochet), Institut Pas-
teur, CNRS, INSERM and the French Infrastructure for Integrated
Structural Biology (FRISBI; ANR-10-INSB-05-01).
C. Amiable was recipient of a PhD fellowship from the French
Ministry of Research. We thank Genevieve Aubert and Thierry
ꢀ
ꢀ
ꢁ
Cresteil (CNRS, Gif/Yvette, France) for carrying out the cytotoxicity
experiments and Patrick Weber (PF6, Institut Pasteur) for per-
forming robot-driven crystallization trials. We acknowledge (SOL-
EIL, ESRF) for provision of the synchrotron radiation facilities and
we would like to thank the staff of beamlines (Proxima-1 and ID29,
respectively) for assistance.
[23] M. Hocek, A. Holy, I. Votruba, H. Dvorakova, Synthesis and cytostatic activity
of substituted 6-phenylpurine bases and nucleosides: application of the
SuzukieMiyaura cross-coupling reactions of 6-chloropurine derivatives with
phenylboronic acids, J. Med. Chem. 43 (2000) 1817e1825.
[24] M. Hocek, A. Holý, I. Votruba, H. Dvorakova, Cytostatic 6-arylpurine nucleo-
sides III. Synthesis and structure-activity relationship study in cytostatic ac-
tivity of 6-aryl-, 6-hetaryl- and 6-benzylpurine ribonucleosides, Collect.
Czech. Chem. Commun. 66 (2001) 483e499.
ꢂꢀ
ꢀ
[25] J. Liu, M.J. Robins, Azoles as Suzuki cross-coupling leaving groups: syntheses
of 6-arylpurine 20-deoxynucleosides and nucleosides from 6-(imidazol-1-yl)-
and 6-(1,2,4-triazol-4-yl)purine derivatives 1, Org. Lett. 6 (2004) 3421e3423.
[26] J. Liu, M.J. Robins, Fluoro, alkylsulfanyl, and alkylsulfonyl leaving groups in
Suzuki cross-coupling reactions of purine 20-deoxynucleosides and nucleo-
sides, Org. Lett. 7 (2005) 1149e1151.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.ejmech.2014.07.110.

C. Amiable et al. / European Journal of Medicinal Chemistry 85 (2014) 418e437
437
[27] M.K. Lakshman, J.H. Hilmer, J.Q. Martin, J.C. Keeler, Y.Q.V. Dinh, F.N. Ngassa,
L.M. Russon, Palladium catalysis for the synthesis of hydrophobic C-6 and C-2
aryl 20-deoxynucleosides. Comparison of CeC versus CeN bond formation as
well as C-6 versus C-2 reactivity, J. Am. Chem. Soc. 123 (2001) 7779e7787.
[34] R. Ottria, S. Casati, E. Baldoli, J.A.M. Maier, P. Ciuffreda, N6-Alkyladenosines:
synthesis and evaluation of in vitro anticancer activity, Bioorg. Med. Chem. 18
(2010) 8396e8402.
[35] P. Naus, R. Pohl, I. Votruba, P. Dzubak, M. Hajdúch, R. Ameral, G. Birkus,
T. Wang, A.S. Ray, R. Mackman, T. Cihlar, M. Hocek, J. Med. Chem. 53 (2010)
460e470.
[36] P. Perlikova, P. Konecny, P. Naus, J. Snasel, I. Votruba, P. Dzubak, I. Pichova,
M. Hajduch, M. Hocek, MedChemComm 4 (2013) 1497e1500.
[37] P.G.W. Plagemann, Transport, phosphorylation, and toxicity of a tricyclic
nucleoside in cultured Novikoff rat hepatoma-cells and other cell lines and
release of its monophosphate by cells, J. Natl. Cancer Inst. 57 (1976)
1283e1295.
[38] A. Vagin, A. Teplyakov, Molecular replacement with MOLREP, Acta Cryst. D66
(2010) 22e25.
[39] A.W. Schuttelkopf, D.M. van Aalten, PRODRG: a tool for high-throughput
crystallography of protein-ligand complexes, Acta Cryst. D60 (2004)
1355e1363.
ꢂ
ꢂ
ꢀ
ꢂ
ꢂ
[28] M. Hocek, P. Naus, R. Pohl, I. Votruba, P.A. Furman, P.M. Tharnish, M.J. Otto,
Cytostatic 6-arylpurine nucleosides. 6. y SAR in anti-HCV and cytostatic ac-
tivity of extended series of 6-hetarylpurine ribonucleosides, J. Med. Chem. 48
(2005) 5869e5873.
[29] E.C. Western, J.R. Daft, E.M. Johnson, P.M. Gannett, K.H. Shaughnessy, Efficient
one-step Suzuki arylation of unprotected halonucleosides, using water-
soluble palladium catalysts, J. Org. Chem. 68 (2003) 6767e6774.
[30] P. Capek, R. Pohl, M. Hocek, Cross-coupling reactions of unprotected hal-
opurine bases, nucleosides, nucleotides and nucleoside triphosphates with 4-
boronophenylalanine in water. Synthesis of (purin-8-yl)- and (purin-6-yl)
phenylalanines, Org. Biomol. Chem. 4 (2006) 2278e2284.
[31] T. Ikemoto, A. Haze, H. Hatano, Y. Kitamoto, M. Ishida, K. Nara, Phosphoryla-
tion of nucleosides with phosphorus oxychloride in trialkyl phosphate, Chem.
Pharm. Bull. 43 (1995) 210e215.
[40] N. O'Boyle, M. Banck, C. James, C. Morley, T. Vandermeersch, G. Hutchison,
Open Babel: an open chemical toolbox, J. Cheminform. 3 (2011) 33.
[32] O. Korb, T. Stützle, T. Exner, An ant colony optimization approach to flexible
proteineligand docking, Swarm Intell. 1 (2007) 115e134.
[41] J.-L. Pons, G. Labesse, @TOME-2:
a new pipeline for comparative
[33] Nucleosides 5aek were easily prepared from 2 by aqueous SuzukieMiyaura
cross coupling reaction with the appropriate boronic acids (details given as
supplementary information).
modeling of proteineligand complexes, Nucleic Acids Res. 37 (2009)
W485eW491.