Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered Pyrrolysyl-tRNA Synthetase

Article

Structural Basis for Genetic-Code Expansion with

Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase

Graphical Abstract

Authors

Tatsuo Yanagisawa, Mitsuo Kuratani,

Eiko Seki, Nobumasa Hino,

Kensaku Sakamoto,

Shigeyuki Yokoyama

Correspondence

tatsuo.yanagisawa@riken.jp (T.Y.),

yokoyama@riken.jp (S.Y.)

In Brief

Yanagisawa et al. analyzed the Y306A/

Y384F mutant of Methanosarcina mazei

pyrrolysyl-tRNA synthetase (PylRS) with

17 non-natural, bulky oxycarbonyllysine

derivatives for tRNA^Pylaminoacylation

and site-speciﬁc incorporation into

proteins. Fourteen crystal structures of

the amino acid-bound PylRS mutant

revealed the structural bases of the

binding. This information facilitates the

structure-based design of novel

amino acids.

Highlights

d

A mutant pyrrolysyl-tRNA synthetase, PylRS(Y306A/Y384),

acts on diverse amino acids

The PylRS mutant and tRNA^Pylincorporated 17 non-natural

amino acids into proteins

Crystal structures of the PylRS mutant bound with 14 of the

amino acids were solved

This information will facilitate the structure-based design of

novel amino acids

Yanagisawa et al., 2019, Cell Chemical Biology 26, 1–14

July 18, 2019 ª 2019 Elsevier Ltd.

https://doi.org/10.1016/j.chembiol.2019.03.008

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

Cell Chemical Biology

Article

Structural Basis for Genetic-Code Expansion

with Bulky Lysine Derivatives

by an Engineered Pyrrolysyl-tRNA Synthetase

Tatsuo Yanagisawa,^1,4,6,Mitsuo Kuratani,^1,6Eiko Seki,^1,3Nobumasa Hino,⁵Kensaku Sakamoto,^2,4

*

and Shigeyuki Yokoyama^1,3,7,

*

¹RIKEN Structural Biology Laboratory, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045, Japan

²Division of Structural and Synthetic Biology, RIKEN Center for Life Science Technologies, 1-7-22 Suehiro-cho, Tsurumi,

Yokohama 230-0045, Japan

³RIKEN Cluster for Science, Technology and Innovation Hub, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045, Japan

⁴Laboratory for Nonnatural Amino Acid Technology, RIKEN Center for Biosystems Dynamics Research, 1-7-22 Suehiro-cho, Tsurumi,

Yokohama 230-0045, Japan

⁵Laboratory of Molecular Medicine, Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka

565-0871, Japan

⁶These authors contributed equally

⁷Lead Contact

*Correspondence: tatsuo.yanagisawa@riken.jp (T.Y.), yokoyama@riken.jp (S.Y.)

https://doi.org/10.1016/j.chembiol.2019.03.008

SUMMARY

2006; Liu and Schultz, 2010). ‘‘Orthogonal’’ pairs of an engi-

neered aminoacyl-tRNA synthetase and tRNA, including bacterial

Pyrrolysyl-tRNA synthetase (PylRS) and tRNA^Pyland archaeal pairs of tyrosyl-tRNA synthetase (TyrRS) and

tRNA^Tyr

(Wang and Schultz, 2001; Wang et al., 2002; Chin

have been extensively used for genetic-code expan-

sion. A Methanosarcina mazei PylRS mutant bearing

the Y306A and Y384F mutations (PylRS(Y306A/

Y384F)) encodes various bulky non-natural lysine de-

rivatives by UAG. In this study, we examined how

PylRS(Y306A/Y384F) recognizes many amino acids.

Among 17 non-natural lysine derivatives, N -³(benzy-

loxycarbonyl)lysine (ZLys) and 10 ortho/meta/para-

substituted ZLys derivatives were efﬁciently ligated

to tRNA^Pyland were incorporated into proteins by

(CUA)

et al., 2002, 2003; Kiga et al., 2002; Sakamoto et al., 2002) and

archaeal pairs of pyrrolysyl-tRNA synthetase (PylRS) and

tRNA^Pyl

for the 22nd amino acid, pyrrolysine (Blight et al.,

(CUA)

2004; Polycarpo et al., 2004), have enabled the site-speciﬁc

incorporation of non-natural amino acids into proteins in

response to the amber (UAG) codon (reviewed in Wang et al.,

2006; Liu and Schultz, 2010; Wan et al., 2014; Chin, 2014;

ꢀ

Crnkovic et al., 2016; Brabham and Fascione, 2017; Chin,

2017; Wang, 2017; Vargas-Rodriguez et al., 2018; Tharp et al.,

2018). Chemically reactive functional groups, such as alkene,

PylRS(Y306A/Y384F). We determined crystal struc- alkyne, azide, and diazirine groups, on non-natural amino acids

allow the post-translational labeling of proteins with detection

probes, polymers, drugs, and UV crosslinkers (reviewed in Lang

and Chin, 2014a, 2014b; Elliott et al., 2014; Nguyen et al., 2018).

tures of 14 non-natural lysine derivatives bound

to the PylRS(Y306A/Y384F) catalytic fragment. The

meta- and para-substituted ZLys derivatives are

snugly accommodated in the productive mode. In

contrast, ZLys and the unsubstituted or ortho-

substituted ZLys derivatives exhibited an alternative

binding mode in addition to the productive mode.

PylRS(Y306A/Y384F) displayed a high aminoacyla-

Pyrrolysine, PylRS, and tRNA^Pylare present in several metha-

nogenic archaea, including Methanosarcina barkeri (Hao et al.,

2002; Srinivasan et al., 2002), and in a few bacteria, including

Desulﬁtobacterium hafniense (Lee et al., 2008; Nozawa et al.,

2009). PylRS belongs to the class IIc aaRSs (Eriani et al., 1990;

¨

Ruff et al., 1991; Ibba and Soll, 2000). This class is phylogeneti-

tion rate for ZLys, indicating that the double-binding

mode minimally affects aminoacylation. These pre-

cally most similar to phenylalanyl-tRNA synthetase (Kavran et al.,

2007), and esteriﬁes tRNA^Pylwith pyrrolysine. PylRS consists of

cise substrate recognition mechanisms by PylRS two domains, the N-terminal tRNA binding domain and the

C-terminal catalytic domain (Herring et al., 2007; Yanagisawa

et al., 2008a; Jiang and Krzycki, 2012; Suzuki et al., 2017). Pyr-

(Y306A/Y384F) may facilitate the structure-based

design of novel non-natural amino acids.

rolysine is site speciﬁcally incorporated into a speciﬁc UAG

site of methylamine methyltransferases with M. barkeri PylRS

INTRODUCTION

(Blight et al., 2004; Polycarpo et al., 2004). Thus, the PylRSs

from M. barkeri, Methanosarcina mazei, and D. hafniense have

The structures and functions of proteins are restricted by the been used for the incorporation of non-standard amino acids

natural variety of building blocks, L-amino acids. Therefore, ex- into proteins (Ambrogelly et al., 2007; Neumann et al., 2008; Mu-

panding the repertoire of amino acids in translation is useful for kai et al., 2008; Yanagisawa et al., 2008b; Chen et al., 2009;

developing novel protein functions (reviewed in Wang et al., Nguyen et al., 2009; Katayama et al., 2012).

Cell Chemical Biology 26, 1–14, July 18, 2019 ª 2019 Elsevier Ltd.

1

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

The unique feature of PylRS is its broad speciﬁcity for substrate L-lysine (Guo et al., 2014), the PylRS(N346G/C348Q) mutant

amino acids. A large number of PylRS mutants that accommo- complexed with 3-benzothienyl-L-alanine (Englert et al., 2015),

date various sizes of non-canonical amino acids have been iden- the PylRS(N346A/C348A) and PylRS(Y306A/N346A/C348A/

tiﬁed, and more than 100 non-natural amino acids and their Y384F) mutants complexed with phenylalanine (Lee et al.,

analogs have been incorporated into proteins in vivo (reviewed 2016), and the PylRS(Y306A/Y384F) mutant complexed with

in Wan et al., 2014; Yanagisawa et al., 2014b; Brabham and Fas- N ³-(furan-2-propyloxycarbonyl)-L-lysine (Schmidt et al., 2014)

cione, 2017) and in vitro (Mukai et al., 2011; Yanagisawa et al., have been reported. In spite of the uniquely broad substrate

2014a; Seki et al., 2018). A lysine derivative with a benzyloxycar- speciﬁcity of the PylRS(Y306A/Y384F) mutant, only one struc-

bonyl (Z) group, N -³benzyloxycarbonyl-L-lysine (ZLys) (Mukai ture with a furan-containing amino acid has been analyzed

et al., 2008; Yanagisawa et al., 2008b), which is much larger (Schmidt et al., 2014). The molecular elucidation of mechanism

than pyrrolysine and BocLys, was reportedly a poor substrate by which the PylRS(Y306A/Y384F) accommodates a variety of

of the wild-type PylRS. Site-speciﬁc incorporations of ZLys and large and bulky non-natural amino acids within its active site is

its derivatives into proteins have been successfully achieved by essential for understanding its amazingly broad speciﬁcity.

using M. mazei tRNA^Pyland PylRS with a double mutation

In the present study, we investigated the incorporation efﬁ-

(Y306A and Y384F), which was obtained by rational and random ciencies of 17 large and bulky non-natural lysine derivatives at

screening (Yanagisawa et al., 2008b). The M. mazei PylRS(Y306/ a speciﬁc site in proteins with M. mazei PylRS(Y306A/Y384F) in

Y384F)/tRNA^Pylsystem enabled the productive incorporation of the Escherichia coli cell-based and cell-free protein syntheses.

N ³-(o-azidobenzyloxycarbonyl)-L-lysine (oAzZLys) with a reac- We then performed X-ray crystallographic analyses of the cata-

tive azide group (Yanagisawa et al., 2008b; Kato et al., 2017), lytic fragment (residues 185–454) of M. mazei PylRS(Y306A/

which can be used for bioorthogonal labeling of proteins (Kolb Y384F) complexed with 14 out of the 17 non-natural lysine deriv-

et al., 2001; Kiick et al., 2002). In a similar manner to the tyrosine atives. Thus, the mechanisms underlying the broad speciﬁcity of

and phenylalanine analogs (e.g., Liu and Schultz, 2010), the aro- M. mazei PylRS(Y306A/Y384F) have been established. This

matic ring of ZLys is used as a scaffold on which chemically reac- structural basis will enable the design of more useful non-canon-

tive groups are attached. As for the ‘‘bioorthogonal’’ labeling of ical amino acids than ever before.

proteins (Blackman et al., 2008; Lang and Chin, 2014a), the

PylRS(Y306A/Y384F)/tRNA^Pylsystem successfully incorporated RESULTS

theortho-, meta-, and para-substitutedZLysderivatives, including

oAzZLys (Yanagisawa et al., 2008b), N -³(p-nitrobenzyloxycar- In Vivo Site-Speciﬁc Incorporation of Bulky Lysine

bonyl)-L-lysine (pNO₂ZLys), N -³(p-triﬂuoromethyldiazirinyl benzy- Derivatives into a Protein Using the Pair of M. mazei

loxycarbonyl)-L-lysine (pTmdZLys) (Yanagisawa et al., 2012), PylRS(Y306A/Y384F) and tRNA^Pyl

N ³-(m-azidobenzyloxycarbonyl)-L-lysine (mAzZLys) (Yamaguchi M. mazei PylRS(Y306A/Y384F) shows extensively broad speci-

et al., 2016), N -³(3-amino-5-azidobenzyloxycarbonyl)-L-lysine ﬁcity for substrate amino acids that are larger than pyrrolysine,

(mAmAzZLys) (Yamaguchi e t a l., 2016), and N -³(m-triﬂuoromethyl- and numerous bulky non-natural amino acids have been incorpo-

diazirinylbenzyloxycarbonyl)-L-lysine (mTmdZLys) (Kita et al., rated into proteins in vivo (Mukai et al., 2008; Yanagisawa et al.,

ꢀ

2016). Beside the ZLys derivatives described above, PylRS 2008b, 2012; Plass et al., 2012; Borrmann et al., 2012; Nikic

(Y306A/Y384F) also accepts non-natural lysine derivatives, et al., 2014; Yamaguchi et al., 2016; Kita et al., 2016). In this study,

containing cyclooctyne (N -³((((1R,8S)-bicyclo[6.1.0]non-4-yn-9- we compared the incorporations of 17 non-natural lysine deriva-

yl)methoxy)carbonyl)-L-lysine [BCNLys] [Lang et al., 2012; tives, ZLys (Mukai et al., 2008; Yanagisawa et al., 2008b), and

Borrmann et al., 2012]) and trans-cyclooctene moieties (N ³- its derivatives containing selenium (ZaeSeCys) (Wang et al.,

((((E)-trans-cyclooct-2-ene-1-yl)oxy)carbonyl)-L-lysine [TCO*Lys] 2012), nitro (pNO₂ZLys) (Virdee et al., 2011; Yanagisawa et al.,

ꢀ

[Plass et al., 2012; Nikic et al., 2014]).

2012), halogens (oBrZLys [this study], and oClZLys [Yokoyama

The crystal structures of the catalytic fragment (residues 185– et al., 2010]), azide (oAzZLys [Yanagisawa et al., 2008b], mAzZLys

454) of M. mazei PylRS and its mutants in complex with a number [Yamaguchi et al., 2016], pAzZLys [Ge et al., 2016]), alkyne

of substrate amino acids have been solved. The M. mazei wild- (oEtZLys, mEtZLys, andpEtZLys[thisstudy]),diazirine(pTmdZLys

type PylRS structures in complex with pyrrolysine (Yanagisawa [Yanagisawa et al., 2012] and mTmdZLys [Kita et al., 2016]), and

et al., 2006, 2008a; Kavran et al., 2007), N -³(tert-butyloxycar- lysine derivatives containing cyclooctyne (BCNLys [Lang et al.,

bonyl)-L-lysine (BocLys) (Yanagisawa et al., 2008b, 2013), N -³al- 2012; Borrmann et al., 2012]), trans-cyclooctene (TCO*Lys [Plass

ꢀ

lyloxycarbonyl-L-lysine (AlocLys) (Yanagisawa et al., 2008b), et al., 2012; Nikic et al., 2014]), aminopyridine (pAmPyLys [this

N ³-cyclopentyloxycarbonyl-D-lysine (CpocLys) (Kavran et al., study]), and silicon (TeocLys [this study]) (Figure 1) into proteins

2007), N -³propionyl-L-lysine, N -³butylyl-L-lysine, N ³-crotonyl-L- with the pair of M. mazei PylRS(Y306A/Y384F) and tRNA^Pylin

3

€

lysine, and N -propargyloxycarbonyl-L-lysine (PocLys) (Flugel the E. coli cell-based system, as follows.

et al., 2014) have been reported. Furthermore, the structures

First, we incorporated the 17 non-natural lysine derivatives into

of the PylRS(A302T/N346V/C348W/V401L/Y384F) mutant in the T7 peptide-tagged GST protein (T7-GST), at a single UAG-

complex with O-methyl-L-tyrosine (Takimoto et al., 2011), the speciﬁed site (position 25) between the T7 peptide and GST, in

PylRS(Y306G/Y384F/I405R) mutant complexed with N ³-(5-nor- E. coli cells expressing PylRS(Y306A/Y384F) and tRNA^Pyl(Fig-

bornene-2-yloxycarbonyl)-L-lysine (Schneider et al., 2013), the ure 2, Key Resources Table) (Yanagisawa et al., 2008b). The

PylRS(N346S/C348I) mutant complexed with 3-iodo-L-phenylal- amounts of the expressed full-length proteins ranged from 1.7

anine, and 2-(5-bromothienyl)-L-alanine, the PylRS(L301V/ to 78.5 mg per liter medium (Table S1). The most efﬁciently intro-

L305I/Y306F/L309A/C348F) mutant complexed with N -³acetyl- duced derivatives were ZLys, ZaeSeCys, oBrZLys, oClZLys,

2

Cell Chemical Biology 26, 1–14, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

Figure 1. Chemical Structures of the Non-natural Lysine Derivatives Analyzed in This Study

The characteristic functional group of each lysine derivative is emphasized with red coloring.

pNO₂ZLys, oAzZLys, mAzZLys, oEtZLys, mEtZLys, and the produced T7-GST proteins by the same mass spectrometric

mTmdZLys. These are amino acids with a benzene ring (ZLys method conﬁrmed the site-speciﬁc incorporation of 16 of the

and ZaeSeCys) and an ortho/meta-substituted benzene ring 17 non-natural lysine derivatives (Figure S1). Peptide mass

(oBrZLys, oClZLys, oAzZLys, mAzZLys, oEtZLys, mEtZLys, and ﬁngerprinting (PMF) analyses of tryptic digests revealed major

mTmdZLys), while pNO₂ZLys is exceptional. The produced T7- peaks, which matched the theoretical masses of the tryptic pep-

GST proteins containing these non-natural lysine derivatives tide NSXSPILGYWK, where X represents ZaeSeCys, oBrZLys,

amounted to 51.8–78.5 mg per liter medium, and to 56.9%– oClZLys, mAzZLys, pAzZLys, oEtZLys, mEtZLys, pEtZLys,

86.2% of the T7-GST protein produced with the tyrosine codon BCNLys, TCO*Lys, TeocLys, and mTmdZLys, respectively

UAC instead of UAG at position 25 (Table S1). The T7-GST pro- (Table S2). The incorporation of pAmPyLys was not conﬁrmed

teins containing pAzZLys, BCNLys, TCO*Lys, and TeocLys by the PMF analysis, because an insufﬁcient amount of the T7-

were produced with moderate efﬁciency (12.4–26.7 mg per liter GST protein containing pAmPyLys was obtained (Figure 2).

medium), and those containing pEtZLys, pAmPyLys, and

pTmdZLys were poorly produced (1.7–3.6 mg per liter medium). Fluorescent Labeling of Proteins Containing an Alkyne

We previously reported the site-speciﬁc incorporations of Moiety by Click Chemistry with Copper-Chelating Azide

ZLys, oAzZLys, pNO₂ZLys, and pTmdZLys, at the single speci- During the last decade, the site-speciﬁc incorporation of non-

ﬁed site (position 25) of the T7-GST proteins by mass spectrom- natural amino acids bearing reactive groups into proteins and

etry (Yanagisawa et al., 2008b, 2012). In this study, analyses of the bioorthogonal labeling of proteins have become important

Cell Chemical Biology 26, 1–14, July 18, 2019

3

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

UV Crosslinking of the Protein Dimer Interface via a

Photo-Crosslinker Amino Acid

Non-natural photo-crosslinker amino acids with arylazido, p-ben-

zoylphenyl, and diazirinyl moieties have been developed for ge-

netic encoding in bacterial and mammalian cells (Chin et al.,

2002; Hino et al., 2005, 2011; Ai et al., 2011). These systems

have been applied to in vivo photo-crosslinking of proteins for

identifying target proteins. Previously, we achieved wide-range

protein crosslinking with the photo-reactive lysine derivative

pTmdZLys, by using the pair of M. mazei PylRS(Y306A/Y384F)

and tRNA^Pyl(Yanagisawa et al., 2012). Furthermore, mTmdZLys

is incorporated much more efﬁciently than pTmdZLys, and is use-

ful for studies of protein-protein interactions in mammalian cells

(Kita et al., 2016). Besides mammalian cells, mTmdZLys can

also be used for protein crosslinking in E. coli cells. The incorpo-

ration of mTmdZLys at one of the dimer interface residues, Glu51,

of GST in the T7 peptide-tagged format was efﬁcient (Figure S2B).

After puriﬁcation and UV irradiation of the T7-GST(51mTmdZLys)

protein, the crosslinked GST dimer was clearly identiﬁed by

Figure 2. Site-Speciﬁc Incorporation of Non-natural Lysine Deriva-

SimplyBlue (ThermoFisher) staining and western blot analyses

tives into the T7-GST Protein in E. coli Cells

(Figure S2B).

E. coli BL21-Gold(DE3) cells harboring the T7-GST gene with a single UAG

codon at position 25, together with the M. mazei PylRS(Y306A/Y384F) and

M. mazei tRNA^Pylgenes, were grown in the absence or presence of non-nat-

ural amino acids. WT, wild-type T7-GST; -a.a., no non-natural amino acid; Z,

ZLys; ZSe, ZaeSeCys; oBr, oBrZLys; oCl, oClZLys; NO₂, pNO₂ZLys; oAz,

oAzZLys; mAz, mAzZLys; pAz, pAzZLys; oEt, oEtZLys; mEt, mEtZLys; pEt,

pEtZLys; BCN, BCNLys; TCO*, TCO*Lys; Teoc, TeocLys; AmPy, pAmPyLys;

pTmd, pTmdZLys; mTmd, mTmdZLys. The T7-GST proteins containing non-

natural amino acids were puriﬁed by glutathione Sepharose column chroma-

tography (upper panel). Yields of the puriﬁed T7-GST proteins per mg liter of

E. coli culture (lower panel). The values represent the means of two indepen-

dent experiments with standard deviations. The images are composites of

those of two different gels, and each gel image is boxed. See also Figure S1,

Tables S1 and S2, and the STAR Methods.

M. mazei PylRS(Y306A/Y384F) Esteriﬁes tRNA^Pylwith

Large and Bulky Lysine Derivatives

As described above, the T7-GST proteins containing pEtZLys,

pAmPyLys, and pTmdZLys were only poorly produced (Figure 2).

Therefore, we compared the tRNA^Pylaminoacylation efﬁciencies

of M. mazei PylRS(Y306A/Y384F) for all 17 non-natural lysine

derivatives (Figure 3). Among the three poorly incorporated

non-natural amino acids, pEtZLys and pAmPyLys showed the

lowest aminoacylation activities. Consequently, the very low

in vivo incorporation efﬁciencies of pEtZLys and pAmPyLys are

ascribed to the low aminoacylation activities.

pEtZLys has a bulky ethynyl group at the para position of the

technologies for the analyses of protein structures/functions benzene ring of ZLys, which may prevent this amino acid from

in cells (Lang and Chin, 2014a). Especially, azide and alkyne binding in the active site of PylRS(Y306A/Y384F). The very low

moieties are the most frequently used functional groups, and in- water solubility of pEtZLys makes it difﬁcult to test higher con-

corporations of non-natural amino acids and labeling of many centrations. In contrast, in the case of pAmPyLys, the amino-

proteins have been performed using bioorthogonal chemical acyl-tRNA^Pylwas effectively produced at a higher concentration

reactions, such as Staudinger ligation (Kiick et al., 2002; Yanagi- (10 mM), rather than 1 mM. Therefore, pAmPyLys can bind in the

sawa et al., 2008b) and click chemistry (copper-assisted azide- active site of PylRS(Y306A/Y384F), but its K_mvalue is appre-

alkyne cycloaddition, or CuAAC) (Kolb et al., 2001; Nguyen ciably higher than those of the other 15 non-natural amino acids.

et al., 2009). Copper ion accelerates the CuAAC reaction, but it pAmPyLys contains a hydrophilic aminopyridine ring, which may

has the serious problem that the high concentration of copper be the reason for its poorer binding in the PylRS(Y306A/Y384F)

ion causes the denaturation of many proteins, and thus is active site, unlike the benzene ring of the ZLys derivatives.

incompatible with cell labeling or cell imaging because of the

The efﬁciency of PylRS(Y306A/Y384F) to esterify tRNA^Pylwith

cytotoxicity. Fortunately, the cell-compatible copper chelator pTmdZLys was as high as those with ZLys, mEtZLys, mAzZLys,

picorylazide, which reduces the toxicity of the CuAAC reaction and mTmdZLys (Figure 3), whereas the incorporation of

conditions to cells, was recently developed (Uttamapinant pTmdZLys into T7-GST by the cell-based system was much

et al., 2012). Thus, we tested two new lysine derivatives, oEtZLys less efﬁcient than those of the four other non-natural lysine

and mEtZLys, for protein ﬂuorescent labeling by click chemistry derivatives.

with picorylazide (Figure S2A). The T7-GST proteins containing

oEtZLys and mEtZLys were successfully labeled with ﬂuores- Site-Speciﬁc Incorporation of Bulky Lysine Derivatives

cent AlexaFluor 488-picorylazide, with a much lower copper into a Protein by Cell-free Protein Synthesis

concentration than that needed for the CuAAC reaction (Fig- To test whether the poor in vivo incorporation efﬁciency of

ure S2A). Actually, the T7-GST proteins containing other non- pTmdZLys is due to its low efﬁciency in some processes after

natural lysine derivatives were not labeled. This method is aminoacylation, we applied a coupled cell-free transcription-

expected to be applicable to the ﬂuorescent labeling of unstable translation system. The N11-tagged superfold type green ﬂuo-

proteins in vitro, and further to the labeling of live cells.

rescent mutant protein (GFPS1) gene (Seki et al., 2008) was

4

Cell Chemical Biology 26, 1–14, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

Figure 3. tRNA Aminoacylation Activities for

Non-natural Amino Acids by M. mazei PylRS

(Y306A/Y384F)

M. mazei PylRS(Y306A/Y384F) esteriﬁes tRNA^Pylwith

non-natural lysine derivatives. The aminoacylation of

tRNA^Pylwas monitored by acidic urea PAGE. Each lane shows a reaction in the presence of PylRS(Y306A/Y384F), tRNA^Pyl, and the following: no non-natural amino

acid (-a.a); Z, ZLys (Z), pNO₂ZLys (NO₂), oAzZLys (oAz), mAzZLys (mAz), pAzZLys (pAz), oEtZLys (oEt), mEtZLys (mEt), pEtZLys (pEt), oBrZLys (oBr), oClZLys (oCl),

BCNLys (BCN), TCO*Lys (TCO*), TeocLys (Teoc), pTmdZLys (pTmd), mTmdZLys (mTmd), and ZaeSeCys (ZSe) at 1 mM; pAmPyLys (AmPy) at 1 and 10 mM; and in

the presence of only tRNA^Pyl(tRNA^Pyl). The images are composites of those of two different gels, and each gel image is boxed. See also STAR Methods.

expressed in the cell-free protein synthesis system using the S30 1.76, 3.9, 7.8, 11.3, and 13.8 mM (Figure S4). However, those

extract from E. coli BL21(DE3) cells. The full-length N11-GFPS1 for other lysine derivatives could not be measured, presumably

protein containing pTmdZLys was produced with a yield of because their afﬁnities are too low. The binding afﬁnities of

0.9 mg protein per mL reaction, which was similar to those of PylRSc(Y306A/Y384F) for mTmdZLys and mEtZLys were six to

ZLys, mAzZLys, mEtZLys, and mTmdZLys (1.33, 0.98, 1.35, eight times higher than those for TeocLys and oEtZLys.

and 0.78 mg per mL reactions, respectively) (Figure 4, Table

S3). In contrast, the production of the N11-GFPS1 protein con- Crystal Structures of the M. mazei PylRS(Y306A/Y384F)

taining pAmPyLys was detectable but much lower than those Catalytic Fragment in Complex with ATP and Lysine

of the other non-natural lysine derivatives (0.03 mg protein per Derivatives

mL reaction) (Figure 4; Table S3), in agreement with the low ami- To elucidate the structural basis for the recognition of the non-

noacylation efﬁciency. We compared the relative yields of the natural amino acid substrates by M. mazei PylRS(Y306A/

non-natural amino acid-containing N11-GFPS1 proteins from Y384F), we performed crystallographic analyses of the catalytic

the cell-based and cell-free systems (Table S3). Eleven milliliters domain of PylRS(Y306A/Y384F) (PylRSc(Y306A/Y384F)) in com-

of E. coli S30 extract, which are required for 33 mL of the cell-free plex with 14 of the 17 non-natural amino acids described above

reactions, can be obtained from 1 L of E. coli culture. Conse- (Table S4).

quently, the yields of the N11-GFPS1 proteins containing ZLys,

In 8 of the 14 determined structures, the bound lysine deriva-

mAzZLys, mEtZLys, mTmdZLys, pTmdZLys, and pAmPyLys tive molecules (pNO₂ZLys, pAmPyLys, pTmdZLys, mTmdZLys,

are estimated to be 43.9, 32.3, 44.6, 29.7, 25.7, and 0.99 mg, mAzZLys, mEtZLys, BCNLys, and TCO*Lys) were modeled nor-

respectively, by the cell-free synthesis using a 1 L culture of mally in a single-binding mode. However, in the PylRSc(Y306A/

E. coli cells (Table S3).

Y384F) structures for ZLys, ZaeSeCys, oBrZLys, oClZLys, and

The incorporations of the non-natural lysine derivatives into oAzZLys, the observed electron density corresponding to the

the N11-GFPS1 protein were conﬁrmed by mass spectrometry amino acid is appreciably longer than that of a single molecule

analyses (Figure S3). The PMF analysis of the tryptic digests (Figures 5 and 6). The side chains of these four amino acids

by MALDI-TOF mass spectrometry revealed major peaks, have, in common, an unsubstituted or ortho-substituted ben-

which match the theoretical masses of the tryptic peptide zene ring and are smaller than the above eight ZLys derivatives.

HEHAHXENLYFQSK, where X represents ZLys, mEtZLys, Therefore, these ‘‘longer’’ electron densities were interpreted as

pAmPyLys, pTmdZLys, and mTmdZLys, respectively (Table composites of two binding modes, shifted from each other.

S2). Electrospray ionization mass analysis revealed the Furthermore, in the TeocLys structure, a similar ‘‘longer’’ elec-

tryptic peptide containing mAzZLys (Table S2). These results tron density was observed, and the bound amino acid was

conﬁrmed that the efﬁcient cell-free production of the full- modeled on the assumption of three binding modes (Figure 6).

length N11-GFPS1 protein with pTmdZLys does not occur These unusual multiple binding modes may occur because

with any non-speciﬁc suppression of the UAG codon with nat- of the enlarged binding pocket due to the double mutation

ural amino acids in the cell-free system.

Therefore, the low in vivo incorporation of pTmdZLys is

Y306A/Y384F.

ascribed to its low efﬁciency in some other processes relevant Structure of M. mazei PylRS(Y306A/Y384F) Catalytic

to the cell-based production, rather than aminoacylation or Fragment in Complex with ATP and the Lysine

translation on the ribosome. The membrane permeability and/or Derivatives with an Unsubstituted Benzene Ring

amino acid transporter system of E. coli cells may be inefﬁcient As the representative of the double-binding mode, the case of

for pTmdZLys. Nevertheless, considering that most other ZLys ZLys is described here in detail. ZLys was modeled in a compos-

derivatives, including mTmdZLys, are efﬁciently incorporated ite of two different binding modes, 1 and 2, with occupancies of

into proteins in E. coli cells, the low incorporation efﬁciency of 0.58 and 0.37, respectively, which gave the lowest R factors

pTmdZLys is odd and require further analysis.

against the diffraction data (Figure 5). The F_o– F_comit electron

density map of ZLys is appreciably longer than that of a single

ZLys molecule, and corresponds well to the dual modes, as

shown in Figure 5C.

Interactions of M. mazei PylRS(Y306A/Y384F) with

Lysine Derivatives

To examine the interaction between PylRSc(Y306A/Y384F) and

Mode 1 is almost the same as the authentic binding mode re-

the lysine derivatives, a surface plasmon resonance (SPR) assay ported for pyrrolysine and other lysine derivatives bound to

was performed. The K_dvalues for mTmdZLys, mEtZLys, BCNLys, M. mazei PylRSc (Yanagisawa et al., 2008a, 2008b), in which

TCO*Lys, TeocLys, and oEtZLys were determined to be 1.62, the carbonyl oxygen atom in the carbamate (-O-CO-NH-) moiety

Cell Chemical Biology 26, 1–14, July 18, 2019

5

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

A

B

Figure 4. Site-Speciﬁc Incorporation of Non-natural Lysine Deriva-

tives into the N11-GFPS1 Protein by Cell-free Protein Synthesis

Full-length N11-GFPS1 proteins synthesized with the S30 extracts from E. coli

BL21(DE3)/pMINOR cells. Non-natural lysine derivatives were site speciﬁcally

incorporated into the single amber site of the N11-GFPS1 protein at position

17 with the PylRS(Y306A/Y384F)/tRNA^Pylpair.

(A) Production of the N11-GFPS1 proteins containing non-natural lysine

derivatives, estimated by ﬂuorescence. The values represent the means of

Figure 5. Crystal Structures of M. mazei PylRSc(Y306A/Y384F) Com-

three independent experiments with standard deviations.

plexed with ZLys and ATP

(A) Overall structure of M. mazei PylRSc(Y306A/Y384F) bound to ZLys (left).

(B) The N11-GFPS1 proteins puriﬁed by Ni-Sepharose column chroma-

tography.

Close-up views of ZLys (right). Two different binding modes of ZLys are shown

See also Figure S3, Tables S2 and S3, and STAR Methods.

as cyan (mode 1) and magenta (mode 2) stick models. Water-mediated

hydrogen bonds between ZLys and the side-chain amide group of Asn348 are

represented by dotted lines. Transparent ribbon models of PylRSc(Y306A/

of ZLys hydrogen bonds with the side-chain amide -CO-NH₂

Y384F) are visible in the background.

˚

group of Asn346 (the oxygen-nitrogen distance is 3.0 A) (Figures

(B) Space-ﬁlling model of M. mazei PylRSc(Y306A/Y384F) and ZLys.

(C) The F_o– F_comit electron density maps (contoured at 1.5s) of ZLys in the

PylRSc(Y306A/Y384F) active site.

5A and 5D). The F_o– F_comit electron density map (Figure 5C) ex-

hibits a peak corresponding to the hydrogen bonding carbamate

carbonyl oxygen atom of ZLys. With respect to this hydrogen

bond between the carbamate carbonyl group and Asn346,

mode 1 corresponds to the single-binding modes of the meta-

and para-substituted ZLys derivatives, as described below.

In contrast, ZLys bound in mode 2 is buried more deeply than

(D) Close-up views of ZLys in mode 1 (cyan, left) and in mode 2 (magenta,

right). Hydrogen bonding distances between ZLys and the side-chain amide

group of Asn348 are shown.

See also Figures S5–S7, and Tables S4 and S5.

˚

in mode 1, and ﬁlls up the remaining space in the hydrophobic Asn346 (the oxygen-nitrogen distance is 5.2 A) (Figures 5A

pocket (Figures 5B and S5A). The benzene ring of ZLys is and 5D).

stacked with the indole ring of Trp417 in both binding modes. In mode 1, the Asn346 side chain forms a water-mediated

˚

In contrast, in mode 2, the benzene ring of ZLys is located closer hydrogen bond with the a-amino group (2.74 A) of ZLys (Figures

to the hydrophobic side chains of Met276, Ile405, Leu407, and 5A and 5D), as in the authentic pyrrolysine-bound PylRSc struc-

˚

Trp411 (Figure S5A), with distances of 3.4, 5.3, 3.7, and 3.5 A, ture (Yanagisawa et al., 2008a). In contrast, in mode 2, the

˚

as compared with 5.0, 5.6, 5.4, and 5.1 A, respectively, in Asn346 side chain forms the corresponding water-mediated

˚

mode 1. In particular, the d2-methyl group of Leu407 forms a hydrogen bond with the a-carboxyl group (3.12 A) of ZLys (Fig-

van der Waals contact with the p-CH group with a C-H distance ures 5A and 5D), as in the previously reported BocLys-bound

˚

of 3.68 A, which limits the deepest position of the benzene ring PylRSc structure (Yanagisawa et al., 2008b). The distance be-

(Figures 5A and 5D). The conformation of the Leu407 side chain tween the a-carboxyl group of ZLys in mode 1 and the a-phos-

˚

is ﬁxed by steric interactions with its surrounding residues (main phate group of ATP (4.01 A) is closer than that in mode 2

˚

and side chains). Instead of forming this van der Waals contact, (4.53 A) (Figures 5A and 5D).

the carbamate moiety moves away from Asn346 and thus the ZaeSeCys is an analog of ZLys, with an unsubstituted benzene

carbonyl oxygen atom does not form the hydrogen bond with ring and a selenium atom within the lysine side chain (Figure 1).

6

Cell Chemical Biology 26, 1–14, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

A

D

C

B

G

E

F

J

I

H

L

M

K

Figure 6. Crystal Structures of M. mazei PylRSc(Y306A/Y384F) Complexed with Non-natural Lysine Derivatives

Close-up views of ZaeSeCys (A), oBrZLys (B), oClZLys (C), oAzZLys (D), mAzZLys (E), mEtZLys (F), mTmdZlys (G), pNO₂ZLys (H), pTmdZLys (I), pAmPyLys (J),

BCNLys (K), TCO*Lys (L), and TeocLys (M) are shown (upper panels). The two different binding modes of ZaeSeCys, oBrZLys, oClZLys, and oAzZLys are shown

as magenta and cyan stick models, and the three binding modes of TeocLys are shown as magenta, cyan, and green stick models. Water-mediated hydrogen

bonds between the non-natural amino acids and the side-chain amide group of Asn348 are represented by dotted lines. Transparent ribbon models of

PylRSc(Y306A/Y384F) are visible in the background. Space-ﬁlling and stick models of the non-natural amino acids are shown on transparent surface models of

M. mazei PylRSc(Y306A/Y384F) (lower left panels). The F_o– F_comit electron density maps (contoured at 1.5s) of the non-natural amino acids in the

PylRSc(Y306A/Y384F) active site (lower right panels). See also Figures S5–S7, and Tables S4 and S5.

Cell Chemical Biology 26, 1–14, July 18, 2019

7

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

This amino acid also exhibits the double-binding modes, 1 and 2 to create additional space in the active site. The 3 -methyl group

(Figures 6A and S5), which are quite similar to those of ZLys (Fig- of Met276 is rotated away from the azide group of oAzZLys

ure 5). The -CH₂-CH₂-Se-CH₂- moiety of ZaeSeCys is well (mode 2) to evade steric hindrance with it.

accommodated in the site corresponding to the -CH₂-CH₂-

CH₂-CH₂- moiety of ZLys. Here, the occupancies of ZaeSeCys Structure of M. mazei PylRS(Y306A/Y384F) Catalytic

in modes 1 and 2 are 0.24 and 0.76, respectively.

Fragment Complexed with the meta-Substituted ZLys

Derivatives and ATP

Structures of M. mazei PylRS(Y306A/Y384F) Catalytic

Fragment Complexed with ortho-Substituted ZLys

Derivatives and ATP

The electron density revealed that the meta-substituted ZLys de-

rivatives assume a single-binding mode (Figures 6 and S5). In the

mAzZLys, mEtZLys, and mTmdZLys-bound forms, the distances

Similar to ZLys and ZaeSeCys with the unsubstituted benzene between the carbonyl oxygen atom of the carbamate moiety and

˚

ring, the ortho-chloro (oCl)-, ortho-bromo (oBr)-, and ortho-azide the side-chain amide group of Asn346 are 3.3, 2.9, and 3.3 A,

(oAz)-substituted ZLys derivatives, oClZLys, oBrZLys, and respectively (Figures 6E–6G). Therefore, this single-binding

oAzZLys, respectively, also exhibited the double-binding mode mode corresponds to mode 1 in the above-described double-

(Figures 6B–6D and S5). In mode 2, the p-CH groups of these binding mode for ZLys and its ortho-substituted derivatives.

ortho-substituted ZLys derivatives are located in the positions

The mAzZ, mEtZ, and mTmdZ groups are buried in a hydro-

corresponding to that of ZLys, as limited by the van der Waals phobic pocket, formed by Met276, Ala302, Ala306, Leu309,

contact with the d2-methyl group of Leu407 (Figures 6B–6D). Phe384, Leu407, Asp408, Trp411, Ile413, and Trp417 (Figures

In contrast, in mode 1, the carbonyl oxygen atom of the carba- 6E–6G and S5; Table S5). Even in mode 1, the substituents of

mate group of these amino acids hydrogen bonds with the these meta-substituted ZLys derivatives are located in the posi-

Asn346 side chain, as with ZLys.

tions corresponding to the benzene ring of ZLys and its ortho-

In both modes 1 and 2, the chlorine and bromine atoms substituted derivatives in mode 2, because of the van der Waals

of oClZLys and oBrZLys, respectively, and the azide group of contact with the d2-methyl group of Leu407. The meta-substitu-

oAzZLys, were modeled in one of the two ortho positions of ents in the mAzZ- and mTmdZLys-bound structures are favor-

the benzene ring (Figures 6B–D). This orientational preference ably oriented relative to the benzene ring and avoid steric conﬂict

is due to the putative steric conﬂicts of the chlorine and bromine with the side-chain carboxyl group of Asp408 (Figures 6E

atoms, and the azide group, in the other ortho position against and 6G). The meta-substituents of mAzZ- and mTmdZLys

the side chain of Leu309 in mode 1 and against the side chain extend closer to Met276 than that of mEtZLys, and thus they

of Ile413 in mode 2 (not shown). The chlorine and bromine atoms destabilize the major conformation of the Met276 side chain,

of oClZLys and oBrZLys, respectively, are similarly located in and cause conformational mixtures with the major:minor ratios

almost the same position between modes 1 and 2. Thus, both of 0.61:0.39 and 0.63:0.37, respectively (Figures 6E and 6G),

the chlorine and bromine atoms are surrounded, regardless of similarly to oBrZLys (Figure 6C).

the binding modes, by three side-chain atoms, with the dis-

tances of the side-chain methyl group of Ala302 (3.3/3.2 and Structure of M. mazei PylRS(Y306A/Y384F) Catalytic

˚

3.3/3.3 A in modes 1/2), the side-chain 3 1-CH of Phe384 (3.4/ Fragment Complexed with para-Substituted ZLys

˚

3.3 and 4.1/3.4 A), and the 3 -methyl group of Met276 (3.8/3.5 Derivatives and ATP

˚

and 4.1/3.4 A) from the chlorine and bromine atoms, respec- The para-substituted ZLys derivatives, pNO₂ZLys and

tively. The sums of the van der Waals radii of Cl and Br and pTmdZLys, assume a single-binding mode (mode 1) (Figures 6

˚

that of a carbon are 3.45 and 3.55 A, respectively. Therefore, and S5). The distances between the carbonyl oxygen atom of

the chlorine and bromine atoms are nearly within the van der the carbamate moiety and the side-chain amide group of

˚

Waals contact range with the surrounding side-chain atoms. In Asn346 are 2.9 and 2.8 A for pNO₂ZLys and pTmdZLys, respec-

contrast, the position of the benzene ring differs largely between tively (Figures 6H and 6I), indicating their hydrogen bonding in the

the two modes (Figures 6B and 6C).

above-described binding mode 1. The pNO₂Z and pTmdZ moi-

In the case of oBrZLys, the Met276 side chain exhibits a eties are accommodated in the hydrophobic pocket in the same

mixture of the major and minor conformations, at a ratio of manner as the meta-substituted Z moieties (Figure S5, Table

0.58: 0.42, about the Cb-Cg bond, where the major one is the S5). First of all, the benzene rings of pNO₂ZLys and pTmdZLys

same as the Met276 side-chain conformation with ZLys and are stacked with the indole ring of Trp417, similarly to those of

oClZLys. In the minor conformation, the 3 -methyl group is rotated ZLys and its derivatives. The benzene ring of pNO₂ZLys is located

away from the bromine atom, and does not form a van der Waals in a similar position to that of ZLys bound in mode 1, while the

contact with it. This minor conformation speciﬁc to oBrZLys may pNO₂group does not form any particular favorable interaction

be due to the larger van der Waals radius of the bromine atom (Figures 6H and S5). The pTmd group of pTmdZLys is located

than that of the chlorine atom.

in a position quite similar to that of mTmdZLys. In contrast, the

In the case of oAzZLys, the azide group of oAzZLys is sur- benzene ring of pTmdZLys is rotated in the plane by about 26^ꢀ

rounded by the three side-chain atoms, with the distances of relative to that of mTmdZLys (Figure S6), and is closer to Ile413

˚

the side-chain methyl group of Ala302 (3.4/3.2 A in modes 1/2), and Trp417 than to Ala302 and Phe384. Note that Ala302 and

˚

the side-chain 3 1-CH of Phe384 (3.6/4.0 A), and the d-sulfur Phe384 are close to the benzene rings of both the ortho and

˚

atom of Met276 (5.5/3.2 A) from the azide group (Figure 6D). meta-substituents of ZLys derivatives. In the pTmdZLys-bound

Intriguingly, the Met276 side chain assumes a single side-chain structure, the Met276 side chain is close to the triﬂuoromethyl

conformation, which is similar to the minor one with oBrZLys, group, and exhibits a mixture of the major (0.51) and minor

8

Cell Chemical Biology 26, 1–14, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

any particular interactions. From the electron density, it was difﬁ-

A

cult to judge the position of the nitrogen atom in the pyridine ring

(Figures 6J and S5). In either of the two possible positions, the

ring nitrogen atom is surrounded by only hydrophobic amino

acid residues. It might be presumed that the polar nature of

the pyridine ring causes the lower afﬁnity for the enzyme than

those of the ZLys derivatives analyzed in the present study.

B

Structures of M. mazei PylRS(Y306A/Y384F) Catalytic

Fragment Complexed with ATP and Lysine Derivatives

Containing Bicyclooctyne and trans-Cyclooctene

Groups

BCNLys and TCO*Lys have the strained cycloalkyne and trans-

cycloalkene moieties, respectively. Both of them assume a sin-

gle-binding mode, in which the carbonyl oxygen atoms in the

carbamate moiety of BCNLys and TCO*Lys hydrogen bond

˚

with the side chain of Asn346 (3.0 and 3.4 A, respectively) (Fig-

ures 6K and 6L). The ring structures of BCNLys and TCO*Lys

are quite different from the benzene ring structure, and cannot

form p-p stacking interactions with the indole ring of Trp417, un-

like the ZLys derivatives. However, the ‘‘thicker’’ shapes of the

BCN and TCO* rings than the benzene ring are well accommo-

dated between the hydrophobic Trp417 and Ala306 side chains

(Figures 6K, 6L, S5, and S7; Table S5).

Figure 7. Time Course Analysis of the In Vitro Aminoacylation Reac-

tion by M. mazei PylRS(Y306A/Y384F)

The aminoacylation assay conditions are described in the STAR Methods.

(A) Starting from the left, each lane shows a reaction with the following: PylRS

(Y306A/Y384F) with ZLys (0–60 min); PylRS(Y306A/Y384F) with mAzZLys

(0–60 min).

(B) Time-course analysis of ZLys-tRNA^Pyl(black line) and mAzZLys-tRNA^Pyl

(red line) formation catalyzed by PylRS(Y306A/Y384F). The total amounts

(pmol) of aminoacyl-tRNAs synthesized in the reaction mixture were calculated

from the band intensities, as processed with the NIH ImageJ software, and are

shown in the graphs. The plots represent mean values standard deviation

from three independent experiments.

Structures of M. mazei PylRS(Y306A/Y384F) Catalytic

Fragment Complexed with a Lysine Derivative

Containing a Trimethylsilyl Moiety and ATP

The bound TeocLys assumes three different binding modes, 1,

1.5, and 2 (Figures 6M and S5). The occupancies of TeocLys in

(0.49) conformations, as described for the oBrLys-, mAzZLys-, modes 1, 1.5, and 2 are 0.29, 0.38, and 0.33, respectively. In

and mTmdZLys-bound structures (Figures 6C, 6E, and 6G).

mode 1, the carbonyl oxygen atom in the carbamate moiety of

We failed to solve the structures of PylRSc(Y306A/Y384F) TeocLys hydrogen bonds with the side-chain amide group of

˚

bound to pAzZLys and pEtZLys, ZLys derivatives with a straight Asn346 (3.2 A), as in mode 1 of the above-described lysine de-

para-azide (pAz) and a para-ethynyl (pEt) group, respectively, rivatives. In mode 2, the Teoc group is accommodated most

which are longer than those of pNO₂ZLys and pTmdZLys. The deeply inside the binding pocket, and the end reaches Leu407,

accommodation of these long, straight substituents at the para as in mode 2 of the others (Figure S5; Table S5). The TeocLys

position within the limited space of the binding pocket may shift in mode 1.5 is located between modes 1 and 2. Unlike mode

the rest of the molecule relative to the ZLys moiety in mode 1. 1, the carbamate moiety of TeocLys is farther away from

Such putative shifts of the ZLys moiety might correspond to Asn346 in modes 1.5 and 2, and the carbonyl oxygen interacts

the very low activities of PylRS(Y306A/Y384F) for pAzZLys and instead with the main-chain nitrogen atom of Ala306 in mode

pEtZLys (Figure 3).

˚

1.5 (3.2 A), and with the indole nitrogen atom of Trp417 in

˚

mode 2 (3.2 A). The trimethylsilyl group of TeocLys is close to

the Trp417 indole ring, but does not stack with it.

Structures of M. mazei PylRS(Y306A/Y384F) Catalytic

Fragment Complexed with the Lysine Derivative

Containing the para-Aminopyridyl Moiety and ATP

Analysis of In Vitro Aminoacyl-tRNA^PylSynthesis by

For pAmPyLys, a lysine derivative with a para-aminopyridine M. mazei PylRS(Y306A/Y384F)

scaffold instead of the para-substituted benzene ring (Figure 6J), The bound ZLys molecule exhibits two different binding modes,

the crystallization was performed in the presence of 50 mM whereas the mAzZLys molecule assumes a single-binding mode

pAmPyLys, because M. mazei PylRS(Y306A/Y384F) exhibited in the M. mazei PylRSc(Y306A/Y384F) structure. Although the af-

very low aminoacylation activity with 1 mM pAmPyLys (Figure 3). ﬁnities of M. mazei PylRSc(Y306A/Y384F) for these two amino

The electron density of pAmPyLys revealed a single-binding acids were too weak to measure by SPR, as described above,

mode, corresponding to mode 1, as the carbonyl oxygen atom a prolonged reaction with a high concentration of PylRS

in the carbamate moiety of pAmPyLys hydrogen bonds with (Y306A/Y384F) produced the same levels of ZLys-tRNA^Pyland

the side-chain amide group of Asn346 (3.0 A) (Figure 6J). The mAzZLys-tRNA^Pyl(Figure 3). In contrast, a time course analysis

˚

entire pAmPyLys molecule is shifted within the range of 1 A, as using an in vitro aminoacylation assay revealed that the esteriﬁ-

compared with pNO₂ZLys. As a result, the para-amino group is cation of tRNA^Pylby the PylRS(Y306A/Y384F) mutant occurs

˚

located near the side chain of Asp408 (3.3 A), suggesting a more quickly with ZLys than mAzZLys in the initial 30 min of

weak hydrogen bond, whereas the pNO₂group did not exhibit the reaction (Figure 7). The speciﬁc activities of aminoacylation

Cell Chemical Biology 26, 1–14, July 18, 2019

9

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

(pmol aminoacyl-tRNA^Pylformed/pmol enzyme/min) for ZLys

In contrast to these meta- and para-substituted derivatives,

and mAzZLys by the PylRS(Y306A/Y384F) mutant are 0.165 ZLys, ZaeSeCys, and the ortho-substituted ZLys derivatives,

and 0.095 min^ꢁ1, respectively. These results suggest that the oClZLys, oBrZLys, and oAzZLys, exhibit the unusual double-

lysine derivatives bound in some modes can be aminoacylated binding mode (Figures 5, 6, and S6). One is mode 1, deﬁned by

by PylRS(Y306A/Y384F), and that the single or double-binding the hydrogen bond between the carbamate carbonyl group and

mode does not matter, if the PylRS active site can accommodate the Asn346 side chain. These amino acids with the unsubstituted

a sufﬁcient amount of the substrate amino acid.

and ortho-substituted benzene rings are shorter than the meta-

and para-substituted ones along the axis of the side-chain bind-

ing pocket of PylRS(Y306A/Y384F). The benzene ring with no

substituent at the meta/para position cannot reach the Leu407

DISCUSSION

In this study, we demonstrated the protein incorporation of non- wall at one end of the pocket, when the (ortho-substituted)

natural lysine derivatives with the pair of M. mazei PylRS(Y306A/ ZLys is bound in mode 1. In contrast, in the other binding

Y384F) and tRNA^Pyl, for 11 previously reported ones (ZLys, mode, the carbamate carbonyl and Asn346 amide groups are

ZaeSeCys, oClZLys, oAzZLys, mAzZLys, mTmdZLys, pAzZLys, too far apart to hydrogen bond with each other. Instead, the ben-

pTmdZLys, pNO₂ZLys, BCNLys, and TCO*Lys) and ﬁve new zene ring is largely shifted so that the para-CH contacts the

ones (oBrZLys, oEtZLys, mEtZLys, pEtZLys, and TeocLys) (Fig- Leu407 wall, which deﬁnes this alternative mode, designated

ure 1), in the E. coli cell-based and/or cell-free systems. Our as ‘‘mode 2.’’ Although these lysine derivatives with the double-

crystallographic and biochemical analyses revealed the struc- binding mode exhibited much lower afﬁnity for PylRSc(Y306A/

tural mechanisms by which M. mazei PylRS(Y306A/Y384F) rec- Y384F) by the SPR analysis (Figure S4), ZLys is rapidly aminoacy-

ognizes this large variety of non-natural lysine derivatives. The lated by PylRS(Y306A/Y384F) (Figure 7). It is very interesting that

Y306A mutation (Yanagisawa et al., 2008b) was rationally de- PylRS(Y306A/Y384F) accommodates such amino acids that are

signed to expand the amino acid binding pocket of M. mazei shorter than the meta/para-substituted ones in dynamic man-

PylRS for the accommodation of ZLys with the benzene ring ners. As in the case of mAzZLys, mTmdZLys, and pTmdZLys,

on top of the oxycarbonyllysine moiety (Figure 1), on the basis the alternative conformation of Met276 occurs with the bulky

of the crystal structure of M. mazei PylRSc in complex with pyr- oBrZLys and even more signiﬁcantly with the larger oAzZLys.

rolysine and AMPPNP (Yanagisawa et al., 2008a).

The shortest lysine derivative, TeocLys, exhibits the triple-

The present crystal structures of PylRSc(Y306A/Y384F) in binding mode, or an intermediate mode, 1.5, in addition to

complex with the meta-substituted ZLys derivatives, mAzZLys, modes 1 and 2. In mode 1, TeocLys forms the hydrogen bond

mTmdZLys, and mEtZLys, represent the standard binding between the carbamate carbonyl and Asn346 amide groups,

mode. First, the hydrophobic benzene ring is stacked with the and is closest to the ATP-binding site. Unlike ZLys and its deriv-

indole ring of Trp417. It should be noted here that the side chain atives, TeocLys cannot form the p-p stacking interaction with

of Ala306, which is introduced by the mutation of Tyr306, is the Trp417 indole ring. Instead, the trimethylsilyl group of

located on the other side of Trp417, and the wild-type Tyr306 TeocLys hydrophobically interacts with the indole ring, and rea-

side chain must sterically clash with the benzene ring. Second, ches Leu407 in mode 2. Intriguingly, modes 2 and 1.5 are

the meta-substituent of the benzene ring (one end of the side deﬁned by speciﬁc hydrogen bonds with Trp417 and Ala306,

chain) is positioned through the van der Waals contact with the respectively. Actually, the double-binding mode of a phenylala-

d2-methyl group of Leu407. The meta-substituents of mAzZLys nine derivative in the PylRS structure has been reported (Guo

and mTmdZLys sterically give rise to an alternative conformation et al., 2014). The alternative binding mode is non-productive,

of the side chain of Met276. Thus, the long side chain is snugly and is caused by new hydrogen bonds derived from the muta-

accommodated in the hydrophobic side chain binding pocket tions of PylRS to enable the recognition of phenylalanine

of PylRS(Y306A/Y384F). The lysine moiety extends toward the derivatives.

ATP-binding site, through the hydrogen bonding of the carbonyl

In contrast, BCNLys and TCO*Lys exhibit the single-binding

group of the oxycarbonyllysine moiety with the side-chain amide mode, which is mode 1 according to the carbamate carbonyl-

group of Asn346, which deﬁnes ‘‘mode 1,’’ or the productive Asn346 amide hydrogen bond, as with the meta/para-substituted

binding mode.

ZLys derivatives. BCNLys and TCO*Lys, like TeocLys, lack the

The binding modes of the para-substituted ZLys derivatives, p-p stacking with the Trp417 indole ring. Furthermore, the cyclo-

pTmdZLys and pNO₂ZLys, in their crystal structures with PylRSc octyne and trans-cyclooctene moieties of BCNLys and TCO*Lys,

(Y306A/Y384F) are mode 1, according to the mode-deﬁning respectively, do not reach Leu407, a part of the wall. Instead,

hydrogen bond between the carbonyl group of the carbamate these eight-membered rings have a larger volume than the ben-

moiety and the Asn346 side chain. The benzene ring retains zene ring, and can interact hydrophobically with the methyl group

the stacking with the Trp417 indole ring, but is rotated and brings of Ala306, and simultaneously with the Trp417 indole ring (Fig-

the para-substituent to a position similar to that of the meta-sub- ure S7). Therefore, the single-binding mode of BCNLys and

stituent in the above case. Thus, the para-substituent contacts TCO*Lys is not caused by Leu407, but actually by Ala306.

the d2-methyl group of Leu407. The alternative conformation of

Thus, we have established the precise structural bases of the

Met276 was observed for both pTmdZLys and mTmdZLys. accommodation of a wide range of non-natural lysine derivatives

These structures have established how PylRS(Y306A/Y384F) in the amino acid binding site of M. mazei PylRS(Y306A/Y384F).

achieves the snug accommodation of the two types of ZLys In particular, our ﬁnding of the double- and triple-binding modes

derivatives, by adapting to the positional differences of the in addition to the conventional single-binding mode, was quite

meta- and para-substituents.

intriguing. When coupled with more enzyme kinetics data, the

10 Cell Chemical Biology 26, 1–14, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

present structural bases will be useful for the design of novel PylRS(Y306A/Y384F) catalytic fragments complexed with

functional amino acids as substrates of M. mazei PylRS 14 non-natural lysine derivatives, to clarify the structural ba-

(Y306A/Y384F).

sis for the broad substrate speciﬁcity. The meta- and para-

Further structure-based engineering of M. mazei PylRS substituted ZLys derivatives are snugly accommodated in

(Y306A/Y384F) should enable the more efﬁcient incorporation the binding pocket of PylRS(Y306A/Y384F), which repre-

of non-natural amino acids and the expansion of the genetic sents the productive mode (mode 1). In contrast, ZLys and

code with larger or bulkier amino acids. The mutated positions the unsubstituted or ortho-substituted ZLys derivatives ex-

of M. mazei and/or M. barkeri PylRSs for non-natural amino hibited a double-binding mode: an alternative, non-produc-

acid incorporation are summarized in a review by Wan et al. tive binding mode in addition to the productive mode. The

(2014). In addition to the listed active-site residues, Met276, double-binding mode of PylRS(Y306A/Y384F) hardly affects

Leu301, A302, Leu305, Tyr306, Tyr309, Asn346, Cys348, aminoacylation as the aminoacylation rate is high for ZLys.

Met350, Tyr384, Val401, and Trp417 (Wan et al., 2014), we pro- These precise structural mechanisms of the recognitions

pose the mutagenesis of Ile405, Leu407, Trp411, and Ile413, of the substrate lysine derivatives by PylRS(Y306A/Y384F)

which form the hydrophobic pocket in the active site of PylRS may facilitate the structure-based rational design of novel

(the numbering is for M. mazei PylRS), for the incorporation of useful non-natural amino acids for genetic-code expansion.

a larger variety of amino acids. We also suggest the mutations We also demonstrated the usefulness of cell-free protein

of Gly378-Thr387, which constitute half of the b7-b8 hairpin of synthesis for the incorporation of an amino acid that is

PylRS, to overcome the current size limitations of non-natural poorly incorporated in vivo.

amino acids. For instance, lysine derivatives longer than

pTmdZLys cannot be accommodated with straight side chains,

because of the steric hindrance with the main chains constituting

the active site, but hopefully would bind to the pocket expanded

by these proposed mutations by assuming a bent conformation.

In addition, we have demonstrated that the cell-free protein

synthesis method is practically useful, with many advantages

for incorporating non-natural amino acids over the E. coli

cell-based system, such as excluding the negative factors in

the cell membrane permeability of non-natural amino acids,

achieving high productivities of non-natural amino acid-contain-

ing proteins comparable with those of ordinary cell-based

recombinant systems, consuming smaller quantities of non-

natural amino acids for incorporation than the cell-based sys-

tem, and synthesizing toxic proteins and membrane proteins

containing non-natural amino acids that cannot be produced in

the cell-based system (Seki et al., 2018).

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

d KEY RESOURCES TABLE

d CONTACT FOR REAGENT AND RESOURCES SHARING

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

d METHOD DETAILS

B E. coli Cell-Based Protein Synthesis and Puriﬁcation of

the T7-GST Proteins Containing Non-natural

Amino Acids

B Preparation

PylRS(Y306A/Y384F)

B Aminoacylation Assay

of

M.

mazei

tRNA^Pyl

and

B Surface Plasmon Resonance Analysis of the Binding

between M. mazei PylRSc(Y306A/Y384F) and Lysine

Derivatives

SIGNIFICANCE

B Cell-free Protein Synthesis and Puriﬁcation of GFP

Proteins Containing Non-natural Amino Acids

B Cloning, Expression, and Puriﬁcation of the C-terminal

Catalytic Fragment of M. mazei PylRS with the Y306A

and Y384F Mutations

Genetic-code expansion has become a useful technology to

incorporate a non-natural amino acid site speciﬁcally into a

target protein for structural and functional analyses.

Archaeal pyrrolysyl-tRNA synthetase (PylRS) and tRNA^Pyl

are extensively used for genetic-code expansion. The Meth-

anosarcina mazei PylRS mutant bearing the Y306A and

Y384F mutations, PylRS(Y306A/Y384F), has broad substrate

speciﬁcity, and is one of the most widely used enzymes for

the genetic encoding of a variety of large non-natural lysine

derivatives, as well as the naturally occurring post-transla-

tionally modiﬁed lysines, at UAG codons. In this study, we

analyzed the mechanisms underlying the broad amino acid

speciﬁcity of PylRS(Y306A/Y384F). First, 17 non-natural

lysine derivatives, including various functional groups for

click chemistry, photo-crosslinking, etc., were compared

with respect to in vivo protein incorporation and in vitro ami-

noacylation of tRNA^Pyl. N ³-(benzyloxycarbonyl)lysine (ZLys),

and 10 ZLys derivatives with a substitution at the ortho,

meta, or para position of the benzene ring were efﬁciently

ligated to tRNA^Pyland incorporated into proteins by PylRS

(Y306A/Y384F). We determined the crystal structures of the

B Crystallization, Data Collection, and Structure Determi-

nation

B Chemical Syntheses of Non-natural Amino Acids

d QUANTIFICATION AND STATISTICAL ANALYSIS

d DATA AND SOFTWARE AVAILABILITY

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at https://doi.org/10.1016/j.

chembiol.2019.03.008.

ACKNOWLEDGMENTS

We would like to thank Dr. Kunio Hirata (RIKEN Harima), Dr. Yoshiaki Kawano

(RIKEN Harima), and the staff of the beamlines BL26B2, BL32XU, and BL41XU

at SPring-8 (Harima, Japan). We would like to thank Dr. Takaho Terada,

Takako Imada, and Tomoko Nakayama for clerical assistance. We are grateful

to Drs. Seisuke Kusano, Misaki Moriya, Tomomi Sumida, and Shunsuke

Tagami (RIKEN) for the BIAcore analysis. We thank Kaori Ohtsuki, Masaya

Cell Chemical Biology 26, 1–14, July 18, 2019 11

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

Usui, and Aya Abe (RIKEN BSI) for the MS analysis. We thank Dr. Ryohei Ishii

for assistance with the structural analysis. We thank Dr. Seiji Takashima

(Osaka University) for providing mTmdZLys. This work was supported by Plat-

form Project for Supporting Drug Discovery and Life Science Research (Basis

for Supporting Innovative Drug Discovery and Life Science Research [BINDS])

from AMED, Japan under grant no. JP17am0101081 and by The Uehara Me-

morial Foundation (SY). T.Y. was also supported by a grant from MEXT, Japan

(grant no. 24550203).

Chumpolkulwong, N., Hori-Takemoto, C., Hosaka, T., Inaoka, T., Kigawa, T.,

Shirouzu, M., Ochi, K., and Yokoyama, S. (2004). Effects of Escherichia coli

ribosomal protein S12 mutations on cell-free protein synthesis. Eur. J.

Biochem. 271 , 1127–1134.

ꢀ

¨

Crnkovic, A., Suzuki, T., Soll, D., and Reynolds, N.M. (2016). Pyrrolysyl-tRNA

synthetase, an aminoacyl-tRNA synthetase for genetic code expansion.

Croat. Chem. Acta 89 , 163–174.

Collaborative Computational Project, Number 4 (1994). The CCP4 suite: pro-

grams for protein crystallography. Acta Crystallogr. D Biol. Crystallogr. D50 ,

760–763.

AUTHOR CONTRIBUTIONS

Davis, I.W., Leaver-Fay, A., Chen, V.B., Block, J.N., Kapral, G.J., Wang, X.,

Murray, L.W., Arendall, W.B., 3rd, Snoeyink, J., Richardson, J.S., et al.

(2007). MolProbity: all-atom contacts and structure validation for proteins

and nucleic acids. Nucleic Acids Res. 35 , W375–W383.

T.Y. and S.Y. conceived and designed the experiments. M.K. performed the

crystallization experiments and crystallographic analyses. T.Y. performed

the biochemical experiments and crystallographic analyses. E.S. performed

the cell-free protein synthesis experiments. M.K., T.Y., E.S., N.H., K.S., and

S.Y. analyzed the data. M.K., T.Y., and S.Y. wrote the paper.

Elliott, T.S., Bianco, A., and Chin, J.W. (2014). Genetic code expansion and

bioorthogonal labelling enables cell speciﬁc proteomics in an animal. Curr.

Opin. Chem. Biol. 21, 154–160.

DECLARATION OF INTERESTS

Emsley, P., and Cowtan, K. (2004). Coot: model-building tools for molecular

T.Y., N.H., K.S., and S.Y. are co-inventors on related patents to this work.

S.Y. is a founder and shareholder of LiberoThera.

graphics. Acta Crystallogr. D Biol. Crystallogr. D60 , 2126–2132.

¨

Englert, M., Nakamura, A., Wang, Y.S., Eiler, D., Soll, D., and Guo, L.T. (2015).

Probing the active site tryptophan of Staphylococcus aureus thioredoxin with

an analog. Nucleic Acids Res. 43 , 11061–11067.

Received: August 24, 2018

Revised: December 25, 2018

Accepted: March 15, 2019

Published: April 25, 2019

Eriani, G., Delarue, M., Poch, O., Gangloff, J., and Moras, D. (1990). Partition of

tRNA synthetases into two classes based on mutually exclusive sets of

sequence motifs. Nature 347 , 203–206.

REFERENCES

€

Flugel, V., Vrabel, M., and Schneider, S. (2014). Structural basis for the site-

speciﬁc incorporation of lysine derivatives into proteins. PLoS One 9 , e96198.

´

Adams, P.D., Afonine, P.V., Bunkoczi, G., Chen, V.B., Davis, I.W., Echols, N.,

Ge, Y., Fan, X., and Chen, P.R. (2016). A genetically encoded multifunctional

unnatural amino acid for versatile protein manipulations in living cells. Chem.

Sci. 7 , 7055–7060.

Headd, J.J., Hung, L.-W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010).

PHENIX: a comprehensive Python-based system for macromolecular struc-

ture solution. Acta Crystallogr. D Biol. Crystallogr. D66 , 213–221.

Guo, L.T., Wang, Y.S., Nakamura, A., Eiler, D., Kavran, J.M., Wong, M.,

Ai, H.W., Shen, W., Sagi, A., Chen, P.R., and Schultz, P.G. (2011). Probing pro-

tein-protein interactions with a genetically encoded photo-crosslinking amino

acid. ChemBioChem 12 , 1854–1857.

¨

Kiessling, L.L., Steitz, T.A., O’Donoghue, P., and Soll, D. (2014). Polyspeciﬁc

pyrrolysyl-tRNA synthetases from directed evolution. Proc. Natl. Acad. Sci.

U S A 111 , 16724–16729.

¨

Ambrogelly, A., Gundllapalli, S., Herring, S., Polycarpo, C., Frauer, C., and Soll,

Hao, B., Gong, W., Ferguson, T.K., James, C.M., Krzycki, J.A., and Chan, M.K.

(2002). A new UAG-encoded residue in the structure of a methanogen methyl-

transferase. Science 296 , 1462–1466.

D. (2007). Pyrrolysine is not hardwired for cotranslational insertion at UAG

codons. Proc. Natl. Acad. Sci. U S A 104 , 3141–3146.

Blackman, M.L., Royzen, M., and Fox, J.M. (2008). Tetrazine ligation: fast

bioconjugation based on inverse-electron-demand Diels-Alder reactivity.

J. Am. Chem. Soc. 130 , 13518–13519.

Herring, S., Ambrogelly, A., Gundllapalli, S., O’Donoghue, P., Polycarpo, C.R.,

¨

and Soll, D. (2007). The amino-terminal domain of pyrrolysyl-tRNA synthetase

is dispensable in vitro but required for in vivo activity. FEBS Lett. 581 ,

Blight, S.K., Larue, R.C., Mahapatra, A., Longstaff, D.G., Chang, E., Zhao, G.,

Kang, P.T., Green-Church, K.B., Chan, M.K., and Krzycki, J.A. (2004). Direct

charging of tRNA(CUA) with pyrrolysine in vitro and in vivo. Nature 431 ,

333–335.

3197–3203.

Hino, N., Okazaki, Y., Kobayashi, T., Hayashi, A., Sakamoto, K., and

Yokoyama, S. (2005). Protein photo-cross-linking in mammalian cells by

site-speciﬁc incorporation of a photoreactive amino acid. Nat. Methods 2 ,

201–206.

Borrmann, A., Milles, S., Plass, T., Dommerholt, J., Verkade, J.M., Wiessler,

M., Schultz, C., van Hest, J.C., van Delft, F.L., and Lemke, E.A. (2012).

Genetic encoding of a bicyclo[6.1.0]nonyne-charged amino acid enables

fast cellular protein imaging by metal-free ligation. ChemBioChem 13 ,

2094–2099.

Hino, N., Oyama, M., Sato, A., Mukai, T., Iraha, F., Hayashi, A., Kozuka-Hata,

H., Yamamoto, T., Yokoyama, S., and Sakamoto, K. (2011). Genetic incorpo-

ration of a photo-crosslinkable amino acid reveals novel protein complexes

with GRB2 in mammalian cells. J. Mol. Biol. 406 , 343–353.

Brabham, R., and Fascione, M.A. (2017). Pyrrolysine amber stop-codon sup-

pression: development and applications. Chembiochem 18 , 1973–1983.

¨

Ibba, M., and Soll, D. (2000). Aminoacyl-tRNA synthesis. Annu. Rev. Biochem.

69 , 617–650.

Chen, P.R., Groff, D., Guo, J., Ou, W., Cellitti, S., Geierstanger, B.H., and

Schultz, P.G. (2009). A facile system for encoding unnatural amino acids in

mammalian cells. Angew. Chem. Int. Ed. 48 , 4052–4055.

Jiang, R., and Krzycki, J.A. (2012). PylSn and the homologous N-terminal

domain of pyrrolysyl-tRNA synthetase bind the tRNA that is essential for the

genetic encoding of pyrrolysine. J. Biol. Chem. 287 , 32738–32746.

Chin, J.W., Martin, A.B., King, D.S., Wang, L., and Schultz, P.G. (2002).

Addition of

a photocrosslinking amino acid to the genetic code of

Kabsch, W. (2010). XDS. Acta Crystallogr. D Biol. Crystallogr. D66 , 125–132.

Escherichia coli . Proc. Natl. Acad. Sci. U S A 99 , 11020–11024.

Katayama, H., Nozawa, K., Nureki, O., Nakahara, Y., and Hojo, H. (2012).

Pyrrolysine analogs as substrates for bacterial pyrrolysyl-tRNA synthetase

in vitro and in vivo. Biosci. Biotechnol. Biochem. 76 , 205–208.

Chin, J.W., Cropp, T.A., Anderson, J.C., Mukherji, M., Zhang, Z., and Schultz,

P.G. (2003). An expanded eukaryotic genetic code. Science 301 , 964–967.

Chin, J.W. (2014). Expanding and reprogramming the genetic code of cells and

Kato, A., Kuratani, M., Yanagisawa, T., Ohtake, K., Hayashi, A., Amano, Y.,

Kimura, K., Yokoyama, S., Sakamoto, K., and Shiraishi, Y. (2017). Extensive

survey of antibody invariant positions for efﬁcient chemical conjugation using

expanded genetic codes. Bioconjug. Chem. 28 , 2099–2108.

animals. Annu. Rev. Biochem. 83 , 379–408.

Chin, J.W. (2017). Expanding and reprogramming the genetic code. Nature

550 , 53–60.

12 Cell Chemical Biology 26, 1–14, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

¨

Kavran, J., Gundliapalli, S., O’Donoghue, P., Englert, M., Soll, D., and Steitz,

Polycarpo, C., Ambrogelly, A., Berube, A., Winbush, S., McCloskey, J., Crain,

¨

P., Wood, J., and Soll, D. (2004). An aminoacyl-tRNA synthetase that specif-

T.A. (2007). Structure of pyrrolysyl-tRNA synthetase, an archaeal enzyme for

genetic code innovation. Proc. Natl. Acad. Sci. U S A 104 , 11268–11273.

ically activates pyrrolysine. Proc. Natl. Acad. Sci. U S A 101 , 12450–12454.

Kiga, D., Sakamoto, K., Kodama, K., Kigawa, T., Matsuda, T., Yabuki, T.,

Shirouzu, M., Harada, Y., Nakayama, H., Takio, K., et al. (2002). An engineered

Escherichia coli tyrosyl-tRNA synthetase for site-speciﬁc incorporation of an

unnatural amino acid into proteins in eukaryotic translation and its application

in a wheat germ cell-free system. Proc. Natl. Acad. Sci. U S A 99 , 9715–9720.

Ruff, M., Krishnaswamy, S., Boeglin, M., Poterszman, A., Mitschler, A.,

Podjarny, A., Rees, B., Thierry, J.C., and Moras, D. (1991). Class II aminoacyl

transfer RNA synthetases: crystal structure of yeast aspartyl-tRNA synthetase

complexed with tRNA(Asp). Science 252 , 1682–1689.

Sakamoto, K., Hayashi, A., Sakamoto, A., Kiga, D., Nakayama, H., Soma, A.,

Kobayashi, T., Kitabatake, M., Takio, K., Saito, K., et al. (2002). Site-speciﬁc

incorporation of an unnatural amino acid into proteins in mammalian cells.

Nucleic Acids Res. 30 , 4692–4699.

Kigawa, T., Yabuki, T., Matsuda, N., Matsuda, T., Nakajima, R., Tanaka, A.,

and Yokoyama, S. (2004). Preparation of Escherichia coli cell extract for highly

productive cell-free protein expression. J. Struct. Funct. Genomics 5 , 63–68.

Schmidt, M.J., Weber, A., Pott, M., Welte, W., and Summerer, D. (2014).

Structural basis of furan-amino acid recognition by a polyspeciﬁc aminoacyl-

tRNA-synthetase and its genetic encoding in human cells. ChemBioChem 15 ,

1755–1760.

Kiick, K.L., Saxon, E., Tirrell, D.A., and Bertozzi, C.R. (2002). Incorporation of

azides into recombinant proteins for chemoselective modiﬁcation by the

Staudinger ligation. Proc. Natl. Acad. Sci. U S A 99 , 19–24.

Kita, A., Hino, N., Higashi, S., Hirota, K., Narumi, R., Adachi, J., Takafuji, K.,

Ishimoto, K., Okada, Y., Sakamoto, K., et al. (2016). Adenovirus vector-based

incorporation of a photo-cross-linkable amino acid into proteins in human pri-

mary cells and cancerous cell lines. Sci. Rep. 6 , 36946.

€

Schneider, S., Gattner, M.J., Vrabel, M., Flugel, V., L o ´ pez-Carrillo, V., Prill, S.,

and Carell, T. (2013). Structural insights into incorporation of norbornene

amino acids for click modiﬁcation of proteins. ChemBioChem 14 , 2114–2118.

Seki, E., Matsuda, N., Yokoyama, S., and Kigawa, T. (2008). Cell-free protein

synthesis system from Escherichia coli cells cultured at decreased tempera-

tures improves productivity by decreasing DNA template degradation. Anal.

Biochem. 377 , 156–161.

Kolb, H.C., Finn, M.G., and Sharpless, K.B. (2001). Click Chemistry: diverse

chemical function from a few good reactions. Angew. Chem. Int. Ed. 40 ,

2004–2021.

Lang, K., Davis, L., Wallace, S., Mahesh, M., Cox, D.J., Blackman, M.L., Fox,

J.M., and Chin, J.W. (2012). Genetic encoding of bicyclononynes and trans-

cyclooctenes for site-speciﬁc protein labeling in vitro and in live mammalian

cells via rapid ﬂuorogenic Diels-Alder reactions. J. Am. Chem. Soc. 134 ,

10317–10320.

Seki, E., Yanagisawa, T., and Yokoyama, S. (2018). Cell-free protein synthesis

for site-speciﬁc incorporation of non-canonical amino acids using cell extract

from RF-1 deﬁcient Escherichia coli strains. Methods Mol. Biol. 1728 , 49–65.

Srinivasan, G., James, C.M., and Krzycki, J.A. (2002). Pyrrolysine encoded by

UAG in Archaea: charging of a UAG-decoding specialized tRNA. Science 296 ,

1459–1462.

Lang, K., and Chin, J.W. (2014a). Cellular incorporation of unnatural amino

acids and bioorthogonal labeling of proteins. Chem. Rev. 114 , 4764–4806.

Suzuki, T., Miller, C., Guo, L.T., Ho, J.M.L., Bryson, D.I., Wang, Y.S., Liu, D.R.,

and S o ¨ ll, D. (2017). Crystal structures reveal an elusive functional domain of

pyrrolysyl-tRNA synthetase. Nat. Chem. Biol. 13 , 1261–1266.

Lang, K., and Chin, J.W. (2014b). Bioorthogonal reactions for labeling proteins.

ACS Chem. Biol. 9 , 16–20.

Lee, M.M., Jiang, R., Jain, R., Larue, R.C., Krzycki, J., and Chan, M.K. (2008).

Structure of Desulﬁtobacterium hafniense PylSc, a pyrrolysyl-tRNA synthe-

tase. Biochem. Biophys. Res. Commun. 374 , 470–474.

Takimoto, J.K., Dellas, N., Noel, J.P., and Wang, L. (2011). Stereochemical ba-

sis for engineered pyrrolysyl-tRNA synthetase and the efﬁcient in vivo incorpo-

ration of structurally divergent non-native amino acids. ACS Chem. Biol. 6 ,

733–743.

Lee, Y.J., Schmidt, M.J., Tharp, J.M., Weber, A., Koenig, A.L., Zheng, H., Gao,

J., Waters, M.L., Summerer, D., and Liu, W.R. (2016). Genetically encoded ﬂu-

orophenylalanines enable insights into the recognition of lysine trimethylation

by an epigenetic reader. Chem. Commun. (Camb.) 52 , 12606–12609.

Tharp, J.M., Ehnbom, A., and Liu, W.R. (2018). tRNA^Pyl: structure, function,

and applications. RNA Biol. 15 , 441–452.

Uttamapinant, C., Tangpeerachaikul, A., Grecian, S., Clarke, S., Singh, U.,

Slade, P., Gee, K.R., and Ting, A.Y. (2012). Fast, cell-compatible click chem-

istry with copper-chelating azides for biomolecular labeling. Angew. Chem.

Int. Ed. 51 , 5852–5856.

Liu, C.C., and Schultz, P.G. (2010). Adding new chemistries to the genetic

code. Annu. Rev. Biochem. 79 , 413–444.

Mukai, T., Kobayashi, T., Hino, N., Yanagisawa, T., Sakamoto, K., and

Yokoyama, S. (2008). Adding L-lysine derivatives to the genetic code of

mammalian cells with engineered pyrrolysyl-tRNA synthetases. Biochem.

Biophys. Res. Commun. 371 , 818–822.

ꢀ

Vargas-Rodriguez, O., Sevostyanova, A., S o ¨ ll, D., and Crnkovic, A. (2018).

Upgrading aminoacyl-tRNA synthetases for genetic code expansion. Curr.

Opin. Chem. Biol. 46 , 115–122.

Mukai, T., Yanagisawa, T., Ohtake, K., Wakamori, M., Adachi, J., Hino, N.,

Sato, A., Kobayashi, T., Hayashi, A., Shirouzu, M., et al. (2011). Genetic-

code evolution for protein synthesis with non-natural amino acids. Biochem.

Biophys. Res. Commun. 411 , 757–761.

Virdee, S., Kapadnis, P.B., Elliott, T., Lang, K., Madrzak, J., Nguyen, D.P.,

Riechmann, L., and Chin, J.W. (2011). Traceless and site-speciﬁc ubiquitina-

tion of recombinant proteins. J. Am. Chem. Soc. 133 , 10708–10711.

Wan, W., Tharp, J.M., and Liu, W.R. (2014). Pyrrolysyl-tRNA synthetase: an

ordinary enzyme but an outstanding genetic code expansion tool. Biochim.

Biophys. Acta 1844 , 1059–1070.

Neumann, H., Peak-Chew, S.Y., and Chin, J.W. (2008). Genetically encoding

N(epsilon)-acetyllysine in recombinant proteins. Nat. Chem. Biol. 4 , 232–234.

Nguyen, D.P., Lusic, H., Neumann, H., Kapadnis, P.B., Deiters, A., and Chin,

J.W. (2009). Genetic encoding and labeling of aliphatic azides and alkynes in

recombinant proteins via a pyrrolysyl-tRNA synthetase/tRNA(CUA) pair and

click chemistry. J. Am. Chem. Soc. 131 , 8720–8721.

Wang, L., and Schultz, P.G. (2001). A general approach for the generation of

orthogonal tRNAs. Chem. Biol. 8 , 883–890.

Wang, L., Brock, A., and Schultz, P.G. (2002). Adding L-3-(2-naphthyl)alanine

to the genetic code of E. coli . J. Am. Chem. Soc. 124 , 1836–1837.

Nguyen, T.A., Cigler, M., and Lang, K. (2018). Expanding the genetic code to

study protein-protein interactions. Angew. Chem. Int. Ed. 57 , 14350–14361.

Wang, L., Xie, J., and Schultz, P.G. (2006). Expanding the genetic code. Annu.

Rev. Biophys. Biomol. Struct. 35 , 225–249.

ꢀ

Nikic, I., Plass, T., Schraidt, O., Szymanski, J., Briggs, J.A., Schultz, C., and

Lemke, E.A. (2014). Minimal tags for rapid dual-color live-cell labeling and

super-resolution microscopy. Angew. Chem. Int. Ed. 53 , 2245–2249.

Wang, L. (2017). Engineering the genetic code in cells and animals: biological

considerations and impacts. Acc. Chem. Res. 50 , 2767–2775.

Nozawa, K., O’Donoghue, P., Gundllapalli, S., Araiso, Y., Ishitani, R., Umehara,

Wang, Z.U., Wang, Y.S., Pai, P.J., Russell, W.K., Russell, D.H., and Liu, W.R.

(2012). A facile method to synthesize histones with posttranslational modiﬁca-

tion mimics. Biochemistry 51 , 5232–5234.

¨

T., Soll, T., and Nureki, O. (2009). Pyrrolysyl-tRNA synthetase-tRNA(Pyl) struc-

ture reveals the molecular basis of orthogonality. Nature 457 , 1163–1167.

ꢀ

Plass, T., Milles, S., Koehler, C., Szymanski, J., Mueller, R., Wiessler, M.,

Yamaguchi, A., Matsuda, T., Ohtake, K., Yanagisawa, T., Yokoyama, S.,

Fujiwara, Y., Watanabe, T., Hohsaka, T., and Sakamoto, K. (2016).

Incorporation of a doubly functionalized synthetic amino acid into proteins

Schultz, C., and Lemke, E.A. (2012). Amino acids for Diels-Alder reactions in

living cells. Angew. Chem. Int. Ed. 51 , 4166–4170.

Cell Chemical Biology 26, 1–14, July 18, 2019 13

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

for creating chemical and light-induced conjugates. Bioconjug. Chem. 27 ,

encoded N(epsilon)-(benzyloxycarbonyl)lysine derivative with a diazirinyl moi-

198–206.

ety. Mol. Biosyst. 8 , 1131–1135.

Yanagisawa, T., Sumida, T., Ishii, R., and Yokoyama, S. (2013). A novel crystal

form of pyrrolysyl-tRNA synthetase reveals the pre- and post-aminoacyl-tRNA

synthesis conformational states of the adenylate and aminoacyl moieties and

an asparagine residue in the catalytic site. Acta Crystallogr. D Biol. Crystallogr.

D69 , 5–15.

Yanagisawa, T., Ishii, R., Fukunaga, R., Nureki, O., and Yokoyama, S. (2006).

Crystallization and preliminary X-ray crystallographic analysis of the catalytic

domain of pyrrolysyl-tRNA synthetase from the methanogenic archaeon

Methanosarcina mazei . Acta Crystallogr. F Struct. Biol. Cryst. Commun. F62 ,

1031–1033.

Yanagisawa, T., Takahashi, M., Mukai, T., Sato, S., Wakamori, M., Shirouzu,

M., Sakamoto, K., Umehara, T., and Yokoyama, S. (2014a). Multiple site-spe-

ciﬁc installations of N(epsilon)-monomethyl-L-lysine into histone proteins by

cell-based and cell-free protein synthesis. ChemBioChem 15 , 1830–1838.

Yanagisawa, T., Ishii, R., Fukunaga, R., Kobayashi, T., Sakamoto, K., and

Yokoyama, S. (2008a). Crystallographic studies on multiple conformational

states of active-site loops in pyrrolysyl-tRNA synthetase. J. Mol. Biol. 378 ,

634–652.

Yanagisawa, T., Umehara, T., Sakamoto, K., and Yokoyama, S. (2014b).

Expanded genetic code technologies for modiﬁed lysine installation at multiple

sites. ChemBioChem 15 , 2181–2187.

Yanagisawa, T., Ishii, R., Fukunaga, R., Kobayashi, T., Sakamoto, K., and

Yokoyama, S. (2008b). Multistep engineering of pyrrolysyl-tRNA synthetase

to genetically encode N(epsilon)-(o-azidobenzyloxycarbonyl) lysine for site-

speciﬁc protein modiﬁcation. Chem. Biol. 15 , 1187–1197.

Yokoyama, S., Sakamoto, K., Yanagisawa, T., and Kobayashi, T. (2010).

Mutant pyrrolysyl-tRNA synthetase, and method for production of protein

having non-natural amino acid integrated therein by using the same. US

Patent 20100267087 A1.

Yanagisawa, T., Hino, N., Iraha, F., Mukai, T., Sakamoto, K., and Yokoyama, S.

(2012). Wide-range protein photo-crosslinking achieved by a genetically

14 Cell Chemical Biology 26, 1–14, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE

Antibodies

SOURCE

IDENTIFIER

Anti-GST antibody

donkey anti-goat IgG-HRP

Bacterial and Virus Strains

E.coli BL21-Gold(DE3)

E.coli BL21(DE3)

E. coli Rosetta(DE3)

Chemicals, Peptides, and Recombinant Proteins

ZLys

GE Healthcare

Cat#27-4577-01; RRID: AB_771432

Cat#sc-2354; RRID: AB_628490

Santa Cruz Biotechnology

Agilent Technologies Inc.

Novagen

Cat#230132

Cat#230130

Cat#70954-3CN

Bachem

Cat#E-1702

N/A

ZaeSeCys

N^a-Boc-oBrZLys

Sundia/Namiki

Bachem

Cat#A-1415

Cat#E-2725

N/A

oClZLys

Bachem

oAzZLys

Shinsei Chemical

Sundia/Namiki

oEtZLys

N/A

mAzZLys

N/A

mEtZLys

N/A

mTmdZLys

Sundia, Shinsei Chemical, and

Dr. Takashima (Osaka Univ.)

N/A

pNO₂ZLys

Bachem

Cat#E-2960

N/A

pAzZLys

Sundia/Namiki

Sundia, and Shinsei Chemical

Shinsei Chemical

Synnaﬁx

pEtZlys

N/A

pTmdZLys

N/A

pAmPyLys

N/A

BCNLys

Cat#SX-A2011

Cat#SC-8008

Cat#FK2387

Cat#A2383

Cat#G8877

Cat#C1506

Cat#U6875

Cat#G8377

Cat#10108987001

N/A

TCO*Lys

N^a-Fmoc-TeocLys

SciChem

Advanced ChemTech

Sigma-Aldrich

Yanagisawa et al., 2008a

Hampton Research

Nacalai

ATP

GTP

CTP

UTP

GMP

Pyrophosphatase

T7 RNA polymerase

HEPES

Cat#HR2-729

Cat#35401-25

Cat#6132-04-3

Cat#HR2-601

Cat#C4706

Cat#14112-52

Cat#27084601

Cat#S2501

Cat#EI05931

Cat#A9418

Cat#17050-72

Cat#21417-65

(Continued on next page)

Tris(hydroxymethyl)aminomethane (Tris)

Sodium citrate

Nacalai

PEG200

Hampton Research

Sigma-Aldrich

Nacalai

Tris(2-carboxyethyl)phosphine hydrochloride (TCEP)

Dithiothreitol (DTT)

Thrombin

GE Healthcare

Sigma-Aldrich

Carbosynth

Spermidine trihydrochloride

b-D-thiogalactopyranoside (IPTG)

Bovine Serum Albumin (BSA)

L-Glutathione reduced form

b-mercaptoethanol

Sigma-Aldrich

Nacalai

Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019 e1

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

Continued

REAGENT or RESOURCE

SOURCE

IDENTIFIER

cOmplete EDTA-free Protease Inhibitor Cocktail

PrimeSTAR Max DNA Polymerase

Roche (Sigma-Aldrich)

TAKARA

Cat#11873580001

Cat#R045A

Deposited Data

M. mazei PylRSc(Y306A/Y384F)/mAzZLys complex

M. mazei PylRSc(Y306A/Y384F)/mTmdZLys complex

M. mazei PylRSc(Y306A/Y384F)/mEtZLys complex

M. mazei PylRSc(Y306A/Y384F)/TCO*Lys complex

M. mazei PylRSc(Y306A/Y384F)/ZaeSeCys complex

M. mazei PylRSc(Y306A/Y384F)/BCNLys complex

M. mazei PylRSc(Y306A/Y384F)/pNO₂ZLys complex

M. mazei PylRSc(Y306A/Y384F)/pAmPyLys complex

M. mazei PylRSc(Y306A/Y384F)/oAzZLys complex

M. mazei PylRSc(Y306A/Y384F)/oClZLys complex

M. mazei PylRSc(Y306A/Y384F)/ZLys complex

M. mazei PylRSc(Y306A/Y384F)/TeocLys complex

M. mazei PylRSc(Y306A/Y384F)/oBrZLys complex

M. mazei PylRSc(Y306A/Y384F)/pTmdZLys complex

M. mazei PylRSc/pyrrolysyl-AMP complex

Oligonucleotides

This study

Kavran et al., 2007

PDB: 6AAC

PDB: 6AAD

PDB: 6AAN

PDB: 6AAO

PDB: 6AAP

PDB: 6AAQ

PDB: 6AAZ

PDB: 6AB0

PDB: 6AB1

PDB: 6AB2

PDB: 6AB8

PDB: 6ABK

PDB: 6ABL

PDB: 6ABM

PDB: 2ZIM

For preparing M. mazei tRNA^Pyltemplate

AAGCTTAATACGACTCACTATAGGAAACCT

TGGCGGAAACCCCGGGAATCTAACCCGGCTGA

For cloning M. mazei PylRS(Y306A/Y384F)

AGGAGATATACCATGGATAAAAAACCACTAAACACTCTGATATC

CGTGTACACGAGCTCTTACAGGTTGGTAGAAATCCCGTTATAGT

TCTACCAACCTGTAAGAGCTCGTGTACACGGCGCGCCTGCA

TAGTGGTTTTTTATCCATGGTATATCTCCTTATTAAAGTT

Recombinant DNA

Yanagisawa et al., 2008a

N/A

This study

N/A

pET-GST(25Am)

Yanagisawa et al., 2008b

This study

N/A

pCDF-Pyl-AFx2

pCDF-Pyl-Fx1 derivative, Yanagisawa

et al., 2014a

pCR2.1-N11GFPS1(17Am)

pET28-PylRSc(Y306A/Y384F)

pET28-PylRS(Y306A/Y384F)

pMINOR

Seki et al., 2008

N/A

This study

Yanagisawa et al., 2008b

Chumpolkulwong et al., 2004

Yanagisawa et al., 2008a

pUC19-tRNA^Pyl

Software and Algorithms

Phenix 1.9

Adams et al., 2010

https://www.phenix-online.org/

Coot ver. 8

Emsley and Cowtan, 2004

https://www2.mrc-lmb.cam.ac.uk/

personal/pemsley/coot/

XDS ver. November 3, 2014

ccp4 ver. 6.5

Kabsch, 2010

http://xds.mpimf-heidelberg.mpg.de/

http://www.ccp4.ac.uk/

Collaborative Computational

ProjectNumber 4, 1994

Pymol v0.99

Schrodinger, LLC

NIH

http://pymol.sourceforge.net/

ImageJ

https://imagej.nih.gov/ij/index.html

http://molprobity.biochem.duke.edu/

Molprobity

Davis et al., 2007

Other

Ni-Sepharose High Performance

HisTrap HP Column

GE Healthcare

Cat#17526801

Cat#17524701

(Continued on next page)

e2 Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

Continued

REAGENT or RESOURCE

HiLoad 16/600 Superdex 200 pg Column

Glutathione Sepharose High Performance

Resource S Column

SOURCE

IDENTIFIER

GE Healthcare

Cat#28989335

Cat#17527901

Cat#17118001

Cat#17117901

Cat#BR100399

Cat#BR100368

Cat#BR100050

Resource Q Column

Sensor Chip CM5

HBS-P running buffer

N-hydroxysuccinimide (NHS)/1-ethyl-3-(3-dimethylaminopropyl)

carbodiimide (EDC) amine coupling kit

Click-iT Plus AlexaFluor488 Picolyl Azide Toolkit

In Gel Tryptic Digestion Kit

Thermo Scientiﬁc

Merck

Cat#C10641

Cat#89871

Immobilon Western Chemiluminescent HRP Substrate

SimplyBlue SafeStain

Cat#WBKLS0500

Cat#LC6065

Cat#23236

Thermo Scientiﬁc

Pierce Coomassie Plus (Bradford) Assay Kit

CONTACT FOR REAGENT AND RESOURCES SHARING

Further information and requests for resources and reagents should be directed to and will be fulﬁlled by the lead contacts Shiyuki

Yokoyama (yokoyama@riken.jp) and Tatsuo Yanagisawa (tatsuo.yanagisawa@riken.jp).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

No animals or cell lines have been used in this work.

METHOD DETAILS

Abbreviations: ZLys: N ³-benzyloxycarbonyl-L-lysine; ZaeSeCys: N ³-benzyloxycarbonyl-L-aminoethylselenocysteine; pNO₂ZLys:

N ³-(p-nitrobenzyloxycarbonyl)-L-lysine; oBrZLys: N -³(o-bromobenzyloxycarbonyl)-L-lysine; oClZLys: N ³-(o-chlorobenzyloxycar-

bonyl)-L-lysine; oAzZLys: N -³(o-azidobenzyloxycarbonyl)-L-lysine; mAzZLys: N -³(m-azidobenzyloxycarbonyl)-L-lysine; pAzZLys:

N ³- (p-azidobenzyloxycarbonyl)-L-lysine; oEtZLys: N -³(o-ethynylbenzyloxycarbonyl)-L-lysine; mEtZLys: N ³-(m-ethynylbenzyloxycar-

bonyl)-L-lysine; pEtZLys: N ³-(p-ethynylbenzyloxycarbonyl)-L-lysine; mTmdZLys: N -³(m-triﬂuoromethyldiazirinylbenzyloxycarbonyl)-

L-lysine; pTmdZLys: N -³(p-triﬂuoromethyldiazirinylbenzyloxycarbonyl)-L-lysine; BCNLys: N -³((((1R,8S)-bicyclo[6.1.0]non-4-yn-9-yl)

methoxy)carbonyl)-L-lysine: TCO*Lys, N -³((((E)-cyclooct-2-en-1-yl)oxy)carbonyl)-L-lysine; pAmPyLys: N ³-(p-aminopyridylmethoxy-

carbonyl)-L-lysine; and TeocLys, N -³(2-(trimethylsilyl)ethoxycarbonyl)-L-lysine.

Biochemical and molecular biological procedures were performed with commercially available materials, enzymes, and chemicals.

ZLys, pNO₂ZLys, and oClZLys were purchased from Bachem (Switzerland). oAzZLys, and pAmPyLys were purchased from Shinsei

Chemical (Osaka, Japan). mAzZLys, pAzZLys, oEtZLys, mEtZLys, pEtZLys, and ZaeSeCys were purchased from Sundia (China).

The pTmdZLys and mTmdZLys used for protein incorporation were purchased from Shinsei Chemical and Sundia. The

mTmdZLys used for structural analysis was a kind gift from Dr. Seiji Takashima (Osaka University). Chemical syntheses of pAzZLys,

oEtZLys, mEtZLys, pEtZLys, ZaeSeCys, mTmdZLys, and pAmPyLys are described in the STAR Methods. BCNLys was purchased

from Synafﬁx (Netherlands). TCO*Lys was purchased from SciChem (United Kingdom). N^a-Boc-oBrZLys was purchased from

Bachem, and the Boc group was deprotected with 50% TFA to prepare oBrZLys. N^a-Fmoc-TeocLys was purchased from Advanced

Chemtech (USA), and the Fmoc group was deprotected with 20% piperidine to prepare TeocLys. Matrix assisted laser desorption

ionization time-of-ﬂight mass spectrometry (MALDI-TOF MS) and electrospray ionization mass spectrometry (ESI-MS) were

1

performed using TOF/TOF5800 (AB SCIEX) and QSTAR ELITE (ABI) spectrometers, respectively. H NMR spectra were recorded

on Bruker Avance III 300 MHz and Bruker Fourier 400 MHz spectrometers and tetramethylsilane (TMS) was used as the internal

standard. LC/MS analyses were performed with an Agilent LC/MSD 1200 Series quadrupole Mass Spectrometer (Column:

ODS 2000 (50 3 4.6 mm, 5 mm) operating in the ES (+) or (-) ionization mode; T = 30^ꢀC; ﬂow rate = 1.5 ml/min; detected wavelength:

270 nm.

E. coli Cell-Based Protein Synthesis and Puriﬁcation of the T7-GST Proteins Containing Non-natural Amino Acids

The site-speciﬁc incorporation of non-natural lysine derivatives at position 25 of GST in E. coli cells was performed as described

previously (Yanagisawa et al., 2008b), with some modiﬁcations. The plasmids pET-GST(25Am), containing the T7 peptide-tagged

Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019 e3

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

glutathione S-transferase (T7-GST) gene with an amber (UAG) codon at position 25, and pCDF-Pyl-AFx2, containing two copies of

the PylRS(Y306A/Y384F) gene and three copies of the tRNA^Pylgene, were co-transformed into E. coli BL21-Gold(DE3) cells. When

the cells attained an OD₆₀₀of 0.5 at 37^ꢀC, protein expression was induced by 1 mM isopropyl b-D-thiogalactopyranoside (IPTG) at

37^ꢀC for 5 hr, in the presence of 1 mM non-natural amino acids. Protein puriﬁcation and peptide mass ﬁngerprinting (PMF) of the

T7-GST proteins, containing non-natural lysine derivatives, were performed as described previously (Yanagisawa et al., 2008b;

Yamaguchi et al., 2016). The harvested cells were disrupted in 50 mM potassium phosphate buffer (pH 7.4), containing 0.2 M

NaCl, 10 mM b-mercaptoethanol, and a Protease Inhibitor Cocktail (cOmplete EDTA-free, Roche) (buffer G), and the lysate

was centrifuged to remove the cell debris. The supernatants were loaded on a Glutathione Sepharose HP column (GE Healthcare).

The column was washed with buffer G, and the proteins were eluted with buffer G, containing 100 mM Tris-HCl (pH 8.0) and

40 mM reduced glutathione. The puriﬁed T7-GST proteins were subjected to SDS-PAGE, followed by staining with SimplyBlue

SafeStain (Thermo Scientiﬁc). The protein bands were excised and subjected to reduction and alkylation, followed by tryptic

digestion with an In-Gel Tryptic Digestion Kit (Thermo Scientiﬁc), and the tryptic fragments were analyzed by MALDI-TOF MS

spectrometry to conﬁrm the incorporation of the non-natural acids into the protein. The protein concentrations were measured

with a Pierce Coomassie Plus (Bradford) Assay Kit (Thermo Scientiﬁc). The E. coli strains and plasmids used in this study are listed

in the Key Resources Table.

Preparation of M. mazei tRNA^Pyland PylRS(Y306A/Y384F)

The M. mazei tRNA^Pyltranscript was prepared by in vitro transcription, as described previously (Yanagisawa et al., 2008a). The tran-

scription reaction was performed at 37^ꢀC for 3.5 h, in buffer containing 80 mM HEPES/KOH (pH 8.1), 20 mM MgCl₂, 40 mM KCl,

20 mM dithiothreitol (DTT), 2 mM spermidine, 14 mg/ml BSA, 20 mM GMP, 5 mM of each NTP, 0.08 u/ml pyrophosphatase

(Sigma-Aldrich), 0.1 mg/ml puriﬁed T7 RNA polymerase, and the PCR-ampliﬁed template DNA containing the tRNA^Pylgene with

the T7 promoter. The DNA fragment containing the M. mazei tRNA^Pylgene was ampliﬁed by PCR, using a pUC19-based plasmid

containing the tRNA^Pylgene as the template, and used as the template for in vitro transcription. The primer (5⁰-AAGCTTAATACGACT

CACTATAGGAAACCT-3⁰) and the primer complementary to the 3⁰end of tRNA^Pyl(5⁰-TGGCGGAAACCCCGGGAATCTAACCCGGC

TGAACGGA-3⁰) were used for PCR. After phenol/chloroform treatment and isopropanol precipitation, the tRNA^Pyltranscript was

puriﬁed by Resource Q column chromatography (GE Healthcare). The puriﬁed tRNA^Pylfractions were ethanol precipitated, dissolved

in 10 mM Tris-HCl buffer (pH 7.5) containing 5 mM MgCl₂, and stored at –80^ꢀC. Before use, tRNA^Pylwas heated at 80^ꢀC for 2 min and

gradually cooled to room temperature for refolding.

M. mazei PylRS(Y306A/Y384F) was overproduced in E. coli BL21-Gold(DE3) cells and puriﬁed as described previously (Yanagi-

sawa et al., 2008b), with some modiﬁcations. Protein expression was induced by an overnight treatment with 1 mM IPTG at

20^ꢀC. The cells were harvested and disrupted in 50 mM potassium phosphate buffer (pH 7.4), containing 0.5 M NaCl, 25 mM imid-

azole, 5 mM b-mercaptoethanol, and a Protease Inhibitor Cocktail (cOmplete EDTA-free, Roche), and the lysate was centrifuged to

remove the cell debris. The PylRS(Y306A/Y384F) protein was puriﬁed by two column chromatography steps, using HisTrap (GE

Healthcare) and Resource S (GE Healthcare) resins. The puriﬁed PylRS(Y306A/Y384F) fractions were dialyzed against 20 mM potas-

sium phosphate buffer (pH 7.4) containing 0.3 M KCl and 10 mM b-mercaptoethanol, concentrated, ﬂash-cooled in liquid nitrogen,

and stored at –80^ꢀC. Protein concentrations were determined using a Pierce Coomassie Plus (Bradford) Assay Kit (Thermo

Scientiﬁc).

Aminoacylation Assay

The aminoacylation assay by acidic urea PAGE was performed as described previously (Yanagisawa et al., 2008b). The tRNA

aminoacylation reactions were incubated at 37^ꢀC for 1 hr. The standard aminoacylation assay solution (20 ml) contained 5.2 mM

puriﬁed M. mazei PylRS(Y306A/Y384F), 10 mM MgCl₂, 2 mM ATP, 4 mM DTT, 5.9 mM M. mazei tRNA^Pyltranscript, and 1 mM

non-natural lysine derivatives, in 100 mM HEPES-NaOH buffer (pH 7.2). For ZaeSeCys, 50 mM TCEP (Tris(2-carboxyethyl)

phosphine, pH 7.0) was added to the reaction buffer. The time course of the aminoacylation reaction (20 ml total volume)

was measured in the presence of 1.1 mM PylRS(Y306A/Y384F), 10.8 mM tRNA^Pyl, and 1 mM ZLys or mAzZLys for 0, 5, 10,

15, 30, and 60 min at 37^ꢀC. Unaminoacylated and aminoacylated tRNA^Pyls were subjected to electrophoresis on a 10%

denaturing urea polyacrylamide gel under acidic conditions (pH 5.0) at 4^ꢀC for 18 hr, and were stained with 0.2% toluidine

blue in 7.5% acetic acid.

Surface Plasmon Resonance Analysis of the Binding between M. mazei PylRSc(Y306A/Y384F) and Lysine Derivatives

To detect the interactions between M. mazei PylRSc(Y306A/Y384F) and lysine derivatives, BIAcore sensor chips were coated

with PylRSc(Y306A/Y384F) and then exposed to a concentration gradient of the lysine derivatives. The measurements were

performed using a BIAcore T200 system (GE Healthcare) at 20^ꢀC in HBS-P running buffer (10 mM HEPES-NaOH (pH 7.4),

e4 Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

0.15 M NaCl, 0.005% v/v Surfactant P20). The puriﬁed His-tagged PylRSc(Y306A/Y384F) (0.4 mg/ml) was immobilized onto a

CM5 sensor chip using an N-hydroxysuccinimide (NHS)/1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) amine coupling

kit, in 10 mM sodium acetate buffer (pH 5.0). The protein density was ꢂ8,800 response units (RU). To determine the binding

afﬁnities of His-tagged PylRSc(Y306A/Y384F) and the lysine derivatives, solutions of the compound at different concentrations

were injected into the PylRSc(Y306A/Y384F) immobilized chambers. The response units (RUs) were measured at four to

six different concentrations of lysine derivatives (0.1–1 mM of mTmdZLys, 0.1–2 mM of mEtZLys, 0.1–5 mM of BCNLys,

0.1–5 mM of TCO*Lys, 0.1–5 mM of TeocLys, and 0.1–5 mM of oEtZLys). The highest concentration of each amino acid was

limited by its water solubility.

Cell-free Protein Synthesis and Puriﬁcation of GFP Proteins Containing Non-natural Amino Acids

Cell-free coupled transcription/translation was performed as described previously (Kigawa et al., 2004; Mukai et al., 2011; Ya-

nagisawa et al., 2014b; Seki et al., 2018), using pCR2.1-TOPO bearing an N11-tagged superfold type green ﬂuorescent mutant

protein (GFPS1) gene (Seki et al., 2008). The pCR2.1-N11GFPS1 plasmids containing the wild-type N11-GFPS1 gene or the

mutant with a single UAG codon at Ala17 were used as the template DNAs for cell-free protein synthesis with S30 extracts

from E. coli BL21(DE3) cells with a pMINOR plasmid encoding rare codon tRNAs (Chumpolkulwong et al., 2004). The reaction

components for the incorporation of non-natural lysine derivatives at position 17 in N11-GFPS1 were as follows: 2 mg/ml

template plasmid, 10 mM PylRS(Y306A/Y384F), 10 mM tRNA^Pyl, and 1 mM non-natural lysine derivatives. After an overnight

incubation at 25^ꢀC, the synthesized full-length N11-GFPS1 proteins were quantiﬁed as described previously, using a plate

ﬂuorescence reader ARVO Victor2 V Multilabel Counter (PerkinElmer) (Seki et al., 2018). The puriﬁcation of the N11-GFPS1

proteins was performed as follows. After centrifugation of the solution, the supernatant fractions were loaded on a Ni-

Sepharose column (GE Healthcare). The column was washed with 20 mM Tris-HCl buffer (pH 8.0), containing 300 mM NaCl,

20 mM imidazole, and 1 mM DTT, and then eluted with 20 mM Tris-HCl buffer (pH 8.0), containing 300 mM NaCl, 500 mM imid-

azole, and 1 mM DTT. The PMF analysis of the N11-GFPS1 proteins, containing ZLys, mEtZLys, mAzZLys, pAmPyLys,

pTmdZLys, and mTmdZLys, was performed in the same manner as for the T7-GST proteins, using MALDI-TOF MS and ESI-MS

spectrometries.

Cloning, Expression, and Puriﬁcation of the C-terminal Catalytic Fragment of M. mazei PylRS with the Y306A and

Y384F Mutations

The DNA fragment encoding the M. mazei PylRS C-terminal domain (residues 185–454) with the Y306A and Y384F mutations was

PCR-ampliﬁed and cloned into the pET28c vector. The E. coli Rosetta(DE3) strain (Novagen) was transformed with the plasmid and

selected on an LB agar plate supplemented with 50 mg/ml kanamycin and 20 mg/ml chloramphenicol. A single colony was grown at

37^ꢀC in a broth culture containing 30 g tryptone, 10 g yeast extract, and 5 g NaCl per liter, supplemented with 30 mg/ml kanamycin.

When the OD₆₀₀reached 0.1, the cultivation temperature was lowered to 22^ꢀC. The protein expression was induced with 0.1 mM

IPTG when the OD₆₀₀reached 0.7, and the cells were cultivated overnight. The E. coli cells were collected by centrifugation and

stored at –80^ꢀC.

The cells were resuspended in 50 mM Tris-HCl buffer (pH 8.0), containing 300 mM NaCl, 20 mM imidazole, 1% (v/v) Tween-

20, and 1 mM DTT, and were lysed by sonication on ice. The cell lysate was centrifuged at 15,000 3 g for 20 min at 4^ꢀC, ﬁltered

through a 0.45 mm membrane, and fractionated on a HisTrap column (GE Healthcare), which was equilibrated with 20 mM

Tris-HCl buffer (pH 8.0), containing 300 mM NaCl, 20 mM imidazole, and 1 mM DTT. The protein was eluted by a linear gradient

(20–500 mM) of imidazole, collected, and dialyzed against 20 mM Tris-HCl buffer (pH 8.0), containing 100 mM NaCl, 20 mM

imidazole, and 1 mM DTT. The histidine-tag peptide derived from the pET28c vector was cleaved by thrombin protease

(Sigma-Aldrich). The ﬂow-through of the HisTrap column, equilibrated with 20 mM Tris-HCl buffer (pH 8.0), containing

300 mM NaCl, 20 mM imidazole, and 1 mM DTT, was collected and concentrated by ultracentrifugation. The protein was ﬁltered

through a 0.22 mm membrane and fractionated on a HiLoad 16/60 Superdex 200 pg column (GE Healthcare), which was equil-

ibrated with 20 mM HEPES-NaOH buffer (pH 7.4), containing 300 mM NaCl, 20 mM MgCl₂, and 1 mM DTT. The eluted fractions

were collected and concentrated by ultracentrifugation to 20 mg/ml. Aliquots of the protein were ﬂash-cooled in liquid nitrogen

and stored at –30^ꢀC.

Crystallization, Data Collection, and Structure Determination

In the present study, we cleaved the hexahistidine-tag with thrombin after the tag-based puriﬁcation, and found that the tag-free

PylRSc(Y306A/Y384F) could be crystallized under different conditions from those reported previously for PylRSc with the hexahis-

tidine-tag (Yanagisawa et al., 2006). The crystals of PylRSc(Y306A/Y384F) grew in the presence of each lysine derivative and ATP

under the same conditions, with PEG200 as the precipitant.

Prior to crystallization, the protein was diluted to 1 mg/ml and mixed with 2 mM ATP and 10 mM substrate amino acid, and

was incubated at 4^ꢀC for one hour. The sample was concentrated to 15 mg/ml by ultracentrifugation. Crystals were grown at 8^ꢀC

Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019 e5

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

by the sitting drop vapor diffusion method. One microliter of the protein solution was mixed with an equal volume of the precip-

itant solution, composed of 100 mM Tris-HCl buffer (pH 8.5), 40% PEG200, 200 mM KCl, 40 mM MgCl₂, and 10 mM sodium

citrate. The crystal was mounted on a nylon loop and ﬂash-cooled in liquid nitrogen. The X-ray datasets were collected at

the beamline BL32XU at SPring-8 (Harima, Japan) at -173^ꢀC and were processed with XDS (Kabsch, 2010). The crystal of

˚

PylRSc(Y306A/Y384F),ZLys belongs to the space group C2, with unit cell parameters of a=102.13 A b=43.89 A c=62.07 A

and b=98.8^ꢀ. The crystal of PylRSc(Y306A/Y384F),mAzZLys belongs to the space group C2, with unit cell parameters of

ꢀ

˚

a=101.6 A b=43.5 A c=72.1 A and b=118.8 . The phase was calculated by the molecular replacement method with Phaser, using

˚

2ZIM as the search model. One PylRSc(Y306A/Y384F) molecule was found per asymmetric unit, with the solvent content of

˚

45%. The diffraction data up to 1.57 A were used for the model reﬁnement for PylRSc(Y306A/Y384F),ZLys. Iterative cycles

of model reﬁnement by PHENIX (Adams et al., 2010) and manual model building with Coot (Emsley and Cowtan, 2004) were

performed. The R_workand R_freefactors for the PylRSc(Y306A/Y384F) structures complexed with non-natural amino acids are

shown in Table S4. The ﬁnal model was validated with Molprobity (Davis et al., 2007) and Procheck (Collaborative Computational

ProjectNumber 4, 1994). The ﬁnal models consist of residues 188–280 and 284–454 of PylRSc(Y306A/Y384F). The electron

densities revealed that the ATP did not react with the lysine derivative, and is bound to three magnesium ions. Graphical images

were prepared with PyMOL [http://pymol.sourceforge.net/]. The data collection and reﬁnement statistics are summarized in

Table S4.

Chemical Syntheses of Non-natural Amino Acids

Scheme 1. Synthesis of pAzZLys

1.1 Synthesis of (4-azidophenyl)methyl(4-nitrophenoxy)formate (3): To a solution of compound 1 (0.88 g, 5.87 mmol) in dichloro-

methane (DCM) (10 ml), pyridine (1 ml) and compound 2 (1.18 g, 5.87 mmol) was added, at 25^ꢀC under N₂overnight. The reaction

mixture was poured into water (8 ml) and extracted with DCM (20 ml). The organic layer was washed with water (6 ml) and brine

(10 ml), dried over Na₂SO₄and concentrated to give the crude product 3 (0.85 g, yield: 50%) as a yellow solid, which was directly

used for the next step.

1.2 Synthesis of (2S)-6-{[(4-azidophenyl)methoxy]carbonylamino}-2-[(tert-butoxy) carbonylamino]hexanoic acid (5): To a solution

of compound 3 (0.85 g, 2.5 mmol) in tetrahydrofuran (THF) (10 ml), N,N-diisopropylethylamine (DIEA) (0.64 g, 5 mmol) and 6-amino-2-

tert-butoxycarbonylamino-hexanoic acid (0.62 g, 2.5 mmol) were added. The mixture was stirred at 25^ꢀC under N₂overnight. The

mixture was diluted with 4 N HCl for adjustment to pH = 3 and extracted with DCM (10 ml 3 3). The combined organic layer was

washed with water (5 ml) and brine (5 ml), dried over Na₂SO₄and concentrated. The residue was puriﬁed by silica gel column chro-

matography (DCM/MeOH = 40/1) to afford the product 5 (500 mg, yield: 40%) as yellow oil.

1.3 Synthesis of (2S)-2-amino-6-{[(4-azidophenyl)methoxy]carbonylamino}hexanoic acid (pAzZLys): Compound 5 (450 mg,

18 mmol) was suspended in HCl/EtOAc (5 ml) and stirred for 2 hr at room temperature. The mixture was concentrated under reduced

pressure, and the residue was puriﬁed by prep-HPLC to afford the desired product pAzZLys (120 mg, yield: 50%) as an off-white

solid. ¹H NMR (D₂O, 300 MHz): d 7.30 (d, J = 6.3 Hz, 2H), 7.00 (d, J = 6.3 Hz, 2H), 4.95 (s, 2H), 3.08 (m, 1H), 3.00 (m, 2H), 1.38 (m,

4H), 1.19 (m, 2H). LC-MS [mobile phase: from 80% water (0.1% NH₄OH) and 20% CH₃CN to 5% water (0.1% NH₄OH) and 95%

CH₃CN in 6 min, and ﬁnally under these conditions for 0.5 min.] The purity was >95%, the retention time = 3.120 min, and MS Calcd.:

321; MS Found: 322 ([M+H]⁺).

e6 Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

Scheme 2. Synthesis of mAzZLys

2.1 The solution of compound 1 (50 g, 0.13 mol), Boc₂O (44 g, 0.20 mol), and DMAP (2.4 g, 0.02 mol) in tert-butanol (500 ml) was

stirred at room temperature for 5 hrs. The mixture was poured into ice water (500 ml) and extracted with ethyl acetate. The organic

layer was dried over anhydrous sodium sulfate and concentrated to give the crude extract, which was puriﬁed by silica gel column

chromatography to afford compound 2 (40 g, yield: 70%) as yellow oil.

2.2 Synthesis of compound 3: The solution of compound 2 (40 g, 92 mmol) in MeOH (400 ml) was treated with Pd/C (8.0 g). The

reaction mixture was hydrogenated under 50 psi at room temperature overnight, and then ﬁltered through diatomaceous earth under

nitrogen. The ﬁltrate was evaporated in a vacuum to afford compound 3 (26 g, yield: 94%) as yellow oil.

2.3 Synthesis of compound 5: To a solution of compound 4 (40 g, 0.33 mol) in CH₃CN (300 ml), tert-Butyl nitrite (36 g, 0.35 mol) was

added dropwise at 5^ꢀC. After stirring at 5^ꢀC for 15 min, a solution of TMSN₃(40 g, 0.35 mol) in CH₃CN (50 ml) was added to the

solution at 5^ꢀC. The resulting mixture was stirred at room temperature overnight, and quenched with water (500 ml), and extracted

with DCM. The organic layer was dried over anhydrous sodium sulfate and concentrated to give the crude extract, which was puriﬁed

by silica gel column chromatography to afford compound 5 (46 g, yield: 95%) as yellow oil.

3.4 Synthesis of compound 6: A solution of compound 5 (30 g, 0.20 mol) and TEA (25 g, 0.25 mol) in DCM (300 ml) was mixed with

4-nitrophenyl carbonochloridate (44 g, 0.22 mol) at 0^ꢀC. The mixture was stirred at room temperature overnight, quenched with water

(300 ml), and extracted with DCM. The organic layer was dried over anhydrous sodium sulfate and concentrated to give the crude

extract, which was puriﬁed by silica gel column chromatography to afford compound 6 (32 g, yield: 51%) as yellow oil.

3.5 Synthesis of compound 7: The mixture of compound 6 (18 g, 57 mmol), compound 3 (17 g, 57 mmol), and TEA (8.1 g, 80 mmol)

in DCM (200 ml) was stirred at room temperature for 3 hrs. The mixture was then quenched with water (200 ml) and extracted with

DCM. The organic layer was dried over anhydrous sodium sulfate and concentrated to give the crude extract, which was puriﬁed by

silica gel column chromatography to afford compound 7 (24 g, yield: 88%) as yellow oil.

3.6 Synthesis of (2S)-2-amino-6-{[(3-azidophenyl)methoxy]carbonylamino}hexanoic acid (mAzZLys): The mixture of compound 7

(24 g, 50.3 mmol) in HCl/Et₂O (3N, 150 ml) was stirred at room temperature overnight. The mixture was concentrated and diluted with

water (100 ml), and the aqueous layer was adjusted to pH 5 with sat.NaHCO₃aq. The precipitate was ﬁltered, and ﬁltrate cake was

dried in a vacuum to afford mAzZLys (12 g, yield: 74%) as a white solid.

¹H-NMR (400 MHz, CD₃OD): 1.46-1.61 (m, 4 H), 1.89-1.99 (m, 2 H), 3.15-3.18 (t, 2 H), 3.95-3.99 (t, 1 H), 5.09 (s, 2 H), 7.01-7.07

(m, 2 H), 7.15-7.18 (d, 1 H), 7.37-7.41 (t, 1 H).

LC-MS [mobile phase: from 90% water (0.05% NH_3.H₂O) and 10% CH₃CN (0.05% NH₃.H₂O) to 5% water (0.05% NH₃.H₂O) and

95% CH₃CN (0.05% NH₃.H₂O) in 6.0 min, ﬁnally under these conditions for 0.5 min.] The purity was 97.0%, Rt = 3.215 min, and MS

Calcd.:321; MS Found: 322 ([M+H]+).

Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019 e7

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

Scheme 3. Synthesis of pEtZLys

3.1 Synthesis of carbonic acid 4-ethynyl-benzyl ester 4-nitro-phenyl ester (3): To a solution of compound 1 (0.78 g, 5.87 mmol) in

DCM (10 ml), pyridine (1 ml) and compound 2 (1.18 g, 5.87 mmol) were added at 25^ꢀC under N₂, and then the reaction was stirred at

room temperature overnight. The reaction mixture was poured into water (8 ml) and extracted with DCM (2 3 20 ml). The organic layer

was washed with water (6 ml) and brine (10 ml), dried over Na₂SO₄, and concentrated to give the crude product 3 (0.75 g, yield: 50%)

as a yellow solid, which was directly used for the next step.

3.2 Synthesis of 2-tert-butoxycarbonylamino-6-(4-ethynyl-benzyloxycarbonylamino) -hexanoic acid (5): To a solution of

compound 3 (0.75 g, 2.5 mmol) in THF (10 ml), DIEA (0.64 g, 5 mmol) and 6-amino-2-tert-butoxycarbonylamino-hexanoic acid

(0.62 g, 2.5 mmol) were added. The mixture was stirred at 25^ꢀC under N₂overnight. The mixture was diluted with 4 N HCl to adjust

the pH to 3 and extracted with DCM (10 ml 3 3). The combined organic layer was washed with water (5 ml) and brine (5 ml), dried over

Na₂SO₄, and concentrated. The residue was puriﬁed by silica gel column chromatography (DCM/MeOH = 40/1) to afford product 5

(400 mg, yield: 40%) as yellow oil.

3.3 Synthesis of 2-amino-6-(4-ethynyl-benzyloxycarbonylamino)-hexanoic acid (pEtZLys): The mixture of compound 5 (0.3 g,

18 mmol) in HCl/EtOAc (5 ml) was stirred for 2 hr at room temperature. The mixture was concentrated under reduced pressure

1

and the residue was puriﬁed by prep-HPLC to afford the desired product pEtZLys (140 mg, yield: 67%) as a white solid. H NMR

(DMSO-d₆, 300 MHz): d 7.47 (d, J = 5.7 Hz, 2H), 7.34 (d, J = 6.0 Hz, 2H), 7.27 (m, 1H), 5.02 (s, 2H), 4.18 (s, 1H), 3.20 (m, 1H), 2.96

(m, 2H), 1.68 (m, 2H), 1.32 (m, 4H). LC-MS [mobile phase: from 80% water (0.02% NH₄OAc) and 20% CH₃CN to 5% water

(0.02% NH₄OAc) and 95% CH₃CN in 6 min, ﬁnally under these conditions for 0.5 min.] The purity was > 95%, the retention time =

2.598 min, and MS Calcd.: 304; MS Found: 305 ([M+H]⁺).

Scheme 4. Synthesis of mEtZLys

4.1 Synthesis of 3-trimethylsilanylethynyl-benzaldehyde (2): To a solution of aldehyde 1 (20.0 g, 108 mmol) in triethylamine (TEA)

(400 ml), triphenylphosphine (PPh₃)(1.0 g, 3.8 mmol), ethynyltrimethylsilane (60.0 g, 594 mmol), and Pd(OAc)₂(0.2 g, 0.9 mmol) were

e8 Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

added under N2. The resulting mixture was stirred at 100^ꢀC for 6 hr. After the mixture was cooled to room temperature, it was ﬁltered

and washed with DCM. The ﬁltrate was washed with water, dried over Na₂SO₄, and concentrated to afford the crude product 2, which

was puriﬁed by column chromatography to afford compound 2 (20 g, 96%) as brown oil.

¹H NMR (DMSO-d₆, 400 MHz): d 9.83 (s, 1H), 7.81-7.78 (m, 1H), 7.73 (d, J = 8.0 Hz, 1H), 7.58 (d, J = 8.0 Hz, 1H), 7.45-7.40 (m, 1H),

0.08 (s, 9H).

4.2 Synthesis of (3-trimethylsilanylethynyl-phenyl)-methanol (3): To a solution of 3-trimethylsilanylethynyl-benzaldehyde (20 g,

105 mmol) in EtOH (250 ml), NaBH₄(12 g, 321 mmol) was added at 0^ꢀC. The resulting mixture was stirred at 0^ꢀC for 2 min and

was quenched with an NH₄Cl solution. The mixture was extracted with DCM (150 ml 3 3), and dried over Na₂SO₄. The solution

was concentrated to dryness to afford the desired crude product 3 (20 g), as brown oil, which was directly used for next step.

4.3 Synthesis of (3-ethynyl-phenyl)-methanol (4): To a solution of (3-trimethylsilanylethynyl-phenyl)-methanol (3) (20 g, 105 mmol) in

MeOH (400 ml), K₂CO₃(29 g, 210 mmol) was added. The mixture was stirred overnight at 25^ꢀC under N2. The mixture was ﬁltered,

and the ﬁltrate was concentrated to remove most of the organic solvent. The residue was puriﬁed by silica gel column chromatog-

raphy (DCM/petroleum ether = 1/2) to afford product 4 (7 g, 50% yield for 2 steps) as brown oil. ¹H-NMR (DMSO-d₆, 400 MHz): d 7.23-

7.20 (s, 1H), 7.16-7.10 (m, 3H), 5.05 (s, 1H), 4.30-4.26 (m, 2H), 3.91 (s, 1H).

4.4 Synthesis of carbonic acid 3-ethynyl-benzyl ester 4-nitro-phenyl ester (5): To a solution of compound 4 (5.4 g, 40.6 mmol) in

DCM (100 ml), pyridine (10 ml) and 4-nitrophenyl carbonochloridate (8.2 g, 40.6 mmol) were added, and the mixture was incubated

overnight at 25^ꢀC under N₂. The reaction mixture was poured into water (80 ml) and extracted with DCM (200 ml). The organic layer

was washed with water (60 ml) and brine (100 ml), dried over Na₂SO₄, and concentrated to give the crude product 5 (12 g, yield:

100%) as a yellow solid, which was directly used for next step.

4.5 Synthesis of 2-tert-butoxycarbonylamino-6-(3-ethynyl-benzyloxycarbonylamino) -hexanoic acid (6): A solution of compound 5

(7.5 g, 25 mmol) in THF (100 ml) was mixed with DIEA (6.4 g, 50 mmol) and 6-amino-2-tert-butoxycarbonylamino-hexanoic acid (6.2 g,

25 mmol). The mixture was stirred overnight at 25^ꢀC under N₂. The mixture was diluted with 4 N HCl to adjust the pH to 3 and

extracted with DCM (100 ml 3 3). The combined organic layer was washed with water (50 ml) and brine (50 ml), dried over

Na₂SO₄, and concentrated. The residue was puriﬁed by silica gel column chromatography (DCM/MeOH = 40/1) to afford product

6 (4 g, yield: 40%) as yellow oil. Chiral HPLC: e.e. > 99%, Chiralpak IB column (5 mm, 4.6 3 250mm), Hexane: EtOH: TFA = 95 :

5: 0.2, 1.0 ml/min, retention time 22.0 min. ¹H-NMR (DMSO-d₆, 400 MHz): d 12.17 (s, 1H), 7.24-7.14 (m, 3H), 7.06 (t, J = 5.6 Hz,

1H), 6.79 (d, J = 8.0 Hz, 1H), 4.78 (s, 2H), 3.97 (s, 1H), 3.64-3.56 (m, 1H), 2.97-2.94 (m, 1H), 2.80-2.70 (m, 2H), 1.46-1.26 (m, 2H),

1.20-1.12 (m, 13H).

4.6 Synthesis of 2-amino-6-(3-ethynyl-benzyloxycarbonylamino)-hexanoic acid (mEtZLys): The mixture of compound 6 (3.8 g,

9.4 mmol) in HCl/EtOAc (50 ml) was stirred for 2 hr at room temperature. The mixture was concentrated under reduced pressure,

and the residue was puriﬁed by prep-HPLC to afford the desired product mEtZLys (2.6 g, yield: 98%) as a solid yellow HCl

1

salt. H NMR (DMSO-d₆, 300 MHz): d 8.60-8.20 (br, 3H), 7.46-7.26 (m, 5H), 5.00 (s, 2H), 4.21 (s, 1H), 3.86-3.78 (m, 1H), 3.04-2.94

(m, 2H), 1.84-1.72 (m, 2H), 1.50-1.26 (m, 4H). MS Calcd.: 304; MS Found: 305 ([M+H]⁺).

Scheme 5. Synthesis of oEtZLys

Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019 e9

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

5.1 Synthesis of (S)-tert-butyl 13,13-dimethyl-3,11-dioxo-1-phenyl-2,12-dioxa-4,10-diazatetradecane-9-carboxylate (2): The

solution of (S)-13,13-dimethyl-3,11-dioxo-1-phenyl-2,12-dioxa-4,10-diazatetradecane-9-carboxylic acid (1) (50 g, 0.13 mol),

di-tert-butylpyrocarbonate (Boc₂O) (44 g, 0.2 mol), and dimethylaminopyridine (DMAP) (24 g, 0.2 mol) in tert-butanol (500 ml)

was stirred at room temperature for 5 hrs. The mixture was poured into ice water (500 ml). The aqueous layer was extracted

with ethyl acetate (200 ml 3 3). The combined organic layers were dried over sodium sulfate, ﬁltered, and evaporated in a

vacuum to give the crude product, which was puriﬁed by silica gel column chromatography to afford compound 2 (40 g,

70%) as yellow oil.

5.2 Synthesis of (S)-tert-butyl 6-amino-2-(tert-butoxycarbonylamino)hexanoate (3): The solution of compound 2 (40 g, 92 mmol)

and Pd/C (8.0 g) in MeOH (400 ml) was stirred at room temperature overnight under 50 psi. The mixture was ﬁltered, and the ﬁltrate

was evaporated in a vacuum to afford compound 3 (26 g, 94%) as yellow oil.

5.3 Synthesis of (2-((trimethylsilyl)ethynyl)phenyl)methanol (5): The solution of compound 4 ((2-iodophenyl)methanol) (50 g,

0.21 mol), trimethylsilyl acetylene (25 g, 0.26 mol), and tetrakis(triphenylphosphine)palladium(0) [Pd(PPh₃)₄](5.0 g, 4.3 mmol)

in TEA (300 ml) was stirred at 50^ꢀC for 1 hr. The mixture was quenched with water (200 ml), and then the aqueous layer was

extracted with DCM (200 ml 3 3). The combined organic layers were dried over sodium sulfate, ﬁltered, and evaporated in a

vacuum to give the crude product, which was puriﬁed by silica gel column chromatography to afford compound 5 (50 g,

87%) as yellow oil.

5.4 Synthesis of (2-ethynylphenyl)methanol (6): The mixture of compound 5 (50 g, 0.25 mol) and K₂CO₃(18 g, 0.13 mol) in methanol

(500 ml) was stirred at room temperature for 1 hr. The mixture was quenched with water (500 ml), and then the aqueous layer was

extracted with DCM (200 ml 3 3). The combined organic layers were dried over sodium sulfate, ﬁltered, and evaporated in a vacuum

to afford compound 6 (30 g, 93%) as yellow oil.

5.5 Synthesis of 2-ethynylbenzyl 4-nitrophenyl carbonate (7): A solution of 4-nitrophenyl carbonochloridate (55 g, 0.27 mol) in DCM

(50 ml) was added dropwise to a solution of compound 6 (30 g, 0.23 mol) and TEA (30 g, 0.30 mol) in DCM (300 ml) at 0^ꢀC, and the

resulting mixture was stirred at room temperature overnight. The mixture was quenched with water (300 ml), and the aqueous layer

was extracted with DCM (150 ml 3 3). The combined organic layers were dried over sodium sulfate, ﬁltered, and evaporated in a

vacuum to give the crude product, which was puriﬁed by silica gel column chromatography to afford compound 7 (28 g, 42%) as

yellow oil.

5.6 Synthesis of (S)-tert-butyl 2-(tert-butoxycarbonylamino)-6-((2-ethynylbenzyloxy)carbonylamino)hexanoate (8): The mixture of

compound 7 (10 g, 34 mmol), compound 3 (10 g, 34 mmol), and TEA (5.1 g, 50 mmol) in DCM (20 ml) was stirred at room temperature

for 3 hr. The mixture was quenched with water (200 ml), and the aqueous layer was extracted with DCM (150 ml 3 3). The combined

organic layers were dried over sodium sulfate, ﬁltered, and evaporated in a vacuum to give the crude product, which was puriﬁed by

silica gel column chromatography to afford compound 8 (15 g, 97%) as yellow oil.

5.7 Synthesis of 2-amino-6-(2-ethynyl-benzyloxycarbonylamino)-hexanoic acid (oEtZLys): The mixture of compound 8 (5.0 g,

11 mmol) in conc. HCl (10 ml) and THF (10 ml) was stirred at room temperature overnight. The mixture was adjusted to pH 8 with

saturated NaHCO₃. The precipitate was ﬁltered, and the ﬁltrate cake was dried in a vacuum to afford oEtZLys (2.5 g, 76%) as a white

solid. ¹H-NMR (400 MHz, CD₃OD): 1.45-1.59 (m, 4H), 1.81-1.93 (m, 2H), 3.15-3.19 (t, 2H), 3.52-3.56 (t, 1H), 3.81 (s, 1H), 5.25 (s, 2H),

7.29-7.33 (t, 1H), 7.38-7.46 (m, 2H), 7.48-7.51 (d, 1H). The LC/MS purity was >95%; e.e., the (chiral HPLC) purity was >95%, and MS

Calcd.: 304; MS Found: 305 ([M+H]⁺).

Scheme 6. Synthesis of ZaeSeCys

6.1 Synthesis of (2R)-2-amino-6-[(phenylmethoxy)carbonylamino]-4-selenahexanoic acid (ZaeSeCys): L-selenocystine (1)

(260 mg, 0.77 mmol) was suspended under an argon atmosphere in degassed 50 mM KOH (10 ml) and ethanol (3 ml). The

mixture was cooled to 0^ꢀC. NaBH₄(100 mg, 2.6 mmol) was added, and the reaction was allowed to warm to room temperature.

After the reaction mixture became colorless, the mixture was placed in an ice-water bath. Carbamic acid benzyl ester (412 mg,

e10 Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

1.6 mmol) was then added, and the mixture was stirred for 6 hours under N₂at room temperature. 1M HCl (aq) was added to

adjust the pH of the solution to 6. The crude product was puriﬁed by prep-HPLC to give ZaeSeCys (60 mg, yield: 11%) as a

white solid.

¹H NMR (400 MHz, DMSO-d₆+CF₃COOD(5%)): d 2.71 (t, J = 6.8 Hz, 2H), 2.98-3.01 (m, 2H), 3.27 (t, J = 6.8 Hz, 2H), 4.27 (s, 1H), 5.03

(s, 2H), 7.32-7.39 (m, 5H), 15.78-15.80 (m, 3H). LC-MS: Mobile phase: from 95% CH₃CN and 5% water (0.1% TFA) to 5% CH₃CN and

95% water (0.1% TFA) in 6.0 min, ﬁnally under these conditions for 0.5 min; wavelength = 214 nm, purity >95%, Retention time =

2.885 min. MS Calcd.: 346; MS Found: 347 ([M+H]⁺).

Scheme 7. Synthesis of pAmPyLys

7.1 Synthesis of compound 4: 2-(Boc-amino)-5-pyridinemethanol (1) (299.2 mg, 1.33 mmol) was dissolved in THF (20 ml).

Bis(4-nitrophenyl) carbonate (2) (488 mg, 1.2 eq) and TEA (1.2 eq) were added to the solution, and the mixture was stirred at

room temperature for 3 days. Thereafter, reﬂux was performed overnight, and the formation of carbonic acid, [6-[[(1,1-dimethy-

lethoxy)carbonyl]amino]-3-pyridinyl]methyl 4-nitrophenyl ester (3) was conﬁrmed by TLC. The reaction mixture was cooled to

room temperature, Boc-Lys-OH (395 mg, 1.2 eq) was added, and the resulting mixture was stirred for 3 days at 30^ꢀC. After

stopping the reaction by adding a 2% NH₄Cl solution, it was extracted three times with EtOAc, and the organic layer was dried

with MgSO₄. After ﬁltration and concentration, puriﬁcation by silica gel column chromatography gave 439 mg (yield: 66%) of

compound 4.

7.2 Synthesis of (S)-2-amino-6-((((4-aminopyridyl)methoxy)carbonyl)amino)hexanoic acid (pAmPyLys): Compound 4 (300 mg,

604 mmol) was dissolved in 10 ml of DCM. TFA (5 ml) was added into the solution, and the mixture was stirred at room temperature

for about 2.5 hr. After the disappearance of the starting material was conﬁrmed by TLC, the reaction solution was added dropwise to

100 ml of diethyl ether. The resulting precipitate was ﬁltered, washed with ether, and dried to obtain 241 mg of pAmPyLys (TFA salt,

yield: 97%).

1H NMR (400 MHz, D₂O): 7.87(d,1H(aromatic)), 7.77(s,1H(aromatic)), 6.98(d,1H(aromatic)), 4.94(s,2H(benzyl)), 3.90(t,1H(a)),

3.08(t,2H( 3 )), 1.8-2.0(m, 2H(b)), 1.3-1.6(m, 4H(g, d)). MS Calcd.: 296.3; MS Found: 297 ([M+H]⁺).

Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019 e11

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

Scheme 8. Synthesis of mTmdZLys

8.1 Synthesis of (3-bromobenzyloxy)(tert-butyl)dimethylsilane (2): A solution of (3-bromophenyl)methanol (1) (10 g, 53 mmol) in

DCM (100 ml) was mixed with imidazole (7.2 g, 106 mmol) and tert-Butyldimethylsilyl chloride (TBSCl) (8.4 g, 56 mmol) at 0^ꢀC,

and then stirred at room temperature overnight. The solvent was removed in a vacuum, and the residue was puriﬁed by silica gel

column chromatography to give compound 2 (12 g) as colorless oil, yield: 74.0%.

8.2 Synthesis of 1-(3-((tert-butyldimethylsilyloxy)methyl)phenyl)-2,2,2- triﬂuoroethanone (3): Under N₂, a solution of compound 2

(9.0 g, 30 mmol) in THF (90 ml) was mixed with n-Butyllithium (13.2 ml, 33 mmol) dropwise at -70^ꢀC and stirred for 1 hr, and then

a solution of N,N-diethyl-2,2,2-triﬂuoroacetamide (6.0 g, 36 mmol) in THF (10 ml) was added at -70^ꢀC, and the mixture was stirred

for 1 hr. The mixture was quenched with aq. NH₄Cl, extracted with EtOAc (100 ml), dried over Na₂SO₄, and concentrated to give

compound 3 (9.00 g) as yellow oil, yield: 94.0%.

¹H-NMR (400 MHz, CDCl₃): d7.93 (s, 1H), 7.83 (d, 1H, J = 7.6 Hz), 7.54 (d, 1H, J = 7.6 Hz), 7.39 (t, 1H, J = 7.6 Hz), 4.69 (s, 2H), 0.84

(s, 9H), 0.00 (s, 6H).

8.3 Synthesis of 1-(3-((tert-butyldimethylsilyloxy)methyl)phenyl)-2,2,2- triﬂuoroethanone oxime (4): A solution of compound 3

(9.0 g, 28.3 mmol) in EtOH (90 ml) was combined with pyridine (15.0 ml) and hydroxylamine hydrochloride (5.85 g, 85 mmol). The

mixture was stirred at 80^ꢀC overnight. The solvent was removed in a vacuum, and the residue was puriﬁed by silica gel column chro-

matography to give compound 2 (7.0 g) as colorless oil, yield: 74.0%.

8.4 Synthesis of 1-(3-((tert-butyldimethylsilyloxy)methyl)phenyl)-2,2,2- triﬂuoroethanone O-tosyl oxime (5): A solution of compound

4 (7.0 g, 21 mmol) in DCM (100 ml) was combined with TEA (4.2 g, 42 mmol), DMAP (100 mg), and 4-methylbenzene-1-sulfonyl

chloride (4.4 g, 23 mmol) at 0^ꢀC. The mixture was stirred at room temperature overnight, and then washed with water (50 ml), and

dried over Na₂SO₄. The solvent was removed in a vacuum, and the residue was puriﬁed by silica gel column chromatography to

give compound 5 (10 g) as colorless oil, yield: 98.0%.

8.5 Synthesis of 3-(3-((tert-butyldimethylsilyloxy)methyl)phenyl)-3- (triﬂuoromethyl)diaziridine (6): A solution of compound 5 (8.0 g,

16.4 mmol) in DCM (100 ml) was cooled to -70^ꢀC, and liquid ammonia (100 ml) was added. The mixture was stirred at -70^ꢀC for 8 hrs,

and then warmed to room temperature and stirred overnight. The mixture was washed with water and dried over Na₂SO₄. The solvent

was removed to give compound 6 (3.5 g) as colorless oil, yield: 65.0%.

¹H-NMR (400 MHz, DMSO-d₆): d 7.46 (s, 1H), 7.29-7.34 (m, 3H), 4.67 (s, 2H), 4.01 (d, 1H, J = 8.4 Hz), 3.88 (d, 1H, J = 7.6 Hz), 0.83

(s, 9H), 0.00 (s, 6H).

8.6 Synthesis of 3-(3-((tert-butyldimethylsilyloxy)methyl)phenyl)-3- (triﬂuoromethyl)-3H-diazirine (7): A solution of compound 6

(3.5 g, 10.5 mmol) in MeOH (100 ml) was cooled to -70^ꢀC, and hypochlorous acid tert-butyl ester (2.27 g, 21 mmol) was added drop-

wise. After 10 min, NaHCO₃(1.32 g, 15.7 mmol) was added to the mixture. The reaction was warmed to room temperature and stirred

for 2 hrs. The solvent was removed in a vacuum. The residue was resolved in EA (100 ml), washed with water (50 ml), and dried over

Na₂SO₄. The solvent was removed to give compound 7 (3.0 g) as yellow oil, yield: 86.0%.

8.7 Synthesis of (3-(3-(triﬂuoromethyl)-3H-diazirin-3-yl)phenyl)methanol (8): A solution of compound 7 (3.0 g, 9.1 mmol) in THF

(60.0 ml) was mixed with water (5.0 ml) and tetrabutylammonium ﬂuoride (TBAF) (5.7 g, 18.2 mmol), and stirred at room temperature

e12 Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019

Please cite this article in press as: Yanagisawa et al., Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered

Pyrrolysyl-tRNA Synthetase, Cell Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.03.008

overnight. The solvent was removed in a vacuum, and the residue was dissolved in EtOAc (100 ml), washed with water (30 ml 3 2),

and dried over Na₂SO₄. The solvent was removed and the residue was puriﬁed by silica gel column chromatography to give com-

pound 8 (1.2 g) as yellow oil, yield: 67.0%.

1H-NMR (400 MHz, CDCl₃): d 7.37-7.41 (m, 2H), 7.15-7.18 (m, 2H), 4.71 (s, 2H), 1.76 (s, 1H).

8.8 Synthesis of 4-nitrophenyl 3-(3-(triﬂuoromethyl)-3H-diazirin-3-yl)benzyl carbonate (9): To a solution of compound 8 (1.0 g,

4.62 mmol) in DCM (20 ml), TEA (0.93 g, 9.24 mmol) and 4-nitrophenyl carbonochloridate (0.93 g, 4.62 mmol) were added at 0^ꢀC.

The mixture was stirred at room temperature for 2 hrs. The solvent was removed and the residue was puriﬁed by silica gel column

chromatography to give compound 9 (1.2 g) as colorless oil, yield: 68.0%.

8.9 Synthesis of (S)-2-(tert-butoxycarbonylamino)-6-((3-(3-(triﬂuoromethyl)-3H -diazirin-3-yl)benzyloxy)carbonylamino)hexanoic

acid (10): To a solution of compound 9 (1.2 g, 3.15 mmol) in dimethylformamide (DMF) (25 ml), TEA (0.63 g, 6.3 mmol) and

N^a-(tert-butoxycarbonyl)-L-lysine (0.7 g, 2.83 mmol) were added, and the mixture was stirred at 50^ꢀC overnight. The mixture was

poured into 100 ml of water, and extracted with EtOAc (30.0 ml 3 3). The organic layer was concentrated, and the residue was

puriﬁed by prep-HPLC to give compound 10 (0.6 g) as a white solid, yield: 39.0%.

8.10 Synthesis of (S)-2-amino-6-((3-(3-(triﬂuoromethyl)-3H-diazirin-3-yl)benzyloxy)carbonylamino)hexanoic acid hydrochloride

(mTmdZLys): Compound 10 (300 mg, 0.61 mmol) was dissolved in HCl/MeOH (10 ml) and stirred at room temperature for 2 hr.

The solvent was removed to give S0394-A (250 mg) as a white solid, yield: 96.0%.

¹H-NMR (400 MHz, CD₃OD): d7.48-7.49 (m, 2H), 7.23-7.26 (m, 2H), 5.11 (s, 2H), 3.97 (t, 1H, J = 6.4 Hz), 3.16 (t, 2H, J = 6.8 Hz), 1.89-

1.99 (m, 2H), 1.45-1.62 (m, 4H).

LC/MS [mobile phase: from 90% water (0.1% formic acid) and 10% CH₃CN (0.1% formic acid) to 5% water (0.1% formic acid) and

95% CH₃CN (0.1% formic acid) in 6.0 min, ﬁnally under these conditions for 0.5 min.] The purity was 96.3%, Rt = 2.464 min, and MS

Calcd.: 388; MS Found: 389.1 ([M+H]⁺).

QUANTIFICATION AND STATISTICAL ANALYSIS

For the incorporation efﬁciencies of non-natural amino acids and the time course analysis of aminoacylation, data were presented as

mean standard deviation (SD) from two or three independent experiments. Statistical analysis (calculation of SD) was performed by

using Excel (Microsoft).

DATA AND SOFTWARE AVAILABILITY

The coordinates and structure factors have been deposited in the RSCB Protein Data Bank (ID codes 6AB8, 6AAP, 6AB2, 6ABL,

6AB1, 6AAZ, 6AB0, 6ABM, 6AAD, 6AAC, 6AAN, 6AAQ, 6AAO, and 6ABK, for the PylRSc(Y306A/Y384F) structures in complex

with ZLys, ZaeSeCys, oClZLys, oBrZLys, oAzZLys, pNO₂ZLys, pAmPyLys, pTmdZLys, mTmdZLys, mAzZLys, mEtZLys, BCNLys,

TCO*Lys, and TeocLys, respectively). Softwares used for structural analyses are listed in Key Resources Table.

Cell Chemical Biology 26, 1–14.e1–e13, July 18, 2019 e13

Article Doi

Structural Basis for Genetic-Code Expansion with Bulky Lysine Derivatives by an Engineered Pyrrolysyl-tRNA Synthetase

DOI: 10.1016/j.chembiol.2019.03.008

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.chembiol.2019.03.008

Full text of DOI:10.1016/j.chembiol.2019.03.008

Products guided by the article

R&D Labs maybe for 162844-91-9

Relevant to this article

Hot Product