Conjugation of Small Molecules to RNA Using a Reducible Disulfide Linker Attached at the 2′-OH Position through a Carbamate Function

Article abstract of DOI:10.1002/ejoc.201900740

A post-synthesis conjugation method was developed to functionalize oligoribonucleotides with various small molecules of biological interest using a reduction-sensitive disulfide linker connected to 2′OH via a carbamate function. For this, first we prepare

Full text of DOI:10.1002/ejoc.201900740

A Journal of
Accepted Article
Title: Conjugation of small molecules to RNA using a reducible
disulfide linker attached at 2'OH position via a carbamate function
Authors: Florian Gauthier, Astrid Malher, Jean-Jacques Vasseur,
Christelle Dupouy, and Françoise Debart
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: Eur. J. Org. Chem. 10.1002/ejoc.201900740
Link to VoR: http://dx.doi.org/10.1002/ejoc.201900740
Supported by

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
Conjugation of small molecules to RNA using a reducible
disulfide linker attached at 2’-OH position via a carbamate
function
Florian Gauthier,[a] Astrid Malher,[a] Jean-Jacques Vasseur,[a] Christelle Dupouy,*[a] and Françoise
Debart *[a]
Abstract: A post-synthesis conjugation method was developed to
detection. Recently, coumarin derivative attached to ON was
used as a fluorescent probe to specifically detect glutathione,
the most abundant biothiol over cysteine and homocysteine.[4]
Moreover, vitamins receptors, such as biotin receptors, are
overexpressed in many cancers and consequently were used as
biomarkers for the imaging and the detection of tumors cells or
the targeting of drug delivery.[5]
functionalize oligoribonucleotides with various small molecules of
biological interest using
connected to 2’OH via a carbamate function. For this, first we
prepared 2’-O-[(N-(acetylthio)-ethylcarbamoyl] (2’-O-AcSEC)
a reduction-sensitive disulfide linker
a
uridine phosphoramidite as the key precursor of the disulfide linker,
that was incorporated into 21-mer RNAs. Next the 2’-O-AcSEC
group was converted on solid support to the activated 2’-O-[N-(2-
pyridyldisulfanyl)-ethylcarbamoyl] (2’-O-PySSEC) group. Finally, the
coupling between 2’-O-PySSEC-modified RNA and diverse small
molecules bearing a thiol function was based on a thiol-disulfide
exchange reaction in solution. Several RNA-small molecule
conjugates were obtained with satisfactory conjugation yields. An
RNA was successfully double-conjugated with an anticancer drug
(doxorubicin) attesting the efficiency and the robustness of the
conjugation method. We have shown that the disulfide-linked RNA-
small molecule conjugates were cleaved upon 5.6 mM glutathione
treatment, featuring the release of the small molecules in cells.
Attachment of small molecules to ON using various chemical
strategies with amide[6] or oxime[7] linkers or via click chemistry[8]
has been reported. Due to its high compatibility with many
functional groups and the ease of formation, the disulfide bond is
also very attractive for conjugation. Indeed, this linkage is stable
under physiological conditions and is cleaved in the intracellular
reducing environment.[9] The conjugation reactions using a
disulfide linkage were mostly achieved at the 5’- and 3’-end
positions of ON due to their great accessibility.[10] Likewise, the
nucleobases[11] and the phosphodiester bonds[12] were selected
as other conjugation sites. However, these positions suffer from
different various limitations: only one molecule can be
conjugated to ON at 5’- or 3’-end, the base-pairing can be
disturbed by conjugation on the nucleobases and RNA structure
can be altered by modifications of the phosphates. In contrast,
the 2’-position is more versatile and allows multi-conjugation
sites within one sequence. To our knowledge, only a few
examples of conjugation to 2’-position of ribonucleosides via a
disulfide linkage have been reported. Winkler and coll.
developed a solid-phase coupling of peptides and polyethylene
glycols ligands to ON via a 2’-O-thioethyl nucleoside attached to
the solid support through the thiol function.[13]
Introduction
Conjugation of oligonucleotides (ON) with small molecules is
challenging and arouses researcher’s interest for diverse
applications such as therapeutics or diagnosis. Covalent
association to small molecules such as peptides, carbohydrates
or lipids could improve ON properties such as cell-specific
delivery, cellular uptake efficiency or half-lives in fluids.[1]
Carbohydrates are recognized by protein receptors named
lectins expressed on cell surfaces. As glycoproteins containing
sugar moieties are internalized into cells, ON-carbohydrate
conjugates can therefore be used to improve poor cell or tissue-
specific uptake of ON.[2] In particular, N-acetylgalactosamine
(GalNAc) siRNA conjugates should be mentioned as one
significant and relevant example of the successful use of sugar-
oligonucleotide conjugates for delivery to liver hepatocytes.[3]
Conjugation of small molecules to ON could also be used for
[a]
Dr. F. Gauthier, A. Malher, Dr. J.-J. Vasseur, Dr. C. Dupouy,
Dr F. Debart
Institut des Biomolécules Max Mousseron (IBMM), Université de
Montpellier, CNRS, ENSCM, Montpellier, France
E-mail: christelle.dupouy@umontpellier.fr
francoise.debart@umontpellier.fr
Homepage : https://ibmm.umontpellier.fr/?-oligonucleotides-
modifies-
Scheme. 1 Synthesis of 2’-O-[N-(2-ethyldisulfanyl) carbamoyl] RNA-small-
molecule conjugates.
Supporting information for this article is given via a link at the end of
the document.
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
This method is efficient yet only the 3’-extremity of ON can be
conjugated. Another example of conjugation reaction at the 2’-
position with a disulfide linker has been reported for the specific
cross-linking of proteins via cysteine to ON. In this case, a 2’-
amino-2’-deoxyuridine was introduced as a precursor unit within
the ON sequence then the amino group was converted to 2’-
pyridyldithiopropionamide derivative to perform the thiol-disulfide
exchange reaction with cysteine yielding the disulfide linker.[14]
Moreover, in a previous work we developed a post-synthesis
strategy based on the thiol-disulfide exchange reaction for the
preparation of siRNA prodrugs 2’-O-modified by disulfide-
containing groups.[15] We also used this reaction to introduce a
disulfide-bridge between 2’-O-positions of two adjacent
nucleotides in the loop of RNA hairpins.[16] In both cases, the
disulfide bond was anchored to the nucleoside via a thioacetal
function. Reduction of the disulfide bond resulted in an unstable
hemithioacetal giving rise to free 2’-OH RNA.
Et3N.3HF yielded the 3’,5’-OH 2’-O-AcSEC uridine 5 (92 % yield),
which was further selectively protected at 5’-O-position with
dimethoxytrityl chloride to give the nucleoside 6 (98% yield).
Finally, phosphitylation of
(N,N,diisopropylamino)phosphine
6
with chloro-(2-cyanoethoxy)-
afforded the 3’-
phosphoramidite 2’-O-AcSEC uridine 7 with high purity in 89%
yield. The synthesis of 2’-O-AcSEC uridine phosphoramidite 7
was efficiently achieved in 6 steps with 51% overall yield from
5’,3’-O-TIPS-uridine 1.
In this paper, we present a post-synthesis conjugation method of
a 21-mer RNA to various small molecules of interest such as
carbohydrates, lipids, vitamins, fluorescent probes and
anticancer drugs using a disulfide linker attached at 2’-position
via a carbamate function (Scheme 1). It is well known that
carbamate function plays an important role in medicinal
chemistry due to its high stability in physiological conditions.[17]
Moreover, several functional groups (dansyl, amino aliphatic
chains) were previously introduced into the 2’OH position of ON
via a carbamate function.[18] 2’-carbamate modification is stable
to conditions of standard oligonucleotide synthesis using
phosphoramidite chemistry. The 2’-carbamate functionalization
of RNA with various biomolecules for many applications, via a
reduction-responsive disulfide linker remained quite unexplored.
The global strategy for the synthesis of these RNA-small
molecule conjugates is based on a thiol-disulfide exchange
reaction between a small molecule containing a thiol or a thiolate
function and an RNA bearing a pyridyldisulfanyl group (Scheme
1). The driving force of this reaction is the formation and
elimination of the pyridine-2-thione, which allows a rapid and
irreversible reaction.
Scheme 2. Synthesis of 2’-O-AcSEC uridine phosphoramidite 7. Reagent and
conditions : a) 4-nitrophenyl chloroformate, pyridine, toluene, r.t., 5 h, 81% ; b)
2-bromoethylamine hydrobromide, Et3N, pyridine, r.t., 4 h, 98% ; c) CH3COSK,
18-crown-6, CH3CN, r.t., overnight, 80% ; d) Et3N.3HF, THF, r.t., 4 h, 92% ; e)
DMTrCl, DIEA, pyridine, CH2Cl2, r.t., 7 h, 98% ; f) iPr2NPCl(OCNE), DIEA,
CH2Cl2, r.t., 3.5 h, 89%
Synthesis of 21-mer RNAs with one or two 2’-O-PySSEC
modifications. The 2’-O-AcSEC uridine phosphoramidite 7 was
incorporated once or twice into 21-mer RNA whose sequence
corresponds to the sense strand of a siRNA (siEF-4S) targeting
a gene involved in Ewing’s sarcoma. The 2’-O-modification was
introduced either in the middle of the sequence (RNA 8) or at
two sites: in the middle and close to the 3’-end (RNA 9) (Table
1). Both RNAs were synthesized using the phosphoramidite
uridine 7 and commercially available 2’-O-pivaloyloxymethyl (2’-
O-PivOM) ribonucleoside phosphoramidites (Chemgenes) as
precursors of 2’OH ribonucleotides.[19] From the same 2’-O-
AcSEC RNA precursor, various 2’-O-functionalized RNAs with
different molecules bearing a thiol function can be prepared. The
syntheses were carried out on a 1 mol scale with a 180 s
coupling step. After RNA assembly, an activation step of the
thiol function into pyridyldisulfanyl ethylcarbamate (2’-O-
Results and Discussion
Synthesis of 2’-O-AcSEC uridine phosphoramidite 7. To
anchor the linker at 2’-position of RNA, we first prepared 2’-O-
[(N-(acetylthio)-ethylcarbamoyl]
(2’-O-AcSEC)
uridine
3’-
phosphoramidite 7 which represents the precursor unit for 2’-
functionalization within RNA sequence (Scheme 2). The 2’-
carbamate modification was achieved via a 2’-O-carbonate
intermediate 2 obtained with 81% yield by treating 3’,5’-O-
(1,1,3,3-tetraisopropyldisiloxane-1,3-diyl) (TIPS) uridine 1 with 4-
nitrophenylchloroformate.[18b]
carbamoyl] uridine was formed with 2-bromoethylamine
The
2’-O-[N-ethylbromide
3
hydrobromide in 98% yield. Then, a nucleophilic substitution of
bromine by potassium thioacetate in the presence of 18-crown-6
gave 2’-O-AcSEC uridine 4 in 80% yield. A treatment with
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
PySSEC) was performed on solid support, by treating 2’-O-
AcSEC RNAs with a large excess of 2,2’-dithiodipyridine (1000
equiv. per modification) in anhydrous BuNH2/THF (1/3) solution
for 15 min. During this reaction, cyanoethyl protecting groups
were also removed from phosphates. Then 2’-O-PySSEC RNAs
were released from solid support and deprotected (nucleobases
and 2’-OH) with an aqueous concentrated ammonia solution for
3 h at 30°C. Crude 2’-O-PySSEC RNAs 8 and 9 were purified by
Ion-Exchange HPLC (IEX-HPLC), characterized by MALDI-TOF
mass spectrometry and obtained with high purity (Figures S10-
S11, Supplementary Information).
Table 1. Synthesis of 2‘-O-PySSEC RNAs 8 and 9
Figure 1. Structures of small molecules used for conjugation to RNA
Method A corresponds to the direct coupling of commercially
available thiol compounds such as 1-thio--D-glucose 10, 1-thio-
-D-galactose 11, glutathione 12 and 7-mercapto-4-
methylcoumarin 13 to 2’-O-PySSEC RNA 8. The reactions were
performed in HEPES buffer (pH = 8) at 37°C for 24 h except for
coumarin derivative 13 where DMF (50%) was added to improve
solubility (Table 2). After coupling completion, the resulting
conjugates were purified by IEX-HPLC and characterized by
MALDI-TOF mass spectrometry (Table 2, Figures S12-S15).
For example, Figure 2a shows the HPLC chromatograms of the
crude conjugates resulting from the coupling between RNA 8
with 1-thio--D-glucose 10 (left panel) or glutathione 12 (right
panel), respectively. In both cases, the major peak representing
63% and 70% was assigned to RNA conjugates 17 and 19
obtained with reasonable efficacy. RNA conjugates 18 and 20,
corresponding to the functionalization of RNA 8 with 1-thio--D-
galactose 11 and 7-mercapto-4-methylcoumarin 13 respectively,
were obtained with higher efficacy (85% and 72% calculated by
integration of chromatogram at 260 nm) (Table 2).
MALDI-TOF MS [b]
RNA
Sequence [a]
Calcd.
/
Found
/
siEF-4S
5’GCAGCAGAACCCUUCUUAUGA 3’
5’GCAGCAGAACCCURUCUUAUGA 3’
5’GCAGCAGAACCCURUCUUAURGA3’
8
9
6867.4
7079.7
6867.9
7079.5
[a] UR = 2’-O-PySSEC Uridine. [b] Negative mode
However, after IEX-HPLC purification all conjugates were
isolated with much lower recovery yields (from 36% for 17 to
46% for 18 and 20). The additional desalting step performed
after IEX-HPLC purification could explain the difference between
the conjugation efficacies and the recovery yields. Moreover, in
HPLC chromatograms, minor peaks with shorter retention times
are noteworthy (Figure 2a, Figures S12-S15). These peaks were
assigned to shorter RNA sequences corresponding to some
chemical degradations of RNA probably due to the excess of
small molecules at high concentration (100 mM) in the reaction
mixture. To check this hypothesis, we monitored the stability of
the unmodified RNA siEF-4S in the presence of small molecules
10-13 by IEX-HPLC (Figure S19). After 24 h incubation, the
peaks corresponding to siEF-4S mostly decreased in the
presence of 1-thio--D-glucose 10 (33%), 1-thio--D-galactose
11 (54%), 7-mercapto-4-methylcoumarin 13 (6%), respectively
whereas siEF-4S remained more stable (89 %) in the presence
of glutathione 12.
Conjugation of 2’-O-PySSEC RNA to various small
molecules. A large variety of molecules such as galactose,
glucose, glutathione, deoxycholic acid, biotin, 4-methylcoumarin
and doxorubicin (Dox) have been anchored to a 21-mer RNA
(Scheme 1). Moreover, this RNA has been functionalized at one
or two separate sites with Dox, an anthracycline cytotoxic
chemotherapeutic drug employed for the treatment of several
cancers such as breast, stomach, soft tissue sarcomas and
lymphomas cancers. 2’-O-PySSEC RNA 8 was conjugated in
solution to small molecules 10-16 bearing thiol or disulfide
functions using a thiol-disulfide exchange reaction (Figure 1,
Table 2). For the coupling, two slightly different methods A and
B were investigated depending on the commercial availability of
the thiol derivative for each small molecule.
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
Table 2: Synthesis and data for RNA-small molecules conjugates 17-24 linked by a disulfide linkage
Conjugation Recovery
Yield % [d] Yield % [e]
MALDI-TOF MS [c]
ON [a]
R
method [b]
solvent
Calcd.
Found
HEPES buffer
pH 8
17
A
6952.4
6952.8
63
37
HEPES buffer
pH 8
18
19
20
A
A
A
6952.4
70662.6
6948.4
6953.1
7063.7
6945.4
85
70
72
46
42
46
HEPES buffer
pH 8
HEPES buffer
pH 8/DMF 1/1
HEPES buffer
pH 8/DMF 3/1
21
22
23
24
B
B
B
B
7059.6
7403.9
7207.9
8152.6
7061.8
7405.9
7207.5
8152.9
89
88
42
71
46
63
36
38
HEPES buffer
pH 8/DMF 1/1
HEPES buffer
pH 8/DMF 7/3
HEPES buffer
pH 8/DMF 1/1
[a] RNA sequence = 5’GCAGCAGAACCCURUCUUAUGA3’ for RNA-conjugates 17-23 ; RNA sequence = 5’GCAGCAGAACCCURUCUUAURGA3’ for RNA–Dox
conjugate 24, UR = 2’-O-modified Uridine with R = small molecules. [b] Method A = RSH 10-13/solvent, 37°C, 24 h ; Method B= 1) RSSPy 14-16 TCEP solvent
37°C, 2 h. 2) RNA 8 or 9 37°C, 24 h for RNA conjugates 21 and 23, 5 min for RNA conjugates 22 and 24. [c] Negative mode. [d] percentage of peak area
corresponding to the RNA conjugate in crude material as calculated by integration of the IEX-HPLC chromatogram monitored at 260 nm. [e] Recovery yield based
on UV absorption at 260 nm of purified RNA conjugates 17-21 and 23 and at 481 nm for RNA conjugates 22 and 24.
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
Figure 2. a) IEX-HPLC profiles of solution phase conjugation of RNA 8 with 1-thio--D-glucose 10 to give RNA-glucose conjugate 17 (left panel) and glutathione
12 to give RNA-glutathione conjugate 19 (right panel) upon method A. b) RP-HPLC profiles of solution phase conjugation of RNA 8 with Dox-SS-py derivative
15 (left panel) and deoxycholic acid derivative 16 (right panel) upon method B to afford RNA conjugates 22 and 23, respectively.
These results confirm that high concentration of 1-thio--D-
glucose 10, 1-thio--D-galactose 11 or 7-mercapto-4-
methylcoumarin 13 causes some RNA degradation and might
partially explain the low recovery yields.
panel). The steric hindrance of deoxycholic acid derivative could
partially explain this low yield. Moreover, supplementary peaks
were also detectable in the HPLC chromatogram, probably due
to the chemical degradation of RNA caused by high
concentration of deoxycholic acid derivative 16.
The conjugation with more hydrophobic molecules was also
evaluated using an alternative method B. In this case, the
pyridyldisulfanyl derivatives of biotin and deoxycholic acid 14
and 16, respectively, have been synthesized from biotin and
deoxycholic acid that are not commercially available with a thiol
function (Schemes S1-S2).[20] Likewise, the doxorubicin
pyridyldisulfanyl derivative (Dox-SS-Py) 15 was prepared
To check this hypothesis, the stability of unmodified RNA siEF-
4S in the presence of pyridyldisulfanyl derivatives 14, 15 and 16
was monitored by IEX-HPLC. Compounds 14, 15 and 16 were
treated with TCEP in a mixture of HEPES buffer and DMF for 2
h and were added to siEF-4S. After 24 h and 48 h incubation,
siEF-4S remained nearly intact in the presence of 14, 15 and 16
(Figure S20). Nevertheless, after 72 h, siEF-4S was slightly
hydrolyzed in the presence of biotin derivative 14 (corresponding
peak at 87%) and more significantly in the presence of
doxorubicin (corresponding peak at 62%) whereas siEF-4S was
totally degraded in the presence of deoxycholic acid derivative
16. The steric hindrance of 16 combined to chemical
degradation of RNA might explain the lower conjugation
efficiency and recovery yield for RNA-deoxycholic acid
conjugate 23.
following
a
described protocol.[21] The coupling of the
pyridyldisulfanyl derivatives 14, 15 and 16 has been achieved
upon method B (Table 2). First, they were treated with tris(2-
carboxyethyl) phosphine (TCEP) in a mixture of HEPES buffer
and DMF for 2 h to generate a thiol function. Then, this solution
was directly added to the dry 2‘-O-PySSEC RNA 8 upon stirring.
The reaction was performed at 37°C for 24 h and monitored by
IEX-HPLC for conjugate 21 (Figure S16) and RP-HPLC for 22
and 23 to optimize chromatographic separation (Figures 2b,
S17-S18). After 24 h, the crude RNA conjugates were purified
by IEX-HPLC or RP-HPLC and characterized by MALDI-TOF
mass spectrometry. When treating RNA 8 with Dox-SS-Py 15,
some RNA degradations were observed within 24 h, the yield
was improved by reducing the coupling time. Indeed, after 5 min
incubation with Dox-SS-Py 15, the peak corresponding to RNA 8
in the HPLC chromatogram has totally disappeared and the
newly major peak was assigned to RNA conjugate 22 with
satisfactory conjugation and recovery yields (88% and 63%,
respectively) (Figure 2b left panel, Table 2). A similar estimated
conjugation yield (89%) was obtained for RNA conjugate 21 with
biotin after 24 h coupling time (Table 2). In contrast, RNA
conjugate 23 with deoxycholic acid was formed with lower
conjugation yields (42%) after 24 h reaction (Figure 2b, right
In order to synthesize a multi-conjugated RNA, we explored the
conjugation reaction between Dox-SS-Py derivative 15 and RNA
9
bearing 2’-O-PySSEC modifications on two distinct
ribonucleotides. Indeed, combination therapy of cancer using
two drugs with different mechanisms of action (RNAi and
chemotherapy with Dox) has aroused great interest for many
years. Both drugs exhibit an individual biological activity in a
synergistic manner in cancer cells and can overcome multidrug
resistance, thereby inhibiting tumor progression. Up to now,
numerous attempts have been made to co-deliver anticancer
drugs and siRNA into cancer cells using a wide variety of
nanocarriers (nanoparticles, micelles, liposomes).[22]
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
GSH sensitivity of all the conjugates 17-23 were evaluated with
5.6 mM GSH in HEPES buffer (pH 8) by MALDI-TOF mass
spectrometry. After 5 min incubation, as shown in Figure 4, the
peak corresponding to the initial RNA-biotin conjugate 21 (m/z
7061.8) has disappeared and the peak at m/z 6764.2 was
assigned to the intermediate thiol resulting from the disulfide
cleavage.
A new peak at m/z 7066.6 corresponding to the conjugate RNA-
GSH 19 is noteworthy in the MS spectrum after 1.5 h incubation.
Indeed, the released thiol has probably attacked the disulfide
bond of the glutathione disulfide (GSSG), produced upon the
spontaneous oxidation of GSH. After 6 h, RNA-GSH 19 was the
sole compound detected in mass spectrometry and remained
perfectly stable after 24 h. The same result was observed for all
RNA-small molecule conjugates (Figures S21-S26). Moreover,
after 6 h, mass spectra of RNA conjugates 17, 20 and 23
showed important RNA degradations attesting the RNA
sensitivity to 1-thio--D-glucose, 7-mercapto-4-methylcoumarin
and deoxycholic acid derivatives (Figures S21, S24, S26).
These results evidence that the disulfide bond is rapidly cleaved
in the presence of GSH leading to a thiol derivative that is very
reactive to conjugation with other disulfide-containing molecules,
nevertheless the small molecules are released.
Figure 3. HPLC profiles of solution phase conjugation of RNA 9 with Dox-SS-
Py derivative 15. RP-HPLC profiles of pure RNA 9 (panel a) and crude double
DOX RNA conjugate 24 (panel b). Panel c: IEX-chromatogram and MALDI-
TOF mass spectrum of pure RNA conjugate 24.
Here, the disulfide-linked Dox-siRNA conjugates were designed
to simultaneously deliver both molecules to cancer cells and
lipophilic Dox can be expected to increase siRNA uptake.
The double Dox-conjugation with RNA 9 was performed in the
same conditions as for the preparation of single Dox-conjugate
22 (Table 2). After 5 min, HPLC analysis of the crude product
showed one major peak (71%) corresponding to the desired
conjugate 24 (Figure 3b). After purification, double Dox-RNA 24
was obtained with high purity in acceptable yield (38%) (Figure
3c). The MALDI-TOF analysis exhibited a peak (m/z = 8152.9)
assigned to 24 and a second peak (m/z = 7754.3) resulting from
the mass fragmentation of Dox during analysis. As previously
reported, this peak corresponds to the loss of the amino sugar
moiety (loss of 398).[23] The successful synthesis of this double-
Dox RNA conjugate 24 lets expect that the multiple-sites
conjugation should be efficient using method B.
Figure 4. MALDI-TOF MS spectra of RNA-biotin conjugate 21 incubated in the
presence of 5.6 mM GSH in HEPES buffer (pH 8) at 37°C, over 24 h.
Glutathione treatment. The reduction-responsive feature of the
RNA-small molecule conjugates 17-23 was tested in the
presence of glutathione (GSH) which is the most abundant thiol
in the cytosol (up to 10 mM) whereas it is found at low
concentration in extracellular medium.
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
Conclusions
2’-O-(4-nitrophenoxycarbonyl)-3’,5’-O-(1,1,3,3-
tetraisopropyldisiloxane-1,3-diyl) uridine (2). A solution of 3’,5’-O-
(tetraisopropyldisiloxane-1, 3-diyl) uridine 1 (5.00 g, 10.28 mmol, 1.00
equiv) in dry toluene (100 mL) was treated under argon with dry pyridine
(0.82 mL, 10.28 mmol, 1.00 equiv) and 4-nitrophenyl chloroformate (2.38
g, 11.82 mmol, 1.15 equiv). The mixture was stirred for 3 h at room
temperature. Then, dry pyridine (0.15 mL, 2.06 mmol, 0.20 equiv) and 4-
nitrophenyl chloroformate (0.475 g, 2.06 mmol, 0.20 equiv) were added.
After stirring at room temperature for 2 h, the mixture was diluted in ethyl
acetate and washed with water. The aqueous layer was then extracted
with ethyl acetate. The organic layer was washed with brine and dried
over Na2SO4. The solvent was evaporated under reduced pressure. The
crude material was purified by silica gel column chromatography with
In this work, a large variety of small molecules were successfully
conjugated to RNA using a disulfide linker attached to a 2’-OH
uridine via a carbamate function. The 2’-functionalization of RNA
was achieved through the 2’-O-N[(acetylthio)-ethylcarbamoyl]
uridine phosphoramidite, synthesized in 6 steps with 51% overall
yield. Then, the thiol precursor in RNA was activated on solid
support with a pyridyldisulfanyl group allowing subsequent thiol-
disulfide exchange reaction in solution with diverse small
molecules bearing a thiol function. Moreover, the successful
preparation of a RNA bearing two Dox molecules attests the
great potential of this method for conjugation at multiple and
well-defined sites. The rapid cleavage of the disulfide bridge
upon 5.6 mM GSH shows that such RNA conjugates will be
responsive to the reducing environment of the intracellular
medium. The small-molecules will be released with a wide field
of applications such as cell-imaging, in vitro detection or drug
delivery. Particularly, in cancer therapy a co-delivery system
based on multiple doxorubicin attached to siRNA via a disulfide
bond might be envisaged to boost the anticancer activity and
overcome multidrug resistance.
cyclohexane/ethyl acetate (70/30). The desired compound
obtained as white foam (5.4 g, 8.2 mmol, 81
2
was
%).
1H NMR (CDCl3, 400 MHz) δ ppm: 9.14 (s, 1 H, NH), 8.28 (d, J = 8.0 Hz,
2 H, Ph), 7.75 (d, J = 8.0 Hz, 1 , H6), 7.38 (d, J = 8.0 Hz, 2 H, Ph), 5.94 (s,
1 H, H1'), 5.74 (d, J = 8.4 Hz, 1 H, H5), 5.32 (d, J= 9.2 Hz, 1 H, H2'), 4.47
(dd, J= 9.2 Hz, J = 3.6 Hz, 1 H, H3'), 4.26 (d, J = 10.0 Hz, 1 H, H5’), 4.11
(d, J = 3.6 Hz, 1 H, H4’), 4.02 (d, J = 10.2 Hz, 1 H, H5’), 1.10-0.98 (m, 28
H, iPr) ppm. 13C NMR (CDCl3, 100 MHz) δ ppm: 163.0, 155.4, 151.4,
149.8, 145.5, 139.0, 125.4, 121.7, 102.4, 88.0, 82.0, 80.2, 67.8, 59.1,
17.4 - 16.7 (8 C), 13.8 - 12.5 (4 C) ppm. HRMS (ESI+): m/z calcd. for
C28H42N3O11Si2: 652.2358 [M+H]+, found 652.2365.
2’-O-[N-(2-bromoethylcarbamoyl)]-3’,5’-O-(1,1,3,3-
tetraisopropyldisiloxane-1,3-diyl) uridine (3). A solution of compound
2
(2.38 g, 3.65 mmol, 1.00 equiv) in dry pyridine (36.5 mL) was treated
under argon with 2-bromoethylamine hydrobromide (0.897 g, 4.38 mmol,
1.2 equiv) and dry triethylamine (0.5 mL, 7.3 mmol, 2 equiv). After stirring
at room temperature for 4 h, the mixture was diluted in ethyl acetate and
washed with water. The aqueous layer was then extracted with ethyl
acetate. The combined organic extracts were washed with brine and
dried over Na2SO4. The solvent was removed under reduced pressure.
The crude material was purified by silica gel column chromatography with
a step gradient of dichloromethane and ethyl acetate (10-30 %). The
desired compound 3 was obtained as white foam (2.27 g, 3.57 mmol,
98 %).1H NMR (CDCl3, 400 MHz) δ ppm: 9.23 (s, 1 H, NH), 7.65 (d, J =
4.1 Hz, 1 H, H6), 5.83 (s, 1 H, H1'), 5.69 (dd, J = 4.1 Hz, J = 1.1 Hz, 1 H,
H5), 5.67 (t, J = 5.5 Hz, 1 H, NH), 5.27 (d, J = 5.1 Hz, 1 H, H2'), 4.35 (dd,
J = 5.1 Hz, J = 3.1 Hz, 1 H, H3'), 4.19 (d, J = 7.1 Hz, 1 H, H5’), 3.99-3.96
(m, 2 H, H5',H4'), 3.66-3.51. (m, 2 H, CH2), 3.45 (t, J = 5.3 Hz, 2 H, CH2),
1.08-0.99 (m, 28 H, iPr). 13C NMR (CDCl3, 100 MHz) δ ppm: 163.2, 154.4,
149.7, 139.3, 102.2, 88.5, 82.1, 76.1, 67.9, 59.7, 42.8, 32.2, 16.7-17.4 (8
C), 12.5-13.4 (4 C). HRMS (ESI+): m/z calcd. for C24H42BrN3O8Si2
[M+H]+: 636.1772, found 636.1779.
Experimental Section
General Methods. Pyridine, triethylamine and DIEA were distilled over
calcium hydride and methanol was distilled over sodium. All other
solvents and reagents were purchased from commercial suppliers and
were used without further purification. Thin-layer chromatography (TLC)
analyses were carried out on silica plate 60 F254. Purifications by column
chromatography were performed using 0.040-0.063 mm silica from
Merck. NMR experiments were recorded on a Bruker 400 spectrometer
at 20°C. HRMS analyses were obtained with electrospray ionization (ESI)
in positive mode on a Q-TOF Micromass spectrometer. RNAs were
synthesized using an automated DNA synthesizer (Applied Biosystems
394). Crude RNAs and conjugates 8-21 were analyzed and purified by
IEX-HPLC Dionex DNAPac® PA100, 4 x 250 mm for analysis or 9 x 250
for semi-preparative purpose. The following HPLC solvent system was
used: 5% CH3CN in 25 mM Tris-HCl pH 8 (buffer A), 5% CH3CN
containing 400 mM NaClO4 in 25 mM Tris-HCl pH 8 (buffer B). Flow rates
were 1.0 mL/min for analysis or 4 mL/min for semi-preparative purpose;
UV detection was performed at 260 nm. Crude RNA conjugates 22-24
were analyzed and purified by RP-HPLC (Thermo Scientific Accucore aQ
C18 2.6 µm, 2.1 x 50 mm). The following HPLC solvent systems were
used: 1% CH3CN in 12.5 mM TEAAc (buffer A), 80% CH3CN in 12.5 mM
TEEAc (buffer B). Flow rates were 1.9 mL/min. UV detection was
performed at 260 nm. MALDI-TOF mass spectra were recorded using a
Shimadzu AXIMA Assurance spectrometer equipped with an N2 laser
(337 nm) (Shimadzu, Japan) using 2,1,1-trihydroxyacetophenone as a
saturated solution in a mixture of acetonitrile/0.1 M ammonium citrate
solution (1:1, v/v) for the matrix. Analytical samples were mixed with the
matrix in the 1:5 (v/v) ratio, crystallized on a 384-well stainless steel plate
and analyzed. UV quantitation of RNAs was performed using a Varian
Cary 300 Bio UV/Visible spectrometer by measuring absorbance at 260
nm and at 481 nm for RNA conjugates 22 and 24. Lyophilized RNAs
were stored at -20°C for several months without any degradation.
2’-O-[N-(2-acetylthio)-ethylcarbamoyl]-3’,5’-O-(1,1,3,3-
tetraisopropyldisiloxane-1,3-diyl) uridine (4). Under argon, compound
3 (4.2 g, 6.6 mmol, 1.00 equiv) was dissolved in dry acetonitrile (132 mL)
at 40°C. The solution was treated with potassium thioacetate (1.12 g, 9.9
mmol, 1.5 equiv) and 18-crown-6 (0.871 g, 3.3 mmol, 0.5 equiv). After
stirring at room temperature overnight, the mixture was diluted in ethyl
acetate and washed with water. The aqueous layer was then extracted
with ethyl acetate. The combined organic extracts were washed with
brine and dried over Na2SO4. The solvent was evaporated under reduced
pressure. The crude material was purified by silica gel column
chromatography with a step gradient of dichloromethane and ethyl
acetate (0-20 %). The desired compound 4 was obtained as white foam
(3.36 g, 5.32 mmol, 80 %). 1H NMR (CDCl3, 400 MHz) δ ppm: 8.68 (s, 1
H, NH), 7.63 (d, J = 8.4 Hz, 1 H, H6), 5.80 (s, 1 H, H1'), 5.69 (d, J = 8.0 Hz,
1 H, H5), 5.25 (d, J = 4.4 Hz, 1 H, H2'), 5.14 (s, 1 H, NH), 4.36 (dd, J = 7.8
Hz, J = 5.4 Hz, 1 H, H3'), 4.18 (d, J = 11.1 Hz, 1 H, H5’), 4.00-3.95 (m, 2 H,
H5’, H4’), 3.37-3.35 (m, 2 H CH2), 3.00 (t, J = 6.1 Hz, 2 H, CH2), 2.34 (s, 3
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
H, CH3), 1.08-0.95 (m, 28 H, iPr). 13C NMR (CDCl3, 100 MHz) δ ppm:
195.8, 162.8, 154.5, 149.5, 139.5, 102.2, 88.7, 82.1, 75.3, 68.0, 53.4,
40.9, 30.6-30.9, 29.6, 16.0 – 17.4 (8C), 12.6 - 13.4 (4C). HRMS (ESI+):
m/z calcd for C26H46N4O8SSi2 [M+H]+: 632.2493, found 632.2493.
stirred at room temperature for 2 h. Then, the mixture was diluted with
ethyl acetate and washed with a saturated aqueous NaHCO3 solution.
The aqueous phase was extracted with ethyl acetate. The combined
organic layers were dried over Na2SO4 and evaporated under reduced
pressure. The crude residue was purified by silica gel column
chromatography with an isocratic elution of CH2Cl2/EtOAc (4/6)
containing 1 % pyridine. The desired compound 7 was obtained as a
white foam. (975 mg, 1.09 mmol, 89 %). 1H NMR (CD3CN, 400 MHz): δ
ppm: 9.19 (s, 1 H, NH), 7.75 (d, J = 7.6 Hz, 1 H, H6), 7.50-7.47 (m, 2 H,
HAr), 7.38-7.33 (m, 5 H, HAr), 7.23-7.18 (m, 2 H, HAr), 6.90 (dd, J = 8.6 Hz,
J = 3.8 Hz, 4 H, HAr), 6.05-5.95 (m, 2 H, H1' + NH), 5.43-5.36 (m, 2 H, H5
+ H2'), 4.68-4.59 (m, 1 H, H3’), 4.23 (dd, J = 24.3 Hz, J = 2.6 Hz, 1 H, H4’),
3.93-3.83 (m, 1 H, H5’), 3.80 (s, 3 H, OCH3), 3.79 (s, 3 H, OCH3), 3.76-
3.66 (m, 1 H, H5’’), 3.64-3.56 (m, 2 H, CH2), 3.41 (dd, J = 15.0 Hz, J = 2.8
Hz, 2 H, CH2), 3.30 (h, J = 6.9 Hz, 1 H, CH-(CH3)2), 3.22 (h, J = 6.8 Hz, 1
H, CH-(CH3)2), 3.08-2.92 (m, 2 H, CH2), 2.72 (t, J = 6.0 Hz, 1 H, HCH),
2.53 (t, J = 6.0 Hz, 1 H, HCH), 2.36 (s, 3 H, CH3), 1.19-1.06 (m, 12 H, 4
CH3). 13C NMR (CD3CN, 100 MHz) δ ppm: 196.0, 163.4, 159.4, 155.6,
151.0, 150.3, 145.3, 145.2, 140.8, 140.7, 138.5, 136.5, 136.0, 135.9,
135.7, 130.7, 129.5, 128.8, 128.6, 127.6, 125.8, 124.3, 113.8, 102.7,
87.1, 86.9, 84.0, 75.3, 71.5, 71.0, 63.4, 59.6, 58.8, 55.5, 43.5, 40.9, 30.4,
29.2, 24.7, 24.6, 24.5, 24.4, 21.0, 20.6. 31P-NMR (CD3CN, 162 MHz) δ
ppm: 149.66, 149.58. HRMS (ESI+): m/z calcd for C44H54N5O11PS
[M+H]+: 892.3278, found 892.3345.
2’-O-[N-(2-acetylthio)-ethylcarbamoyl] uridine (5). Under argon,
compound 4 (3.36 g, 5.3 mmol, 1.00 equiv) was dissolved in dry THF
(74.5 mL). The solution was treated dropwise with triethylamine
trihydrofluoride (1.7 mL, 10.6 mmol, 2 equiv). After stirring 4 h at room
temperature, the deprotection was complete and the reaction mixture
was treated with triethylammoniumacetate buffer (2 M, pH 7), then co-
evaporated with water and acetonitrile. The crude material was purified
by silica gel column chromatography with dichloromethane and methanol
(95/5). The desired compound 5 was obtained as white foam (1.9 g, 4.88
mmol, 92 %). 1H NMR (DMSO-d6, 400 MHz) δ ppm: 11.32 (s, 1 H, NH),
7.89 (d, J = 8.1 Hz, 1 H, H6), 7.50 (t, J = 6.0 Hz, 1 H, NH), 5.97 (d, J = 6.3
Hz, 1 H, H1'), 5.66 (d, J = 8.2 Hz, 1 H, H5), 5.47 (t, J = 5.2 Hz, 1 H, OH),
5.18 (t, J = 4.6 Hz, 1 H, H2'), 5.02 (t, J = 5.7 Hz, J = 5.1 Hz, 1 H, H3'), 4.19
(dd, J = 8.5 Hz, J = 4.9 Hz, 1 H, H4’), 3.88 (d, J = 3.0 Hz, 1 H, OH), 3.65-
3.54 (m, 2 H, H5’ + H5’’), 3.25-3.09 (m, 2 H, CH2), 2.94-2.84 (m, 2 H, CH2),
2.31 (s, 3 H, CH3). 13C NMR (DMSO-d6, 100 MHz) δ ppm: 195.6, 163.5,
155.6, 151.0, 141.1, 102.6, 86.2, 85.9, 75.2, 69.4, 61.4, 40.9, 31.0, 28.8.
HRMS (ESI+): m/z calcd for C14H19N3O8S [M+H]+: 390.0971, found
390.0972.
Solid-phase synthesis of RNA 8 and 9. RNA oligonucleotides were
synthesized using an ABI model 394 DNA/RNA synthesizer on 1 µmol
scale using commercial 2’-O-PivOM ribonucleosides phosphoramidites
2’-O-[N-(2-acetylthio)-ethylcarbamoyl]-5’-O-(4,4’-dimethoxytrityl)
uridine (6). Compound 5 (0.532 g, 1.37 mmol, 1 equiv) was dried for 24
h under reduced pressure, then was dissolved under argon in dry
pyridine (2.6 mL) at room temperature. After complete dissolution, dry
DCM (13.7 mL) was added. The solution was treated with N, N-
diisopropylethylamine (DIEA) (263 µL, 1.51 mmol, 1.1 equiv) and
dimethoxytrityl chloride (DMTrCl) (559 mg, 1.65 mmol, 1.2 equiv) added
in small portions over 1 h. After 2 h and 6 h, DIEA and DMTrCl (0.5 and
0.2 equiv respectively) were added to the reaction. Completion was
reached after 7 h, the mixture was diluted in DCM and poured into
saturated NaHCO3 solution. The aqueous layer was then extracted with
DCM. The combined organic extracts were washed with brine and dried
over Na2SO4. The solvent was removed under reduced pressure. The
crude material was purified by silica gel column chromatography with
DCM and pyridine (99/1), then DCM with methanol (1-5 %). The desired
compound 6 was obtained as pale yellow foam (980 mg, 1.34 mmol,
98 %). 1H NMR (CDCl3, 400 MHz): δ ppm: 9.36 (s, 1 H, NH), 7.75 (d, J =
8.2 Hz, 1 H, H6), 7.40-7.16 (m, 9 H, HAr), 6.84 (d, J = 8.9 Hz, 4 H, HAr),
6.17 (d, J = 5.1 Hz, 1 H, H1'), 5.80 (t, J = 6.1 Hz, 1 H, NH), 5.34 (dd, J = 8
Hz, J = 1.2 Hz, 1 H, H5), 5.24 (t, J = 5.1 Hz, 1 H, H2'), 4.67 (dd, J = 7.6 Hz,
J = 4.0 Hz, 1 H, H3’), 4.17 (d, J = 3.1 Hz, 1 H, H4’), 3.79 (s, 6 H, OCH3),
3.57 (m, 1 H, H5’), 3.57-3.48 (m, 2 H, H5’’+ HCH), 3.25-2.89 (m, 1 H+2 H,
HCH + CH2), 2.15 (s, 3 H, CH3). 13C NMR (CDCl3, 100 MHz) δ ppm:
196.9, 163.3, 158.7, 155.4, 150.7, 144.2, 140.2, 137.9, 135.9, 135.0,
130.2, 130.2, 130.0, 129.1, 129.1, 128.2, 128.2, 128.1, 128.1, 127.2,
125.3, 113.4, 113.3, 102.8, 87.2, 86.0, 84.1, 70.3, 62.8, 55.3, 55.3, 41.2,
28.8, 21.5. HRMS (ESI+): m/z calcd for C35H38N3O10S [M+H]+: 692.2200,
found 692.2283.
(Chemgenes)
or
2’-O-[N-(acetylthioethyl)carbamoyl]
uridine
phosphoramidite 7 and a long chain alkylamine (LCAA) controlled-pore
glass (CPG) as solid support though a succinyl linker. Oligonucleotides
were assembled in TWISTTM synthesis columns (Glen Research).
Phosphoramidites were vacuum-dried prior to their dissolution in extra
dry acetonitrile (Biosolve) at 0.1 M concentration. Coupling for 180 s was
performed with 5-benzylmercaptotetrazole (BMT, 0.3 M) as the activator.
The oxidizing solution was 0.1 M iodine in THF/pyridine/H2O (78:20:2,
v/v/v) (Link Technologies). The capping step was performed with a
mixture of 5% phenoxyacetic anhydride (Pac2O) in THF and 10% N-
methylimidazole in THF (Link Technologies). Detritylation was performed
with 3% TCA in CH2Cl2. After RNA assembly completion, the column was
removed from the synthesizer and dried under a stream of argon.
The solid support was treated with 2 mL of a 0.4 M solution of 2,2’-
dithiodipyridine (1000 equiv. per modification) and a 2.5 M butylamine
(0.5 mL) solution in anhydrous THF (1.5 mL). The solution was applied to
the synthesis column using two glass syringes filled with 4 Å molecular
sieves (5 beads each), and was pushed back and forth through the
synthesis column for 15 min. Then the solution was removed and the
solid-support was washed with anhydrous THF followed by a 1 min flush
with argon. Finally, the solid support was treated with a 30 % aqueous
ammonia solution for 3 h at 25°C. The solution was evaporated in the
presence of isopropylamine (13 % of total volume) under reduced
pressure. The residue was dissolved in 1.5 mL water, transferred to a 2
mL Eppendorf-vial and lyophilized.
2’-O-[N-(2-acetylthio)-ethylcarbamoyl]-3’-O-(2-cyanoethyl-N,N-
diisopropylphosphoramidite)-5’-O-(4,4’-dimethoxytrityl) uridine
7
Analysis, purification and desalting of RNA 8 and 9. The crude RNAs
were then purified by semi-preparative IEX-HPLC with a 20 min linear
gradient of 0% to 60% of eluent B in eluent A. The pure fractions of each
Under argon, compound 6 (0.850 g, 1.23 mmol, 1 equiv) was dissolved in
anhydrous CH2Cl2 (10 mL) previously passed through an alumina column.
A mixture of DIEA (386 µL, 2.21 mmol, 1.8 equiv) and 2-cyanoethyl N,N-
diisopropylchlorophosphoramidite (437 µL, 1.95 mmol, 1.5 equiv) in
CH2Cl2 (2.3 mL) was added dropwise. The mixture was stirred at room
temperature for 1.5 h. DIEA (129 µL, 0.74 mmol, 0.6 equiv) and 2-
cyanoethyl N,N-diisopropylchlorophosphoramidite (137 µL, 0.65 mmol,
0.5 equiv) in CH2Cl2 (2.3 mL) was added dropwise, and the reaction was
RNA were pooled in
a 100 mL round-bottomed flask and were
concentrated to dryness under reduced pressure. The residues were
dissolved in 100 mL TEAAc buffer, pH 7 and they were desalted using a
C18 cartridge (Sep-Pak®, Waters) equilibrated with a 100 mM TEAAc
buffer solution. The desired compound was eluted with a 12.5 mM
TEAAc/ CH3CN (50/50) solution in a 50 mL round-bottomed flask and
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
was lyophilized. The residue was dissolved in 1.5 mL water (divided in 3
portions 0.8 mL, 0.4 mL and 0.3 mL for flask rinsing), transferred to a 2
by freezing in liquid nitrogen and the RNA-deoxycholic acid conjugate 23
was purified by RP-HPLC, evaporated and characterized by MALDI-TOF
MS using the procedures described above.
mL Eppendorf-vial and lyophilized. Purified RNAs
8 and 9 were
characterized by MALDI-TOF MS and quantified by UV measurement
Recovery yields for RNA-Dox conjugates 22 and 24 were calculated from
UV absorption at 481 nm of the RNA conjugates. Other recovery yields
were calculated from UV absorption at 260 nm of RNA-small molecule
conjugates.
Procedures for conjugation of RNAs in solution.
Preparation of RNA-sugar conjugates 17, 18 and RNA-GSH 19. A 10
mM solution of of 1-thio-D-glucose 10, 1-thio--D-galactose 11, or
glutathione 12 was prepared in HEPES buffer (34 mM NaCl, 1 mM MgCl2,
0.05 mM EDTA, 7.5 mM HEPES, pH 8). The buffered solution (10µL by
nmol of RNA) was added to the lyophilized RNA 8 in a 0.5 mL Eppendorf.
The mixture was stirred at 37°C for 24 h using a thermoshaker (Thermal
Shake lite ®). The reaction was stopped by freezing in liquid nitrogen.
The RNA conjugates 17, 18 and 19 were purified by IEX-HPLC, desalted
and characterized by MALDI-TOF MS using the procedures described
above.
Reductive conversion of RNA under glutathione treatment.1 nmol of
RNA-small molecule conjugates (1 nmol) were freeze-dried in 500 µL
Eppendorf tubes then were dissolved in 100 µL of a glutathione-HEPES
buffer (34 mM NaCl, 1 mM MgCl2, 0.05 mM EDTA, 7.5 mM HEPES, 10
mM glutathione, pH 8) and incubated at 37°C. For RNA-conjugates 17,
19, 20, 21 and 23, aliquots were collected after 5 min, 1.5 h, 6 h and 24 h.
For RNA conjugate 18, aliquots were collected after 1.5 h, 6 h and 24 h.
For RNA conjugate 22, aliquots were collected after 30 min, 4 h and 24 h.
All aliquots were immediately frozen in liquid nitrogen and kept at -80°C
until analysis. Samples were diluted with water and analyzed by MALDI-
TOF MS.
Preparation of RNA-4-methylcoumarin conjugate 20.
A 10 mM
solution of 7-Mercapto-4-methylcoumarin 13 was prepared in 1:1 mixture
of HEPES buffer (34 mM NaCl, 1 mM MgCl2, 0.05 mM EDTA, 7.5 mM
HEPES, pH 8) and DMF. The buffered solution (10 µL by nmol of RNA)
was added to the freeze-dried RNA 8 in a 0.5 mL Eppendorf. Then, the
mixture was stirred at 37°C for 24 h using a thermoshaker. The reaction
was stopped by freezing in liquid nitrogen. The RNA-4-methylcoumarin
conjugate 20 was purified by IEX-HPLC, desalted and characterized by
MALDI-TOF spectrometry using the procedures described above.
Acknowledgments
Dr. F. Gauthier thanks the University of Montpellier for financial
support.
Preparation of RNA-biotin conjugate 21. A 10 mM solution of (+) -
Biotin N-2-(pyridin-2-yldisulfanyl)ethyl amide 14 was prepared in 1:1
mixture of HEPES buffer (34 mM NaCl, 1 mM MgCl2, 0.05 mM EDTA, 7.5
mM HEPES, pH 8) and DMF. 100 µL of this solution (1000 nmol, 100
equiv.) were diluted with 84 µL of HEPES buffer pH 8 and 16 µL of a
buffered solution of TCEP (50 nmol / µL, 80 equiv,). The mixture was
stirred for 2 h at 37°C using a thermoshaker. Then the solution was
added to the freeze-dried RNA 8 in a 0.5 mL Eppendorf and stirred at
37°C for 24 h using a thermoshaker. The reaction was stopped by
freezing in liquid nitrogen and the RNA-biotin conjugate 21 was purified
by IEX-HPLC, desalted and characterized by MALDI-TOF MS using the
procedures described above.
Keywords: conjugation • RNA • disulfide bridge • carbamate •
2’-OH modification
[1]
[2]
X. Ming, B. Laing, Adv. Drug Deliv. Rev. 2015, 87, 81-89.
a) A. Aviñó, S. M. Ocampo, R. Lucas, J. J. Reina, J. C. Morales, J.
C. Perales, R. Eritja, Mol. Divers. 2011, 15, 751-757; b) B. Ugarte-
Uribe, S. Pérez-Rentero, R. Lucas, A. Aviñó, J. J. Reina, I. Alkorta,
R. Eritja, J. C. Morales, Bioconjugate Chem. 2010, 21, 1280-1287;
c) T. S. Zatsepin, T. S. Oretskaya, Chem. Biodivers. 2004, 1,
1401-1417; d) Y. Ikeda, D. Kubota, Y. Nagasaki, Bioconjugate
Chem. 2010, 21, 1685-1690.
[3]
a) S. Matsuda, K. Keiser, J. K. Nair, K. Charisse, R. M. Manoharan,
P. Kretschmer, C. G. Peng, A. V. Kel’in, P. Kandasamy, J. L. S.
Willoughby, A. Liebow, W. Querbes, K. Yucius, T. Nguyen, S.
Milstein, M. A. Maier, K. G. Rajeev, M. Manoharan, ACS Chem.
Biol. 2015, 10, 1181-1187; b) A. D. Springer, S. F. Dowdy, Nucleic
Acid Ther. 2018, 28, 109-118.
Preparation of RNA-Dox conjugates 22 and 24. A 10 mM solution of
Doxorubicine 2-(pyridin-2-yldisulfanyl)ethylcarbamate 15 was prepared in
DMF. 100 µL of this solution (1000 nmol, 100 equiv) were diluted with 84
µL of HEPES buffer (34 mM NaCl, 1 mM MgCl2, 0.05 mM EDTA, 7.5 mM
HEPES, pH 8) and 16 µL of a buffered solution of TCEP (50 nmol / µL,
80 equiv). The mixture was stirred for 2 h at 37°C using a thermoshaker.
Then the solution was added to the freeze-dried RNA 8 or 9 in a 0.5 mL
Eppendorf and stirred at 37°C for 5 min using a thermoshaker. The
reaction was stopped by addition of a large excess of HEPES buffer pH 5.
The RNA-Dox conjugates 22 and 24 were immediately purified by RP-
HPLC, characterized IEX-HPLC and MALDI-TOF MS using the
procedures described above
[4]
[5]
L. He, Q. Xu, Y. Liu, H. Wei, Y. Tang, W. Lin, ACS Appl. Mater.
Interfaces 2015, 7, 12809-12813.
a) G. Russell-Jones, K. McTavish, J. McEwan, J. Rice, D.
Nowotnik, J. Inorg. Biochem. 2004, 98, 1625-1633; b) W. X. Ren, J.
Han, S. Uhm, Y. J. Jang, C. Kang, J.-H. Kim, J. S. Kim, Chem.
Commun. 2015, 51, 10403-10418.
[6]
a) J. R. Dunetz, J. Magano, G. A. Weisenburger, Org. Process Res.
Dev. 2016, 20, 140-177; b) A. V. Kachalova, D. A. Stetsenko, E. A.
Romanova, V. N. Tashlitsky, M. J. Gait, T. S. Oretskaya, Helv.
Chim. Acta 2002, 85, 2409-2416.
[7]
[8]
a) Y. Singh, E. Defrancq, P. Dumy, J. Org. Chem. 2004, 69, 8544-
8546; b) D. Forget, D. Boturyn, E. Defrancq, J. Lhomme, P. Dumy,
Chem. Eur. J. 2001, 7, 3976-3984.
a) T. Yamada, C. G. Peng, S. Matsuda, H. Addepalli, K. N.
Jayaprakash, M. R. Alam, K. Mills, M. A. Maier, K. Charisse, M.
Sekine, M. Manoharan, K. G. Rajeev, J. Org. Chem. 2011, 76,
1198-1211; b) W. Wang, K. Chen, D. Qu, W. Chi, W. Xiong, Y.
Huang, J. Wen, S. Feng, B. Zhang, Tetrahedron Lett. 2012, 53,
6747-6750; c) M. Gerowska, L. Hall, J. Richardson, M. Shelbourne,
T. Brown, Tetrahedron 2012, 68, 857-864.
Preparation of RNA-deoxycholic acid conjugate 23. A 10 mM solution
of
N-(2-(pyridin-2-yldisulfaneyl)ethyl)-3α.12α-dihydroxy-5β-cholan-24-
amide 16 was prepared in 2:3 mixture of HEPES buffer (34 mM NaCl, 1
mM MgCl2, 0.05 mM EDTA, 7.5 mM HEPES, pH 8) and DMF. 100 µL of
the solution (1000 nmol, 100 equiv) were diluted with 86 µL of buffer and
16 µL of a buffered solution of TCEP (50 nmol / µL, 80 equiv). The
mixture was stirred for 2 h at 37°C using a thermoshaker. Then, the
solution was added to the freeze-dried RNA 8 in a 0.5 mL Eppendorf and
stirred at 37°C for 24 h using a thermoshaker. The reaction was stopped
[9]
M. H. Lee, Z. Yang, C. W. Lim, Y. H. Lee, S. Dongbang, C. Kang,
J. S. Kim, Chem. Rev. 2013, 113, 5071-5109.
[10]
a) H. Lönnberg, Bioconjugate Chem. 2009, 20, 1065-1094; b) F.
Maurel, F. Debart, F. Cavelier, A. R. Thierry, B. Lebleu, J.-J.
Vasseur, E. Vivès, Bioorg Med Chem Lett 2005, 15, 5084-5087; c)
W. H. A. Kuijpers, C. A. A. van Boeckel, Tetrahedron 1993, 49,
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
10931-10944; d) Y.-H. Rogers, P. Jiang-Baucom, Z.-J. Huang, V.
A. Ohkubo, M. Sekine, Bioorg. Med. Chem. 2009, 17, 7275-7280;
c) K. Seio, M. Tokugawa, T. Kanamori, H. Tsunoda, A. Ohkubo, A.
Sekine, Bioorg. Med. Chem. Lett. 2012, 22, 2470-2473; d) M.
Prhavc, E. A. Lesnik, V. Mohan, M. Manoharan, Tetrahedron Lett.
2001, 42, 8777-8780; e) N. N. Dioubankova, A. D. Malakhov, D. A.
Stetsenko, M. J. Gait, P. E. Volynsky, R. G. Efremov, V. A.
Korshun, ChemBioChem 2003, 4, 841-847.
Bogdanov, S. Anderson, M. T. Boyce-Jacino, Anal Biochem 1999,
266, 23-30; e) D. R. Corey, Methods Mol. Biol. 2004, 283, 197-206.
a) C. He, G. L. Verdine, Chem Biol 2002, 9, 1297-1303; b) H.
Huang, S. C. Harrison, G. L. Verdine, Chem Biol 2000, 7, 355-364;
c) S. R. Paalman, D. M. Noll, N. D. Clarke, Nucleic Acids Res.
1997, 25, 1795-1801.
[11]
[12]
[13]
[14]
S. Pérez-Rentero, S. Grijalvo, R. Ferreira, R. Eritja, Molecules
2012, 17, 10026.
M. Dirin, E. Urban, C. R. Noe, J. Winkler, Eur. J. Med. Chem. 2016,
121, 132-142.
V. Metelev, A. Romanenkov, E. Kubareva, E. Zubin, N. Polouchine,
T. Zatsepin, N. Molochkov, T. Oretskaya, IUBMB life 2006, 58,
654-658.
[19]
[20]
T. Lavergne, J.-R. Bertrand, J.-J. Vasseur, F. Debart, Chem. Eur. J.
2008, 14, 9135-9138.
a) G. Sengle, A. Jenne, P. S. Arora, B. Seelig, J. S. Nowick, A.
Jäschke, M. Famulok, Bioorg. Med. Chem. 2000, 8, 1317-1329; b)
V. Noponen, H. Belt, M. Lahtinen, A. Valkonen, H. Salo, J.
Ulrichová, A. Galandáková, E. Sievänen, Steroids 2012, 77, 193-
203.
[15]
a) A. Biscans, S. Rouanet, J.-J. Vasseur, C. Dupouy, F. Debart,
Org. Biomol. Chem 2016, 14, 7010-7017; b) F. Gauthier, S.
Claveau, J.-R. Bertrand, J.-J. Vasseur, C. Dupouy, F. Debart,
Bioorg. Med. Chem. 2018, 26, 4635-4643.
F. Gauthier, F. Beltran, A. Biscans, F. Debart, C. Dupouy, J.-J.
Vasseur, Org. Biomol. Chem 2018, 16, 3181-3188.
A. K. Ghosh, M. Brindisi, J. Med. Chem. 2015, 58, 2895-2940.
a) A. Misra, S. Mishra, K. Misra, Bioconjugate Chem. 2004, 15,
638-646; b) K. Seio, R. Tawarada, T. Sasami, M. Serizawa, M. Ise,
[21]
[22]
A. Latorre, P. Couleaud, A. Aires, A. L. Cortajarena, Á. Somoza,
Eur. J. Med. Chem. 2014, 82, 355-362.
a) H. Meng, M. Liong, T. Xia, Z. Li, Z. Ji, J. I. Zink, A. E. Nel, ACS
Nano 2010, 4, 4539-4550; b) A. M. Chen, M. Zhang, D. Wei, D.
Stueber, O. Taratula, T. Minko, H. He, Small 2009, 5, 2673-2677.
D. Kaushik, G. Bansal, J. Pharm. Anal. 2015, 5, 285-295.
[16]
[23]
[17]
[18]
This article is protected by copyright. All rights reserved.

10.1002/ejoc.201900740
European Journal of Organic Chemistry
FULL PAPER
Entry for the Table of Contents
FULL PAPER
RNA conjugation
F. Gauthier, A. Malher, J.J Vasseur, C.
Dupouy*, F. Debart*
Page No. – Page No.
Conjugation of small molecules to
RNA using a reducible disulfide linker
attached at 2’-OH position via a
carbamate function.
In this paper, we developed a post-synthesis conjugation of small molecules to
RNA using a reduction sensitive disulfide linker connected to 2’OH via a carbamate
function.
This article is protected by copyright. All rights reserved.