Extended aromatic furan amidino derivatives as anti-Pneumocystis carinii agents

Article abstract of DOI:10.1021/jm980230c

The syntheses of nine new derivatives of 2,5-bis[4-(N- alkylamidino)phenyl]furans with extended aromatic systems are reported. The interaction of these dicationic furans with poly(dA)*poly(dT) and with the duplex oligomers d(CGCGAATTCGCG)₂ and d(GCGAATTCGC)₂ was determined by T(m) measurement, and the effectiveness of these compounds against the immunosuppressed rat model of Pneumocystis carinii was evaluated. At a screening dose of 10 μmol/kg, 4 of the 12 amidino furans described here are more active than the parent compound 1. In general, extension of the aromatic system in the absence of a substitution of the amidino nitrogens resulted in higher affinity for DNA than the parent compound as judged by the larger ΔT(m) values and suggests enhanced van der Waals interactions in the amidino furan-DNA complex. Three of the compounds, 3, 5, and 11, yield cysts counts of less than 0.1% of control when administered at a dosage of 10 μmol/kg. Compound 3, which does not have an extended aromatic system, is the most active derivative. Although a direct correlation between anti-P. carinii activity and DNA binding affinity was not observed, all compounds which have significant activity have large ΔT(m) values.

Full text of DOI:10.1021/jm980230c

3872
J . Med. Chem. 1998, 41, 3872-3878
Exten d ed Ar om a tic F u r a n Am id in o Der iva tives a s An ti-P n eu m ocystis ca r in ii
Agen ts
Katherine T. Hopkins,† W. David Wilson,† Brendan C. Bender,‡ Donald R. McCurdy,‡ J ames Edwin Hall,‡,§
Richard R. Tidwell,‡ Arvind Kumar,† Miro Bajic,† and David W. Boykin*,†
Department of Chemistry and Center for Biotechnology and Drug Design, Georgia State University,
Atlanta, Georgia 30303-3083, and Department of Pathology, School of Medicine, and Department of Epidemiology,
School of Public Health, The University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599
Received April 15, 1998
The syntheses of nine new derivatives of 2,5-bis[4-(N-alkylamidino)phenyl]furans with extended
aromatic systems are reported. The interaction of these dicationic furans with poly(dA)*poly-
(dT) and with the duplex oligomers d(CGCGAATTCGCG)2 and d(GCGAATTCGC)2 was
determined by Tm measurement, and the effectiveness of these compounds against the
immunosuppressed rat model of Pneumocystis carinii was evaluated. At a screening dose of
10 µmol/kg, 4 of the 12 amidino furans described here are more active than the parent compound
1. In general, extension of the aromatic system in the absence of a substitution of the amidino
nitrogens resulted in higher affinity for DNA than the parent compound as judged by the larger
∆Tm values and suggests enhanced van der Waals interactions in the amidino furan-DNA
complex. Three of the compounds, 3, 5, and 11, yield cysts counts of less than 0.1% of control
when administered at a dosage of 10 µmol/kg. Compound 3, which does not have an extended
aromatic system, is the most active derivative. Although a direct correlation between anti-P.
carinii activity and DNA binding affinity was not observed, all compounds which have
significant activity have large ∆Tm values.
In tr od u ction
immunosuppressed rat model1,6 and has been shown to
be effective in vivo against Trypanosoma rhodesiense
in both the mouse and simian models.13,14 Furthermore,
1 has been shown to bind in the minor groove of DNA
at AT rich sites and to bind weakly at GC sites.1,15,16
Other diamidino compounds, such as berenil and DAPI,
also exhibit sequence-dependent dual binding modes.17,18
However, the binding mode of 1 at GC sites is currently
a matter of debate.19,20
Several factors have been shown to be important in
minor groove binding affinity, such as electrostatic,
hydrogen-bonding, and van der Waals interactions, as
well as the radius of curvature of the molecule.21,22 The
crystal structure of 1 with d(CGCGAATTCGCG)2 indi-
cates the molecule sits in the minor groove of the AT
region with the amidines within hydrogen-bonding
distance of thymine carbonyls and the extended aro-
matic system in van der Waals contact with the sides
of the groove. Also, the curvature of the molecule
mimics the curvature of the minor groove.1 The crystal
structure of 2,5-bis[4-(N-isopropylamidino)phenyl]furan
(2) and 2,5-bis[4-(N-cyclopropylamidino)phenyl]furan (3)
with the same sequence also exhibits a good fit with the
AATT site.23 Furthermore, 2 and 3 have been shown
to be more effective against P. carinii than pentamidine
and 1.6 In addition to binding to DNA, some diamidino
furans also bind to RNA, although the mode of binding
is thought to be intercalation.24 It is postulated that
the intercalation binding of these compounds with
nucleic acids may be involved in toxicity and drug loss.
Dicationic unfused aromatic amidine molecules simi-
lar to pentamidine are known to bind to the minor
groove of DNA at AT-rich sites and to be effective agents
against many opportunistic organisms such as Pneu-
mocystis carinii, Giardia lamblia, and Cryptosporidium
parvum.1-6 Several hypotheses have been proposed to
explain the mode of action of these compounds; however,
there is strong evidence to support the binding of these
compounds to DNA and subsequent inhibition of DNA-
dependent enzymes as the mode of action.7 Various
minor groove binding compounds are known to interfere
with the function of topoisomerases I and II and to
intervene in transcription control.8,9 Studies with G.
lamblia and diamidino bis-benzimidazole molecules
showed a strong correlation between DNA minor groove
binding affinity, microbial topoisomerase II inhibition,
and biological activity.4,10 Other studies with P. carinii
and diamidino bis-benzimidazole compounds showed
selective inhibition of microbial topoisomerase II over
mammaliam topoisomerase II. However, a strong cor-
relation between anti-P. carinii activity and microbial
enzyme inhibition was not observed.11 Recently, furan
diamidines have been found to inhibit an endo/exonu-
clease isolated from P. carinii.12
The compound 2,5-bis(4-amidinophenyl)furan (1) and
substituted amidino derivatives have been studied
extensively by our laboratory. Previously, 1 has been
shown to be effective in vivo at a submicromole per
kilogram body weight dosage against P. carinii in the
Biophysical studies of other minor groove binding
compounds as well as the X-ray crystallographic data
for 1-3 demonstrate the importance of van der Waals
contact with the minor groove for binding affinity. On
† Georgia State University.
‡ Department of Pathology, The University of North Carolina.
§ Department of Epidemiology, The University of North Carolina.
S0022-2623(98)00230-1 CCC: $15.00 © 1998 American Chemical Society
Published on Web 09/10/1998

Furan Amidino Derivatives as Anti-P. carinii Agents
J ournal of Medicinal Chemistry, 1998, Vol. 41, No. 20 3873
Sch em e 1a
a
(a) Benzoquinone, EtOH; (b) HCl, EtOH; (c) RNH2, EtOH.
the basis of these studies and in order to increase the
overall efficacy, decrease the toxicity, and improve the
minor groove binding affinity, derivatives of 1-3 with
extended aromatic systems were synthesized. Three
modifications were made to increase the potential for
van der Waals interactions: (1) one phenyl ring was
replaced with a benzimidazole ring; (2) both phenyl
rings were replaced with benzimidazole rings; and (3)
benzimidazole rings were added in addition to the
phenyl rings. This report describes the synthesis of
these extended analogues of 1-3, the determination of
their DNA binding affinity, and the evaluation of their
effectiveness against P. carinii pneumonia in the im-
munosuppressed rat model.
phenylenediamine ring, whereas in the cases of 10-12,
the amidino units were formed after construction of the
benzimidazole ring.
Biologica l Resu lts
Table 1 contains the results of thermal melting
experiments with poly(dA)*poly(dT) in MES 10 buffer
at a ratio of 0.3 drug per phosphate, poly(dA)*poly(dT)
in CAC 10 buffer at a ratio of 0.1 drug per phosphate,
d(CGCGAATTCGCG)2 in MES 10 buffer at a ratio of
1.0 drug per duplex, and d(GCGAATTCGC)2 in CAC 10
buffer at a ratio of 1.0 drug per duplex. It was necessary
to employ the smaller drug-to-phosphate ratio with
polymeric DNA as affinity ranking was difficult at the
0.3 drug-to-phosphate ratio as several measurements
exceeded the temperature limits for the spectrometer.
Oligomeric studies were done with both d(CGCGAAT-
TCGCG)2 and d(GCGAATTCGC)2 in order to compare
the ∆Tm for a 10-base pair and a 12-base pair duplex
with essentially the same binding site. As the melting
transition for the 12-base pair duplex was gradual, there
was some concern about hairpin formation and biphasic
melting.
Ch em istr y
The syntheses of the new compounds 4-12 were
achieved employing a similar approach for the three
different systems. The approaches used are outlined
in Scheme 1. The key step in each was formation of
benzimidazole rings. In each case an aldehyde was
allowed to react with a substituted phenylenediamine
in the presence of 1,4-benzoquinone as the aromatizing
agent. In the cases of preparation of 4-9, the amidino
unit was preformed and was the substituent on the
In general, extending the aromatic region increased
the binding affinity, as measured by thermal melting

3874 J ournal of Medicinal Chemistry, 1998, Vol. 41, No. 20
Hopkins et al.
Ta ble 1. Nucleic Acid Binding Results and in Vivo Activity of Dicationic Furans against P. carinii
a
b
c
d
∆Tm
∆Tm
∆Tm
∆Tm
dosagee
(µmol/kg/day)
cyst/g of lunge
(% of control)
compd
saline
R
(DNA)
(DNA)
(oligomer)
(oligomer)
toxicitye
100.0 ( 7.66f
1.82 ( 0.38
pentamidine
22.0
1
2
3
H
18.8
25.0
8.3
11.7
14.4
15.8
13.3
2.7
0.3
0.03
10.8
2.2
1.1
0.2
9.4
0.73 ( 0.32
6.74 ( 3.3
0
0
0
0
0
0
0
0
+
6.42 ( 3.11
26.23 ( 4.64
0.24 ( 0.22
10.04 ( 8.62
14.00 ( 5.59
201.74 ( 72.96
0.04 ( 0.03
CH(CH3)2
22.9
>28.0
>28.0
11.7
12.8
>28.5
1.9
0.9
0.2
0.09 ( 0.06
0.13 ( 0.03
111.65 ( 45.60
0
0
0
4
5
H
>28.5
>28.0
>28.0
11.7
10.0
14.4
12.9
10.0
10.0
2.0
1.80 ( 0.57
0.11 ( 0.03
31.77 ( 11.65
53.81 ( 53.16
+
0
0
CH(CH3)2
21.9
6
**
**
11.7
11.7
3.8
++
7
8
9
H
**
**
7.1
**
**
**
7.1
5.0
6.1
180.10 ( 18.14
NA
NA
+
++++
++++
CH(CH3)2
10
11
12
H
22.4
20.1
21.8
24.3
23.2
**
10.0
9.0
9.7
11.4
10.0
9.7
5.0
10.0
2.5
50.98 ( 11.95
0.13 ( 0.04
0.82 ( 0.42
0
+
++
CH(CH3)2
a
b
Increase in thermal melting of poly(dA)‚poly(dT) in 0.01 M cacodylate and 0.1 drug per base. Increase in thermal melting of
poly(dA)‚poly(dT), 0.3 drug per base, see ref 24. c Increase in thermal melting of the oligomer d(GCGAATTCGC)2 in 0.01 M cacodylate
and 1.0 drug per duplex. Increase in thermal melting of the oligomer d(CGCGAATTCGCG)2, see ref 31. e Evaluation of iv dosage of the
d
furan dications against P. carinii in rats as described in ref 2. f Mean cyst count for pooled controls: saline (n ) 125) 53.41 ( 4.09 cysts/g
of lung tissue; pentamidine (n ) 135) 0.93 ( 0.14 cysts/g of lung tissue. ** DNA-drug complex precipitated.
experimentation with these compounds and AT-rich
DNA. Specifically, for the unsubstituted amidino de-
rivatives with d(GCGAATTCGC)2, the phenyl benzim-
idazole amidine 10 has a greater DNA binding affinity
that 1, and the bis-benzimidazole amidine 4 has a
greater DNA binding affinity than 10. As expected,
extending the aromatic system resulted in increased
DNA binding affinity most likely due to the increased
potential for van der Waals interactions. The trend did
not hold true for the highly extended diphenyl bis-
benzimidazole analogue 7 as thermal melting result
suggests that 7 slightly destabilized d(GCGAATTCGC)2.
However, UV-visible titration of 7 with d(GCGAAT-
TCGC)2 in ethanol, water, and buffer (CAC 10) indicates
that the compound tends to self-stack as the solvent
becomes more polar and that the compound does
interact with the DNA (Figure 1). Based on this result,
it was concluded that 7 was self-stacking under the

Furan Amidino Derivatives as Anti-P. carinii Agents
J ournal of Medicinal Chemistry, 1998, Vol. 41, No. 20 3875
Ta ble 2. ∆Tm for Selected Compounds with Oligomers
Containing 4-, 6-, and 8-AT Base Pair Binding Sites
compound no.
1a
4a
7a
10a
d(GCGAATTCGC)2
8.3 11.7 **
10.0
d(CGAAATTTCG)2
d(GAAAATTTTCGAAAATTTTC)2
12.6 17.1 -1.5 14.1
7.3 18.0 29.5 14.8
a
Experiments were performed using CAC 10 buffer and were
done at a ratio of 1.0 drug per binding site. ** Drug-DNA complex
precipitated.
the AT tract is extended to 8 base pairs. However, for
an 8-base pair AT tract, 7 exhibits stronger binding
affinity than 1, 4, or 10. At a ratio of 1.0 drug to binding
site, the ∆Tm of 7 is 11.5 °C greater than that of
compound 10, 14.7 °C greater than that of 4, and 22.2
°C greater than that of 1. Given the large hydrophobic
area of the central portion of 7 relative to the other three
systems, one possible explanation for the behavior of 7
is that under the conditions of the experiment stacking
interactions are greater than the drug-DNA interac-
tions until the binding site is enlarged to 8 AT base
pairs. The 8-base pair binding site most likely provides
the best fit for the highly extended 7.
Results for in vivo testing for P. carinii pneumonia
are also shown in Table 1. At a dosage of approximately
10 µM/kg/day compounds 1-5, 11, and 12 demonstrate
excellent activity ranging from 0.04% to 1.80% cysts
relative to the saline control. Recently, Boykin et al.
reported the anti-P. carinii activity of analogues of 1,
which had been substituted at the amidino nitrogens
with alkyl groups.6 They found that all compounds
which had a large ∆Tm value with d(CGCGAATTCGCG)
showed strong activity against P. carinii at a dosage of
approximately 10 µM/kg/day. For the present studies
three compounds (2-4) produced a large ∆Tm with
d(CGCGAATTCGCG), and all three of these compounds
showed excellent activity and no or little toxicity at a
dosage of approximately 10 µM/kg/day.
Compounds 7-9 were not included in the above
analysis as they produced negligible ∆Tm values with
d(GCGAATTCGC)2, although spectroscopic results in-
dicate these compounds do have affinity for this se-
quence. With oligomers containing an 8-base pair AT
tract, all three compounds produced ∆Tm values over
29 °C, an indication of strong affinity for AT tract DNA.
However, all three of these compounds were either
inactive (7) or too toxic to be evaluated for anti-P. carinii
activity (8 and 9). Given the large affinity for DNA, a
possible explanation for the toxicity and inactivity of
these highly extended compounds is nonspecific binding
to other biomolecules.
F igu r e 1. Spectral properties of 7 and titration of 7 with
d(GCGAATTCGC)2: (A) UV-vis spectra of 1 × 10-5 M 7 in
water, ethanol, and CAC 10 buffer; (B) titration of 1 × 10-5
7 in CAC 10 buffer with d(GCGAATTCGC)2.
M
conditions of the experiment which explained the neg-
ligible Tm and that 7 did have some affinity for this
sequence.
For the extended N-alkyl-substituted derivatives, an
increase in DNA binding affinity was observed. How-
ever, the increase was not as great for the extended
analogues relative to the increase seen when the iso-
propyl and cyclopentyl substituents were added to 1.
Specifically, 5 and 11 have a smaller ∆Tm with both
d(CGCGAATTCGCG)2 and d(GCGAATTCGC)2 com-
pared to 2; 6 and 12 have a smaller ∆Tm with both
d(CGCGAATTCGCG)2 and d(GCGAATTCGC)2 com-
pared to 3. An explanation for this result could be that
with the extended aromatic system, the bulky alkyl
groups at the termini of the molecule are no longer
easily accommodated by a 4-base pair binding site and/
or an additional entropy cost exists for the orientation
of the N-alkyl side chains. Again, for the corresponding
highly extended diphenyl bis-benzimidazole derivatives,
either a negligible or a negative ∆Tm was observed with
d(GCGAATTCGC)2.
Because the extended diphenyl bis-benzimidazoles
7-9 produced negligible ∆Tm with both poly(dA)*poly-
(dT) and oligomeric DNA with 4-base pair AT binding
sites, oligomers with longer AT tracts were employed
to discern the length of the AT tract needed to enhance
binding affinity of these molecules. Table 2 shows the
results of 1, 4, 7, and 10 with three oligomers of 4-, 6-,
and 8-base pair AT tract length: The highly extended
7 does not exhibit any appreciable binding affinity until
For the present set of compounds, it was concluded
that while DNA binding affinity was clearly important
for drug activity, a direct correlation between AT tract
DNA binding affinity and activity was not evident.
Other factors which could be important in determining
drug activity are cell membrane permeability and
nonspecific binding. Furthermore, it was concluded that
extending the length of the compound did not increase
the efficacy of this class of compounds against P. carinii.
Exp er im en ta l Section
Melting points were recorded using a Thomas-Hoover (Uni-
Melt) capillary melting point apparatus or a Fisher-J ohns

3876 J ournal of Medicinal Chemistry, 1998, Vol. 41, No. 20
Hopkins et al.
apparatus and are uncorrected. 1H NMR and 13C NMR spectra
were recorded employing a Varian GX400 spectrometer,
chemical shifts (δ) are in ppm relative to TMS, and coupling
constants (J ) are reported in hertz. Mass spectra were
recorded on a VG Instruments 70-SE spectrometer (Georgia
Institute of Technology, Atlanta, GA). IR spectra were re-
corded using a Michelson 100 (Bomem, Inc.) instrument.
Elemental analyses were obtained from Atlantic Microlab Inc.
(Norcross, GA) and are within (0.4 of the theoretical values.
All chemicals and solvents were purchased from Aldrich
Chemical Co. or Fisher Scientific. The syntheses of 1-3 have
been previously reported.6,13 Thermal melting experiments
and DNA preparations were done as previously described.25
(DMSO-d6): 162.4, 140.8, 134.0, 118.4, 115.6, 113.0, 112.5,
53.7, 31.3, 23.5. MS (FAB): 219 (M+ + 1). Anal. (C12H18N4‚
HCl‚H2O) C, H, N.
A protocol similar to that described above was employed for
the condensation of 2,5-furandicarboxaldehyde26 and 4-(N-
cyclopentylamidino)-1,2-phenylenediamine to give a 77% yield
of a yellow-green powder, mp 287-289 °C dec. 1H NMR
(DMSO-d6/D2O): 8.07 (s, 2H), 7.82 (d, 2H, J ) 8.4), 7.66 (s,
2H), 7.63 (d, 2H, J ) 8.4), 4.22-4.14 (m, 2H), 2.14-2.04 (m,
4H), 1.82-1.67 (m, 8H), 1.64-1.56 (m, 4H).13C NMR (DMSO-
d6/D2O): 163.0, 145.4, 144.5, 140.4, 137.7, 123.9, 123.2, 116.4,
115.5, 115.2, 54.6, 31.5, 23.7. MS (FAB): 521 (M+ + 1). Anal.
(C30H32N8O‚4HCl) C, H, N.
4: 2,5-Bis[2-(5-a m id in ob en zim id a zoyl)]fu r a n H yd r o-
ch lor id e. A solution of furan-2,5-dicaboxaldehyde26 (0.248 g,
0.002 mol), 4-amidino-1,2-phenylenediamine hydrochloride
hydrate27 (0.8 g, 0.004 mol), and 1,4-benzoquinone (0.432 g,
0.004 mol) in ethanol (40 mL) was heated at reflux for 4 h
(under nitrogen).28 The reaction mixture was cooled to room
temperature, and the dark solid was collected by filtration,
washed with cold ethanol and anhydrous ether, and dried to
yield 0.61 g (80%) of the free base. This solid was dissolved
in hot ethanol (300 mL) and filtered. The filtrate volume was
reduced to 70 mL and acidified with HCl-saturated ethanol.
After standing overnight in the refrigerator, the green solid
was collected by filtration, washed with anhydrous ether, and
dried under vacuum to yield 0.4 g (52%) of a yellow-green
powder solid, mp > 300 °C. 1H NMR (DMSO-d6): 9.30 (s, 4H),
8.95 (s, 4H), 8.19 (s, 2H), 7.81 (d, 2H, J ) 8.8), 7.72 (d, 2H, J
) 8.4), 7.60 (s, 2H). 13C NMR (DMSO-d6/D2O): 166.8, 146.3,
146.1, 142.2, 139.7, 123.4, 122.7, 117.1, 116.1, 115.4. MS
(FAB): m/z 385 (M+ + 1). HRMS: calcd mass (free base),
7: 4,4′-Bis[2-(5-a m id in oben zim id a zoyl)]-2,5-d ip h en yl-
fu r a n Hyd r och lor id e. 2,5-Bis(4-formylphenyl)furan was
prepared by reduction of 2,5-bis(4-cyanophenyl)furan29,30 (1.12
g, 0.004 mol) using 1 M DIBAL in (CHCl3:ether). 1H NMR
(DMSO-d6): 10.0 (s, 2H), 8.05 (d, 4H, J ) 7.5), 7.97 (d, 4H, J
) 7.5), 7.37 (s, 2H).13C NMR (DMSO-d6): 192.0, 125.7, 135.0,
134.6, 130.1, 123.9, 111.6. MS: m/e 276. Anal. (C18H12O3)
C, H.
A protocol similar to that described above was employed for
the condensation of 2,5-bis(4-formylphenyl)furan and 4-ami-
dino-1,2-phenylenediamine27 to give a 68% yield of a yellow-
brown powder, mp 355-7 °C dec. 1H NMR (DMSO-d6/D2O):
8.35 (d, 4H, J ) 8), 8.21 (s, 2H), 8.06 (d, 4H, J ) 8), 7.84 (d,
2H, J ) 8.4), 7.34 (d, 2H, J ) 8.4), 7.29 (s, 2H). 13C NMR
(DMSO-d6/D2O/90 °C): 165.9, 143.2, 152.7, 140.8, 137.9, 132.2,
127.9, 126.5, 124.1, 122.7, 121.8, 115.9, 114.7, 110.4. MS
(FAB): 537 (M+ + 1). Anal. (C32H24N8O‚4HCl‚H2O) C, H, N.
8: 4,4′-Bis[2-(5-(N-isop r op yla m id in o)ben zim id a zoyl)]-
2,5-d ip h en ylfu r a n Hyd r och lor id e. A protocol similar to
that described above was employed for the condensation of
2,5-bis(4-formylphenyl)furan and 4-(N-isopropylamidino)-1,2-
phenylenediamine27 to give a 75% yield of yellow solid, mp
385.1525 (M+ + 1); observed mass, 385.1535. Anal. (C20H16
N8O‚2HCl‚1.5H2O) C, H, N.
-
5: 2,5-Bis[2-(5-(N-isop r op yla m id in o)ben zim id a zoyl)]fu -
r a n Hyd r och lor id e. A protocol similar to that described
above was employed for the condensation of 2,5-furandicar-
boxaldehyde26 and 4-(N-isopropylamidino)-1,2-phenylenedi-
amine27 to give a 54% yield of a yellow-green powder, mp >
300 °C. 1H NMR (DMSO-d6): 9.60 (s, 1H), 9.58 (s, 1H,), 9.45
(s, 2H), 9.04 (s, 2H), 8.06 (s, 2H), 7.82 (d, 2H, J ) 8.4), 7.69 (s,
2H), 7.62 (d, 2H, J ) 8.2), 4.09 (m, 2H, J ) 7.0), 1.32 (d, 12H,
J ) 6.3). 13C NMR (DMSO-d6/D2O): 162.8, 145.9, 145.1, 140.9,
138.5, 124.5, 124.0, 116.9, 115.9, 115.8, 45.9, 21.7. MS
(FAB): m/z 469 (M+ + 1). HRMS: calcd mass (free base),
1
290-292 °C dec. H NMR (DMSO-d6/D2O): 8.28 (d, 4H, J )
6.8), 8.1 (s, 2H), 7.95 (d, 4H, J ) 6.8), 7.80 (d, 2H, J ) 8.4),
7.62 (d, 2H, J ) 8.4), 7.2 (s, 2H), 4.09 (septet, 2H, J ) 6.4),
1.32 (d, 12H, J ) 6.4). 13C NMR (DMSO-d6/D2O): 162.3, 162.2,
152.8, 152.4, 138.9, 133.0, 132.9, 128.3, 125.1, 124.4, 123.7,
115.6, 114.8, 111.1, 45.5, 21.1. MS (FAB): 621 (M+ + 1). Anal.
(C38H36N8O‚4HCl‚2H2O) C, H, N.
9: 4,4′-Bis[2-(5-(N-cyclopen tylam idin o)ben zim idazoyl)]-
2,5-d ip h en ylfu r a n Hyd r och lor id e. A protocol similar to
that described above was employed for the condensation of
4-(N-cyclopentylamidino)-1,2-phenylenediamine with 2,5-bis-
(4-formylphenyl)furan to yield (77%) a yellow solid, mp 295-
297 °C dec. 1H NMR (DMSO-d6/D2O): 8.30 (d, 4H, J ) 8.4),
8.05 (d, 4H, J ) 8.4), 8.01 (s, 1H), 7.77 (d, 2H, J ) 8.4), 7.56
(d, 2H, J ) 8.4), 7.27 (s, 2H), 4.15 (br, 2H), 2.13-2.03 (m, 4H),
1.81-1.55 (m, 12H). 13C NMR (DMSO-d6/D2O): 163.7, 154.0,
153.1, 141.2, 138.6, 132.8, 127.9, 126.1, 124.6, 123.3, 123.1,
469.2464 (M+ + 1); observed mass, 469.2475. Anal. (C26H28
N8O‚3HCl‚2.5H2O) C, H, N.
-
6: 2,5-Bis[2-(5-(N-cyclop en tyla m id in o)ben zim id a zoyl)]-
fu r a n Hyd r och lor id e. Distilled cyclopentylamine (1.83 g,
0.021 mol) was added to a stirred suspension of the imidate
ester hydrochloride (4.91 g, 0.02 mol) (formed from 4-cyano-
2-nitroaniline under Pinner type conditions) in 30 mL of dry
ethanol; the mixture was stirred for 12 h at room temperature
and for 1 h at 50 °C. The solvent was removed under reduced
pressure, and the residual thick oily mass was triturated with
dry ether and dried under vacuum to yield 4.7 g (95%), mp
168-179 °C dec. 1H NMR (DMSO-d6): 9.29 (br, 3H), 8.45 (d,
2H, J ) 2.4), 8.03 (s, 2H), 7.77 (dd, 1H, J ) 2.4, 8.8), 7.20 (d,
1H, J ) 8.8), 4.20 (quintet, 1H, J ) 6.0), 2.04-2.0 (m, 2H),
1.73-1.65 (m, 4H), 1.57-1.49 (m, 2H). 13C NMR (DMSO-d6):
160 4, 148.5, 134.1, 129.4, 127.3, 118.9, 114.6, 54.1, 31.2, 23.5.
The 4-(N-cyclopentylamidino)-2-nitroaniline (mp 238-240
°C dec) was used directly without further characterization (5.0
g, 0.02 mol), and 1.0 g of 10% Pd/C in 130 mL of dry methanol
was subjected to hydrogenation at 50 psi for approximately 1
h. The catalyst was filtered over Celite and washed with hot
methanol, the solvent of the filtrate was removed under
reduced pressure, the residue was triturated with dry ether,
and the solid was filtered and dried under vacuum at 45 °C
for 24 h. The yield of light brown hygroscopic solid was 3.91
g (72%), mp 170-178 °C. 1H NMR (DMSO-d6): 8.97 (br s,
1H), 8.82 (br s, 1H), 8.64 (brs, 1H), 6.89 (s, 1H), 6.88 (d, 1H, J
) 8.4), 6.59 (d, 1H, J ) 8.4), 5.40-4.92 (br, 2H), 4.17 (m, 1 H),
3.63 (br, 2H), 2.10-1.98 (m, 2H), 1.82-1.76 (m, 4H). 13C NMR
115.9, 115.7, 111.0, 55.7, 32.3, 24.4. MS (FAB): 673 (M+
1). Anal. Calcd for C42H40N8O‚4HCl: C, 61.61; H, 5.42; N,
13.69. Found: C, 62.28; H, 5.74; N, 13.62.
+
10: 2-(4-Am idin oph en yl)-5-[2-(5-am idin oben zim idazoyl)]-
fu r a n Hyd r och lor id e. A solution of 5-(4-cyanophenyl)furan-
2-carboxaldehyde29,30 (1.88 g, 0.0152 mol), 3,4-diaminobenzo-
nitrile27 (2 g, 0.0152 mol), and benzoquinone (1.64 g, 0.0152
mol) in ethanol (150 mL) was allowed to reflux under nitrogen
for 4 h. After cooling solid was collected by filtration and
recrystallized from chloroform, yield 3.75 g (79%) of yellow
solid, mp 157-160 °C dec. 1H NMR (DMSO-d6): 13.65 (brs,
1H), 8.14 (brs, 1H), 8.11 (d, 2H, J ) 8.4), 7.98 (d, 2H, J ) 8.1),
7.76 (d, 1H, J ) 8.4), 7.62 (dd, 1H, J ) 8.4, 1.5), 7.49 (d, 1H,
J ) 3.9), 7.46 (d, 1H, J ) 3.9). 13C NMR (DMSO-d6): 153.0,
145.8, 145.2, 133.1, 132.9, 125.9, 125.9, 124.5, 119.8, 118.7,
114.4, 111.6, 110.2, 104.3. MS: m/e 310 (M+). HRMS: calcd
mass, 310.0855; observed mass, 310.0803. Anal. (C19H10N4O‚
H2O) C, H, N.
A suspension of 2-(5-cyano-2-benzimidazolyl)-5-(4-cyano-
phenyl)furan (0.5 g, 0.0015 mol) in 50 mL of absolute ethanol
was chilled to 0-5 °C and was saturated with HCl (g). The
flask was stoppered, and contents were stirred at room

Furan Amidino Derivatives as Anti-P. carinii Agents
J ournal of Medicinal Chemistry, 1998, Vol. 41, No. 20 3877
(3) Lombardy, R. L.; Tanious, F. A.; Ramachandran, K.; Tidwell,
R. R.; Wilson, W. D. Synthesis and DNA Interactions of Benz-
imidazole Dications which have Activity against Opportunistic
Infections. J . Med. Chem. 1996, 39, 1452-1462.
(4) Bell, C. A.; Dykstra, C. C.; Naiman, N. N.; Cory, M.; Fairley, T.
A.; Tidwell, R. R. Structure-activity studies of dicationic
substituted bis-benzimidazoles against Giardia lamblia: Cor-
relation of antigiardial activity with DNA binding affinity and
giardial topoisomerase II inhibition. Antimicrob. Agents Chemo-
ther. 1993, 37, 2668-2673.
(5) Blagburn, B. L.; Sundermann, C. A.; Lindsay, D. S.; Hall, J . E.;
Tidwell, R. R. Inhibition of Crytosporidium parvum in neonatal
Hsd:(1CR)BR swiss miceby polyether ionophores and aromatic
amidines. Antimicrob. Agents Chemother. 1991, 35, 1520-1523.
(6) Boykin, D. W.; Kumar, A.; Xiao, G.; Wilson, W. D.; Bender, B.
C.; McCurdy, D. R.; Hall, J . E.; Tidwell, R. R. 2,5-Bis[4(N-
alkylamidino)phenyl]furans as Anti-Pneumocystis carinii Agents.
J . Med. Chem. 1998, 41, 124-129.
(7) Tidwell, R. R.; Bell, C. A. Pentamidine and Related Compounds
in Treatment of Pneumocystis carinii Infection. Pneumocystis
carinii; Marcel Decker: New York, 1993; pp 561-583.
(8) Henderson, D.; Hurley, L. H. Molecular Struggle for Transcrip-
tion Control. Nature Med. 1995, 1, 525-527.
(9) Beerman, T. A.; McHugh, M. M.; Sigmund, R.; Lown, J . W.; Rao,
K. E.; Bathini, Y. Effects of Analogues of the DNA Minor Groove
Binder Hoechst 33258 on Topoisomerase I and II Mediated
Activity. Biochim. Biophys. Acta 1992, 1131, 52-61.
(10) Bell, C. A.; Cory, M.; Fairley, T. A.; Hall, J . E.; Tidwell, R. R.
Structure-Activity Relationships of Pentamidine Analogues
against Giardia lamblia: Correlation of antigiardial activity with
DNA binding affinity and giardial topoisomerase II inhibition.
Antimicrob. Agents Chemother. 1991, 35, 1099-1107.
(11) Dykstra, C. C.; McClernon, D. R.; Elwell, L. P.; Tidwell, R. R.
Selective Inhibition of Topoisomerases from Pneumocystis carinii
Compared with That of Topoisomerases from Mammalian Cells.
Antimicrob. Agents Chemother. 1994, 38, 1890-1898.
(12) Hildebrandt, E.; Boykin, D. W.; Kumar, A.; Tidwell, R. R.;
Dykstra, C. C. Identification and Characterization of an Endo/
Exonuclease in Pneumocystis carinii that is Inhibited by Dicat-
ionic Diarylfurans with Efficacy Against Pneumocystis pneumo-
nia. Implications for Mechanism of Antimicrobial Action. J . Euk.
Microbiol. 1998, 45, 112-121.
temperature until an IR spectra indicated the disappearance
of the nitrile peak. Anhydrous ether was added to the
suspension, and solid was collected by filtration and washed
with dry ether. Diimidate ester suspended in absolute ethanol
(50 mL) was added, and suspension was chilled to 0-5 °C and
saturated with NH3 (g). The flask was stoppered, and contents
were stirred at room temperature for 3 days. Anhydrous ether
was added to the suspension, and solid was collected by
filtration and washed with anhydrous ether. Free base was
suspended in absolute ethanol saturated with HCL (25 mL),
and the mixture was heated at reflux for 1 h. After cooling
solid was collected by filtration, washed with ether and
acetone, and dried in a vacuum at 90 °C for 3 days to yield
0.46 g (68%) of yellow powder, mp 284-290 °C. 1H NMR
(DMSO-d6/D2O): 8.18 (d, 2H, J ) 8.7), 8.16 (d, 1H, J ) 1.7),
7.98 (d, 2H, J ) 8.7), 7.80 (d, 1H, J ) 8.6), 7.68 (dd, 1H, J )
8.4, 1.8), 7.51 (d, 1H, J ) 2.9), 7.48 (d, 1H, J ) 3.8). 13C NMR
(D2O/DMSO-d6): 166.4, 165.5, 154.3, 146.4, 144.3, 142.2, 139.2,
134.7, 128.9, 126.0, 125.2, 123.0, 121.5, 116.2, 116.1, 112.1.
MS (FAB): m/z 345 (M+ + 1). HRMS: calcd mass (free base),
345.1464 (M+ + 1); observed mass, 345.1490. Anal. (C19H16
N6O‚2HCl‚1.5H2O) C, H, N.
-
11: 2-[4-(N-Isop r op yla m id in o)p h en yl]-5-[2-(5-(N-isop r o-
pyla m idin o)ben zim id a zoyl)]fu r a n Hyd r och lor id e. A sus-
pension of 2-(5-cyano-2-benzimidazolyl)-5-(4-cyanophenyl)-
furan (0.5 g, 0.0016 mol) in 50 mL of absolute ethanol was
chilled to 0-5 °C and was saturated with HCl (g). The flask
was stoppered, and the contents were stirred at room tem-
perature until an IR spectra indicated the disappearance of
the nitrile peak. Anhydrous ether was added to the suspen-
sion, and solid was collected by filtration and washed with dry
ether. Diimidate ester was suspended in absolute ethanol (50
mL), and isopropylamine (2.1 mL, 25 mmol) was added.
Mixture was stirred for 72 h at room temperature, and ether
was added. The form solid was collected by filtration and dried
in a vacuum at 90 °C for 48 h. Free base was suspended in
absolute ethanol saturated with HCl, and the mixture was
heated at 2 h. After cooling dry ether was added and solid
collected by filtration, washed with acetone and dry ether, and
dried in a vacuum at 90 °C for 48 h, yield 0.52 g (65%) of yellow
crystals, mp 268-285 °C dec. 1H NMR (DMSO-d6/D2O): 8.14
(d 2H, J ) 8.2), 8.06 (s, 1H), 7.86 (d, 2H, J ) 7.9), 7.83 (d, 1H,
J ) 8.5), 7.63 (d, 1H, J ) 8.4), 7.51 (d, 1H, J ) 3.1), 7.42 (d,
1H, J ) 3.0), 4.06 (m, 2H), 1.36 (m, 12H). 13C NMR (D2O/
DMSO-d6): 163.4, 163.0, 156.4, 144.6, 141.8, 139.1, 136.2,
134.1, 129.4, 129.1, 125.9, 125.5, 124.9, 119.2, 116.2, 115.8,
112.5, 47.6, 47.5, 22.1, 22.0. MS (FAB): m/z 428 (M+ + 1).
HRMS: calcd mass (free base), 428.2325; observed mass,
428.2353. Anal. (C25H28N6O‚2HCl‚1.5H2O) C, H, N.
12: 2-[4-(N-Cyclop en tyla m id in o)p h en yl]-5-[2-(5-(N-cy-
clop en tyla m id in o)ben zim id a zoyl)]fu r a n Hyd r och lor id e.
A protocol similar to that above for 11 was employed to yield
0.6 g (71%) of a yellow solid, mp 239-241 °C dec. 1H NMR
(DMSO-d6/D2O): 8.11 (d, 2H, J ) 8.4), 8.06 (d, 1H, J ) 1.2),
7.82 (d, 2H, J ) 8.4), 7.80 (d, 1H, J ) 7.9), 7.65 (d, 1H, J )
7.9), 7.61 (d, 1H, J ) 7.9), 7.41 (d, 1H, J ) 3.0), 7.4 (d, 1H, J
) 3.0), 4.14 (m, 2H), 2.5-2.15 (m, 4H), 1.81-1.63 (m, 8H),
1.61-1.55 (m, 4H). 13C NMR (D2O/DMSO-d6): 163.1, 162.4,
155.0, 144.6, 143.1, 139.5, 136.7, 133.3, 129.5, 128.7, 124.8,
124.3, 122.1, 117.1, 116.1, 115.1, 111.4, 54.8, 51.7, 31.7, 30.8,
23.9, 23.7. MS (FAB): m/z 481 (M+ + 1). Anal. (C29H32N6O‚
3HCl‚1.0H2O) C, H, N.
(13) Das, B. P.; Boykin, D. W. Synthesis and Antiprotozoal Activity
of 2,5-bis(4-guanylphenyl)furans. J . Med. Chem. 1977, 20, 531-
536.
(14) Steck, E. A.; Kinnamon, K. K.; Davidson, D. E.; Duxbury, R. E.;
J ohnson, A. J .; Masters, R. E. Trypanosoma rhodesiense: Evalu-
ation of the Antitrypanosomal Action of 2,5-bis(4-Guanylphenyl)-
furan Dihydrochloride. Exp. Parasitol. 1982, 53, 133-144.
(15) Tanious, F. A.; Spychala, J .; Kumar, A.; Greene, K.; Boykin, D.
W.; Wilson, W. D. Different binding mode in AT and GC
sequences for unfused-aromatic dications. J . Biomol. Struct. Dyn.
1994, 11, 1063-1083.
(16) Wilson, W. D.; Tanious, F. A.; Buczak, H.; Venkatramanan, M.
K.; Das, B. P.; Boykin, D. W. The Effects of Ligand Struture on
Binding Mode and Specificity in the Interaction of Unfused
Aromatic Cations. In Molecular Basis of Specificity in Nucleic
Acid-Drug Interactions; Pullman J ., Ed.; Kluwer Academic
Publishers: The Netherlands, 1990; pp 331-353.
(17) Pilch, D. S.; Kirolos, M. A.; Lui, X.; Plum, G. E.; Breslauer, K.
J . Berenil [1,3-Bis(4′-amidinophenyl)triazene Binding to DNA
Duplexes and to a RNA Duplex: Evidence for Both Intercalative
and Mnior Groove Binding Properties. Biochemistry 1995, 34,
9962-9976.
(18) Wilson, W. D.; Tanious, F. A.; Barton, H.; J ones, R. L.; Strekow-
ski, L.; Boykin, D. W. Binding of 4′,6-diamidino-2 phenylindole
(DAPI) to GC sequences in DNA. J . Am. Chem. Soc. 1989, 11,
5008-5010.
(19) Coury, J . E.; McFail-Isom, L.; Williams, L. D.; Bottomley, L. A.
A Novel Assay for Drug-DNA Binding Mode, Affinity, and
Exclusion Number: Scanning Force Microscopy. Proc. Natl.
Acad. Sci. U.S.A. 1996, 93, 12283-12286.
(20) J ansen, K.; Lincoln, P.; Norden, B. Binding of a DAPI analogue
2,5-bis(4-amidinophenyl)furan to DNA. Biochemistry 1993, 32,
6605-6612.
(21) Czarny, A.; Boykin, D. W.; Wood, A. A.; Nunn, C. M.; Neidle, S.;
Zhao, M.; Wilson, W. D. Analysis of van der Waals and
Electrostatic Contributions in the Interactions of Minor Groove
Binding Benzimidazoles with DNA. J . Am. Chem. Soc. 1995, 117,
4716-4717.
(22) Cory, M.; Tidwell, R. R.; Fairley, T. Structure and DNA Binding
Activity of Analogues of 1,5-bis(4-amidinophenoxy)pentane (pen-
tamidine). J . Med. Chem. 1992, 35, 431-438.
Refer en ces
(1) Boykin, D. W.; Kumar, A.; Spychala, J .; Zhou, M.; Lombardy,
R. J .; Wilson, W. D.; Dykstra, C. C.; J ones, S. K.; Hall, J . E.;
Tidwell, R. R.; Loughton, C.; Nunn, C. M.; Neidle, S. Dicationic
Diarylfurans as Anti-Pneumocystis carinii Agents. J . Med. Chem.
1995, 38, 912-916.
(2) Tidwell, R. R.; J ones, S. K.; Naiman, N. A.; Berger, L. C.; Brake,
W. B.; Dykstra, C. C.; Hall, J . E. Activity of Cationically
Substituted Bis-benzimidazoles against Experimental Pneu-
mocystis carinii pneumonia. Antimicrob. Agents Chemother.
1993, 37, 1713-1716.

3878 J ournal of Medicinal Chemistry, 1998, Vol. 41, No. 20
Hopkins et al.
(23) Trent, J . O.; Clark, G. R.; Kumar, A.; Wilson, W. D.; Boykin, D.
W.; Hall, J . E.; Tidwell, R. R.; Blagburn, B. L.; Neidle, S.
Targeting the Mnior Groove of DNA: Crystal Structure of Two
Complexes between Furan Derivatives of Berenil and the DNA
Dodecomer d(CGCGAATTCGCG)2. J . Med. Chem. 1996, 39,
4554-4562.
(24) Wilson, W. D.; Ratmeyer, L.; Zhao, M.; Strekowski, L.; Boykin,
D. W. The Search for Structure-Specific Nucleic Acid-Interactive
Drugs: Effects of Compound Structure on RNA Versus DNA
Interaction Strength. Biochemistry 1993, 32, 4098-4104.
(25) Wilson, W. D.; Tanious, F. A.; Fernandez-Saiz, M.; Rigl, C. T.
Evaluation of Drug-Nucleic Acid Interactions by Thermal Melt-
ing Curves. In Drug DNA Protocols; Fox, K. R., Ed.; Humana
Press: Totowa, NJ , 1996.
Moieties Consisting of an Indole or Indole-like Ring. J . Med.
Chem. 1978, 21, 613-623.
(28) Kumar, S.; Kansal, V.; Bhaduri, A. Possible Anthelmintic
Agents: Syntheses of Ethyl 5(6)-[5(6)-substituted-2-benzimida-
zolyl]benzimidazole-2-carbamates and Ethyl 4,6-dinitro-5-sub-
stituted-aminobenzimidazole-2-carbamates. Indian J . Chem.
1981, 20B, 254-256.
(29) Kovac, J .; Krutosikova, A.; Frimm, R. Preperation of Substituted
5-phenyl-2-furfuryl bromides, isocyanates, and thiocyanates.
Chem. Zvesti. 1973, 27, 107-111.
(30) Krutosikova, A.; Kovac, J .; Sykora, V. The Synthesis of 5-aryl-
2-furancarboxylic acids. Collect. Czech. Chem. Commun. 1974,
39, 1892-1897.
(31) Spychala, J .; Boykin, D. W.; Wilson, W. D.; Zhao, M.; Tidwell,
R. R.; Dykstra, C. C.; Hall, J . E.; J ones, S. K.; Schinazi, R. F.
Synthesis of Dicationic Diaryltriazines Nucleic Acid Binding
Agents. Eur. J . Med. Chem. 1994, 29, 363-367.
(26) Firouzabadi, H. Ghadheri Barium Manganate. An Efficient
Oxidizing Reagent for Oxidation of Primary and Secondary
Alcohols to Carbonyl Compounds. Tetrahedron Lett. 1978, 839-
840.
(27) Tidwell, R. R.; Geratz, J . D.; Dann, O.; Volz, G.; Zeh, D.; Loewe,
H. Diarylamidine Derivatives With One or Both of the Aryl
J M980230C