The i-motif in the bcl-2 P1 promoter forms an unexpectedly stable structure with a unique 8:5:7 loop folding pattern

Article abstract of DOI:10.1021/ja9076292

Transcriptional regulation of the bcl-2 proto-oncogene is highly complex, with the majority of transcription driven by the P1 promoter site and the interaction of multiple regulatory proteins. A guanine- and cytosine-rich (GC-rich) region directly upstrea

Full text of DOI:10.1021/ja9076292

Published on Web 11/12/2009
The i-Motif in the bcl-2 P1 Promoter Forms an Unexpectedly
Stable Structure with a Unique 8:5:7 Loop Folding Pattern
Samantha Kendrick,† Yoshitsugu Akiyama,‡ Sidney M. Hecht,‡,§ and
Laurence H. Hurley*,†,|,⊥,#
Arizona Cancer Center, 1515 North Campbell AVenue, Tucson, Arizona 85724, BIO5 Institute,
1657 East Helen Street, Tucson, Arizona 85721, College of Pharmacy, UniVersity of Arizona, Tucson,
Arizona 85721, Center for BioEnergetics, Biodesign Institute, Arizona State UniVersity, Tempe,
Arizona 85287, Department of Chemistry, UniVersity of Arizona, Tucson, Arizona 85721 and
Department of Chemistry, Arizona State UniVersity, Tempe, Arizona 85287
Received September 8, 2009; E-mail: hurley@pharmacy.arizona.edu
Abstract: Transcriptional regulation of the bcl-2 proto-oncogene is highly complex, with the majority of
transcription driven by the P1 promoter site and the interaction of multiple regulatory proteins. A guanine- and
cytosine-rich (GC-rich) region directly upstream of the P1 site has been shown to be integral to bcl-2 promoter
activity, as deletion or mutation of this region significantly increases transcription. This GC-rich element consists
of six contiguous runs of guanines and cytosines that have the potential to adopt DNA secondary structures,
the G-quadruplex and i-motif, respectively. Our laboratory has previously demonstrated that the polypurine-rich
strand of the bcl-2 promoter can form a mixture of three different G-quadruplex structures. In this current study,
we demonstrate that the complementary polypyrimidine-rich strand is capable of forming one major intramolecular
i-motif DNA secondary structure with a transition pH of 6.6. Characterization of the i-motif folding pattern using
mutational studies coupled with circular dichroic spectra and thermal stability analyses revealed an 8:5:7 loop
conformation as the predominant structure at pH 6.1. The folding pattern was further supported by chemical
footprinting with bromine. In addition, a novel assay involving the sequential incorporation of a fluorescent thymine
analog at each thymine position provided evidence of a capping structure within the top loop region of the
i-motif. The potential of the GC-rich element within the bcl-2 promoter region to form DNA secondary structures
suggests that the transition from the B-DNA to non-B-DNA conformation may play an important role in bcl-2
transcriptional regulation. Furthermore, the two adjacent large lateral loops in the i-motif structure provide an
unexpected opportunity for protein and small molecule recognition.
an antiapoptotic phenotype,1,4-6 while an opposite shift in neuronal
cells from neurodegenerative diseases, including Alzheimer’s and
Introduction
The proto-oncogene bcl-2 (B-cell lymphoma gene 2) belongs
to the Bcl-2 family of proteins, which consists of pro- and
antiapoptotic factors that regulate the mitochondrial or intrinsic
apoptotic pathway. The bcl-2 gene was originally discovered to
be highly constitutively expressed in B-cell lymphomas due to the
insertion at the reciprocal chromosomal translocation t(14:18)
breakpoint.1,2 Rather than stimulate cellular proliferation similar
to other oncogenes, Bcl-2 promotes cell survival through the
inhibition of cell death.1 Bcl-2 is well-known for its antiapoptotic
activity in suppressing the function of pro-apoptotic counterparts
such as Bax. Studies that have addressed the manner in which Bcl-2
inactivates Bax suggest that the levels of Bcl-2 and Bax protein
present determine the susceptibility or resistance of a cell to undergo
apoptosis.3 Consistent with this model, cancer cells that overexpress
Bcl-2 shift the balance of the cellular Bcl-2/Bax ratio and exhibit
Parkinson’s, results in an increased susceptibility to induced
apoptosis.7,8 Despite extensive research, the aberrant bcl-2 expres-
sion present in various diseases and the direct effect of this
expression on cell survival are poorly understood due to the
complexity of bcl-2 transcription.
Transcriptional control of the bcl-2 proto-oncogene is highly
complex and involves two promoter sites, P1 and P2, with the
majority of the control occurring at the P1 site (Figure 1A).
The P1 promoter located 1386-1423 base pairs upstream of
the translational start site consists of a TATA-less, GC-rich
(4) Baretton, G. B.; Diebold, J.; Christoforis, G.; Vogt, M.; Muller, C.;
Dopfer, K.; Schneiderbanger, K.; Schmidt, M.; Lohrs, U. Cancer 1996,
77, 255.
† Arizona Cancer Center.
(5) Tjalma, W.; De Cuyper, E.; Weyler, J.; Van Marck, E.; De Pooter,
C.; Albertyn, G.; van Dam, P. Am. J. Obstet. Gynecol. 1998, 178,
113.
‡ Biodesign Institute, Arizona State University.
§ Department of Chemistry, Arizona State University.
| BIO5 Institute.
(6) Joensuu, H.; Pylkkanen, L.; Toikkanen, S. Am. J. Pathol. 1994, 145,
1191.
⊥ College of Pharmacy, University of Arizona.
# Department of Chemistry, University of Arizona.
(1) Vaux, D. L.; Cory, S.; Adams, J. M. Nature 1988, 335, 440.
(2) Yunis, J. J. Science 1983, 221, 227.
(7) Berry, M. D.; Boulton, A. A. Prog. Neuropsychopharmacol. Biol.
Psychiatry 2003, 27, 197.
(8) Bar-Am, O.; Weinerb, O.; Amit, T.; Youdim, M. B. H. FASEB J.
2005, 19, 1899.
(3) Oltvai, Z. N.; Milliman, C. L.; Korsmeyer, S. J. Cell 1993, 74, 609.
9
10.1021/ja9076292 CCC: $40.75  2009 American Chemical Society
J. AM. CHEM. SOC. 2009, 131, 17667–17676 17667

A R T I C L E S
Kendrick et al.
Figure 1. Structure of the human bcl-2 gene promoter region (A), and the guanine-guanine and cytosine+-cytosine base pairings that give rise to the
G-quadruplex (B) and i-motif (C) secondary structures. (A) Locations of the P1 and P2 promoters, the upstream C-rich element (inset), and Sp1, WT1, and
CREB transcriptional factor binding sites upstream of the bcl-2 P1 promoter. (B) Three stacked G-tetrads form the G-quadruplex and (C) three sets of two
intercalated hemiprotonated cytosine+-cytosine base pairs form the i-motif structure. The previously proposed c-myc24-26 G-quadruplex and i-motif structures
formed under conditions of negative supercoiling serve as examples, with the yellow, green, red, and blue circles representing the nucleobases cytosine,
adenine, guanine, and thymine, respectively.
region with multiple transcription initiation sites.9 To date, the
mechanisms of bcl-2 transcriptional regulation are not well
characterized; however, several response elements within the
P1 and P2 promoter regions have been shown to be involved
in the activation or deactivation of bcl-2 transcription. Specif-
ically, A-Myb exhibits potent activation of the P2 promoter in
t(14;18) lymphoma cells through interaction with the Cdx
binding site,8 and in contrast, p53 has been shown to negatively
regulate bcl-2 transcription via the TATA element.9 Similarly,
both positive and negative transcription factors have been shown
to interact with P1 promoter elements and alter bcl-2 gene
expression, including NF-κB and WT-1, respectively.10,11
Although there are no consensus sequences for NF-κB, this
transcriptional regulator has been shown to activate bcl-2
expression in lymphoma cell lines through the cAMP response
element (CRE) and Sp1 binding sites.11 In addition, the
interaction of the cAMP response element binding protein
(CREB) with the CRE also leads to the activation of bcl-2
transcription.12,13 Alternatively, WT-1 represses bcl-2 transcrip-
tion in both HeLa and t(14;18) lymphoma cell lines.11 Of
particular interest, transcription factors WT-1, Sp1, and E2F
recognize and bind within the GC-rich region upstream of the
P1 promoter.9,10,14 This GC-rich region contains potential DNA
secondary structure-forming sequences. These sequences have
recently been shown to form not only G-quadruplexes15-18 but
also i-motif19 structures, which may act as additional regulators
of bcl-2 transcription.
The dynamic nature of DNA topology and the conformational
transitions that may occur during transcriptionally induced
negative superhelicity as a result of unwinding or resolution of
the double helix are becoming increasingly recognized.20-23
(12) Ji, L.; Mochon, E.; Arcinas, M.; Boxer, L. M. J. Biol. Chem. 1996,
271, 22687.
(13) Wilson, B. E.; Mochon, E.; Boxer, L. M. Mol. Cell. Biol. 1996, 16,
5546.
(14) Gomez-Manzano, C.; Mitlianga, P.; Fueyo, J.; Lee, H. Y.; Hu, M.;
Spurgers, K. B.; Glass, T. L.; Koul, D.; Liu, T. J.; McDonnell, T. J.;
Yung, W. K. Cancer Res. 2001, 61, 6693.
(15) Dexheimer, T.; Sun, D.; Hurley, L. H. J. Am. Chem. Soc. 2006, 128,
5404.
(16) Li, H.; Liu, Y.; Lin, S.; Yuan, G. Chem.sEur. J. 2009, 15, 2445.
(17) Dai, J.; Chen, D.; Jones, R. A.; Hurley, L. H.; Yang, D. Nucleic Acids
Res. 2006, 34, 5133.
(9) Wu, Y.; Mehew, J. W.; Heckman, C. A.; Arcinas, M.; Boxer, L. M.
Oncogene 2001, 20, 240.
(18) Dai, J.; Dexheimer, T. S.; Chen, D.; Carver, M.; Ambrus, A.; Jones,
R. A.; Yang, D. J. Am. Chem. Soc. 2006, 128, 1096.
(19) Khan, N.; Avino, A.; Tauler, R.; Gonzalez, C.; Eritja, R.; Gargallo,
R. Biochimie 2007, 89, 1562.
(10) Heckman, C.; Mochon, E.; Arcinas, M.; Boxer, L. M. J. Biol. Chem.
1997, 272, 19609.
(11) Heckman, C.; Mehew, J. W.; Boxer, L. M. Oncogene 2002, 21, 3898.
9
17668 J. AM. CHEM. SOC. VOL. 131, NO. 48, 2009

i-Motif in the bcl-2 P1 Promoter
A R T I C L E S
Recently it has been demonstrated that G- and C-rich sequences
are capable of rearranging from B-DNA conformations into non-
B-DNA secondary structures (G-quadruplexes and i-motifs)
under negative superhelicity.24 G-rich sequences can give rise
to G-quadruplexes, which are secondary DNA structures
composed of stacked G-tetrads formed by the Hoogsteen
interaction of four guanines stabilized by the presence of a
monovalent cation (Figure 1B).27 Similarly, the complementary
C-rich strand may fold back on itself to form an i-motif structure
comprising two parallel duplexes with intercalated hemiproto-
nated cytosine+-cytosine base pairs (Figure 1C).28-30 Both
secondary structure-forming sequences require adjacent guanine
or cytosine tracts separated by one or more bases. These dynamic
GC-rich sequences have been discovered within or near numerous
promoter regions throughout the human genome, suggesting that
thesestructuresmayfunctionintheregulationofgenetranscription.31-37
Genomic analyses on the prevalence of G-quadruplex-forming
sequences within 1 kb upstream of transcriptional start sites have
revealed that 43% of promoter regions contain these G-rich
elements.32 One such G-rich sequence was identified within the
c-myc promoter and has been shown to adopt intramolecular
parallel G-quadruplex structures.38-42 In support of the hypothesis
that DNA secondary structures serve as modulators of transcrip-
tion, the c-myc G-quadruplex has been demonstrated to function
as a transcriptional repressor in vitro.41 TMPyP4, an established
G-quadruplex-interactive compound,41,43 and more recently
discovered quindoline derivatives44 and actinomycin D45 bind
to and stabilize the c-myc G-quadruplexes, resulting in the
downregulation of c-myc mRNA levels in RAMOS Burkitt’s
lymphoma41,43,45 and Hep G2 hepatocellular carcinoma44 cell
lines. In further support of secondary structure involvement in
gene transcription, protein-facilitated unwinding or folding of
the c-myc G-quadruplex as observed with NM23-H224,46 and
nucleolin,47 respectively, resulted in activation or repression of
c-myc transcription. Subsequent investigations of G-rich ele-
ments within other oncogene promoter regions has led to the
discovery of G-quadruplex-forming sequences upstream of the
VEGF,48,49 c-kit,50-53 PDGF-A,54 RET,55 KRAS,56 hif-1R,57
bcl-2,15-18 and hTERT58 promoters and downstream of the
c-myb59 and Rb60 promoters.
While previous research has focused principally on the
characterization of G-quadruplex structures, more recent studies
have been expanded to also include characterization of i-motif
structures within a variety of promoter regions, such as
c-myc,61-63 Rb,60 RET,56 VEGF,49 and EPM1.64 Of interest, the
bcl-2 C-rich promoter sequence contains six runs of at least
three contiguous cytosines that may serve as the core building
block for i-motif formation. Recent experimental data with the
bcl-2 C-rich promoter sequence utilizing only the middle four
runs of cytosines has illustrated the ability of this sequence to
form two intramolecular i-motif structures.19 These bcl-2 i-motif
structures were not only present at low pH but persisted at pH
6.1, and approximately 5% of the oligomer remained at pH 7.19
This supports the possibility that i-motif structures may form
opposite to the G-quadruplex in vivo and may also play an
important role in the transcriptional process.
(20) Benham, C. J. Annu. ReV. Biophys. Biophys. Chem. 1985, 14, 23.
(21) Lee, J. S.; Ahsley, C.; Hample, K. J.; Bradley, R.; Scraba, D. G. J.
Mol. Biol. 1995, 252, 283.
Since the bcl-2 promoter region consists of six cytosine runs,
our studies utilized the full-length sequence rather than the
previously studied truncated sequence of four cytosine runs19
(22) Kouzine, F.; Levens, D. Front. Biosci. 2007, 12, 4409.
(23) Kouzine, F.; Sandrod, S.; Elisha-Feil, Z.; Levens, D. Nat. Struct. Mol.
Biol. 2008, 15, 146.
(24) Sun, D.; Hurley, L. H. J. Med. Chem. 2009, 52, 2863.
(25) Halder, K.; Chowdhury, S. Nucleic Acids Res. 2005, 33, 4466.
(26) Simonsson, T.; Pribylova, M.; Vorlickova, M. Biochem. Biophys. Res.
Commun. 2000, 278, 158.
(46) Dexheimer, T. S.; Carey, S. S.; Zuohe, S.; Gokhale, V. M.; Hu, X.;
Murata, L. B.; Maes, E. M.; Weichsel, A.; Sun, D.; Meuillet, E. J.;
Montfort, W. R.; Hurley, L. H. Mol. Cancer Ther. 2009, 8, 1363.
(47) Gonza´lez, V.; Guo, K.; Hurley, L. H.; Sun, D. J. Biol. Chem. 2009,
284, 23622.
(27) Williamson, J. R.; Raghuraman, M. K.; Cech, T. R. Cell 1989, 59,
871.
(48) Sun, D.; Guo, K.; Rusche, J. J.; Hurley, L. H. Nucleic Acids Res.
2005, 33, 6070.
(28) Gueron, M.; Leroy, J. L. Curr. Opin. Struct. Biol. 2000, 10, 326.
(29) Leroy, J. L.; Gehring, K.; Kettani, A.; Gueron, M. Biochemistry 1993,
32, 6019.
(49) Guo, K.; Gokhale, V.; Hurley, L. H.; Sun, D. Nucleic Acids Res. 2008,
36, 4598.
(30) Chen, L.; Cai, L.; Zhang, X.; Rich, A. Biochemistry 1994, 33, 13540.
(31) Huppert, J. L.; Balasubramanian, S. Nucleic Acids Res. 2005, 33, 2908.
(32) Huppert, J. L.; Balasubramanian, S. Nucleic Acids Res. 2007, 35, 406.
(33) Huppert, J. L.; Bugaut, A.; Kumar, S.; Balasubramanian, S. Nucleic
Acids Res. 2008, 36, 6260.
(50) Rankin, S.; Reszka, A. P.; Huppert, J.; Zloh, M.; Parkinson, G. N.;
Todd, A. K.; Ladame, S.; Balasubramanian, S.; Neidle, S. J. Am. Chem.
Soc. 2005, 127, 10584.
(51) Fernando, H.; Reszka, A. P.; Huppert, J.; Ladame, S.; Rankin, S.;
Venkitaraman, A. R.; Neidle, S.; Balasubramanian, S. Biochemistry
2006, 45, 7854.
(34) Huppert, J. L. Biochimie 2008, 90, 1140.
(35) Yadav, V. K.; Abraham, J. K.; Mani, P.; Kulshrestha, R.; Chowdhury,
S. Nucleic Acids Res. 2008, 36, D381.
(52) Phan, A. T.; Kuryavyi, V.; Burge, S.; Neidle, S.; Patel, D. J. J. Am.
Chem. Soc. 2007, 129, 4386.
(36) Mani, P.; Yadav, V. K.; Das, S. K.; Chowdhury, S. PLoS ONE 2009,
4, e4399.
(53) Shirude, P. S.; Okumus, B.; Ying, L.; Ha, T.; Balasubramanian, S.
J. Am. Chem. Soc. 2007, 129, 7484.
(37) Verma, A.; Halder, K.; Halder, R.; Yadav, V. K.; Rawal, P.; Thakur,
R. K.; Mohd, F.; Sharma, A.; Chowdhury, S. J. Med. Chem. 2008,
51, 5641.
(54) Qin, Y.; Rezler, E. M.; Gokhale, V.; Sun, D.; Hurley, L. H. Nucleic
Acids Res. 2007, 25, 7698.
(55) Guo, K.; Pourpak, A.; Beetz-Rogers, K.; Gokhale, V.; Sun, D.; Hurley,
L. H. J. Am. Chem. Soc. 2007, 129, 10220.
(38) Phan, A. T.; Modi, Y. S.; Patel, D. J. J. Am. Chem. Soc. 2004, 126,
8710.
(56) Cogoi, S.; Xodo, L. E. Nucleic Acids Res. 2006, 34, 2536.
(57) De Armond, R.; Wood, S.; Sun, D.; Hurley, L. H.; Ebbinghaus, S. W.
Biochemistry 2005, 44, 16341.
(39) Seenisamy, J.; Rezler, E. M.; Powell, T. J.; Tye, D.; Gokhale, V.;
Joshi, C. S.; Siddiqui-Jain, A.; Hurley, L. H. J. Am. Chem. Soc. 2004,
126, 8702.
(58) Palumbo, S. L.; Ebbinghaus, S. W.; Hurley, L. H. J. Am. Chem. Soc.
2009, 131, 10878.
(40) Ambrus, A.; Chen, D.; Dai, J.; Jones, R. A.; Yang, D. Biochemistry
2005, 44, 2048.
(59) Palumbo, S.; Memmott, R. M.; Uribe, D. J.; Krotova-Khan, Y.; Hurley,
L. H.; Ebbinghaus, S. W. Nucleic Acids Res. 2008, 36, 1755.
(60) Xu, Y.; Sugiyama, H. Nucleic Acids Res. 2006, 34, 949.
(61) Mathur, V.; Verma, A.; Maiti, S.; Chowdhury, S. Biochem. Biophys.
Res. Commun. 2004, 320, 1220.
(41) Siddiqui-Jain, A.; Grand, C. L.; Bearss, D. J.; Hurley, L. H. Proc.
Natl. Acad. Sci. U.S.A. 2002, 99, 11593.
(42) Yang, D.; Hurley, L. H. Nucleosides, Nucleotides, Nucleic Acids 2006,
25, 951.
(43) Hurley, L. H.; Von Hoff, D. D.; Siddiqui-Jain, A.; Yang, D. Semin.
Oncol. 2006, 33, 498.
(62) Cashman, D. J.; Buscaglia, R.; Freyer, M. W.; Dettler, J.; Hurley,
L. H.; Lewis, E. A. J. Mol. Model. 2008, 14, 93.
(63) Simonsson, T.; Pribylova, M.; Vorlickova, M. Biochem. Biophys. Res.
Commun. 2000, 278, 158.
(44) Ou, T. M.; Lu, Y. J.; Zhang, C.; Huang, Z. S.; Wang, J. H.; Tan,
J. H.; Chen, Y.; Ma, D. L.; Wong, K. Y.; Tang, J. C.; Chan, A. S.;
Gu, L. Q. J. Med. Chem. 2007, 50, 1465.
(64) Pataskar, S. S.; Dash, D.; Brahmachari, S. K. J. Biomol. Struct. Dyn.
2001, 19, 307.
(45) Kang, H. J.; Park, H. J. Biochemistry 2009, 48, 7392.
9
J. AM. CHEM. SOC. VOL. 131, NO. 48, 2009 17669

A R T I C L E S
Kendrick et al.
Table 1. Sequences of bcl-2 Oligonucleotides
DNA oligomer
sequence (5′f3′)
Py39WT
5′-IM
Mid-IM
CAGCCCCGCTCCCGCCCCCTTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCCCCTTCCTCCCG
GCTCCCGCCCCCTTCCTCCCGCGCCCG
3′-IM
GCCCCCTTCCTCCCGCGCCCGCCCCT
Py39 mutant
Py39MT-5T
Py39MT-12T
Py39MT-15T
Py39MT-16T
Py39MT-17T
Py39MT-18T
Py39MT-19T
Py39MT-26T
Py39MT-32T
Py39MT-35T
Py39MT-36T
Py39MT-37T
Py39MT-38T
10T
CAGTTTTGCTCCCGCTTTCTTCCTTTTGCGCCCGCCCCT
CAGCTCCGCTCCCGCCCCCTTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCTCGCCCCCTTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGTCCCCTTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCTCCCTTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCTCCTTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCCTCTTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCCCTTTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCCCCTTCCTCTCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCCCCTTCCTCCCGCGCTCGCCCCT
CAGCCCCGCTCCCGCCCCCTTCCTCCCGCGCCCGTCCCT
CAGCCCCGCTCCCGCCCCCTTCCTCCCGCGCCCGCTCCT
CAGCCCCGCTCCCGCCCCCTTCCTCCCGCGCCCGCCTCT
CAGCCCCGCTCCCGCCCCCTTCCTCCCGCGCCCGCCCTT
CAGCCCCGCNdUCCCGCCCCCTTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCCCCNdUTCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCCCCTNdUCCTCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCCCCTTCCNdUCCCGCGCCCGCCCCT
CAGCCCCGCTCCCGCCCCCTTCCTCCCGCGCCCGCCCCNdU
20T
21T
24T
39T
recorded three times, averaged, smoothed, and baseline-corrected
for signal contributions from buffers. Molar ellipticities for melting
curves were recorded at 286 nm (the λ of the maximum molar
ellipticity) over a temperature range of 4-100 °C and then plotted
against temperatures for Tm determination. Tm values were calculated
within (1 °C error. The i-motif-forming oligonucleotides were
prepared at a 5 µM strand concentration in a 50 mM Na cacodylate
buffer (pH 4.4, 5.0, 5.4, 5.9, 6.1, 6.5, 7.1, or 8.0). Due to the
buffering capacity of cacodylate buffer (pH 5.0-7.4), experiments
at pH 4.4 were also performed using Tris-acetate, which has a
buffering capacity at pH 4.4. These experiments produced results
similar to those with the cacodylate buffer (data not shown), and
for experimental consistency, only results using cacodylate buffer
were discussed.
to investigate the ability of this C-rich element to form i-motif
structures. We demonstrated through CD, FRET, and fluores-
cence analyses that the full-length C-rich sequence upstream
of the bcl-2 P1 promoter forms intramolecular i-motif structures
in vitro with a transitional pH of 6.6. Isolation of three separate
possible i-motif-forming DNA sequences from the full-length
element as well as mutational studies of the full-length sequence
confirmed that the full-length sequence is required to form the
most stable i-motif structure. Bromine footprinting and fluo-
rescent analog substitution of thymines within the loop regions
have provided evidence that the predominant, biologically
relevant bcl-2 i-motif species consists of an 8:5:7 loop folding
pattern.
Fluorescence Resonance Energy Transfer Assay (FRET).
Biosearch Technologies provided FRET probes of the Bcl-2
Py39WT, mutant, and poly-T sequences modified at the 5′-end with
a FAM-fluorophore and at the 3′-end with a black hole quencher.
Each probe was placed in a 50 mM Na cacodylate buffer (pH 4.4,
5.0, 5.4, 5.9, 6.1, 6.5, 7.1, or 8.0) at a concentration of 1 µM and
incubated at room temperature (25 °C) for 1 h to allow for i-motif
formation. Samples were prepared in triplicate, and 100 µL was
placed into each well of a black 96-well optiplate (PerkinElmer).
Fluorescence measurements were recorded by a Bio-Tek Synergy
HT spectrofluorimeter at 25 °C with 20 nm bandwidths. The
excitation and emission wavelengths were set at 495 and 528 nm,
respectively. End point fluorescence or quenching was plotted as
the average relative fluorescence units of the triplicate wells after
correction for background. The control poly-T probe was used to
evaluate the effects of acidic pH on the emission spectra of the
FRET probes. The excitation wavelength was fixed at 495 nm, and
emission spectra were recorded from 500 to 540 nm for pH 4.4,
5.4, 6.1, 7.1, and 8.0. The maximum fluorescence for emission was
observed at 515 nm for probe in pH 4.4 and 5.4, 516 nm for pH
6.1, and 517 nm for pH 8.0 (data not shown).
Materials and Experimental Methodology
DNA Oligonucleotides. DNA oligonucleotides were synthesized
by Biosearch, and strand concentration was calculated using the
Beer-Lambert law: A ) ε·C·l. The extinction coefficients for each
oligonucleotide were determined by the nearest neighbor method.
Since these particular oligonucleotides exhibit higher order struc-
tures, absorbance at 260 nm was recorded at 95 °C (at least 20 °C
above their respective Tm) to ensure the presence of single-stranded
DNA. The extinction coefficients (M-1 cm-1) were as follows:
Py39WT, 310 640; 5′-IM, 262 040; Mid-IM, 216 260; 3′-IM, 205
220; Py39 mutant, 314 200; Py39MT-5T and 36T, 305 500;
Py39MT-12T, 16T, 17T, 18T, 19T, 26T, and 32T, 311 350;
Py39MT-15T, 313 150; Py39MT-38T, 306 400. The Py39WT
sequence corresponds to the C-rich strand within the bcl-2 promoter
region from bases -1489 to -1451. Sequences are provided in
Table 1.
Preparation and End-Labeling of Oligonucleotides. The DNA
oligonucleotides were 5′-end-labeled with [γ-32P] ATP upon
incubation with T4 polynucleotide kinase for 1 h at 37 °C.
Subsequently, T4 kinase was heat inactivated for 5 min at 95 °C,
and the labeled oligonucleotides were purified using a Bio-Spin 6
chromatography column (BioRad). The oligonucleotides were
further purified by denaturing gel electrophoresis (12% PAGE).
Circular Dichroism (CD). CD analyses were conducted on a
Jasco-810 spectropolarimeter (Jasco, Easton, MD), using a quartz
cell of 1 mm optical path length. Specifically, spectra were obtained
at an instrument scanning speed of 100 nm/min, with a response
time of 1 s, over a wavelength range of 200-350 nm and were
Naphthodeoxyuridine Fluorescence Assay. A fluorescent thy-
mine analogue, naphthodeoxyuridine (NdU), was prepared as
previously reported (Scheme 1).65 Briefly, TMS-mediated activation
of benzo[g]quinazoline-2,4-(1H, 3H)-dione (1)66 in hexamethyld-
isilazane followed by condensation with bis-3, 5-O-methylbenzoyl-
(65) Godde, F.; Toulme, J. J. Biochemistry 1998, 37, 13765.
(66) Curd, F. H. S.; Landquist, J. K.; Rose, F. L. J. Chem. Soc. 1948, 1759.
9
17670 J. AM. CHEM. SOC. VOL. 131, NO. 48, 2009

i-Motif in the bcl-2 P1 Promoter
A R T I C L E S
Scheme 1. Synthesis of the Phosphoramidite of Naphthodeoxyuridine
2-deoxy-ribofuranosyl chloride (2)67,68 in the presence of CuI
afforded an R, ꢀ anomeric mixture of NdU derivative 3 in 40%
yield over two steps. Removal of the O-3 and O-5 methylbenzoyl
groups was accomplished using sodium methoxide in MeOH to
afford 4 in 71% yield. 5′-DMTr protection in pyridine and
separation of the anomers by chromatography gave 5, as the
ꢀ-anomer, in 11% yield. Phosphitylation using diisopropylethy-
lamine and 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite in
CH2Cl2 then afforded NdU phosphoramidite 6 in 41% yield. The
NdU was incorporated into five separate oligonucleotides to replace
each of the five thymidines present in the Py39WT sequence one
at a time. The NdU extinction coefficient of 49 800 M-1 cm-1 was
used in calculations for each substituted oligomer.66 The extinction
coefficient for each oligomer, 10T, 20T, 21T, 24T, and 39T, was
328 680 M-1 cm-1. Each probe was placed in a 50 mM Na
cacodylate buffer (pH 4.4, 5.1, 6.0, 6.3, 6.6, 7.4, or 8.0) at a strand
concentration of 10 µM, incubated at 95 °C for 5 min, and allowed
to cool to room temperature (25 °C) to allow for i-motif formation.
Samples were prepared in triplicate to a final volume of 150 µL,
and 50-µL aliquots were placed into each triplicate well of a black
96-well optiplate (PerkinElmer). Fluorescence measurements were
recorded using a Bio-Tek Synergy HT spectrofluorimeter at 25 °C
with 20 nm bandwidth. The excitation and emission wavelengths
were set at 250 and 440 nm, respectively. End point fluorescence
or quenching was plotted as the average relative fluorescence units
of the triplicate wells after correction for background.
Py39WT oligonucleotide was 5′-end-labeled with [γ-32P] ATP as
previously described. The purified 5′-end-labeled Py39WT oligomer
was incubated with molecular bromine formed in situ by mixing
an equal molar concentration (50 mM) of KBr with KHSO5 for 20
min and terminated by the addition of 60 µL of a 0.6 M sodium
acetate and calf thymus DNA (10 mg/mL) solution. Any unreacted
bromine was removed in subsequent ethanol precipitation steps.
After ethanol precipitation, the DNA pellet was dried and resus-
pended in 30 µL of a 100 mM piperidine solution. Samples were
heated at 90 °C for 20 min to induce bromination-specific strand
cleavage, dried, and resuspended with alkaline sequencing gel
loading dye. The bromination-specific strand cleavage was visual-
ized on a sequencing gel (20% PAGE with 7 M urea). A pyrimidine-
specific reaction was performed using hydrazine to generate a
cytosine sequencing marker.70
Results
Cytosine-Rich Sequence within the bcl-2 Promoter Region
Can Form One or More Intramolecular i-Motif DNA Secondary
Structures. The full-length wild-type C-rich sequence from the
bcl-2 promoter region (Py39WT, Table 1) was subjected to a
pH gradient CD spectral analysis. Previous studies involving
i-motif-forming oligonucleotides at acidic pHs have determined
that the signature CD spectrum specific for an i-motif secondary
structure consists of a maximum positive peak within 280-288
nm and a negative peak within 260-267 nm.19,62,64,71 Purified
Py39WT oligonucleotide displayed the characteristic i-motif
positive peak at 286 nm and a negative peak approximately half
the amplitude of the positive peak at 264 nm at pH e 6.5 (Figure
2A, left). These CD spectral features are distinctive for
hemiprotonated cytosine+-cytosine base pairs.71 The positive
maximum begins to shift toward 277 nm at pH 7.1, and the
molar ellipticity decreases by over 50% at pH 8.0, which is
Electrophoretic Mobility Shift Assay. The Py39WT, Py39
mutant, and poly-T oligonucleotides were 5′-end-labeled with
[γ-32P] ATP as noted above. These oligonucleotides were prepared
at 10 000 cpm in 50 mM Na cacodylate buffers, pH 4.4 and 6.1,
and subjected to electrophoresis on a 12% nondenaturing PAGE
gel. As a control, the same oligonucleotide preparations were also
subjected to electrophoresis on a 12% denaturing PAGE gel to
demonstrate similar mobility among all three oligonucleotides.
Bromine Footprinting. The bromine footprinting assay protocol
was adapted from a previously established procedure.69 Briefly,
(67) Hoffer, M. Chem. Ber. 1960, 93, 2777.
(68) Rolland, V.; Kotera, M.; Lhomme, J. Syn. Commun. 1997, 27, 3505.
(69) Ross, S.; Burrows, C. Nucleic Acids Res. 1996, 24, 5062.
(70) Maxam, A. M.; Gilbert, W. Methods Enzymol. 1980, 65, 499.
(71) Manzini, G.; Yathindra, N.; Xodo, L. E. Nucleic Acids Res. 1994, 22,
4634.
9
J. AM. CHEM. SOC. VOL. 131, NO. 48, 2009 17671

A R T I C L E S
Kendrick et al.
Figure 2. bcl-2 Py39WT sequence was subjected to a pH gradient for CD spectra analysis (A, left), melt temperature determination (B, left), and the FRET
assay (C). The transitional pH was determined from the plot of pH versus the corresponding molar ellipticity at 286 nm (A, right). Melt temperatures were
calculated from CD thermal curves (B, right). The bcl-2 Py39 mutant and poly-T sequences were also used in the FRET assay as i-motif unstable and
negative controls, respectively. Relative fluorescence was plotted in log scale (C).
consistent with an unordered, random-coiled structure.72 The
transitional pH of 6.6 was quantitatively determined from the
plot of molar ellipticity at 286 nm versus the corresponding
pH (Figure 2A, right). Subsequent CD melt curve experiments
were performed to examine the pH dependence of the thermal
stability of Py39WT. In agreement with the CD spectra analysis,
the melting curves (Figure 2B, right) and calculated Tm (Figure
2B, left) revealed a pH-dependent stability of the i-motif
structure. The i-motif structure has a Tm of 69 °C under acidic
conditions that decreases with increasing pH to 40 °C near
neutral pH. These Tm values are consistent, albeit slightly higher,
with previously published data using a Py39WT truncated
sequence containing only the middle four runs of cytosines that
yielded a Tm of 68 °C at pH 4.5 and 36 °C at pH 6.1.19 Since
our thermal stability studies involved the full-length sequence
containing all six cytosine runs, it is expected to potentially
exhibit greater stability and therefore provide slightly higher
Tm values. In addition, a pH gradient experiment was conducted
using a FRET assay to further illustrate the potential of the
Py39WT sequence to adopt an i-motif structure. A FRET probe
consisting of the Py39WT sequence with 5′-end FAM fluoro-
phore and 3′-end black hole quencher labels was assayed for
relative fluorescence at various pH levels. In the presence of
i-motif formation, the black hole quencher resides in close
proximity to the fluorophore and quenches fluorescence. A
poly-T probe served as a negative control for the absence of
i-motif formation, and a Py39 mutant probe unable to form a
stable i-motif was designed as an intermediate control probe.
The relative fluorescence units of the Py39WT probe steadily
increased with rising pH levels (Figure 2C). At pH 6.5 and
higher the Py39WT probe reached similar relative fluorescence
units as the mutant and poly-T probes, confirming the loss of
i-motif stability that occurs at the transitional pH. The pH-
dependent fluorescence of the Py39WT probe exhibited almost
100% quenching under the most stable i-motif structure-forming
conditions (pH 4.4), in contrast to the mutant and poly-T probes
that displayed significantly more fluorescence (Figure 2C). This
trend remains observable at pH 5.0 with a 4- and 21-fold
(72) Cantor, C. R.; Warshaw, M. M.; Shapiro, H. Biopolymers 1970, 9,
1059.
9
17672 J. AM. CHEM. SOC. VOL. 131, NO. 48, 2009

i-Motif in the bcl-2 P1 Promoter
A R T I C L E S
Figure 3. Twelve percent nondenaturing (A) and denaturing (B) gel analysis
of the bcl-2 Py39WT sequence at pH 4.4 and 6.1 (lanes 1 and 4). For
comparison, the Py39 mutant (lanes 2 and 5) and 39-mer poly-T (lanes 3
and 6) sequences were analyzed.
decrease in fluorescence of the wild-type probe compared to
the mutant and poly-T probes, respectively, and the decreases
at pH 5.4, pH 5.9, and pH 6.1 were 6- and 40-fold, 9- and 23-
fold, and 12- and 20-fold, respectively.
In addition, we conducted a concentration-dependent thermal
stability analysis as well as an electrophoretic mobility shift
assay to assess whether the Py39WT oligonucleotide formed
an intramolecular or intermolecular secondary structure. Under
nondenaturing conditions, the Py39WT sequence displayed
faster electrophoretic mobility at both pH 4.4 and 6.1 with
respect to the Py39 mutant and poly-T sequences, indicative of
an intramolecularly folded structure (Figure 3A). In contrast,
denaturing conditions demonstrated that all three sequences
exhibited similar mobility and thus consist of the same oligomer
length (Figure 3B). CD melt curves of increasing DNA strand
concentration (2.5-50 µM) at pH 4.4 and 6.1 revealed a
concentration-independent thermal stability of the Py39WT
i-motif structure, confirming formation of an intramolecularly
folded structure at both acidic and near neutral pHs (data not
shown).
Figure 4. Full-length Py39WT sequence, with each of the truncated
sequences bracketed, is shown in (A). Truncated sequences are also listed
in Table 1. Comparison of CD spectra at pH 4.4 (B) and pH 6.1 (C) of the
three possible i-motif-forming sequences involving either the 5′-end (5′-
IM), middle (Mid-IM), or 3′-end (3′-IM) four runs of cytosines to the full-
length (Py39WT).
Characterization of the Predominant bcl-2 i-Motif Species at
pH 6.1 Suggests a Major 8:5:7 Loop Folding Pattern of the
Full-Length Sequence. A series of mutational, thermal stability,
fluorescent thymine substitution, and bromine footprinting
experiments were performed to characterize the predominant
bcl-2 i-motif conformation from the full-length wild-type
sequence. Mutational analysis of the Py39WT sequence was
performed in conjunction with thermal stability studies to
evaluate which of the major runs of cytosines are most important
for i-motif stability. CD melt curves were obtained for each
mutant at pH 6.1 and compared to the wild-type sequence.
Bromine footprinting analysis was then performed to identify
the specific cytosines involved in i-motif formation at pH 6.1
and consequently served as a basis for predicting the loop sizes
and folding pattern. Last, each thymine within the Py39WT
sequence was substituted with a fluorescent analog, not only to
serve as a secondary pH gradient assay, but also to provide
information regarding thymine position and stacking environ-
ment within the i-motif loop regions.
A. Mutational Studies in Combination with Thermal Stabil-
ity Analysis Suggest That the Predominant bcl-2 i-Motif Structure
Involves Noncontiguous Runs of Cytosines Separated by Large
Loops. Sequential mutation of a single cytosine to a thymine
within each of the six cytosine tracts was performed to predict
which runs of cytosines are involved in the formation of the
predominant bcl-2 i-motif (Table 1 and Figure 5A). The Tm of
each mutant oligomer at pH 6.1 was then determined by CD
thermal analysis (Figure 5A). In addition, each cytosine within
tracts III and VI, which consist of more than three cytosines,
was mutated in order to determine the specific cytosines
Isolation and CD Analysis of Three Truncated Py39WT
Sequences Demonstrate the Ability to Form Different i-Motif
Structures within the bcl-2 Promoter. The G- and C-rich strands
within the bcl-2 promoter region both display highly complex
arrangements of repetitive tracts. Previous studies conducted
to elucidate the predominant G-quadruplex structure demon-
strated that the 5′- and 3′-end contiguous runs, as well as the
middle four guanine runs, formed three different secondary
structures.15,18 Therefore, we utilized this approach as the
starting point for the determination of the predominant folding
pattern of the i-motif. The Py39WT sequence was truncated to
isolate the three major i-motif structures that may form from
four adjacent 5′-end, middle, or 3′-end runs of cytosines. These
i-motif structures are denoted as 5′-IM, Mid-IM, and 3′-IM, and
the sequences are provided in Table 1 and Figure 4A. The
transitional pH for each truncated sequence was determined
following CD spectral analysis of a pH gradient (data not
shown). The transitional pHs for 5′-IM (6.4) and Mid-IM (6.2)
were comparable to the full-length (6.6), while 3′-IM yielded a
lower transitional pH of 5.8. In addition, the CD spectra of all
three oligonucleotides at pH 4.4 (Figure 4B) and pH 6.1 (Figure
4C) were compared to spectra obtained from the Py39WT
sequence. Although all three truncated sequences displayed
spectra specific for an i-motif structure at both pH 4.4 and 6.1,
the molar ellipticity decreased by at least 50 and 25%,
respectively (Figure 4, B and C). In addition, with the exception
of the Mid-IM, which retained the 286 nm positive maximum
at pH 4.4, the oligomer fragments of Py39WT displayed a shift
in the maximum toward 290 nm (Figure 4, B and C).
9
J. AM. CHEM. SOC. VOL. 131, NO. 48, 2009 17673

A R T I C L E S
Kendrick et al.
cytosines of run I (C5, C6, and C7) were strongly protected in
comparison to the 5′-end cytosine (C4). The 5′-cytosine of run
III (C15) showed pronounced cleavage in comparison to the
protection of the other four cytosines. Cytosines C17 and C18,
were well protected, whereas C16 and C19 were only partially
protected. Complete or partial protection from piperidine
cleavage was observed for the three cytosines within both runs
IV and VI (Figure 6, A and B). In contrast, all of the cytosines
within runs II and V displayed significant cleavage (Figure 6A).
Cytosines within the 5′- and 3′-lateral loop regions, C9 and C29,
respectively, displayed different cleavage patterns (Figure 6, A
and D). Complete protection was observed for C9, which resides
between runs I and II, whereas C29, located between runs IV
and V, was significantly cleaved. A scan of the band intensities
from the 0.5 mM bromine reaction was performed to confirm
the protection pattern observed in the PAGE analyses (Figure
6, A and B). A schematic of this protection pattern along with
the identification of the cytosine tracts and loop regions is
provided in Figure 6C. On the basis of these results, and in
conjunction with data obtained from the mutational studies, a
folding pattern of the predominant bcl-2 i-motif structure is
proposed to consist of seven intercalated cytosine+-cytosine
base pairs with loop regions of 8, 5, and 7 bases (Figure 6D).
C. NdU Substitutions Indicate the Potential Involvement of
Loop Thymines in Stacking Interactions That Differ within the
5′ and 3′ Loops. To gain further information on the potential for
base stacking interaction in the loops of the bcl-2 i-motif, each
thymine within the bcl-2 Py39WT sequence was sequentially
replaced with the fluorescent thymine analog NdU, which
fluoresces in an unquenched environment or becomes quenched
in the presence of base-base stacking interactions. Replacement
of thymine T39, which resides at the 3′-end of the oligomer and
outside the i-motif-forming region, served as an internal control
and does not exhibit pH-dependent fluorescence (Figure 7A).
Significantly, thymines within the loops of the i-motif-forming
region of the Py39WT sequence demonstrated different fluo-
rescence patterns. Substituted thymines at positions 20, 21, and
24 displayed quenched fluorescence at low pH levels (pH
4.4-6.3) and fluorescence at higher pH levels (pH 6.6-8.0)
(Figure 7A). Incorporation of a fluorescent thymine at positions
20 or 21 resulted in at least 50% less fluorescence, which
persisted over the low pH levels (pH 4.4-6.3). Significant
quenching was also observed for a fluorescent thymine at
position 24 (pH 4.4); however, fluorescence steadily increased
with increasing pH. In contrast, substitution of thymine 10
resulted in fluorescence only at acidic pH levels and quenched
fluorescence at neutral pH levels (Figure 7A). Figure 7B displays
the proposed loop positions of the thymines in a schematic
model of the i-motif structure.
Figure 5. Mutational analysis of the bcl-2 Py39WT sequence. (A, upper)
Full-length bcl-2 Py39 oligomer sequence with each of the mutated cytosines
labeled. (A, lower) Graphical representation of the specified bcl-2 Py39
oligomer melting temperatures obtained by CD thermal analysis of each
mutant at pH 6.1. (B) Potential folding pattern based on mutant thermal
analysis.
involved in the base-pairing of the i-motif (Figure 5A). Overall,
mutations of cytosines within runs I, III, IV, and VI most
significantly affected the thermal stability of the bcl-2 Py39
i-motif (Figure 5A). The mutation of cytosine C5 within run I
produced an 8.5 °C decrease in Tm of the bcl-2 Py39 i-motif.
Mutation of each of the central three cytosines in run III (C16,
C17, C18) resulted in a 9.5 °C or greater decrease in melting
temperature, while mutation of the flanking cytosines, C15 and
C19, produced a much smaller ∆Tm (-4.9 and -6 °C, respec-
tively). A decrease of 5.8 °C in Tm was observed for mutation
of C26 within run IV. Mutations of cytosines C35, C36, C37, and
C38 within run VI significantly lowered the Tm of Py39WT by
7.5, 7.2, 7.7, and 9.3 °C, respectively. In contrast, mutations of
cytosines within runs II (C12) and V (C32) produced minimal
effects on the thermal stability of the Py39WT i-motif, with
only a 2.1 or 2.8 °C decrease in melt temperature, respectively.
These mutational studies implicate the major involvement of
runs I, III, IV, and VI in providing the stability of the bcl-2
promoter i-motif (Figure 5B) and also provide additional
information on which cytosines in runs III and VI are used for
i-motif formation.
B. Bromine Footprinting Protection Pattern Identifies the
Specific Cytosines Involved in the bcl-2 Promoter i-Motif Struc-
ture. Bromine footprinting can be used to identify the specific
cytosines involved in the base pairing and intercalation in the
bcl-2 i-motif structure due to preferential bromination of
cytosines that lack steric or electrostatic hindrance at the C5
position.24,69 Reactivity of these cytosines with bromine results
in their increased susceptibility to cleavage by piperidine, and
PAGE can then be used to visualize the resulting cleavage
products. Consistent with the results from Tm measurements of
mutant oligomers, the overall protection pattern of the Py39WT
oligomer at pH 6.1 revealed that cytosines within runs I, III,
IV, and VI were consistently protected or partially protected,
whereas cytosines within runs II and V displayed strong
piperidine cleavage (Figure 6, A and B). The three 3′-end
Discussion
The bcl-2 proto-oncogene encodes an antiapoptotic protein
involved in the inhibition of the mitochondrial apoptotic
pathway. Dysregulation of bcl-2 expression may lead to
prolonged cell survival despite apoptotic stimuli, which is
hypothesized to result in the chemoresistance observed in a wide
variety of cancers that overexpress bcl-2.1,4-6 Alternatively,
downregulation of bcl-2 has been associated with extensive
neuron apoptosis in a number of neurodegenerative diseases.7,8
The prevalence of defects in bcl-2 expression in the two distinct
pathologies makes bcl-2 an attractive target for therapy. The
P1 promoter region responsible for the majority of bcl-2
expression consists of multiple transcription factor binding sites,
9
17674 J. AM. CHEM. SOC. VOL. 131, NO. 48, 2009

i-Motif in the bcl-2 P1 Promoter
A R T I C L E S
Figure 6. Bromine footprinting pattern obtained from the Py39WT oligomer at pH 6.1. (A and B) Autoradiogram and densitometric scans of the PAGE
band intensities of the cleavage products from the Py39WT sequence. The CT lanes represent pyrimidine sequencing, while the bromine lanes reflect
cytosine cleavage in the presence of 0.5 mM bromine. Lane C in (A) represents the cleavage reaction in the absence of bromine. The scanned band intensities
correspond to the 0.5 mM bromine reaction displayed in the bromine lanes. Illustrations of (C) the cytosine protection pattern with the designated loop
regions and (D) the proposed folding pattern are based on the bromine footprinting PAGE analysis. The open (white), half open (white/black), and closed
(black) circles represent full protection, partial protection, and no protection from cleavage of cytosines, respectively. The yellow, green, red, and blue
circles represent the nucleobases cytosine, adenine, guanine, and thymine, respectively.
Figure 7. Each of the thymines within the bcl-2 Py39 sequence was substituted with a fluorescent tricyclic naphthodeoxyuridine thymine analog. (A)
Fluorescence was plotted for each substituted thymine as relative fluorescence units over a pH gradient. (B) Proposed folding pattern of the bcl-2 i-motif
with identification of the substituted thymines. The yellow, green, red, and blue circles represent the nucleobases cytosine, adenine, guanine, and thymine,
respectively.
as well as a GC-rich element, that may serve as sites for
modulating transcription.
induction of i-motif formation through negative supercoiling
within the bcl-2 promoter. These studies are ongoing. There
are numerous i-motif folding patterns possible from the six runs
of three, four, or five cytosines in the complex runs of cytosines
within the bcl-2 C-rich promoter sequence. Consistent with a
recent publication in which only the central four cytosine runs
were examined,19 our results confirm that intramolecular i-motif
formation occurs within the bcl-2 promoter sequence. However,
our data suggest the presence of a different conformation that
requires all six runs of cytosines of the full-length sequence to
form the most stable, biologically relevant i-motif structure. We
demonstrate, through mutational studies coupled with bromine
footprinting, that the predominant i-motif structure formed by
the bcl-2 C-rich promoter sequence consists of an 8:5:7 loop
While our previous studies have focused on the G-rich strand
within the bcl-2 promoter region, the present study involves
the characterization of the dynamic topology of the comple-
mentary C-rich strand. The pH-dependent formation of the bcl-2
i-motif within an in vitro system raises the question of the
biological relevance of i-motif formation within cellular DNA.
Significantly, recent studies have demonstrated that i-motif
formation within the c-myc promoter region may occur purely
as a result of negative supercoiling.24 This provides a precedent
that the C-rich strand of bcl-2 will also exhibit dynamic
properties, including an i-motif structure in vivo. Further plasmid
chemical probing experiments are required to address the
9
J. AM. CHEM. SOC. VOL. 131, NO. 48, 2009 17675

A R T I C L E S
Kendrick et al.
folding pattern (Figures 6 and 7). The discovery of these large
lateral loops poses the question, what significance or advantage
does the large loop size offer the i-motif structure? Typically,
the most stable G-quadruplex structures exhibit smaller loop
sizes than those found in i-motifs, which accommodate the
characteristic double-chain reversal and lateral loops.73-76 The
complementary bcl-2 promoter G-rich strand forms a mixed
parallel/antiparallel G-quadruplex that can adopt three different
G-quadruplex structures. Although an equilibrium between the
three conformations may exist, the middle four runs of guanines
were shown to provide the most predominant, stable conforma-
tion, consisting of three G-tetrads with a 3:7:1 loop folding
pattern, which results in the double-chain reversal and two lateral
loops.15 Therefore, the additional nonquadruplex-forming gua-
nine tracts within the G-rich strand may provide the necessary
number of cytosine tracts for stable i-motif formation. A possible
reason for the larger loop sizes in the bcl-2 promoter is that
these are needed to provide additional stability, perhaps through
the formation of capping structures. Indeed, the mutational
studies and the bromine footprinting analyses provided evidence
for the involvement of loop cytosines in a capping structure,
while thymine involvement was demonstrated through the NdU
fluorescence assay. The complete and partial protection observed
for the 5′-loop cytosines C9 and C13, respectively (Figure 6A),
suggest that these cytosines may be involved in a capping
structure formed by the bases within the lateral loop regions.
Consistent with the bromine footprinting pattern and the
possibility that these cytosines function in stabilizing the i-motif
through the formation of capping structures, mutation of C9 to
a thymine resulted in a ∆Tm of -7.8 °C (data not shown).
A novel assay was designed based on the unique fluorescence
emission properties of a NdU thymine analog that was previ-
ously used to detect the formation of triplex DNA.65 For our
purposes, the incorporation of NdU into a secondary structure-
forming oligomer provided information regarding the local
environment of each thymine within the loop regions. The
phosphoramidite of NdU was prepared as previously described65
for incorporation into five separate oligonucleotides to sequen-
tially replace each of the five thymines within the Py39WT
sequence. Thymine substitution with NdU at positions 20, 21,
and 24 within the top (middle) loop resulted in quenched
fluorescence in the presence of i-motif formation at pH 6.3 or
lower (Figure 7A). Presumably, these thymines are involved in
stacking interactions within the loop regions to form a capping
structure. The capping structures formed by the large 8:5:7 loop
conformation of the bcl-2 i-motif may be responsible for the
high transitional pH (6.6) and stability. Similarly, the well-
characterized c-myc i-motif also utilizes six cytosine tracts,
which results in a 6:2:6 loop conformation, and, as in the bcl-2
i-motif, these large lateral loops most likely contribute to the
high transitional pH of 6.5-6.8.60,62 This is in contrast to the
previously characterized smaller i-motif loop conformation of
2:(3-4):2 for the VEGF,49 RET,55 and Rb60 structures, which
exhibit lower transitional pHs of 5.9, 6.4, and 5.9, respectively.
Interestingly, thymine substitution with NdU at position 10 gave
a different pH-dependent pattern of fluorescence quenching,
suggesting that the local environment of this residue is distinctly
different than those at positions 20, 21, and 24.
In addition to the importance of loop size to the overall
conformation and stability of the i-motif, perhaps the capping
structures formed from these large loops may also serve as
recognition scaffolds for specific interaction with nuclear
proteins and even small molecules. In support of this hypothesis,
loop sizes and capping structures in RNA secondary structures
are important for stabilization and protein recognition of
hairpins. Single-stranded RNA most often folds back on itself
to form a stem-loop structure where the stem adopts a duplex
conformation and the loop consists of noncanonical base-pairing
and stacking of nucleotides.77 In DNA the i-motif structure is
also formed from a single strand that folds into an antiparallel
duplex with a loop structure; however, the i-motif consists of a
second fold-back that produces additional loop regions.28-30
While the stem of RNA secondary structures primarily consists
of Watson-Crick base pairs, there is evidence of non-
Watson-Crick regions.77 For example, RNA hairpins have been
shown to consist of protonated adenine-cytosine base pairs at
neutral pH that contribute to structure stabilization.78,79 In
addition, the thermal and structural stability of RNA hairpins
also depend on the loop nucleotide sequence and size.80,81 For
example, rRNA hairpins appear to be most stable with a
tetraloop, whereas stable hairpins formed from tRNA consist
of seven nucleotides in the loop region.82 As a consequence, it
is not surprising that proteins have been shown to recognize
and interact with RNA secondary structures in a sequence-
specific fashion. Specifically, the loop regions are important
protein recognition sites, as mutations within the loop region
disrupt RNA-protein interaction.83 Thus, in addition to providing
stability through the formation of capping structures, the two
lateral loops of 8 and 7 bases may together offer selectivity in
protein recognition and small molecular targeting of the i-motif
for modulation of bcl-2 transcription.
Acknowledgment. This research was supported by grants from
the Arizona Board of Regents, the National Institutes of Health
(GM085585, T32CA09213), and the Leukemia and Lymphoma
Society (6225-08). We thank Daekyu Sun for providing experi-
mental guidance with the bromine footprinting protocol and
interpretation of data. We also thank David Bishop for his significant
contribution in the preparation and editing of the final version of
the text and figures displayed in the article.
JA9076292
(77) Bevilacqua, P. C.; Blose, J. M. Annu. ReV. Phys. Chem. 2008, 59, 79.
(78) Legault, P.; Pardi, A. J. Am. Chem. Soc. 1994, 116, 8390.
(79) Cai, Z.; Tinoco, I., Jr. Biochemistry 1996, 35, 6026.
(80) Groebe, D. R.; Uhlenbeck, O. C. Nucleic Acids Res. 1988, 16, 11725.
(81) Haasnot, C. A. G.; Hilbers, C. W.; van der Marel, G. A.; van Boom,
J. H. J. Biosci. 1985, 8, 767.
(73) Qin, Y.; Hurley, L. H. Biochimie 2008, 90, 1149.
(74) Hazel, P.; Huppert, J.; Balasubramanian, S.; Neidle, S. J. Am. Chem.
Soc. 2004, 126, 16405.
(75) Risitano, A.; Fox, K. R. Nucleic Acids Res. 2004, 32, 2598.
(76) Bugaut, A.; Balasubramanian, S. Biochemistry 2008, 47, 689.
(82) Uhlenbeck, O. Nature 1990, 346, 613.
(83) Zwieb, C. J. Biol. Chem. 1992, 267, 15650.
9
17676 J. AM. CHEM. SOC. VOL. 131, NO. 48, 2009