Extending the structure-activity relationship of anthranilic acid derivatives as farnesoid x receptor modulators: Development of a highly potent partial farnesoid x receptor agonist

Article

pubs.acs.org/jmc

Extending the Structure−Activity Relationship of Anthranilic Acid

Derivatives As Farnesoid X Receptor Modulators: Development of a

Highly Potent Partial Farnesoid X Receptor Agonist

Daniel Merk,*^,†Christina Lamers,^†Khalil Ahmad,^†Roberto Carrasco Gomez,^†Gisbert Schneider,^‡

Dieter Steinhilber,^†and Manfred Schubert-Zsilavecz^†

^†Institute of Pharmaceutical Chemistry, Goethe University Frankfurt, Max-von-Laue-Strasse 9, 60438 Frankfurt, Germany

^‡Department of Chemistry and Applied Biosciences, ETH Zurich, Vladimir-Prelog-Weg 1-5/10, 8093 Zurich, Switzerland

̈

S

* Supporting Information

ABSTRACT: The ligand activated transcription factor nuclear farnesoid X receptor (FXR) is involved as a regulator in many

metabolic pathways including bile acid and glucose homeostasis. Therefore, pharmacological activation of FXR seems a valuable

therapeutic approach for several conditions including metabolic diseases linked to insulin resistance, liver disorders such as

primary biliary cirrhosis or nonalcoholic steatohepatitis, and certain forms of cancer. The available FXR agonists, however,

activate the receptor to the full extent which might be disadvantageous over a longer time period. Hence, partial FXR activators

are required for long-term treatment of metabolic disorders. We here report the SAR of anthranilic acid derivatives as FXR

modulators and development, synthesis, and characterization of compound 51, which is a highly potent partial FXR agonist in a

reporter gene assay with an EC₅₀value of 8 3 nM and on mRNA level in liver cells.

physiological FXR ligand chenodeoxycholic acid (CDCA, 1,

Scheme 1), 6α-ethyl-CDCA²⁰(6-ECDCA, obeticholic acid,

INT-747, 2, Scheme 1) was discovered, which is presently

being investigated in clinical phase II and III trials for PBC,

NASH, and NAFLD.¹⁷The most important and widely used

nonsteroidal FXR agonist is GW4064²¹(3, Scheme 1), which

served as a model or reference compound in many experiments.

3 and several other synthetic nonsteroidal FXR agonists,

however, have a poor bioavailability or show toxic eﬀects which

limit their clinical utility.^19,22−25In addition, a recent study

indicated that GW4064 (3) is active on several oﬀ-targets.²⁶

CDCA (1), 6-ECDCA (2), and GW4064 (3) all constitute

full FXR agonists. For GW4064 (3), the EC₅₀value varies in

literature depending on the applied test system from 15 nM in

a coactivator recruitment assay to 0.9 μM in a reporter gene

assay. 6-ECDCA (2) was characterized with an EC₅₀value of

99 nM for coactivator recruitment and 85 nM in a reporter

gene assay (reviewed in ref 27).

INTRODUCTION

■

As a ligand activated transcription factor, nuclear farnesoid X

receptor (FXR) regulates several metabolic pathways involved

in bile acid, triglyceride, and glucose homeostasis. It binds to

speciﬁc response elements on the DNA as monomer or as

heterodimer with RXR and controls the transcription of genes

especially involved in bile acid synthesis and metabolism when

activated by its physiological ligands, the bile acids.^1,2

Modulation of FXR may be a valuable therapeutic approach

for various pathophysiological conditions. FXR activation

showed promising results in vitro and in vivo for the treatment

of metabolic,³⁻⁸neoplastic,⁹as well as inﬂammatory¹⁰⁻¹⁵

diseases such as diabetes and inﬂammatory bowel disease.

Clinical development of FXR agonists for the treatment of the

liver disorders primary biliary cirrhosis (PBC), nonalcoholic

steatohepatitis (NASH), and nonalcoholic fatty liver disease

(NAFLD) is ongoing.^6,16,17Most recently, an in vivo model

indicated that the very beneﬁcial metabolic eﬀects of vertical

sleeve gastrectomy in adipose individuals could be due to

activation of FXR.¹⁸

Given the fact that conditions which might be treatable with

FXR ligands are predominantly metabolic diseases that require

A number of synthetic steroidal and nonsteroidal FXR

agonists has been developed so far (reviewed in ref 19). By

introduction of an additional ethyl residue in the most potent

Received: June 20, 2014

A

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Scheme 1. Important FXR Agonists CDCA (1), 6-ECDCA (2), and GW4064 (3)

Scheme 2. Synthesis Routes for Preparation of the Tested Acylanthranilic Amides

a stable long-term therapy, well tolerated agents are required

that can be applied over long time. Many of the known FXR

ligands, however, exhibit toxicity and show poor bioavail-

ability.^19,22−25In addition, targeting of nuclear receptors

involved in metabolic processes such as FXR and PPARγ has

taught that full activation of a ligand activated transcription

factor may lead to various side eﬀects in long-term treatment

and that full activation is not necessarily required for beneﬁcial

eﬀects.²⁵New potent FXR modulators are therefore needed

that do not exhibit full agonism but only activate the nuclear

receptor to a partial extent.

We recently described the discovery and development of

anthranilic acid derivatives as novel FXR agonists.^28,29Here we

report the optimization of the anthranilic acid scaﬀold to highly

potent FXR partial agonists by structure−activity relationship

(SAR) studies and molecular docking. Optimized compound

51 constitutes a potent partial FXR agonist with an EC₅₀value

of 8 3 nM and a maximum relative FXR activation of 17.5

0.7% in a FXR reporter gene assay.

ortho-aminobenzoylation of amines or anilines in a mixture of

DMF and pyridine at 80 °C and in the presence of 4-DMAP as

a catalyst.²⁸For several substituted anilines that were necessary

for our SAR, these conditions however led to very poor yields.

Better yields could be achieved when the reaction was carried

out in absolute ethanol under reﬂux with an excess of the isatoic

anhydride derivative (5a−f). The better performance of this

reaction in ethanol may probably be due to better solubility and

the presence of a protic solvent (Scheme 2).

For some aniline derivatives as headgroup substituents that

showed a very poor nucleophilicity, another synthetic strategy

was necessary. In addition, some isatoic anhydride derivatives

containing certain substituents were not commercially available.

In these cases, synthetic route B was used.

Synthetic route B started with ortho-nitrobenzoic acid

derivatives (6a−f), which were activated by chlorination with

thionyl chloride in methylene chloride in the presence of

catalytic amounts of DMF and subsequently reacted with the

respective aniline derivatives (4a−u) in THF/pyridine to

introduce the headgroup substituents. By reduction of the nitro

group of the resulting derivatives 9a−f with tin and

hydrochloric acid in THF, the required ortho-aminobenzoylani-

line derivaties (7a−z, 10a−e) were available (Scheme 2).

Finally, the ortho-aminobenzoylaniline derivatives 7a−z and

10a−e from route A or B were reacted with various acyl

chlorides (8a−j) to introduce the acyl substituent at the aniline

group of the anthranilic acid core structure. For some

compounds, a ﬁnal alkaline ester hydrolysis was necessary

RESULTS

■

Chemistry. Anthranilic acid derivatives were generated via

two diﬀerent synthetic strategies depending on the reactivity

and availability of starting materials.

Synthetic route A involved the ortho-aminobenzoylation of

an aniline derivative (4a−u) with a derivative of isatoic

anhydride (5a−f) to introduce the acidic headgroup at the

anthranilic acid core structure. We previously reported this

B

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Scheme 3. Synthesis of Tetrazole Derivative 27 and Amide 28

Scheme 4. Development of Compound 13

after this synthesis procedure to yield the test compound

(Scheme 2).

promoter, and a constitutively expressed renilla luciferase with

SV40 promoter as internal control for transfection eﬃciency

and toxicity. As reference compound, GW4064 (3) was used in

a concentration of 3 μM, which we set as 100% FXR activation.

The assay was validated with CDCA (1), which had an EC₅₀of

18 1 μM with 88 3% maximum relative FXR activation and

6-ECDCA (2), which showed an EC₅₀of 0.16 0.02 μM (87

3% max).

We ﬁrst analyzed fragments of the lead compound 13 to

evaluate the possibility of reducing the size of the compounds.

Fragment 7a without lipophilic acyl substituent and anthranilic

acid were inactive, however. We then inverted both amide

bonds of compound 13, resulting in 14, which was inactive on

FXR as well.

In case of the lipophilic acyl substituent, the SAR was equally

steep as we have already observed in our ﬁrst SAR study.²⁸

Replacement of the 4-tert-butyl moiety of 13 by comparably

large and lipophilic residues such as a triﬂuoromethyl group

(15) or a bromine atom (16) strongly reduced the potency. In

our ﬁrst SAR study, also a 2-naphthoyl substituent (12) showed

potent FXR activating results. We therefore investigated

potential bioisosters and homologues of this moiety. A

methylenedioxo residue (17), a dihydrobenzodioxine residue

(18), and a 4-triﬂuoromethyl-3-ﬂuorobenzyl moiety (19) were

signiﬁcantly less active than the 2-naphthoyl substituent (12).

Moving the substitution from 4-position of the aromatic ring to

3- and 5-positions in 20 or the introduction of additional

carbon atoms between amide group and aromatic ring in 21

The bioisosteric derivatives 27 and 28 were generated by

diﬀerent strategies. Tetrazole derivative 27 was obtained by

cycloaddition of sodium azide and nitrile 24 in DMF/MeOH in

the presence of catalytic amounts copper(I) oxide.³⁰For the

preparation of amide 28, the respective carboxylic acid

derivative 13 was used as starting material and reacted with

silica supported ammonium chloride in the presence of tosyl

chloride and triethyl amine as described previously³¹(Scheme

3).

Biological Evaluation and Structure−Activity Rela-

tionships. In our ﬁrst SAR study, we discovered compounds

11 (EC₅₀= 2.5 0.4 μM, 19 1% max) and 12 (EC₅₀= 1.5

0.2 μM, 37 1% max) as FXR partial agonists with moderate

potency. Recombination of the 3-aminobenzoic acid of 12 as

headgroup and the 4-tert-butylbenzoyl moiety of 11 as

lipopholic acyl substituent in compound 13 resulted in

improved potency and provided the starting point of this

SAR study (13, EC₅₀= 0.28

0.03 μM, 9.4

0.2% max,

Scheme 4). With compound 13 as the starting point, we

investigated the SAR of the lipophilic acyl substituent, the

acidic headgroup, and the anthranilic acid core structure.

FXR activity was determined in a full-length FXR reporter

gene assay in HeLa cells that were transiently transfected with

hFXR (constitutively expressed, CMV promoter), hRXR

(constitutively expressed, CMV promoter), a ﬁreﬂy luciferase

(reporter gene) under the control of a minimum BSEP

C

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

Table 1. In Vitro Activities of 7a and 13−22 in the Full-Length FXR Transactivation Assay

a

Values are expressed as mean SEM. i.a.: inactive.

and 22 reduced potency as well. Summarizing the above, the 4-

tert-butylbenzoyl moiety of lead compound 13 proved to be the

best substituent in this position (Table 1).

To discover additional space for further substituents in the

binding pocket, we introduced additional residues at the

aromatic ring of the headgroup. A methyl group in 6-position

(33) disrupted FXR activation activity, while a methyl group on

either side of the carboxylic acid in 2- and 6-positions (34 and

35) strongly improved the potency of the compounds. Because

docking of compound 13 into the FXR ligand binding site had

suggested additional space for substituents in 4-position of the

aromatic ring of the headgroup, we also investigated other

residues than the methyl group (33), which was inactive.

Introduction of a methoxy group (36), a ﬂuorine (37), or

chlorine atom (38) retained low FXR activating activity, but all

compounds 36−38 showed lower potency than the lead

compound. This worse activity might also be due to steric

clashes between 4-substituent and the amide group, which

makes the aromatic ring of the headgroup ﬂip out of the plane

of the central aromatic ring. This eﬀect might however be

generated by a larger substituent in the 2-position (compound

34) as well (Table 3).

As next step, we investigated the SAR of the acidic

headgroup. Therefore, we replaced the carboxylic acid with

suitable bioisosters of the carboxylic acid and introduced

additional carbon atoms between aromatic ring and carboxylic

acid. Bioisosteric replacement of the carboxylic acid with a

methyl ketone (23), a nitrile group (24), a methoxy group

(25), or a methylmercaptan moiety (26) did not signiﬁcantly

change the potency of the compounds. A 1H-tetrazolyl moiety

(27) as headgroup signiﬁcantly enhanced the maximum relative

activation activity at FXR, but the EC₅₀value was worsened by

a factor 10. Replacement of the carboxylic acid by a carboxylic

amide (28) improved the potency at FXR, but unfortunately

the compound was quite toxic to the HeLa cells in our assay

system, so we did not further investigate the amide moiety. The

potency could also be improved by introduction of a second

methoxy group as hydrogen bond acceptor in 2-position of the

aromatic ring (29), while a third methoxy group (30)

completely disrupted activity (Table 2).

The best position for further substitution therefore seemed

to be the 6-position (35) next to the carboxylic acid. We

replaced the methyl group of 35, which had strongly improved

the potency of compound 13 by various other residues.

However, the SAR was quite steep again. While the

introduction of a methoxy group (39) retained the low

By replacing the benzoic acid residue of 13 with a phenyl

acetic acid (31), potency was slightly lowered while a 3-

phenlylpropionic acid (32) increased the activity on FXR

(Table 2).

D

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

a

Table 2. In Vitro Activities of 23−32 in the Full-Length FXR Transactivation Assay

a

Values are expressed as mean SEM. i.a.: inactive.

a

Table 3. In Vitro Activities of 33−42 in the Full-Length FXR Transactivation Assay

a

Values are expressed as mean SEM. i.a.: inactive.

E

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 1. Antagonistic activity of 45 in competition with GW4064 (3) in the reporter gene assay. * p < 0.05; ** p < 0.01; *** p < 0.001.

a

Table 4. In Vitro Activities of 43−51 in the Full-Length FXR Transactivation Assay

a

Values are expressed as mean SEM. i.a.: inactive.

nanomolar activity of 35, a chlorine (40) or bromine atom (41)

reduced the potency by about 6-fold and 3-fold, respectively.

Introduction of a nitro group (42) even completely disrupted

the activity (Table 3).

F

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

At last we also investigated the availability of additional space

around the anthranilic acid core structure of lead compound 13

by introducing chlorine atoms in every position of the aromatic

ring. An additional chlorine atom in 3- or 6-positions of the

anthranilic acid moiety (43 and 44) led to inactivity on FXR,

which might be due to steric clashes with the amide groups that

causes a diﬀerent geometry. Chlorine substitution in the 5-

position (45) interestingly led to moderate antagonistic activity

on FXR (Figure 1), while a chlorine atom in the 4-position

(46) improved the agonistic activity (Table 4).

Table 5. In Vitro Activities of 52−54 in the Full-Length FXR

a

Transactivation Assay

In the next step, we replaced the chlorine atom in 4-position

of compound 46 with various other substituents. In this case,

the SAR was less steep than before. While the 4-nitro derivative

48 was inactive, the 4-methyl (49) as well as the 4-bromo

derivative (50) were more potent than the 4-chloro derivative

46. Introduction of a methoxy group in 4-position (51) ﬁnally

led to the desired improvement of potency to a low nanomolar

EC₅₀value (Table 4).

To conﬁrm the antagonistic activity of 45, we prepared

derivative 47 with a methoxy group in the 5-position which

exhibited a comparable antagonistic activity. Further inves-

tigation of this antagonism shall, however, be performed and

discussed elsewhere (Table 4).

Finally, we investigated the possibility to recombine the best

moieties of our SAR studies to further improve the potency.

Therefore, we tested derivative 52 containing the 4-chloro

substituent at the anthranilic acid core and the 6-methyl residue

at the headgroup. Although potent on FXR, this compound

(52) could not outmatch the derivatives 35 and 46 with only

one of the substituents but was more or less equally potent.

When the best residues, in particular the 4-methoxy group at

the central aromatic ring and the 6-methyl group at the

headgroup aromatic ring, were combined in 53, potency was

even slightly diminished. We assumed this might be due to

steric clashes with the receptor by the double substitution and

prepared the smallest possible compound with two substitu-

tions (54) which contained a 4-methyl group at the anthranilic

acid residue and a 6-methyl substituent at the headgroup.

However, this derivative was again equally potent as the

derivatives bearing only one of the methyl groups (35 and 49).

Hence, 51 remained the best anthranilic acid derivative as FXR

agonist (Tables 3, 4, and 5).

In Vitro Characterization of Compound 51. To further

investigate the FXR agonist activity of compound 51, we

determined its eﬀect on FXR target genes in the liver carcinoma

cell line HepG2 and the colorectal adenocarcinoma cell line

HT-29 by quantitative PCR experiments at the concentrations

0.1, 0.3, 1, 3, and 10 μM. 51 showed statistically signiﬁcant

partial agonist activity on FXR target genes. The mRNA of

small heterodimer partner (SHP) was induced by about 2-fold

a

Values are expressed as mean SEM. i.a.: inactive.

ileal bile acid binding protein (IBABP: untreated, 100%;

CDCA, 288 15%; 51, 0.1 μM 188 42%, 0.3 μM 145

29%, 1 μM 161 12%, 3 μM 168 29%, 10 μM 144 22%),

51 showed a concentration independent partial agonistic

activity. For all investigated target genes, this eﬀect reached a

maximum of about 40% of the eﬀect produced by CDCA (1, 50

μM). The fact that 51 exhibited a constant eﬀect on the target

genes in a concentration range from 0.1 to 10 μM shows that

51 has a partial FXR agonistic activity not only in the reporter

gene assay but on FXR target genes on mRNA level as well

(Figure 2).

To characterize the pharmacological proﬁle of 51, we also

investigated its activity on common oﬀ-targets. Compound 51

was inactive on the membrane bile acid receptor TGR5 (30

μM) and on PPARδ (3 μM). A slight activity on PPARγ and

PPARα was observed (EC₅₀(PPARγ) = 2.99 0.10 μM (81

2% max); EC₅₀(PPARα) > 10 μM), which makes 51 about

375-fold selective for FXR over PPARγ and >1000-fold over

PPARα, PPARδ, and the membrane bile acid receptor TGR5

(Figure 3A).

Furthermore, 51 showed an aqueous solubility of 2.6 mg/L

and was quite stable against metabolism by liver microsomes in

vitro. After 60 min incubation, 80.2 0.2% of the compound

were still detectable (Figure 3B).

Finally, we determined the toxicity of compound 51 which

showed slight toxic eﬀects on HeLa cells in the reporter gene

assay starting from 30 μM. In HepG2 cells, 51 had an

antiproliferative eﬀect at concentrations of 30 μM and above in

a WST-1 assay and exhibited acute toxicity at the same

concentrations in an LDH assay (Figure 3C,D).

(untreated, 100%; CDCA, 537

88%, 0.3 μM 247 4%, 1 μM 181 12%, 3 μM 185 18%, 10

μM 214 14%) and mRNA of CYP7A1 (untreated, 100%;

113%; 51, 0.1 μM 239

CDCA, 33 8%; 51, 0.1 μM 52 17%, 0.3 μM 59 9%, 1

μM 55 11%, 3 μM 67 10%, 10 μM 57 16%), which is

not a direct FXR target gene but aﬀected via SHP induction,

was repressed by about 2-fold. Also on the organic solute

transporter α (OSTα: untreated, 100%; CDCA, 450 94%;

51, 0.1 μM 151 11%, 0.3 μM 198 10%, 1 μM 140 14%, 3

μM 149 13%, 10 μM 234 19%), the bile salt export protein

(BSEP: untreated, 100%; CDCA 624 40%; 51, 0.1 μM 294

16%; 0.3 μM 300 8%; 1 μM 319 46%; 3 μM 326 58%;

10 μM 308 46%; GW4064 (3, 3 μM) 1523 187%), and the

Receptor−Ligand Docking. Among the 25 available

cocrystal structures of the FXR-LBD, the complex (PDB ID:

3OLF³²) with the benzimidazole-based partial agonistic ligand

55 (EC₅₀= 0.5 μM, 51% max)³²seemed most suited for

docking studies on the here reported partial FXR agonists.

Comparison of benzimidazole-based cocrystal structures

(complexes of 55 (3OLF) and related derivatives (PDB IDs:

G

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 2. In vitro pharmacological activity of compound 51. (A) Relative FXR activation of 51 in the reporter gene assay compared to 3 μM

GW4064 (3), which is set as 100%. Nonlinear regression yielded an EC₅₀value of 8 3 nM with 17.5% max rel activation; n = 5. (B) Eﬀect of 51 on

mRNA expression of direct FXR target gene SHP in HepG2 cells. Partial FXR agonist 51 (0.1, 0.3, 1, 3, 10 μM) induces SHP expression by about 2-

fold (physiologic FXR agonist CDCA: 5.4-fold); eﬀect independent from concentration; n = 4. (C) Eﬀect of 51 (0.1, 0.3, 1, 3, 10 μM) on mRNA

expression of indirect FXR target gene CYP7A1 in HepG2 cells. Partial FXR agonist 51 represses CYP7A1 expression to about 60% (physiologic

FXR agonist CDCA: 33%); eﬀect independent from concentration; n = 4. (D) Eﬀect of 51 (0.1, 0.3, 1, 3, 10 μM) on mRNA expression of direct

FXR target gene OSTα in HepG2 cells. Partial FXR agonist 51 induces OSTα expression by about 1.8-fold (physiologic FXR agonist CDCA: 4.5-

fold); eﬀect independent from concentration; n = 4. (E) Eﬀect of 51 (0.1, 0.3, 1, 3, 10 μM) on mRNA expression of direct FXR target gene BSEP in

HepG2 cells. Partial FXR agonist 51 induces BSEP expression by about 3-fold (physiologic FXR agonist CDCA, 6.5-fold; GW4064, 15-fold); eﬀect

independent from concentration; n = 4. (F) Eﬀect of 51 (0.1, 0.3, 1, 3, 10 μM) on mRNA expression of direct FXR target gene IBABP in HT-29

cells. Partial FXR agonist 51 induces IBABP expression by about 1.7-fold (physiologic FXR agonist CDCA: 3-fold); eﬀect independent from

concentration; n = 4. * p < 0.05; ** p < 0.01; *** p < 0.001.

3OKH, 3OKI, 3OMK, 3OMM, 3OOF, 3OOK)) with the

cocrystal structure of the GW4064-analogue 56 (PDB-ID:

3RUT³³) revealed signiﬁcant diﬀerences in the protein

structure and in the form of the ligand binding pocket (Figure

4A). Especially, the helices 3 and 7 which form the ligand

binding pocket are in signiﬁcantly shifted positions. This

inﬂuences the geometry of the ligand binding site. While the

complexes of the partial agonistic benzimidazoles such as 55

reveal a triangular ligand binding pocket, the pocket of full

agonistic ligands such as 56 is long and narrow. Docking of the

here reported partial agonistic anthranilic acid derivatives in a

model of the FXR-LBD derived from 3OLF³²yielded sound

H

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 3. In vitro characterization of 51. (A) oﬀ-target activity of compound 51: 51 is highly selective over PPARs and the membrane bile acid

receptor TGR5. (B) In vitro metabolism of 51 with Sprague Wistar Rat liver microsomes: after 60 min, 80.2 0.2% of the compound were still

detectable; n = 4. (C) LDH activity of HepG2 cells after 48 h treatment with compound 51: 51 showed acute toxicity starting from 30 μM; n = 4.

(D) WST-1 assay in HepG2 cells: 51 exhibited signiﬁcant antiproliferative eﬀects starting from 30 μM; n = 4.

docking poses. Accordingly, models derived from other

benzimidazole-based FXR-LBD complexes led to equal results.

However, docking of the anthranilic acid derivatives into

models derived from FXR-LBD cocrystal structures with full

agonistic ligands such as 56 revealed no reasonable docking

poses in contrast. Therefore, the complex 3OLF³²was used to

generate the model for our docking studies.

Docking of lead compound 13 into the ligand binding site of

FXR (model derived from PDB ID: 3OLF³²) suggested

prominent polar interactions of the benzoic acid with Arg₃₃₅

and with Arg₂₆₈via a near water cluster formed by two water

molecules. The lipophilic substituent was buried in a hydro-

phobic pocket formed by Phe₃₃₃, Leu₂₉₁, Leu₄₅₅, Met₄₅₄, and

Trp₄₅₈(Figure 5A). Through elongation of the benzoic acid in

13 to phenylacetic acid (31), these interactions were weakened

because the distances for polar interactions were not optimal.

The Gibbs energies for the poses of 31 and 13 were however

comparable (−8.9 and −8.7; Figure 5B). According to our

docking, further elongation to phenylpropionic acid in 32 on

the other hand strengthened the interactions with Arg₃₃₅and

with Arg₂₆₈and led to displacement of one water molecule from

the cluster (Figure 5C), which explains the rank order of

potency of 13, 31, and 32. Additionally, the Gibbs energy for

the pose of 32 was signiﬁcantly lower with −9.2 than for 31.

Additionally, docking of 45 yielded an explanation for its

antagonistic activity. Introduction of a chlorine substituent in 5-

postion of the central aromatic ring in 45 seemed to shift the

whole compound toward helix 7 and make a polar interaction

with Tyr₃₇₃possible (Figure 5D,E). A comparable interaction of

I

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 4. Comparison of the conformation (A) and pocket form (B) of the FXR-LBD cocrystal structures in complex with the partial agonist 55

(green, 3OLF) and the full agonist 56 (yellow, 3RUT). Helices 3 and 7 are shifted, which makes the ligand binding pocket of the partial agonistic

conformation triangular, while in the full agonistic conformation, the pocket is long and narrow.

FXR antagonists with helix 7 has already been described

previously.³³

derivatives because one substitution alone is suﬃcient to

displace a water from the cluster. The double substituted

derivative 54 (green) was slightly twisted compared to the

poses of 35 (pink) and 46 (blue). The Gibbs energies also

support this thesis, with values of −9.6 for 35 and −8.3 for 53

(Figure 5K,L).

Finally, we tried to dock the optimized compound 51 in

diﬀerent models of the FXR-LBD derived from complexes of

other compound classes than the benzimidazoles related to 55

on which our docking was based. Docking of 51 in FXR-LBD

models derived from cocrystals of full FXR agonists such as 56

(PDB-ID: 3RUT³³), which display a long and narrow binding

pocket, yielded no reasonable docking poses however. The fact

that 51 could only reasonably be docked in FXR models based

on the partial agonistic benzimidazoles related to 55 further

conﬁrms the partial FXR agonistic activity of the acylanthranilic

acid scaﬀold.

With an additional substituent in the 4-position of the

headgroup aromatic ring (compounds 33 and 36−38), the

compounds cannot form the same docking pose as, e.g., 13

because the 4-substituent and the amide oxygen would form a

steric clash. In the docking pose, both amide groups were

ﬂipped, and with this diﬀerent geometry, a good binding pose

and many beneﬁcial interactions seemed to be lost (Figure 5F).

An additional substituent in the 4-position of the central

aromatic ring (compounds 46 and 48−51) in the docking was

placed between helix 3 and helix 7, which slightly changed the

whole binding mode of the compounds and led to a docking

pose quite similar to the pose of phenylpropionic acid

derivative 32. The interactions with Arg₃₃₅and Arg₂₆₈as well

as with the associated water cluster were strengthened, and one

water molecule was displaced. Additionally, the docking pose

suggested a further cation−π interaction of the headgroup

aromatic ring with Met₂₉₄(Figure 5G/H). The displacement of

one water molecule together with the more favorable relative

position of the carboxylic acid function to Arg₃₃₅and Arg₂₆₈can

explain the high rise in potency of compounds 46, 49, 50, and

51. There was no further polar interaction for compound 51,

but in addition to the displacement of one water molecule, the

methoxy group and the tert-butylbenzoyl moiety were buried

more deeply in lipophilic pockets, probably leading to the

additional rise in potency (Figure 5I,J).

Substituents in the ortho-position of the carboxylic acid (6-

position of headgroup, compounds 35 and 39−42) also

seemed to displace one water molecule from the water cluster

associated with Arg₃₃₅and Arg₂₆₈, thereby increasing the

potency of the compounds (Figure 5K). There seemed

however not to be enough space for large substituents such

as bromine (41) or a nitro group (42), which explains their loss

in potency. On the other hand, the docking poses of 35 and 51

can explain why the combination of both beneﬁcial

substitutions in compounds 52 and 54 could not further

improve the potency but led to approximately equally potent

DISCUSSION AND CONCLUSIONS

■

We have intensively investigated the SAR of anthranilic acid

derivatives as partial FXR agonists. Starting from compound 13,

which resulted from recombination of the best moieties in our

ﬁrst SAR study,²⁸all structural features of the acyl

anthranilamide scaﬀold and their impact on FXR activity have

been evaluated. Inversion of the amide bonds (14) disrupted

the activity on FXR, and we found no comparable or better

lipophilic backbone substituent (compounds 15−22) than the

4-tert-butylbenzoyl residue (13).

Interestingly, the acidic headgroup of 13 could be replaced

by several bioisosteric moieties such as a nitrile (24), a methyl

ketone (23), or even a methoxy group (25) without a

signiﬁcant change in potency. However, none of the bioisosteric

groups improved the potency either and for reasons of

solubility the carboxylic acid remained the most convenient

residue.

By elongation of the acidic headgroup side chain from a

benzoic acid (13) to phenylacetic acid (31) potency was

slightly diminished, while further elongation to phenylpropionic

J

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Figure 5. continued

one water molecule and forms a similar docking pose as 32 and 51.

(L) Superimposed docking poses of 35 (pink), 49 (light blue), and 54

(green): introduction of two methyl groups (4-position of the central

aromatic ring and 6-position of the headgroup aromatic ring) does not

lead to a more beneﬁcial docking pose because each methyl group

alone is suﬃcient to displace one water from the cluster associated

with Arg₃₃₅and Arg₂₆₈

.

acid (32) strongly improved the potency. This rank order of

potency is best explained by interaction of the headgroup with a

water cluster associated with Arg₃₃₅and Arg₂₆₈as suggested by

the docking pose. While the benzoic acid (13) can well interact

with the water cluster, for the phenylacetic acid moiety (31),

angles and distances might be inappropriate for good

interaction, and ﬁnally, the phenylpropionic acid (32) seems

to form potent interactions with Arg₃₃₅and Arg₂₆₈and to

displace one water molecule from the cluster.

By selectively substituting all free positions of the headgroup

(33−42) and central aromatic ring (43−51), we discovered

positions that through substitution either disrupted the activity

of the compounds on FXR or strongly improved their potency.

Additional substituents on the central aromatic moiety next to

the amide bonds (43 and 44) led to inactivity which is probably

due to steric clashes with the amide bonds and a consequently

diﬀerent geometry of the compounds. Substituents in the 4-

position of the headgroup aromatic ring (33, 36−38) strongly

reduced the potency as well. The fact that a ﬂuorine atom,

which constitutes the smallest substituent in this series, retained

most activity indicates that the loss of potency is as well due to

steric interactions with the amide group in proximity.

Substituents in the 4-position of the central aromatic ring

(46, 49−51) and in the 6-position of the headgroup (35, 39−

41) both strongly improved the potency of the compounds. In

the case of the headgroup, the SAR was quite steep because

only a methyl (35) and a methoxy group (39) were highly

potent while larger substituents were less active. Our docking

studies suggest that the gain in potency of 35 and 39 might be

due to displacement of one water molecule from the water

cluster associated with Arg₃₃₅and Arg₂₆₈

.

Furthermore, in the case of 5-substituted derivatives (45 and

47) of the central aromatic ring, we found two FXR

antagonists. According to our docking studies, the additional

substituent seems to change slightly the binding mode of the

whole scaﬀold and make a polar interaction of the tert-

butylbenzoylamide oxygen with Tyr₃₇₃in helix 7 possible. It has

been suggested³⁴that interaction with helix 7 might lead to

antagonistic activity on FXR, which here seems to be true as

well.

The strongest improvement in agonistic activity was gained

by introduction of substituents in the 4-position of the central

aromatic ring. A methyl group (49), a chlorine atom (46), and

a bromine atom (50) in this position led to equally potent

derivatives, which is according to our docking studies due to a

slight shift in the binding mode toward Arg₃₃₅and Arg₂₆₈and

the associated water cluster. The docking pose of 49 is similar

to the pose of phenylpropionic acid derivative 32 and reveals

better angles and distances for polar interactions with Arg₃₃₅

and Arg₂₆₈as well as displacement of one water molecule. A

methoxy group (51) in the 4-position of the central aromatic

ring showed even more potency on FXR and a very favorable

docking pose.

Figure 5. Docking poses of compounds docked to the FXR-LBD

derived from 3OLF.³²(A) lead compound 13. (B) 31 with elongated

side chain: the distances and angles of the acidic headgroup to Arg₃₃₅

,

Arg₂₆₈, and the associated water molecules are inappropriate for polar

interactions. (C) 32 with further elongated side chain: 32 forms potent

polar interactions with Arg₃₃₅, Arg₂₆₈, and the associated water

molecules and displaces one water molecule from the cluster. (D)

Antagonistic compound 45. (E) 45 (green) in comparison with 32

(pink): 45 forms a diﬀerent docking pose than the agonistic

compounds and is shifted toward helix 7. (F) Introduction of an

additional methyl substituent in the 4-position of the aromatic ring of

the headgroup in 33 (pink) leads to a diﬀerent docking pose in which

the amide bonds are ﬂipped and beneﬁcial interactions are lost. (G)

Methyl group in the 4-position of the central aromatic ring in 49

(green) leads to a docking pose similar to 32 (pink) with displacement

of one water molecule from the cluster. (H) Additionally, in the

docking pose, an additional interaction of 49 with Met₂₉₄is present.

(I) Compound 51 displaces one water molecule from the water cluster

and forms potent interactions with Arg₃₃₅, Arg₂₆₈, and the associated

water molecule; furthermore, the lipophilic 4-tert-butylbenzoyl

substituent is deeply buried in a lipophilic pocket and the methoxy

group is placed in a lipophilic pocket next to helix 7. (J) Superimposed

docking poses of 13 (pink) and 35 (green). (K) Methyl group in 6-

position of the headgroup aromatic ring (35) also seems to displace

K

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

Na₂SO₄, and solvent was evaporated in vacuum. The crude product

was further puriﬁed by recrystallization or column chromatography on

silica.

The resulting compound 51 of this SAR study constitutes a

highly potent and selective partial FXR agonist (EC₅₀= 8

3

nM, 17.5 0.7% max) with good physicochemical properties,

acceptable solubility, high metabolic stability, and acceptable

toxicity compared to its potency. The fact that the eﬀect of 51

on FXR target genes was not concentration dependent in the

investigated range from 0.1 to 10 μM shows that 51 exhibits

true partial FXR agonism which might be of therapeutic value

for metabolic disorders because full activation of nuclear

receptors over long-term treatment has been observed to cause

negative eﬀects as well, e.g., for full FXR agonists, promoting

eﬀects on proliferation and migration of several forms of cancer

have been observed³⁵⁻⁴⁰and FXR agonism might induce

impaired cholesterol homeostasis⁴¹because the conversion of

cholesterol to bile acids and their elimination are inhibited by

FXR activation. Overactivation of the nuclear receptor might

also evoke a cholestatic condition,²and ﬁnally FXR agonism

can cause serious liver damage in cholestasis.⁴²The develop-

ment of FXR targeting drugs therefore must either ﬁnd the

right balance between beneﬁcial FXR activation and disadvanta-

geous overactivation or discover target gene selective FXR

modulators that similarly to the selective estrogen-receptor

modulators (SERMs) exhibit diﬀerential eﬀects on diﬀerent

target genes. The here reported highly potent FXR partial

agonist 51 constitutes a novel FXR targeting agent that only

moderately activates the nuclear receptor and might display one

possible way to overcome the handicaps of full FXR agonists.

b. ortho-Nitrobenzoylation with Benzoic Acid Derivatives. ortho-

Nitrobenzoic acid derivative (6a−f, 1.0 equiv) was dissolved in

CH₂Cl₂(abs, 5 mL/mmol 6a−f) and DMF (abs, 0.1 mL/mmol 6a−f).

Thionyl chloride (1.3 equiv) was added slowly at room temperature,

and the mixture was stirred 4 h under reﬂux. Solvents were evaporated

in vacuum, and the crude product (9a−f) was dried in ultravacuum.

Without further puriﬁcation the crude product (9a−f) was used for

reaction with aniline derivatives (4a−u): for this purpose aniline

derivative (4a−u, 1.3 equiv) was dissolved in CH₂Cl₂(abs, 5 mL/

mmol 6a−f) and pyridine (abs, 1 mL/mmol 6a−f), and the crude

ortho-nitrobenzoyl chloride derivative (9a−f) in CH₂Cl₂(abs, 5 mL/

mmol 6a−f) was added dropwise. The mixture was stirred at room

temperature until TLC indicated consumption of starting material (4−

12 h). The reaction mixture was then poured into an equal volume

10% hydrochloric acid, phases were separated, and the aqueous phase

was extracted three times with ethyl acetate. Combined organic layers

were dried over Na₂SO₄, and solvent was evaporated in vacuum.

Further puriﬁcation was performed by recrystallization or column

chromatography on silica.

c. Reduction of ortho-Nitrobenzoylaniline Derivatives. ortho-

Nitrobenzoylaniline derivative (10a−e, 1.0 equiv) was dissolved in

THF (abs, 10 mL/mmol), tin (3.5 equiv) was added, and the mixture

was heated to 50 °C. Hydrochloric acid (36%, 7 equiv) was added

slowly, and the mixture was stirred under reﬂux for 60 min, then

ﬁltered, diluted with an equal volume ethyl acetate, and washed twice

with water. The combined aqueous layers were extracted three times

with ethyl acetate, and the combined organic layers were dried over

Na₂SO₄and solvent was evaporated in vacuum. Further puriﬁcation

was performed by recrystallization or column chromatography on

silica.

d. Acylation of Anthranilic Acid Derivatives. Anthranilic acid

derivative (7a−z, 10a−e, 1.0 equiv) was dissolved in THF (3 mL/

mmol 7a−z, 10a−e), and pyridine (3.0 equiv) was added. After a clear

solution had formed, the respective acyl chloride (8a−j, 1.3 equiv) was

added in THF (2 mL/mmol 7a−z, 10a−e). The reaction mixture was

kept at room temperature for 4−8 h, and the reaction progress was

monitored by TLC. When anthranilic acid derivative (7a−z, 10a−e)

was consumed, the reaction mixture was diluted with ethyl acetate and

washed three times with 10% hydrochloric acid, and dried over

Na₂SO₄. Further puriﬁcation was performed by column chromatog-

raphy on silica and recrystallization.

e. Alkaline Ester Hydrolysis. The respective ester was dissolved in

THF (9 mL/mmol), and aqueous LiOH solution (10%, 1 mL/mmol)

was added slowly. The mixture was then stirred at room temperature

or at 40 °C until TLC indicated complete conversion of the starting

material (12−24 h). The mixture was then poured into 10% aqueous

hydrochloric acid, an equal volume of ethyl acetate was added, and

phases were separated. The aqueous layer was extracted three times

with ethyl acetate, the combined organic layers were dried over

Na₂SO₄, and solvent was evaporated in vacuum. Further puriﬁcation

was performed by recrystallization or column chromatography on

silica.

EXPERIMENTAL SECTION

■

General. All chemicals and solvents were of reagent grade and used

1

without further puriﬁcation unless otherwise speciﬁed. H NMR and

¹³C NMR spectra were measured in DMSO-d₆on a Bruker AV 500,

Bruker AV 400, Bruker AV 300, or Bruker am250xp spectrometer.

Chemical shifts are reported in parts per million (ppm), with

tetramethylsilane (TMS) as an internal standard. Mass spectra were

obtained on a Fisons Instruments VG Plattform II measuring in the

positive- or negative-ion mode (ESI−MS system). The purity of the

ﬁnal compounds was determined by combustion analysis, which was

performed by the Microanalytical Laboratory of the Institute of

Organic Chemistry and Chemical Biology, Goethe University

Frankfurt, on an Elementar Vario Micro Cube. All tested compounds

described here have a purity ≥95%. Intermediates were not analyzed.

Synthesis. General Procedures. a. ortho-Aminobenzoylation

with Isatoic Anhydride Derivatives. Isatoic anhydride derivative (5a−

f, 1.0 equiv) and 4-N,N-dimethylaminopyridine (0.1 equiv) were

dissolved in a mixture of pyridine (2 mL/mmol 5a−f) and DMF (0.5

mL/mmol 4a,b) and heated to 80 °C. After a clear brown solution had

formed, the respective aniline derivative (4a−u, 1.1 equiv) was added

in one portion. With addition of NEt₃(0.5 mL/mmol 5a−f), the

formation of carbon dioxide started. The reaction mixture was kept at

80 °C for 16 h. Then the solvents were evaporated in vacuum and the

crude product dissolved in ethyl acetate. The organic phase was

washed twice with 10% hydrochloric acid and brine and dried over

Na₂SO₄. Further puriﬁcation was performed by recrystallization or

column chromatography on silica.

Aniline derivative (4a−u, 1.0 equiv) was dissolved in EtOH (abs, 5

mL/mmol 4a−u) and heated to reﬂux. When the mixture had cleared

and reached at least 80 °C, isatoic anhydride derivative (5a−f, 2.0

equiv) was added in one portion with the immediate formation of

carbon dioxide. The reaction mixture was stirred under reﬂux for 60

min. After cooling to room temperature, volume was reduced in

vacuum until crystallization of the product initiated and the crude

product was ﬁltered oﬀ. When no crystallization was possible, the

crude product was partitioned between ethyl acetate and 10%

hydrochloric acid, the aqueous layer was extracted with additional

ethyl acetate three times, the combined organic layers were dried over

Test Compounds. 3-(2-(4-(tert-Butyl)benzamido)benzamido)-

benzoic Acid (13). Preparation according to general procedure d

using 7a and tert-butylbenzoyl chloride (8a). After column

chromatography on silica with hexane/ethyl acetate/acetic acid

(89:9:2) as mobile phase, the product was recrystallized from

hexane/ethyl acetate to give 13 as white solid in 77% yield. R_f

1

(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.58. H NMR (500

MHz, DMSO) δ = 13.03 (s, 1H), 11.55 (s, 1H), 10.70 (s, 1H), 8.32 (t,

J = 1.8 Hz, 1H), 8.00−7.96 (m, 1H), 7.95 (dd, J = 7.9, 1.2 Hz, 1H),

7.87−7.84 (m, 1H), 7.78 (d, J = 8.5 Hz, 1H), 7.74−7.71 (m, 1H), 7.59

(d, J = 8.5 Hz, 2H), 7.51 (t, J = 7.9 Hz, 1H), 7.48−7.45 (m, 1H),

7.32−7.28 (m, 2H), 1.31 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ =

168.08, 167.58, 165.08, 155.48, 139.26, 132.83, 132.23, 131.72, 129.56,

129.43, 127.39, 126.21, 126.04, 125.69, 125.47, 123.69, 123.20, 122.32,

121.79, 35.22, 31.34. C₂₅H₂₄N₂O₄. MS (ESI−): m/z 415.9 ([M − HM

L

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

− H]⁻, 100). Combustion analysis measured (calculated): C 72.17

(72.10); H 6.21 (5.81); N 6.64 (6.73).

chloride (8e). After column chromatography on silica with hexane/

ethyl acetate/acetic acid (89:9:2) as mobile phase, the product was

recrystallized from hexane/ethyl acetate to give 18 as white solid in

3-((2-((4-(tert-Butyl)phenyl)carbamoyl)phenyl)carbamoyl)-

benzoic Acid (14). Preparation according to general procedure e using

14a. After column chromatography on silica with hexane/ethyl

acetate/acetic acid (89:9:2) as mobile phase, the product was

recrystallized from hexane/ethyl acetate to give 14 as white solid in

1

41% yield. R_f(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.34. H

NMR (500 MHz, DMSO) δ = 13.04 (s, 1H), 11.44 (s, 1H), 10.69 (s,

1H), 8.42 (d, J = 7.7 Hz, 1H), 8.32 (s, 1H), 7.97 (dd, J = 8.1, 1.0 Hz,

1H), 7.95−7.91 (m, 1H), 7.72 (d, J = 7.8 Hz, 1H), 7.64−7.59 (m,

1H), 7.51 (t, J = 7.9 Hz, 1H), 7.44−7.39 (m, 2H), 7.31−7.26 (m, 1H),

7.03 (d, J = 8.4 Hz, 1H), 4.31 (dd, J = 10.7, 5.1 Hz, 4H). ¹³C NMR

(126 MHz, DMSO) δ = 168.07, 167.57, 164.32, 147.24, 143.73,

139.27, 139.18, 132.78, 131.73, 129.55, 129.43, 127.87, 125.66, 125.45,

123.63, 123.27, 122.29, 121.85, 120.94, 117.85, 116.59, 64.86, 64.48.

C₂₃H₁₈N₂O₆. MS (ESI+): m/z 419.37 ([M + H]⁺, 16), 441.37 ([M +

Na]⁺, 100). Combustion analysis measured (calculated): C 65.57

(66.03); H 4.62 (4.34); N 6.93 (6.70).

1

89% yield. R_f(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.60. H

NMR (500 MHz, DMSO) δ = 13.32 (s, 1H), 11.81 (s, 1H), 10.50 (s,

1H), 8.52 (s, 1H), 8.42 (d, J = 8.1 Hz, 1H), 8.15 (dd, J = 14.2, 7.8 Hz,

2H), 7.92 (d, J = 7.6 Hz, 1H), 7.72 (t, J = 7.7 Hz, 1H), 7.63 (t, J = 7.2

Hz, 3H), 7.38 (d, J = 8.6 Hz, 2H), 7.32 (t, J = 7.5 Hz, 1H), 1.28 (s,

9H). ¹³C NMR (126 MHz, DMSO) δ = 167.64, 167.10, 164.32,

147.11, 138.76, 136.37, 135.32, 133.02, 132.58, 131.93, 131.55, 129.87,

129.36, 128.55, 125.75, 124.05, 123.98, 122.10, 121.33, 34.58, 31.65.

C₂₅H₂₄N₂O₄. MS (ESI−): m/z 415.26 ([M − H]⁻, 100), 451.24 ([M

+ Cl]⁻, 46). Combustion analysis measured (calculated): C 72.01

(72.10); H 6.18 (5.81); N 6.72 (6.73).

3-(2-(3-Fluoro-4-(triﬂuoromethyl)benzamido)benzamido)-

benzoic Acid (19). Preparation according to general procedure d using

7a and 3-ﬂuoro-4-(triﬂuoromethyl)benzoyl chloride (8f). After

column chromatography on silica with hexane/ethyl acetate/acetic

acid (89:9:2) as mobile phase, the product was recrystallized from

hexane/ethyl acetate to give 19 as white solid in 73% yield. R_f

2-Methyl-5-(2-(4-(triﬂuoromethyl)benzamido)benzamido)-

benzoic Acid (15). Preparation according to general procedure d using

7a and 4-(triﬂuoromethyl)benzoyl chloride (8b). After column

chromatography on silica with hexane/ethyl acetate/acetic acid

(89:9:2) as mobile phase, the product was recrystallized from

hexane/ethyl acetate to give 15 as white solid in 78% yield. R_f

1

(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.53. H NMR (500

MHz, DMSO) δ = 13.01 (s, 1H), 11.46 (s, 1H), 10.69 (s, 1H), 8.34 (s,

1H), 8.21 (d, J = 8.2 Hz, 1H), 8.03 (t, J = 7.7 Hz, 1H), 7.95 (d, J =

10.2 Hz, 2H), 7.91 (d, J = 8.0 Hz, 2H), 7.70 (d, J = 7.6 Hz, 1H), 7.65

(t, J = 7.8 Hz, 1H), 7.48 (t, J = 7.9 Hz, 1H), 7.37 (t, J = 7.5 Hz, 1H).

¹³C NMR (126 MHz, DMSO) δ = 167.60, 167.52, 163.00, 141.73,

139.45, 137.72, 132.49, 131.74, 129.58, 129.37, 128.78, 125.76, 125.37,

125.30, 124.86, 124.16, 124.13, 123.11, 122.04, 121.67, 116.65, 116.47.

C₂₂H₁₄F₄N₂O₄. MS (ESI+): m/z 469.38 ([M + Na]⁺, 100).

Combustion analysis measured (calculated): C 58.97 (59.20); H

3.17 (3.16); N 6.38 (6.28).

1

(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.54. H NMR (500

MHz, DMSO) δ = 13.00 (s, 1H), 11.56 (s, 1H), 10.70 (s, 1H), 8.34−

8.30 (m, 2H), 8.11 (d, J = 8.2 Hz, 2H), 7.95 (dd, J = 11.5, 8.2 Hz, 4H),

7.71 (d, J = 7.7 Hz, 1H), 7.67−7.62 (m, 1H), 7.49 (t, J = 7.9 Hz, 1H),

7.35 (dd, J = 11.1, 4.1 Hz, 1H). ¹³C NMR (126 MHz, DMSO) δ =

167.75, 167.60, 164.18, 139.36, 138.83, 138.30, 132.63, 132.28, 132.03,

131.79, 129.57, 129.38, 128.57, 126.38, 126.35, 125.50, 125.37, 124.82,

124.46, 123.23, 122.63, 122.18, 21.54. C₂₃H₁₇F₃N₂O₄. MS (ESI−): m/

z 427.8 ([M − H]⁻, 100). Combustion analysis measured (calculated):

C 61.32 (61.69); H 3.58 (3.53); N 6.48 (6.54).

3-(2-(3,5-Bis(triﬂuoromethyl)benzamido)benzamido)benzoic

Acid (20). Preparation according to general procedure d using 7a and

3,5-bis(triﬂuoromethyl)benzoyl chloride (8g). After column chroma-

tography on silica with hexane/ethyl acetate/acetic acid (89:9:2) as

mobile phase, the product was recrystallized from hexane/ethyl acetate

to give 20 as white solid in 66% yield. R_f(hexane/ethyl acetate/acetic

3-(2-(4-Bromobenzamido)benzamido)benzoic Acid (16). Prepara-

tion according to general procedure d using 7a and 4-bromobenzoyl

chloride (8c). After column chromatography on silica with hexane/

ethyl acetate/acetic acid (89:9:2) as mobile phase, the product was

recrystallized from hexane/ethyl acetate to give 16 as white solid in

1

acid (49:49:2)) = 0.57. H NMR (500 MHz, DMSO) δ = 12.95 (s,

1

1H), 11.33 (s, 1H), 10.63 (s, 1H), 8.50 (s, 2H), 8.38 (s, 2H), 7.98 (d, J

= 8.1 Hz, 1H), 7.94 (d, J = 8.0 Hz, 1H), 7.85 (d, J = 7.1 Hz, 1H),

7.68−7.65 (m, 1H), 7.65−7.62 (m, 1H), 7.44 (t, J = 7.9 Hz, 1H), 7.39

(td, J = 7.7, 0.9 Hz, 1H). ¹³C NMR (126 MHz, DMSO) δ = 167.59,

167.11, 162.91, 139.70, 137.43, 136.83, 132.07, 131.69, 131.29, 131.02,

129.53, 129.24, 128.69, 125.87, 125.38, 125.04, 124.83, 124.57, 124.22,

121.58. C₂₃H₁₄F₆N₂O₄. MS (ESI+): m/z 519.4 ([M + Na]⁺, 100).

Combustion analysis measured (calculated): C 55.55 (55.66); H 2.76

(2.84); N 5.63 (5.64).

30% yield. R_f(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.51. H

NMR (500 MHz, DMSO) δ = 11.48 (s, 1H), 10.69 (s, 1H), 8.33 (d, J

= 8.3 Hz, 1H), 8.32 (s, 1H), 7.96 (d, J = 8.1 Hz, 1H), 7.94−7.91 (m,

1H), 7.87−7.82 (m, 2H), 7.79 (d, J = 8.6 Hz, 2H), 7.71 (d, J = 7.8 Hz,

1H), 7.66−7.60 (m, 1H), 7.49 (t, J = 7.9 Hz, 1H), 7.32 (dd, J = 11.0,

4.2 Hz, 1H). ¹³C NMR (126 MHz, DMSO) δ = 168.64, 167.84,

167.58, 164.38, 139.32, 138.56, 134.12, 132.66, 132.37, 129.68, 129.55,

129.39, 126.27, 125.55, 125.39, 124.36, 124.19, 122.41, 122.21.

C₂₁H₁₅BrN₂O₄. MS (ESI+): m/z 461.29 ([M + Na]⁺, 95); 463.29

([M + Na]⁺, 100). Combustion analysis measured (calculated): C

57.21 (57.42); H 3.70 (3.44); N 6.19 (6.38).

3-(2-(2-Phenylacetamido)benzamido)benzoic Acid (21). Prepara-

tion according to general procedure d using 7a and phenylacetyl

chloride (8h). After column chromatography on silica with hexane/

ethyl acetate/acetic acid (89:9:2) as mobile phase, the product was

recrystallized from hexane/ethyl acetate to give 21 as white solid in

3-(2-(Benzo[d][1,3]dioxole-5-carboxamido)benzamido)benzoic

Acid (17). Preparation according to general procedure d using 7a and

benzo[d][1,3]dioxole-5-carbonyl chloride (8d). After column chro-

matography on silica with hexane/ethyl acetate/acetic acid (89:9:2) as

mobile phase, the product was recrystallized from hexane/ethyl acetate

to give 17 as white solid in 45% yield. R_f(hexane/ethyl acetate/acetic

1

72% yield. R_f(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.43. H

NMR (500 MHz, DMSO) δ = 13.02 (s, 1H), 10.56 (s, 1H), 10.45 (s,

1H), 8.40 (s, 1H), 8.11 (d, J = 8.3 Hz, 1H), 7.90 (t, J = 14.3 Hz, 1H),

7.77 (d, J = 7.7 Hz, 1H), 7.71 (d, J = 7.7 Hz, 1H), 7.51 (dt, J = 12.8,

7.7 Hz, 2H), 7.36−7.26 (m, 4H), 7.26−7.21 (m, 2H), 3.70 (s, 2H).

¹³C NMR (126 MHz, DMSO) δ = 169.75, 167.68, 167.30, 139.56,

137.91, 135.79, 132.07, 131.68, 129.83, 129.30, 129.09, 128.85, 127.16,

125.34, 125.18, 125.11, 123.87, 122.45, 121.77, 44.20. C₂₂H₁₈N₂O₄.

MS (ESI+): m/z 375.38 ([M + H]⁺, 20), 397.36 ([M + Na]⁺, 100).

Combustion analysis measured (calculated): C 70.50 (70.58); H 4.97

(4.85); N 7.43 (7.48).

1

acid (49:49:2)) = 0.41. H NMR (500 MHz, DMSO) δ = 13.03 (s,

1H), 11.40 (s, 1H), 10.69 (s, 1H), 8.40 (d, J = 7.6 Hz, 1H), 8.33 (t, J =

1.8 Hz, 1H), 7.97 (dd, J = 8.1, 1.1 Hz, 1H), 7.93 (dd, J = 7.9, 1.1 Hz,

1H), 7.74−7.70 (m, 1H), 7.64−7.59 (m, 1H), 7.53−7.47 (m, 2H),

7.40 (d, J = 1.7 Hz, 1H), 7.29 (td, J = 7.8, 1.0 Hz, 1H), 7.09 (d, J = 8.1

Hz, 1H), 6.14 (s, 2H). ¹³C NMR (126 MHz, DMSO) δ = 168.01,

167.58, 164.37, 150.91, 148.23, 139.31, 139.07, 132.74, 131.71, 129.54,

129.42, 128.97, 125.60, 125.42, 123.73, 123.58, 122.63, 122.22, 122.01,

108.81, 107.62, 102.45. C₂₂H₁₆N₂O₆. MS (ESI+): m/z 405.37 ([M +

H]⁺, 23), 427.37 ([M + Na]⁺, 100). Combustion analysis measured

(calculated): C 64.96 (65.35); H 4.28 (3.99); N 6.77 (6.93).

3-(2-Cinnamamidobenzamido)benzoic Acid (22). Preparation

according to general procedure d using 7a and cinnamoyl chloride

(8i). After column chromatography on silica with hexane/ethyl

acetate/acetic acid (89:9:2) as mobile phase, the product was

recrystallized from hexane/ethyl acetate to give 22 as white solid in

3-(2-(2,3-Dihydrobenzo[b][1,4]dioxine-6-carboxamido)-

benzamido)benzoic Acid (18). Preparation according to general

procedure d using 7a and 2,3-dihydrobenzo[b][1,4]dioxine-6-carbonyl

1

42% yield. R_f(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.48. H

M

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

NMR (500 MHz, DMSO) δ = 13.02 (s, 1H), 10.66 (d, J = 12.5 Hz,

1H), 10.59 (s, 1H), 8.42 (s, 1H), 8.28 (d, J = 8.2 Hz, 1H), 8.01−7.92

(m, 1H), 7.82 (dd, J = 7.7, 1.0 Hz, 1H), 7.74−7.66 (m, 3H), 7.62−

7.55 (m, 2H), 7.49 (t, J = 7.9 Hz, 1H), 7.46−7.38 (m, 3H), 7.31−7.25

(m, 1H), 6.93 (d, J = 15.7 Hz, 1H). ¹³C NMR (126 MHz, DMSO) δ =

167.64, 167.46, 164.14, 141.44, 139.61, 138.11, 135.01, 132.17, 131.70,

130.37, 129.39, 129.33, 128.54, 125.24, 125.21, 123.93, 122.75, 122.65,

121.88. C₂₃H₁₈N₂O₄. MS (ESI−): m/z 485.24 ([M − H]⁻, 100).

Combustion analysis measured (calculated): C 71.11 (71.49); H 4.75

(4.70); N 7.32 (7.25).

123.66, 123.25, 122.07, 121.74, 118.67, 118.06, 35.22, 31.35, 15.12.

C₂₅H₂₆N₂O₂S. MS (ESI+): m/z 419.46 ([M + H]⁺, 15); 441.44 ([M +

Na]⁺, 100). Combustion analysis measured (calculated): C 71.78

(71.74); H 5.96 (6.26); N 6.79 (6.69); S 7.33 (7.66).

N-(3-(1H-Tetrazol-5-yl)phenyl)-2-(4-(tert-butyl)benzamido)-

benzamide (27). 24 (199 mg, 0.5 mmol, 1.0 equiv) was dissolved in 5

mL of DMF/MeOH (9:1), and Cu₂O (3.6 mg, 5 mol %) and NaN₃

(297 mg, 3.0 mmol, 6.0 equiv) were added. The mixture was stirred at

90 °C for 24 h. After cooling to room temperature, 15 mL of 5%

aqueous hydrochloric acid and 10 mL of CH₂Cl₂were added and the

mixture was vigorously stirred for another 30 min. Phases were then

separated, and the aqueous phase was extracted with equal volumes of

ethyl acetate three times. The combined aqueous layers were dried

over Na₂SO₄, and the solvents were evaporated in vacuum. Further

puriﬁcation was performed by column chromatography on silica with

hexane/ethyl acetate/acetic acid and recrystallization from acetone/

water to obtain 27 as white solid in 20% yield. R_f(hexane/ethyl

acetate/acetic acid (49:49:2)) = 0.15. ¹H NMR (500 MHz, DMSO) δ

= 11.53 (s, 1H), 10.79 (s, 1H), 8.49 (t, J = 1.8 Hz, 1H), 8.46 (dd, J =

8.3, 0.9 Hz, 1H), 7.97 (dd, J = 7.9, 1.3 Hz, 1H), 7.93−7.89 (m, 1H),

7.88−7.84 (m, 2H), 7.79 (d, J = 7.8 Hz, 1H), 7.67−7.57 (m, 4H), 7.32

(td, J = 7.7, 1.1 Hz, 1H), 1.31 (s, 9H). ¹³C NMR (126 MHz, DMSO)

δ = 192.78, 168.15, 165.11, 155.48, 139.97, 139.17, 132.88, 132.20,

130.33, 129.59, 127.42, 126.21, 124.06, 123.75, 123.33, 123.05, 121.91,

119.88, 35.22, 31.34. C₂₅H₂₄N₆O₂. MS (ESI−): m/z 439.8 ([M −

H]⁻, 100). Combustion analysis measured (calculated): C 67.82

(68.17); H 5.57 (5.49); N 18.91 (19.08).

N-(3-Acetylphenyl)-2-(4-(tert-butyl)benzamido)benzamide (23).

Preparation according to general procedure d using 7b and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 23 as

1

white solid in 27% yield. R_f(hexane/ethyl acetate (4:1)) = 0.63. H

NMR (500 MHz, DMSO) δ = 11.59 (s, 1H), 10.72 (s, 1H), 8.48 (dd,

J = 8.3, 0.8 Hz, 1H), 8.26 (t, J = 1.8 Hz, 1H), 8.03 (dd, J = 8.1, 1.2 Hz,

1H), 7.95 (dt, J = 14.9, 7.5 Hz, 1H), 7.90−7.82 (m, 2H), 7.79−7.74

(m, 1H), 7.67−7.60 (m, 1H), 7.60−7.57 (m, 2H), 7.55 (dd, J = 10.0,

5.9 Hz, 1H), 7.30 (td, J = 7.7, 1.1 Hz, 1H), 2.59 (s, 3H), 1.31 (s, 9H).

¹³C NMR (126 MHz, DMSO) δ = 198.08, 168.12, 165.06, 155.47,

139.39, 139.25, 137.73, 132.87, 132.21, 129.59, 129.51, 127.40, 126.19,

126.10, 124.73, 123.67, 123.10, 121.79, 120.88, 35.21, 31.33, 27.25.

C₂₆H₂₆N₂O₃. MS (ESI−): m/z 413.25 ([M − H]⁻, 100). Combustion

analysis measured (calculated): C 75.16 (75.34); H 6.32 (6.32); N

6.56 (6.76).

2-(4-(tert-Butyl)benzamido)-N-(3-carbamoylphenyl)benzamide

(28). 13 (417 mg, 1.0 mmol, 1.0 equiv) was added to a mixture of silica

gel and NH₄Cl (5:1, 1.3 g). After TsCl (210 mg, 1.1 mmol, 1.1 equiv)

was added, the mixture was treated with 2.2 mL of triethylamine mixed

with a spatula for 5 min. Then the mixture was added to 30 mL of

ethyl acetate, and silica was ﬁltered oﬀ. The ﬁltrate was washed with

1% aqueous hydrochloric acid, and the aqueous layer was extracted

with additional ethyl acetate three times. The combined aqueous layers

were dried over Na₂SO₄, and the solvents were evaporated in vacuum.

Further puriﬁcation was performed by column chromatography on

silica with hexane/ethyl acetate/acetic acid and recrystallization from

acetone/water to obtain 28 as white solid in 38% yield. R_f(hexane/

ethyl acetate/acetic acid (49:49:2)) = 0.34. ¹H NMR (500 MHz,

DMSO) δ = 11.70 (s, 1H), 10.67 (s, 1H), 8.58−8.48 (m, 1H), 8.19 (t,

J = 1.7 Hz, 1H), 8.01−7.95 (m, 2H), 7.88−7.83 (m, 3H), 7.67−7.62

(m, 2H), 7.62 7.58 (m, 2H), 7.46 (t, J = 7.9 Hz, 1H), 7.40 (s, 1H),

7.30 (td, J = 7.8, 1.0 Hz, 1H), 1.31 (s, 9H). ¹³C NMR (126 MHz,

DMSO) δ = 168.19, 168.09, 165.01, 155.51, 139.42, 138.94, 135.44,

132.90, 132.21, 129.53, 128.99, 127.35, 126.26, 124.49, 123.59, 123.53,

122.69, 121.57, 121.39, 35.22, 31.34. C₂₅H₂₅N₃O₃. MS (ESI−): m/z

414.26 ([M − H]⁻, 100). Combustion analysis measured (calculated):

C 71.93 (72.27); H 6.06 (6.07); N 9.76 (10.11).

2-(4-(tert-Butyl)benzamido)-N-(3-cyanophenyl)benzamide (24).

Preparation according to general procedure d using 7c and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 24 as

white solid in 59% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.74. H NMR (500 MHz, DMSO) δ = 11.38 (s, 1H),

10.80 (s, 1H), 8.40 (dd, J = 11.6, 3.9 Hz, 1H), 8.16 (s, 1H), 8.04−7.97

(m, 1H), 7.91 (dd, J = 7.8, 1.3 Hz, 1H), 7.88−7.83 (m, 2H), 7.66−

7.62 (m, 1H), 7.62−7.58 (m, 4H), 7.32 (td, J = 7.7, 1.0 Hz, 1H), 1.32

(s, 9H). ¹³C NMR (126 MHz, DMSO) δ = 168.17, 165.15, 155.48,

140.01, 139.00, 132.93, 132.16, 130.66, 129.53, 128.09, 127.46, 126.18,

125.99, 124.11, 123.85, 123.60, 122.14, 119.17, 111.94, 35.22, 31.35.

C₂₅H₂₃N₃O₂. MS (ESI−): m/z 396.7 ([M − H]⁻, 100). HRMS

(MALDI+) measured for [M + K]⁺(calculated): 436.14240

(436.14219). HPLC purity 100% (H₂O/MeOH gradient, 25 min).

2-(4-(tert-Butyl)benzamido)-N-(3-methoxyphenyl)benzamide

(25). Preparation according to general procedure d using 7d and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 25 as

white solid in 52% yield. R_f(hexane/ethyl acetate/acetic acid (39:9:2))

= 0.35. ¹H NMR (500 MHz, DMSO) δ = 11.67 (s, 1H), 10.50 (s, 1H),

8.52 (s, 1H), 7.92 (d, J = 7.8 Hz, 1H), 7.86 (d, J = 8.3 Hz, 2H), 7.65−

7.57 (m, 3H), 7.35 (d, J = 8.4 Hz, 2H), 7.29 (t, J = 7.6 Hz, 2H), 6.76−

6.72 (m, 1H), 3.76 (s, 3H), 1.30 (d, J = 8.5 Hz, 9H). ¹³C NMR (126

MHz, DMSO) δ = 167.97, 164.97, 159.87, 155.49, 140.10, 139.28,

132.76, 132.18, 129.94, 129.46, 127.35, 126.22, 123.58, 123.03, 121.60,

113.86, 109.99, 107.56, 55.53, 35.21, 31.33. C₂₅H₂₆N₂O₃. MS (ESI−):

m/z 401.14 ([M − H]⁻, 100). Combustion analysis measured

(calculated): C 74.41 (74.60); H 6.56 (6.51); N 6.83 (6.96).

2-(4-(tert-Butyl)benzamido)-N-(3,4-dimethoxyphenyl)benzamide

(29). Preparation according to general procedure d using 7f and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 29 as

white solid in 70% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.57. H NMR (500 MHz, DMSO) δ = 11.83 (s, 1H),

10.41 (s, 1H), 8.55 (d, J = 8.3 Hz, 1H), 7.93 (d, J = 7.7 Hz, 1H), 7.86

(d, J = 8.3 Hz, 2H), 7.63−7.58 (m, 3H), 7.35−7.25 (m, 3H), 6.96 (d, J

= 8.6 Hz, 1H), 3.76 (s, 6H), 1.32 (s, 9H). ¹³C NMR (126 MHz,

DMSO) δ = 167.65, 164.92, 155.49, 148.94, 146.24, 139.38, 132.68,

132.22, 132.14, 129.28, 127.34, 126.24, 123.50, 122.72, 121.40, 114.03,

112.27, 106.96, 56.19, 55.95, 35.22, 31.34. C₂₆H₂₈N₂O₄. MS (ESI+):

m/z 455.53 ([M + Na]⁺, 100). Combustion analysis measured

(calculated): C 71.87 (72.20); H 6.46 (6.53); N 6.46 (6.48).

2-(4-(tert-Butyl)benzamido)-N-(3,4,5-trimethoxyphenyl)-

benzamide (30). Preparation according to general procedure d using

7g and tert-butylbenzoyl chloride (8a). After column chromatography

on silica with hexane/ethyl acetate/acetic acid (89:9:2) as mobile

phase, the product was recrystallized from hexane/ethyl acetate to give

30 as white solid in 74% yield. R_f(hexane/ethyl acetate/acetic acid

2-(4-(tert-Butyl)benzamido)-N-(3-(methylthio)phenyl)benzamide

(26). Preparation according to general procedure d using 7e and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 26 as

white solid in 58% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.79. H NMR (500 MHz, DMSO) δ = 11.58 (s, 1H),

10.53 (s, 1H), 8.48 (d, J = 8.2 Hz, 1H), 7.94−7.89 (m, 1H), 7.86 (t, J

= 7.6 Hz, 2H), 7.66−7.58 (m, 4H), 7.55 (d, J = 8.1 Hz, 1H), 7.34−

7.27 (m, 2H), 7.05 (dd, J = 7.9, 0.9 Hz, 1H), 2.48 (s, 3H), 1.31 (s,

9H). ¹³C NMR (126 MHz, DMSO) δ = 167.98, 165.02, 155.49,

139.52, 139.18, 138.97, 132.78, 132.20, 129.66, 129.47, 127.39, 126.22,

N

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

1

(49:49:2)) = 0.54. H NMR (500 MHz, DMSO) δ = 11.59 (s, 1H),

DMSO) δ = 169.48, 168.48, 164.92, 155.51, 140.16, 137.30, 135.52,

133.27, 133.21, 132.17, 132.12, 131.11, 129.34, 128.58, 127.25, 126.29,

123.45, 121.08, 120.86, 35.20, 31.31, 15.74. C₂₆H₂₆N₂O₄. MS (ESI−):

m/z 429.8 ([M − H]⁻, 100). Combustion analysis measured

(calculated): C 72.10 (72.54); H 6.06 (6.09); N 6.17 (6.51).

10.43 (s, 1H), 8.47 (d, J = 8.3 Hz, 1H), 7.88 (dd, J = 12.9, 8.2 Hz, 3H),

7.64−7.56 (m, 3H), 7.29 (t, J = 7.4 Hz, 1H), 7.09 (s, 2H), 3.77 (s,

6H), 3.65 (s, 3H), 1.32 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ =

167.74, 165.02, 155.49, 153.10, 139.06, 134.91, 134.79, 132.66, 132.17,

129.36, 127.43, 126.20, 123.67, 123.48, 121.80, 99.73, 60.60, 56.32,

35.22, 31.35. C₂₇H₃₀N₂O₅. MS (ESI+): m/z 463.52 ([M + H]⁺, 51);

485.51 ([M + Na]⁺, 51). Combustion analysis measured (calculated):

C 69.85 (70.11); H 6.47 (6.54); N 6.21 (6.06).

5-(2-(4-(tert-Butyl)benzamido)benzamido)-2-methylbenzoic Acid

(35). Preparation according to general procedure d using 7l and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 35 as

white solid in 66% yield. R_f(hexane/ethyl acetate/acetic acid

2-(3-(2-(4-(tert-Butyl)benzamido)benzamido)phenyl)acetic Acid

(31). Preparation according to general procedure d using 7h and

tert-butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 31 as

white solid in 72% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.58. H NMR (500 MHz, DMSO) δ = 12.91 (s, 1H),

11.65 (s, 1H), 10.61 (s, 1H), 8.50 (d, J = 8.3 Hz, 1H), 8.17 (d, J = 1.9

Hz, 1H), 7.94 (d, J = 7.8 Hz, 1H), 7.88−7.80 (m, 3H), 7.61 (dd, J =

17.6, 8.1 Hz, 3H), 7.29 (dd, J = 14.6, 7.8 Hz, 2H), 1.32 (s, 9H). ¹³C

NMR (126 MHz, DMSO) δ = 168.87, 167.96, 165.03, 155.48, 139.29,

136.73, 135.30, 132.80, 132.25, 130.94, 129.48, 127.37, 126.23, 124.89,

123.61, 123.44, 122.93, 121.63, 40.57, 40.48, 40.41, 40.32, 40.24,

40.15, 40.07, 39.98, 39.91, 39.81, 39.65, 39.48, 35.22, 31.35, 21.27.

C₂₆H₂₆N₂O₄. MS (ESI+): m/z 431.46 ([M + H]⁺, 16); 453.45 ([M +

Na]⁺, 100). Combustion analysis measured (calculated): C 72.19

(72.54); H 6.08 (6.09); N 6.43 (6.51).

1

(49:49:2)) = 0.48. H NMR (500 MHz, DMSO) δ = 12.37 (s, 1H),

11.68 (s, 1H), 10.55 (s, 1H), 8.52 (d, J = 8.3 Hz, 1H), 7.94 (d, J = 7.8

Hz, 1H), 7.85 (d, J = 8.4 Hz, 2H), 7.66−7.62 (m, 2H), 7.60 (d, J = 8.2

Hz, 3H), 7.33 (t, J = 7.8 Hz, 1H), 7.29 (t, J = 7.6 Hz, 1H), 7.06 (d, J =

7.6 Hz, 1H), 3.58 (s, 2H), 1.32 (s, 9H). ¹³C NMR (126 MHz, DMSO)

δ = 173.06, 167.96, 165.00, 155.48, 139.33, 138.87, 135.98, 132.77,

132.22, 129.52, 127.37, 126.24, 125.92, 123.57, 122.92, 122.54, 121.54,

120.13, 67.49, 41.28, 35.22, 31.35. C₂₆H₂₆N₂O₄. MS (ESI−): m/z

429.17 ([M − H]⁻, 100). Combustion analysis measured (calculated):

C 72.35 (72.54); H 6.27 (6.09); N 6.19 (6.51).

3-(2-(4-(tert-Butyl)benzamido)benzamido)-4-methoxybenzoic

Acid (36). Preparation according to general procedure d using 7m and

tert-butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 36 as

white solid in 38% yield. R_f(hexane/ethyl acetate/acetic acid

3-(3-(2-(4-(tert-Butyl)benzamido)benzamido)phenyl)propanoic

Acid (32). Preparation according to general procedure d using 7i and

tert-butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 32 as

white solid in 72% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.54. H NMR (500 MHz, DMSO) δ = 11.83 (s, 1H),

9.93 (s, 1H), 8.49 (d, J = 8.3 Hz, 1H), 8.22 (t, J = 5.4 Hz, 1H), 8.01 (d,

J = 7.7 Hz, 1H), 7.87−7.83 (m, 3H), 7.64 (t, J = 7.5 Hz, 1H), 7.58 (d,

J = 8.4 Hz, 2H), 7.29 (t, J = 7.6 Hz, 1H), 7.20 (d, J = 8.7 Hz, 1H), 3.83

(s, 3H), 1.30 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ = 167.87,

167.29, 165.16, 156.35, 155.52, 139.36, 133.01, 132.11, 129.44, 128.98,

127.37, 127.09, 126.36, 126.22, 123.87, 123.20, 122.48, 121.89, 111.81,

56.52, 35.21, 31.33. C₂₆H₂₆N₂O₅. MS (ESI−): m/z 445.24 ([M −

H]⁻, 100). Combustion analysis measured (calculated): C 69.54

(69.94); H 5.92 (5.87); N 6.01 (6.27).

1

(49:49:2)) = 0.55. H NMR (500 MHz, DMSO) δ = 12.16 (s, 1H),

11.69 (s, 1H), 10.50 (s, 1H), 8.51 (d, J = 8.3 Hz, 1H), 7.96−7.91 (m,

1H), 7.85 (d, J = 8.4 Hz, 2H), 7.64−7.57 (m, 3H), 7.52 (s, 1H), 7.29

(ddd, J = 8.3, 3.1, 1.7 Hz, 2H), 7.03 (d, J = 7.6 Hz, 1H), 2.83 (t, J = 7.6

Hz, 2H), 2.55 (t, J = 7.6 Hz, 2H), 1.31 (s, 9H). ¹³C NMR (126 MHz,

DMSO) δ = 174.14, 167.92, 164.99, 155.49, 141.85, 139.31, 138.87,

132.75, 132.20, 129.47, 129.08, 127.36, 126.24, 124.74, 123.58, 122.97,

121.55, 121.54, 119.56, 35.55, 35.22, 31.34, 30.83. C₂₇H₂₈N₂O₄. MS

(ESI+): m/z 467.52 ([M + Na]⁺, 100). Combustion analysis measured

(calculated): C 73.32 (72.95); H 6.50 (6.35); N 5.88 (6.30).

3-(2-(4-(tert-Butyl)benzamido)benzamido)-4-ﬂuorobenzoic Acid

(37). Preparation according to general procedure d using 7n and

tert-butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 37 as

white solid in 51% yield. R_f(hexane/ethyl acetate/acetic acid

3-(2-(4-(tert-Butyl)benzamido)benzamido)-4-methylbenzoic Acid

(33). Preparation according to general procedure d using 7j and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 33 as

white solid in 64% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.59. H NMR (500 MHz, DMSO) δ = 13.18 (s, 1H),

11.81 (s, 1H), 10.58 (s, 1H), 8.56 (d, J = 8.2 Hz, 1H), 8.15 (dd, J =

7.3, 2.0 Hz, 1H), 8.01 (t, J = 10.3 Hz, 1H), 7.90 (ddd, J = 8.4, 4.6, 2.1

Hz, 1H), 7.83 (d, J = 8.5 Hz, 2H), 7.68−7.63 (m, 1H), 7.58 (d, J = 8.4

Hz, 2H), 7.49−7.43 (m, 1H), 7.30 (dd, J = 11.2, 4.0 Hz, 1H), 1.30 (s,

9H). ¹³C NMR (126 MHz, DMSO) δ = 168.29, 166.60, 165.08,

155.51, 139.78, 133.34, 132.17, 129.65, 129.38, 129.31, 129.13, 127.77,

127.33, 126.24, 125.87, 125.77, 123.62, 121.48, 121.33, 116.99, 116.82,

35.20, 31.32. C₂₅H₂₃FN₂O₄. MS (ESI+): m/z 435.44 ([M + H]⁺, 13);

457.45 ([M + Na]⁺, 100). Combustion analysis measured (calculated):

C 68.92 (69.11); H 5.24 (5.34); N 6.49 (6.45).

1

(49:49:2)) = 0.58. H NMR (500 MHz, DMSO) δ = 12.96 (s, 1H),

12.03 (s, 1H), 10.38 (s, 1H), 8.61 (d, J = 8.3 Hz, 1H), 8.07 (d, J = 7.7

Hz, 1H), 7.91 (d, J = 1.2 Hz, 1H), 7.83 (d, J = 8.5 Hz, 2H), 7.79 (dd, J

= 7.9, 1.5 Hz, 1H), 7.65 (t, J = 7.8 Hz, 1H), 7.58 (d, J = 8.5 Hz, 2H),

7.44 (d, J = 8.0 Hz, 1H), 7.30 (t, J = 7.6 Hz, 1H), 2.32 (s, 3H), 1.29 (s,

9H). ¹³C NMR (126 MHz, DMSO) δ = 168.35, 167.38, 164.96,

155.48, 140.12, 139.94, 136.47, 133.11, 132.19, 131.23, 129.47, 129.41,

128.35, 127.77, 127.30, 126.25, 123.53, 121.44, 121.26, 40.57, 40.48,

40.41, 40.32, 40.24, 40.15, 40.07, 39.98, 39.91, 39.81, 39.65, 39.48,

35.20, 31.32, 31.17, 18.56. C₂₆H₂₆N₂O₄. MS (ESI−): m/z 429.9 ([M

− H]⁻, 100). Combustion analysis measured (calculated): C 72.21

(72.54); H 6.12 (6.09); N 6.41 (6.51).

3-(2-(4-(tert-Butyl)benzamido)benzamido)-4-chlorobenzoic Acid

(38). Preparation according to general procedure d using 7o and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 38 as

white solid in 35% yield. R_f(hexane/ethyl acetate/acetic acid

3-(2-(4-(tert-Butyl)benzamido)benzamido)-2-methylbenzoic Acid

(34). Preparation according to general procedure d using 7k and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 34 as

white solid in 71% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.61. H NMR (500 MHz, DMSO) δ = 13.33 (s, 1H),

11.87 (s, 1H), 10.56 (s, 1H), 8.57 (d, J = 8.3 Hz, 1H), 8.12 (d, J = 1.8

Hz, 1H), 8.06 (d, J = 7.6 Hz, 1H), 7.88 (dd, J = 8.4, 1.8 Hz, 1H), 7.84

(d, J = 8.3 Hz, 2H), 7.73 (d, J = 8.4 Hz, 1H), 7.66 (t, J = 7.6 Hz, 1H),

7.58 (d, J = 8.3 Hz, 2H), 7.31 (t, J = 7.6 Hz, 1H), 1.30 (s, 9H). ¹³C

NMR (126 MHz, DMSO) δ = 168.37, 166.65, 165.06, 155.51, 139.85,

135.32, 135.26, 133.35, 132.15, 130.86, 130.56, 129.94, 129.46, 129.04,

127.35, 126.24, 123.66, 121.49, 121.33, 35.21, 31.32. C₂₅H₂₃ClN₂O₄.

1

(49:49:2)) = 0.57. H NMR (500 MHz, DMSO) δ = 12.17 (s, 1H),

10.43 (s, 1H), 8.66 (d, J = 8.3 Hz, 1H), 8.09 (d, J = 7.7 Hz, 1H), 7.83

(d, J = 8.5 Hz, 2H), 7.74−7.69 (m, 1H), 7.68−7.62 (m, 1H), 7.58 (d, J

= 8.5 Hz, 2H), 7.49 (d, J = 7.2 Hz, 1H), 7.35 (t, J = 7.8 Hz, 1H),

7.32−7.27 (m, 1H), 2.39 (s, 3H), 1.29 (s, 9H). ¹³C NMR (126 MHz,

O

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

MS (ESI+): m/z 474.44 ([M + H]⁺, 100). Combustion analysis

measured (calculated): C 66.38 (66.59); H 5.17 (5.14); N 6.14 (6.21).

5-(2-(4-(tert-Butyl)benzamido)benzamido)-2-methoxybenzoic

Acid (39). Preparation according to general procedure d using 7p and

tert-butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 39 as

white solid in 60% yield. R_f(hexane/ethyl acetate/acetic acid

product was recrystallized from hexane/ethyl acetate to give 43 as

white solid in 68% yield. R_f(hexane/ethyl acetate/acetic acid

(49:49:2)) = 0.47. H NMR (500 MHz, DMSO) δ = 12.96 (s, 1H),

1

10.50 (s, 1H), 10.11 (s, 1H), 8.32 (s, 1H), 7.87 (t, J = 7.7 Hz, 3H),

7.75 (d, J = 8.0 Hz, 1H), 7.64 (t, J = 7.2 Hz, 2H), 7.49 (dd, J = 15.4,

8.0 Hz, 3H), 7.42 (t, J = 7.9 Hz, 1H), 1.30 (s, 9H). ¹³C NMR (126

MHz, DMSO) δ = 167.60, 166.01, 165.55, 155.13, 139.86, 137.43,

133.59, 132.99, 131.72, 131.69, 131.52, 129.36, 128.42, 128.05, 127.73,

125.67, 124.86, 124.32, 121.01, 35.15, 31.37. C₂₅H₂₃ClN₂O₄. MS

(ESI−): m/z 449.08 ([M − H]⁻, 100). Combustion analysis measured

(calculated): C 66.42 (66.59); H 5.10 (5.14); N 6.17 (6.21).

1

(49:49:2)) = 0.40. H NMR (500 MHz, DMSO) δ = 11.76 (s, 1H),

10.53 (s, 1H), 8.53 (d, J = 7.7 Hz, 1H), 7.97 (d, J = 2.6 Hz, 1H), 7.94

(dd, J = 7.9, 1.2 Hz, 1H), 7.87−7.82 (m, 3H), 7.64−7.58 (m, 3H),

7.28 (td, J = 7.8, 1.1 Hz, 1H), 7.15 (d, J = 9.1 Hz, 1H), 3.82 (s, 3H),

1.32 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ = 167.78, 167.50,

164.99, 155.49, 155.36, 139.40, 132.78, 132.25, 131.34, 129.37, 127.34,

126.56, 126.25, 124.37, 123.55, 122.60, 121.47, 113.25, 56.48, 35.23,

31.35. C₂₆H₂₆N₂O₅. MS (ESI−): m/z 445.9 ([M − H]⁻, 100).

Combustion analysis measured (calculated): C 69.77 (69.94); H 5.93

(5.87); N 5.93 (6.27).

3-(2-(4-(tert-Butyl)benzamido)-3-chlorobenzamido)benzoic Acid

(44). Preparation according to general procedure e using 44a. After

column chromatography on silica with hexane/ethyl acetate/acetic

acid (89:9:2) as mobile phase, the product was recrystallized from

hexane/ethyl acetate to give 44 as white solid in 86% yield. R_f

1

(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.46. H NMR (500

MHz, DMSO) δ = 12.95 (s, 1H), 10.50 (s, 1H), 10.11 (s, 1H), 8.32 (s,

1H), 7.90−7.84 (m, 3H), 7.75 (dd, J = 8.1, 1.2 Hz, 1H), 7.67−7.61

(m, 2H), 7.52−7.46 (m, 3H), 7.42 (t, J = 7.9 Hz, 1H), 1.30 (s, 9H).

¹³C NMR (126 MHz, DMSO) δ = 167.59, 166.01, 165.55, 155.13,

139.85, 137.43, 133.58, 132.98, 131.72, 131.69, 131.52, 129.36, 128.41,

128.05, 127.72, 125.67, 124.85, 124.32, 121.01, 35.15, 31.37.

C₂₅H₂₃ClN₂O₄. MS (ESI−): m/z 449.7 ([M − H]⁻, 100).

Combustion analysis measured (calculated): C 66.48 (66.59); H

5.11 (5.14); N 6.12 (6.21).

5-(2-(4-(tert-Butyl)benzamido)benzamido)-2-chlorobenzoic Acid

(40). Preparation according to general procedure d using 7q and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 40 as

white solid in 63% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.50. H NMR (500 MHz, DMSO) δ = 11.42 (s, 1H),

10.74 (s, 1H), 8.41 (d, J = 7.9 Hz, 1H), 8.17 (d, J = 2.6 Hz, 1H), 7.91

(dd, J = 8.7, 2.3 Hz, 2H), 7.85 (d, J = 8.5 Hz, 2H), 7.65−7.61 (m, 1H),

7.59 (d, J = 8.5 Hz, 2H), 7.55 (d, J = 8.7 Hz, 1H), 7.33−7.27 (m, 1H),

1.32 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ = 172.49, 168.03,

166.91, 165.13, 155.46, 139.02, 138.08, 132.85, 131.77, 131.44, 129.52,

127.44, 126.79, 126.17, 125.07, 123.77, 123.52, 123.37, 122.03, 35.22,

31.35. C₂₅H₂₃ClN₂O₄. MS (ESI−): m/z 449.9 ([M − H]⁻, 100).

Combustion analysis measured (calculated): C 66.53 (66.59); H 5.19

(5.14); N 6.23 (6.21).

3-(2-(4-(tert-Butyl)benzamido)-5-chlorobenzamido)benzoic Acid

(45). Preparation according to general procedure d using 7u and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 45 as

pale-yellow solid in 44% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.65. H NMR (500 MHz, DMSO) δ = 11.45 (s, 1H),

10.76 (s, 1H), 8.45 (d, J = 8.9 Hz, 1H), 8.30 (s, 1H), 8.01 (d, J = 2.4

Hz, 1H), 7.99−7.96 (m, 1H), 7.84 (d, J = 8.5 Hz, 2H), 7.73 (d, J = 7.8

Hz, 1H), 7.70 (dd, J = 8.9, 2.5 Hz, 1H), 7.59 (d, J = 8.5 Hz, 2H), 7.51

(t, J = 7.9 Hz, 1H), 1.31 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ =

167.55, 166.61, 165.16, 155.63, 139.08, 137.98, 132.39, 131.96, 131.77,

129.45, 129.15, 127.52, 127.47, 126.22, 125.64, 125.60, 125.12, 123.66,

122.33, 35.24, 31.33. C₂₅H₂₃ClN₂O₄. MS (ESI−): m/z 449.8 ([M −

H]⁻, 100). Combustion analysis measured (calculated): C 66.25

(66.59); H 4.96 (5.14); N 6.12 (6.21).

2-Bromo-5-(2-(4-(tert-butyl)benzamido)benzamido)benzoic Acid

(41). Preparation according to general procedure d using 7r and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 41 as

white solid in 54% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.48. H NMR (500 MHz, DMSO) δ = 11.40 (s, 1H),

10.73 (s, 1H), 8.41 (t, J = 7.3 Hz, 1H), 8.13 (d, J = 2.6 Hz, 1H), 7.91

(d, J = 7.7 Hz, 1H), 7.83 (dd, J = 13.6, 5.5 Hz, 3H), 7.71 (d, J = 8.7

Hz, 1H), 7.63 (t, J = 7.8 Hz, 1H), 7.59 (d, J = 8.4 Hz, 2H), 7.30 (t, J =

7.4 Hz, 1H), 1.32 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ = 168.03,

167.52, 165.14, 155.47, 139.00, 138.62, 134.58, 134.09, 132.85, 132.21,

129.52, 127.44, 126.17, 125.03, 123.79, 123.58, 123.21, 122.06, 114.61,

35.22, 31.35. C₂₅H₂₃BrN₂O₄. MS (ESI−): m/z 494.0 ([M − H]⁻, 99),

495.9 ([M − H]⁻, 100). Combustion analysis measured (calculated):

C 60.93 (60.62); H 5.11 (4.68); N 5.60 (5.66).

3-(2-(4-(tert-Butyl)benzamido)-4-chlorobenzamido)benzoic Acid

(46). Preparation according to general procedure d using 7v and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 46 as

white solid in 61% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.63. H NMR (500 MHz, DMSO) δ = 13.05 (s, 1H),

11.82−11.68 (m, 1H), 10.76 (s, 1H), 8.63 (d, J = 2.1 Hz, 1H), 8.32 (d,

J = 16.3 Hz, 1H), 8.03−7.96 (m, 2H), 7.85 (d, J = 8.4 Hz, 2H), 7.74

(d, J = 7.8 Hz, 1H), 7.61 (d, J = 8.5 Hz, 2H), 7.52 (t, J = 7.9 Hz, 1H),

7.43−7.36 (m, 1H), 1.31 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ =

167.54, 167.28, 165.31, 155.82, 140.69, 139.04, 137.28, 131.81, 131.75,

131.33, 129.47, 127.46, 126.31, 125.82, 125.64, 123.32, 122.45, 121.28,

120.88, 35.26, 31.32. C₂₅H₂₃ClN₂O₄. MS (ESI−): m/z 449.8 ([M −

H]⁻, 100). Combustion analysis measured (calculated): C 66.68

(66.59); H 5.05 (5.14); N 6.08 (6.21).

5-(2-(4-(tert-Butyl)benzamido)benzamido)-2-nitrobenzoic Acid

(42). Preparation according to general procedure d using 7s and

tert-butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 42 as

yellow solid in 31% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.51. H NMR (500 MHz, DMSO) δ = 12.23 (s, 1H),

10.58 (s, 1H), 8.44 (d, J = 2.6 Hz, 1H), 8.25 (t, J = 1.8 Hz, 1H), 7.97

(t, J = 8.5 Hz, 1H), 7.94−7.91 (m, 1H), 7.86 (d, J = 8.5 Hz, 2H),

7.75−7.71 (m, 1H), 7.61 (d, J = 8.5 Hz, 2H), 7.55 (t, J = 7.9 Hz, 1H),

6.98 (dd, J = 8.9, 2.6 Hz, 1H), 1.32 (s, 9H). ¹³C NMR (126 MHz,

DMSO) δ = 174.03, 168.09, 167.60, 165.19, 162.65, 153.22, 142.08,

138.89, 134.14, 131.45, 129.87, 127.64, 126.67, 124.82, 125.61, 122.34,

113.12, 109.34, 106.03, 35.23, 31.33. C₂₅H₂₃N₃O₆. MS (ESI−): m/z

460.9 ([M − H]⁻, 100). Combustion analysis measured (calculated):

C 64.78 (65.07); H 4.97 (5.02); N 9.06 (9.11).

3-(2-(4-(tert-Butyl)benzamido)-6-chlorobenzamido)benzoic Acid

(43). Preparation according to general procedure d using 7t and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

3-(2-(4-(tert-Butyl)benzamido)-5-methoxybenzamido)benzoic

Acid (47). Preparation according to general procedure e using 47a.

After column chromatography on silica with hexane/ethyl acetate/

acetic acid (89:9:2) as mobile phase, the product was recrystallized

from hexane/ethyl acetate to give 47 as white solid in 85% yield. R_f

1

(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.54. H NMR (500

MHz, DMSO) δ = 13.04 (s, 1H), 11.13 (s, 1H), 10.64 (s, 1H), 8.31

(d, J = 1.7 Hz, 1H), 8.26 (d, J = 9.0 Hz, 1H), 8.00−7.94 (m, 1H), 7.83

(d, J = 8.5 Hz, 2H), 7.71 (d, J = 7.8 Hz, 1H), 7.57 (d, J = 8.5 Hz, 2H),

7.50 (t, J = 7.9 Hz, 1H), 7.45 (d, J = 2.9 Hz, 1H), 7.22 (dd, J = 9.0, 2.9

Hz, 1H), 3.87 (s, 3H), 1.31 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ

= 167.57, 167.53, 164.88, 155.38, 155.21, 139.27, 132.32, 131.90,

P

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

131.68, 129.42, 127.34, 126.09, 125.61, 125.58, 125.42, 124.06, 122.24,

118.05, 114.42, 56.07, 35.18, 31.36. C₂₆H₂₆N₂O₅. MS (ESI−): m/z

446.1 ([M − H]⁻, 100). Combustion analysis measured (calculated):

C 69.83 (69.94); H 6.02 (5.87); N 6.05 (6.27).

7y and tert-butylbenzoyl chloride (8a). After column chromatography

on silica with hexane/ethyl acetate/acetic acid (89:9:2) as mobile

phase, the product was recrystallized from hexane/ethyl acetate to give

52 as white solid in 74% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.63. H NMR (500 MHz, DMSO) δ = 12.88 (s, 1H),

3-(2-(4-(tert-Butyl)benzamido)-4-nitrobenzamido)benzoic Acid

(48). Preparation according to general procedure d using 7w and

tert-butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 48 as

yellow solid in 51% yield. R_f(hexane/ethyl acetate/acetic acid

11.83 (d, J = 18.3 Hz, 1H), 10.67 (s, 1H), 8.65 (t, J = 2.6 Hz, 1H),

8.15 (t, J = 3.0 Hz, 1H), 8.00 (d, J = 8.5 Hz, 1H), 7.86−7.83 (m, 2H),

7.82 (dd, J = 8.3, 2.5 Hz, 1H), 7.61 (t, J = 6.4 Hz, 2H), 7.37 (dt, J =

13.0, 6.5 Hz, 1H), 7.30 (t, J = 11.2 Hz, 1H), 2.51 (s, 3H), 1.31 (s, 9H).

¹³C NMR (126 MHz, DMSO) δ = 168.81, 167.16, 165.27, 155.82,

140.76, 137.25, 136.50, 135.53, 132.29, 131.80, 131.23, 130.94, 127.43,

126.31, 125.03, 123.58, 123.25, 121.00, 120.74, 35.26, 31.32, 21.28.

C₂₆H₂₅ClN₂O₄. MS (ESI−): m/z 463.9 ([M − H]⁻, 100).

Combustion analysis measured (calculated): C 66.98 (67.17); H

5.73 (5.42); N 5.65 (6.03).

1

(49:49:2)) = 0.56. H NMR (500 MHz, DMSO) δ = 11.50 (s, 1H),

10.95 (s, 1H), 9.24 (d, J = 2.2 Hz, 1H), 8.33 (s, 1H), 8.16 (d, J = 8.6

Hz, 1H), 8.12 (dd, J = 8.6, 2.3 Hz, 1H), 7.99 (dd, J = 8.1, 1.0 Hz, 1H),

7.88−7.85 (m, 2H), 7.76−7.73 (m, 1H), 7.62−7.59 (m, 2H), 7.52 (t, J

= 7.9 Hz, 1H), 1.31 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ =

172.49, 167.52, 166.29, 165.57, 162.77, 155.92, 149.51, 139.71, 139.02,

131.77, 131.56, 131.08, 129.51, 129.25, 127.62, 126.25, 125.75, 125.63,

122.29, 118.13, 116.32, 35.26, 31.31. C₂₅H₂₃N₃O₆. MS (ESI−): m/z

460.9 ([M − H]⁻, 100). Combustion analysis measured (calculated):

C 64.80 (65.07); H 5.17 (5.02); N 9.06 (9.11).

5-(2-(4-(tert-Butyl)benzamido)-4-methoxybenzamido)-2-methyl-

benzoic Acid (53). Preparation according to general procedure d using

7z and tert-butylbenzoyl chloride (8a). After column chromatography

on silica with hexane/ethyl acetate/acetic acid (89:9:2) as mobile

phase, the product was recrystallized from hexane/ethyl acetate to give

53 as white solid in 63% yield. R_f(hexane/ethyl acetate/acetic acid

3-(2-(4-(tert-Butyl)benzamido)-4-methylbenzamido)benzoic Acid

(49). Preparation according to general procedure e using 49a. After

column chromatography on silica with hexane/ethyl acetate/acetic

acid (89:9:2) as mobile phase, the product was recrystallized from

hexane/ethyl acetate to give 49 as white solid in 82% yield. R_f

1

(49:49:2)) = 0.59. H NMR (500 MHz, DMSO) δ = 12.90 (s, 1H),

12.33 (s, 1H), 10.47 (s, 1H), 8.35 (d, J = 2.6 Hz, 1H), 8.13 (d, J = 2.4

Hz, 1H), 8.01 (d, J = 8.9 Hz, 1H), 7.88−7.84 (m, 2H), 7.83 (dd, J =

8.3, 2.4 Hz, 1H), 7.61 (d, J = 8.5 Hz, 2H), 7.31 (d, J = 8.4 Hz, 1H),

6.84 (dd, J = 8.9, 2.6 Hz, 1H), 3.88 (s, 3H), 2.51 (s, 3H), 1.31 (s, 9H).

¹³C NMR (126 MHz, DMSO) δ = 168.87, 168.08, 165.11, 162.89,

155.60, 142.13, 136.69, 135.25, 132.23, 131.20, 130.91, 127.28, 126.33,

125.22, 123.73, 113.38, 108.91, 105.88, 55.97, 35.24, 31.33, 21.27.

C₂₇H₂₈N₂O₅. MS (ESI−): m/z 459.2 ([M − H]⁻, 100). Combustion

analysis measured (calculated): C 70.12 (70.42); H 6.07 (6.13); N

5.89 (6.08).

1

(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.60. H NMR (500

MHz, DMSO) δ = 13.04 (s, 1H), 11.77 (s, 1H), 10.63 (s, 1H), 8.41 (s,

1H), 8.30 (s, 1H), 7.97 (dd, J = 9.0, 8.0 Hz, 1H), 7.88 (t, J = 7.3 Hz,

1H), 7.85 (d, J = 8.5 Hz, 2H), 7.72 (d, J = 7.8 Hz, 1H), 7.60 (d, J = 8.5

Hz, 2H), 7.51 (t, J = 7.9 Hz, 1H), 7.11 (d, J = 8.0 Hz, 1H), 2.42 (s,

3H), 1.32 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ = 168.20, 167.59,

164.97, 155.48, 143.26, 139.65, 139.20, 132.29, 129.52, 129.41, 127.31,

126.26, 125.79, 125.45, 124.18, 122.45, 121.81, 119.56, 35.23, 31.34,

21.94. C₂₆H₂₆N₂O₄. MS (ESI+): m/z 431.50 ([M + H]⁺, 45), 453.49

([M + Na]⁺, 100). Combustion analysis measured (calculated): C

72.19 (72.54); H 6.33 (6.09); N 6.12 (6.51).

5-(2-(4-(tert-Butyl)benzamido)-4-methylbenzamido)-2-methyl-

benzoic Acid (54). Preparation according to general procedure d using

7aa and tert-butylbenzoyl chloride (8a). After column chromatography

on silica with hexane/ethyl acetate/acetic acid (89:9:2) as mobile

phase, the product was recrystallized from hexane/ethyl acetate to give

54 as white solid in 60% yield. R_f(hexane/ethyl acetate/acetic acid

3-(4-Bromo-2-(4-(tert-butyl)benzamido)benzamido)benzoic Acid

(50). Preparation according to general procedure d using 7x and tert-

butylbenzoyl chloride (8a). After column chromatography on silica

with hexane/ethyl acetate/acetic acid (89:9:2) as mobile phase, the

product was recrystallized from hexane/ethyl acetate to give 50 as

white solid in 57% yield. R_f(hexane/ethyl acetate/acetic acid

1

(49:49:2)) = 0.57. H NMR (500 MHz, DMSO) δ = 11.86 (s, 1H),

10.54 (s, 1H), 8.43 (s, 1H), 8.15 (d, J = 2.3 Hz, 1H), 7.88 (d, J = 8.1

Hz, 1H), 7.85 (d, J = 8.5 Hz, 2H), 7.82 (dd, J = 8.5, 2.4 Hz, 1H), 7.60

(d, J = 8.5 Hz, 2H), 7.31 (d, J = 8.4 Hz, 1H), 7.10 (d, J = 8.0 Hz, 1H),

2.50 (s, 3H), 2.41 (s, 3H), 1.32 (s, 9H). ¹³C NMR (126 MHz,

DMSO) δ = 168.87, 168.08, 164.93, 155.48, 143.20, 139.70, 136.68,

135.27, 132.24, 131.56, 130.95, 129.42, 127.29, 126.27, 125.02, 124.12,

123.56, 121.68, 119.35, 35.22, 31.34, 21.94, 21.26. C₂₇H₂₈N₂O₄. MS

(ESI−): m/z 444.0 ([M − H]⁻, 100). Combustion analysis measured

(calculated): C 72.95 (72.95); H 6.25 (6.35); N 5.91 (6.30).

Intermediates. 3-(2-Aminobenzamido)benzoic Acid (7a). Prep-

aration according to general procedure a1 using isatoic anhydride (5a)

and 3-aminobenzoic acid (4a). The crude product was puriﬁed by

column chromatography on silica with hexane/ethyl acetate/acetic

acid (49:49:2) as mobile phase to obtain 7a as white solid in 64%

yield. R_f(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.58. ¹H NMR

(500 MHz, DMSO) δ = 13.16 (s, 1H), 7.96 (t, J = 8.0 Hz, 1H), 7.70

(dd, J = 9.1, 7.4 Hz, 1H), 7.65 (dd, J = 7.7, 1.2 Hz, 1H), 7.59 (t, J = 7.8

Hz, 1H), 7.53−7.49 (m, 1H), 7.37−7.31 (m, 1H), 7.05 (s, 1H), 6.79−

6.70 (m, 2H). ¹³C NMR (126 MHz, DMSO) δ = 167.26, 163.21,

147.09, 139.23, 135.33, 134.20, 132.11, 131.47, 129.79, 129.03, 128.32,

117.72, 115.09, 114.63. C₁₄H₁₂N₂O₃. MS (ESI−): m/z 255.0 ([M −

H]⁻, 100), as representative intermediate. For synthesis and analytical

data of other intermediates, please see Supporting Information.

Docking. Docking simulations were performed using the Molecular

Operating Environment (MOE) (version 2012.10; The Chemical

Computing Group, Montreal, Canada). The crystal structure of FXR

(PDB ID: 3OLF³²) was downloaded from the Protein Data Bank

(PDB). Prior to ligand docking, one monomer of the dimer crystal

structure was isolated and the crystallized ligand was removed.

Subsequently, the structure was prepared with Protonate 3D, and the

active site was isolated using MOE Site Finder. The structures were

1

(49:49:2)) = 0.61. H NMR (500 MHz, DMSO) δ = 11.70 (s, 1H),

10.76 (s, 1H), 8.76 (d, J = 2.0 Hz, 1H), 8.30 (t, J = 1.8 Hz, 1H), 7.97

(dt, J = 13.7, 6.8 Hz, 1H), 7.92 (d, J = 8.5 Hz, 1H), 7.85 (d, J = 8.5 Hz,

2H), 7.76−7.71 (m, 1H), 7.61 (d, J = 8.5 Hz, 2H), 7.52 (dd, J = 8.9,

7.1 Hz, 2H), 1.31 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ = 172.49,

167.54, 167.36, 165.29, 155.81, 140.62, 139.04, 131.80, 131.73, 131.39,

129.48, 127.46, 126.30, 126.09, 125.80, 125.63, 123.86, 122.43, 121.75,

35.26, 31.32. C₂₅H₂₃BrN₂O₄. MS (ESI+): m/z 517.47 ([M + Na]⁺,

77), 519.46 ([M + Na]⁺, 100). Combustion analysis measured

(calculated): C 60.89 (60.62); H 4.72 (4.68); N 5.27 (5.66).

3-(2-(4-(tert-Butyl)benzamido)-4-methoxybenzamido)benzoic

Acid (51). Preparation according to general procedure e using 51a.

After column chromatography on silica with hexane/ethyl acetate/

acetic acid (89:9:2) as mobile phase, the product was recrystallized

from hexane/ethyl acetate to give 51 as white solid in 83% yield. R_f

1

(hexane/ethyl acetate/acetic acid (49:49:2)) = 0.56. H NMR (500

MHz, DMSO) δ = 12.26 (s, 1H), 10.56 (s, 1H), 8.34 (d, J = 2.6 Hz,

1H), 8.26 (t, J = 1.8 Hz, 1H), 8.01 (t, J = 8.5 Hz, 1H), 7.99−7.95 (m,

1H), 7.86 (d, J = 8.5 Hz, 2H), 7.74−7.70 (m, 1H), 7.61 (d, J = 8.5 Hz,

2H), 7.50 (t, J = 7.9 Hz, 1H), 6.86 (dd, J = 8.9, 2.6 Hz, 1H), 3.88 (s,

3H), 1.32 (s, 9H). ¹³C NMR (126 MHz, DMSO) δ = 168.18, 167.65,

165.13, 162.94, 155.62, 142.11, 139.13, 132.21, 131.32, 129.33, 127.29,

126.34, 125.82, 125.42, 122.63, 113.50, 108.95, 105.96, 55.99, 35.25,

31.33. C₂₆H₂₆N₂O₅. MS (ESI−): m/z 446.0 ([M − H]⁻, 100).

Combustion analysis measured (calculated): C 70.26 (69.94); H 5.88

(5.87); N 6.36 (6.27).

5-(2-(4-(tert-Butyl)benzamido)-4-chlorobenzamido)-2-methyl-

benzoic Acid (52). Preparation according to general procedure d using

Q

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

placed in the site with the Triangle Matcher method and then ranked

with the London dG scoring function. For the energy minimization in

the pocket, MOE Force Field Reﬁnement was used and ranked with

the GBVI/WSA dG scoring function.

In Vitro Biological Evaluation. FXR Transactivation Assay. Cell

Culture. HeLa cells were grown in DMEM high glucose,

supplemented with 10% fetal calf serum (FCS), 1 mM sodium

pyruvate (SP), penicillin (100 U/mL), and streptomycin (100 μg/mL)

at 37 °C and 5% CO₂.

Plasmids for Full-Length FXR Transactivation Aassay. pcDNA3-

hFXR contains the sequence of human FXR and was already published

elsewhere,⁴³and pGL3basic (Promega, Mannheim, Germany) was

used as a reporter plasmid, with a shortened construct of the promotor

of the bile salt export pump (BSEP, sequence of construct from ref 44)

cloned into the SacI/NheI cleavage site in front of the luciferase gene.

pRL-SV40 (Promega) was transfected as a control for normalization of

transfection eﬃciency and cell growth. pSG5-hRXR was already

published elsewhere⁴⁵as well.

Full-Length FXR Transactivation Assay. Twenty-four h before

transfection, HeLa cells were seeded in 96-well plates with a density of

8000 cells per well. Then 3.5 h before transfection, medium was

changed to DMEM high glucose supplemented with 1 mM SP,

penicillin (100 U/mL), streptomycin (100 μg/mL), and 0.5%

charcoal-stripped FCS. Transient transfection of HeLa cells with

BSEP-pGL3, pRL-SV40, and the expression plasmids pcDNA3-hFXR

and pSG5-hRXR was carried out using calcium phosphate transfection

method. Then 16 h after transfection, medium was changed to DMEM

high glucose, supplemented with 1 mM SP, penicillin (100 U/mL),

streptomycin (100 μg/mL), and 0.5% charcoal-stripped FCS. Then 24

h after transfection, medium was changed to DMEM without phenol

red, supplemented with 1 mM SP, penicillin (100 U/mL),

streptomycin (100 μg/mL), 2 mM ^L-glutamate, and 0.5% charcoal-

stripped FCS, now additionally containing 0.1% DMSO and the

respective test compound or 0.1% DMSO alone as untreated control.

Each concentration was tested in triplicate wells, and each experiment

was repeated independently at least three times. Following 24 h

incubation with the test compounds, cells were assayed for luciferase

activity using Dual-Glo luciferase assay system (Promega) according to

the manufacturer’s protocol. Luminescence was measured with a

Tecan Inﬁnite M200 luminometer (Tecan Deutschland GmbH,

Crailsheim, Germany). Normalization of transfection eﬃcacy and

cell growth was done by division of ﬁreﬂy luciferase data by renilla

luciferase data, resulting in relative light units (RLU). Fold activation

was obtained by dividing the mean RLU of the tested compound at a

respective concentration by the mean RLU of untreated control.

Relative activation was obtained by dividing the fold activation of the

tested compound at a respective concentration by the fold activation of

FXR full agonist GW4064 (3) at 3 μM. EC₅₀and standard error of the

mean values were calculated with the mean relative activation values of

at least three independent experiments by SigmaPlot 10.0 (Systat

Software GmbH, Erkrath, Germany) using a four parameter logistic

regression.

cDNA using the High-Capacity cDNA Reverse Transcription Kit (Life

Technologies: 4368814) according to the manufacturer’s protocol.

q-RT PCR. FXR target gene expression was evaluated by quantitative

PCR analysis with a StepOnePlus System (Life Technologies) using

PowerSYBRGreen (Life Technologies; 12.5 μL per well) and the

f o l l o w i n g p r i m e r s ( 3 0 0 n M e a c h ) : S H P , 5 ′ -

GCTGTCTGGAGTCCTTCTGG (forward) and 5′-CCAATGA-

TAGGGCGAAAGAAGAG (reverse); CYP7A1, 5′-CACCTTGAG-

GACGGTTCCTA (forward) and 5′-CGATCCAAAGGGCATG-

TAGT (reverse); BSEP, 5′-CATGGTGCAAGAAGTGCTGAGT

(forward) and 5′-AAGCGATGAGCAACTGAAATGAT (reverse);

OSTα, 5′-TGCTGCTCACCAGGAAGAAG (forward) and 5′-ATA-

GAGCTGTGCTCCCCTCA (reverse); IBABP, 5′-TCAAGGC-

CACTGTGCAGATG (forward) and 5′-CAGCTTGTCACCCAC-

GATCTC (reverse). Results were normalized to GAPDH Ct values.

Sequences of the GAPDH primers were as follows: 5′-ATATGATTC-

C A C C C A T G G C A ( f o r w a r d ) a n d 5 ′ - G A T G A T -

GACCCTTTTGGCTC (reverse). Each sample was set up in

duplicate and repeated in at least four independent experiments.

The expression was quantiﬁed by comparative ΔΔCt method.

PPAR Transactivation Assay. Cell Culture. COS-7 cells were

grown in DMEM high glucose, supplemented with 10% FCS, 1 mM

sodium pyruvate (SP), penicillin (100 U/mL), and streptomycin (100

μg/mL) at 37 °C and 5% CO₂.

Plasmids for PPAR Transactivation Assay. The Gal4-fusion

receptor plasmids pFA-CMV-PPARα-LBD, pFA-CMV-PPARδ-LBD,

and pFA-CMV-PPARγ-LBD containing the hinge region and ligand

binding domain (LBD) for each of the PPAR subtypes, respectively,

were constructed by integrating cDNA fragments obtained from PCR

ampliﬁcation of human monocytes into the SmaI/XbaI cleavage site of

the pFA-CMV vector (Stratagene, La Jolla, CA, USA) and have already

been published.⁴⁶The cDNA fragments consist of bps 499−1407

(NM_005 036), bps 412−1323 (NM_006 238) and bps 610−1518

(NM_015 869) for PPARα, PPARδ, and PPARγ, respectively. Frame

and sequence of the fusion receptors were veriﬁed by sequencing.

pFR-Luc (Stratagene) was used as reporter plasmid and pRL-SV40

(Promega) for normalization of transfection eﬃciency and cell growth.

PPAR Transactivation Assay. The day before transfection, COS-7

cells were seeded in 96-well plates with a density of 30000 cells per

well. Transient transfection was carried out using Lipofectamine LTX

reagent (Invitrogen, Carlsbad, CA, USA) according to the

manufacturer’s protocol with pFR-Luc (Stratagene), pRL-SV40

(Promega), and the Gal4-fusion receptor plasmids (pFA-CMV-

hPPAR-LBD) of the respective PPAR subtype. Then 5 h after

transfection, medium was changed to DMEM without phenol red and

10% FCS, supplemented with 1 mM SP, penicillin (100 U/mL),

streptomycin (100 μg/mL), and 2 mM ^L-glutamate, now additionally

containing 0.1% DMSO and the respective test compound or 0.1%

DMSO alone as untreated control. Each concentration was tested in

triplicate wells, and each experiment was repeated independently at

least three times. Following overnight incubation with the test

compounds, cells were assayed for luciferase activity using Dual-

GloTM luciferase assay system (Promega) according to the

manufacturer’s protocol. Luminescence was measured with an Inﬁnite

M200 luminometer (Tecan Deutschland GmbH). Normalization of

transfection eﬃcacy and cell growth was done by division of ﬁreﬂy

luciferase data by renilla luciferase data, resulting in relative light units

(RLU). Fold activation was obtained by dividing the mean RLU of a

test compound at a respective concentration by the mean RLU of

untreated control. Relative activation was obtained by dividing the fold

activation of a test compound at a respective concentration by the fold

activation of PPARα full agonist GW 7647 at 1 μM, PPARδ full

agonist L165,041 at 1 μM, or PPARγ full agonist pioglitazone at 1 μM,

respectively. EC₅₀and standard error of the mean values were

calculated with the mean relative activation values of at least three

independent experiments by SigmaPlot 10.0 (Systat Software GmbH)

using a four-parameter logistic regression.

FXR Target Gene Quantiﬁcation (qRT-PCR). Cell Culture.

HepG2 cells were seeded and grown in DMEM high glucose,

supplemented with 10% FCS, 1 mM SP, penicillin (100 U/mL), and

streptomycin (100 μg/mL) at 37 °C and 5% CO₂in 6-well plates (2 ×

10⁶per well). HT-29 cells were seeded and grown in McCoys 5A

medium supplemented with 10% FCS, penicillin (100 U/mL), and

streptomycin (100 μg/mL) at 37 °C and 5% CO₂in 6-well plates (2 ×

10⁶per well). Then 24 h after seeding, medium was changed to MEM

supplemented with 1% charcoal stripped FCS, penicillin (100 U/mL),

streptomycin (100 μg/mL), and 2 mM ^L-glutamate. After an additional

24 h, medium was again changed to MEM now additionally containing

the test compounds in DMSO or DMSO alone (ﬁnal concentration

0.1% DMSO). Cells were incubated with the test compounds for 24 h,

harvested, washed with cold PBS, and then directly used for RNA

extraction or stored at −80 °C.

RNA Extraction and cDNA Synthesis. Two micrograms of total

RNA were extracted from HepG2 or HT-29 cells by the Total RNA

Mini Kit from Omega (R6834-02). RNA was reverse transcribed into

TGR5 Assay. The activity of 51 on TGR5 was evaluated by

measuring the level of cAMP using a HTR-FRET assay. In brief, NCI-

H716 cells were cultured in DMEM supplemented with 10%FBS,

R

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

using 96-well plates coated with Matrigel (BD Biosciences). After 24 h,

cells were stimulated with increasing concentrations of test compound

51 for 60 min at 37 °C in OptiMEM with 1 mM IBMX (Sigma). The

level of intracellular cAMP was assessed using the Lance kit

(PerkinElmer) according to the manufacturer’s protocol.

ASSOCIATED CONTENT

■

S

* Supporting Information

Preparation and analytical data of intermediate compounds.

This material is available free of charge via the Internet at

http://pubs.acs.org.

Cytotoxicity Assays. WST-1. The WST-1 assay from Roche was

performed according to manufacturer’s protocol. In brief, HepG2 cells

were seeded in DMEM supplemented with 1 mM SP, penicillin (100

U/mL), streptomycin (100 μg/mL), and 10% FCS in 96-well plates (3

× 10⁴cells/well). After 24 h, medium was changed to DMEM

supplemented with penicillin (100 U/mL), streptomycin (100 μg/

mL), and 1% FCS, and cells were incubated with compound 51 (ﬁnal

concentrations 1, 10, 30, and 100 μM), Revlotron (100 μM) as

positive control, and Zileuton (100 μM) and DMEM/1% DMSO as

negative controls. After 48 h, WST reagent (Roche) was added to each

well according to manufacturer’s instructions. After 45 min incubation,

absorption (450 nm/reference: 620 nm) was determined with a

TEACAN Inﬁnite M200 luminometer. Each experiment was repeated

three times in triplicates. Results (expressed as mean SEM; n = 4;

untreated = 100%) 51: 1 μM, 94 2%; 10 μM, 76 1%; 30 μM, 40

1%; 100 μM, 0%.

AUTHOR INFORMATION

■

Corresponding Author

*Phone: +49-69-798-29328. Fax: +49-69-798-29332. E-mail:

merk@pharmchem.uni-frankfurt.de .

Notes

The authors declare no competing ﬁnancial interest.

ACKNOWLEDGMENTS

■

We thank Prof. Dr. R. Pellicciari and Dr. D. Passeri for the

generous in vitro characterization of compound 51 on TGR5.

K.A. gratefully acknowledges ﬁnancial support from Else

Kroner-Fresenius-Stiftung (Dr. Hans Kroner-Graduiertenkol-

leg) and from CEF.

̈

LDH. LDH assay (Roche) was performed according to manufac-

turer’s instructions. In brief, HepG2 cells were seeded in DMEM

supplemented with 1 mM SP, penicillin (100 U/mL), streptomycin

(100 μg/mL), and 10% FCS in 96-well plates (3 × 10⁴cells/well).

After 24 h, medium was changed to DMEM supplemented with

penicillin (100 U/mL), streptomycin (100 μg/mL), and 1% FCS, and

cells were incubated with the respective compounds for 48 h. As

positive control, TRITON X-100 (2%) was added 2 h before

measurement. After incubation, supernatant of each well was

transferred into a fresh plate and LDH substrate/reagent was added.

After 20 min incubation, absorption at measurement (490 nM) and

reference (690 nM) wavelength was determined with a TECAN

inﬁnite 200. All experiments were performed in triplicates and at least

in three independent repeats. Results (expressed as mean SEM; n =

4; untreated = 0%, Triton X-100 (2%) = 100%) 51: 1 μM, 0 7%; 10

μM, 0 7%; 30 μM, 63 5%; 100 μM, 91 6%.

Metabolism Assay. The solubilized test compounds (5 μL, ﬁnal

concentration 10 μM in DMSO) were preincubated at 37 °C in 432

μL of phosphate buﬀer (0.1 M, pH 7.4) together with a 50 μL of

NADPH regenerating system (30 mM glucose-6-phosphate, 4 U/mL

glucose-6-phosphate dehydrogenase, 10 mM NADP, 30 mM MgCl₂).

After 5 min, the reaction was started by the addition of 13 μL of

microsome mix from the liver of Sprague−Dawley rats (Invitrogen,

Darmstadt, Germany; 20 mg protein/mL in 0.1 M phosphate buﬀer)

in a shaking water bath at 37 °C. The reaction was stopped by addition

of 250 μL of of ice-cold methanol at 0, 15, 30, and 60 min. The

samples were diluted with 250 μL of DMSO and centrifuged at 10000g

for 5 min at 4 °C. The supernatants were analyzed, and test

compounds were quantiﬁed by HPLC: mobile phase, MeOH 83%/

H₂O 17%/formic acid 0.1%; ﬂow-rate, 1 mL/min; stationary phase,

MultoHigh Phenyl phase, 5 μm, 250 × 4 precolumn, phenyl, 5 μm, 20

× 4; detection wavelength, 330 and 254 nm; injection volume, 50 μL.

Control samples were performed to check the stability of the

compounds in the reaction mixture: ﬁrst control was without NADPH,

which is needed for the enzymatic activity of the microsomes, second

control was with inactivated microsomes (incubated for 20 min at 90

°C), third control was without test compounds (to determine the

baseline). The amounts of the test compounds were quantiﬁed by an

external calibration curve, where data are expressed as means SEM

of single determinations obtained in three independent experiments.

The metabolism experiments showed the following curves (expressed

as mean SEM; n = 4) 51: 0 min, 93.5 2.4%; 15 min, 86.0 1.8%;

30 min, 84.3 1.4%; 60 min, 80.2 0.2%.

REFERENCES

■

(1) Fiorucci, S.; Mencarelli, A.; Distrutti, E.; Palladino, G.; Cipriani,

S. Targeting farnesoid-X-receptor: from medicinal chemistry to disease

treatment. Curr. Med. Chem. 2010, 2, 139−159.

(2) Fiorucci, S.; Mencarelli, A.; Distrutti, E.; Zampella, A. Farnesoid

X receptor: from medicinal chemistry to clinical applications. Future

Med. Chem. 2012, 7, 877−891.

(3) Dufer, M.; Horth, K.; Wagner, R.; Schittenhelm, B.; Prowald, S.;

̈

Wagner, T.; Oberwinkler, J.; Lukowski, R.; Gonzalez, F.; Krippeit-

Drews, P.; Drews, G. Bile Acids Acutely Stimulate Insulin Secretion of

Mouse-Cells via Farnesoid X Receptor Activation and KATP Channel

Inhibition. Diabetes 2012, 6, 1479−1489.

(4) Dufer, M.; Horth, K.; Krippeit-Drews, P.; Drews, G. The

̈

significance of the nuclear farnesoid X receptor (FXR) in β cell

function. Islets 2012, 5, 333−338.

(5) Li, Y.; Jadhav, K.; Zhang, Y. Bile acid receptors in non-alcoholic

fatty liver disease. Biochem. Pharmacol. 2013, 11, 1517−1524.

(6) Adorini, L.; Pruzanski, M.; Shapiro, D. Farnesoid X receptor

targeting to treat nonalcoholic steatohepatitis. Drug Discovery Today

2012, 17−18, 988−997.

(7) Musso, G.; Gambino, R.; Cassader, M. Cholesterol metabolism

and the pathogenesis of non-alcoholic steatohepatitis. Prog. Lipid Res.

2013, 1, 175−191.

(8) Renga, B.; Mencarelli, A.; Vavassori, P.; Brancaleone, V.; Fiorucci,

S. The bile acid sensor FXR regulates insulin transcription and

secretion. Biochim. Biophys. Acta 2010, 3, 363−372.

(9) Wang, X.; Fu, X.; van Ness, C.; Meng, Z.; Ma, X.; Huang, W. Bile

Acid Receptors and Liver Cancer. Curr. Pathobiol. Rep. 2013, 1, 29−

35.

(10) Nijmeijer, R. M.; Gadaleta, R. M.; van Mil, S. W. C.; van

Bodegraven, A. A.; Crusius, J. B.; Dijkstra, G.; Hommes, D. W.; de

Jong, D. J.; Stokkers, P. C.; Verspaget, H. W.; Weersma, R. K.; van der

Woude, C. J.; Stapelbroek, J. M.; Schipper, M. E.; Wijmenga, C.; van

Erpecum, K. J.; Oldenburg, B. Farnesoid X receptor (FXR) activation

and FXR genetic variation in inflammatory bowel disease. PLoS One

2011, 8, e23745.

(11) Hollman, D. A. A.; Milona, A.; van Erpecum, K. J.; van Mil, S.

W. C. Anti-inflammatory and metabolic actions of FXR: insights into

molecular mechanisms. Biochim. Biophys. Acta 2012, 11, 1443−1452.

(12) Wildenberg, M. E.; van den Brink, G. R. FXR activation inhibits

inflammation and preserves the intestinal barrier in IBD. Gut 2011, 4,

432−433.

(13) Hageman, J.; Herrema, H.; Groen, A. K.; Kuipers, F. A role of

the bile salt receptor FXR in atherosclerosis. Arterioscler. Thromb. Vasc.

Biol. 2010, 8, 1519−1528.

S

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

(14) Mencarelli, A.; Fiorucci, S. FXR an emerging therapeutic target

for the treatment of atherosclerosis. J. Cell. Mol. Med. 2010, 1−2, 79−

92.

(15) Fiorucci, S.; Cipriani, S.; Mencarelli, A.; Renga, B.; Distrutti, E.;

Baldelli, F. Counter-regulatory role of bile acid activated receptors in

immunity and inflammation. Curr. Mol. Med. 2010, 6, 579−595.

(16) Silveira, M. G.; Lindor, K. D. Obeticholic acid and budesonide

for the treatment of primary biliary cirrhosis. Expert Opin.

Pharmacother. 2014, 3, 365−372.

(29) Achenbach, J.; Gabler, M.; Steri, R.; Schubert-Zsilavecz, M.;

Proschak, E. Identification of novel farnesoid X receptor modulators

using a combined ligand- and structure-based virtual screening. Med.

Chem. Commun. 2013, 6, 920−924.

(30) Jin, T.; Kitahara, F.; Kamijo, S.; Yamamoto, Y. Copper-catalyzed

synthesis of 5-substituted 1H-tetrazoles via the [3 + 2] cycloaddition

of nitriles and trimethylsilyl azide. Tetrahedron Lett. 2008, 17, 2824−

2827.

(31) Khalafi-Nezhad, A.; Parhami, A.; Soltani Rad, M. N.; Zarea, A.

Efficient method for the direct preparation of amides from carboxylic

acids using tosyl chloride under solvent-free conditions. Tetrahedron

Lett. 2005, 40, 6879−6882.

(32) Richter, H. G.; Benson, G. M.; Blum, D.; Chaput, E.; Feng, S.;

Gardes, C.; Grether, U.; Hartman, P.; Kuhn, B.; Martin, R. E.;

Plancher, J. M.; Rudolph, M. G.; Schuler, F.; Taylor, S.; Bleicher, K. H.

Discovery of novel and orally active FXR agonists for the potential

treatment of dyslipidemia and diabetes. Bioorg. Med. Chem. Lett. 2011,

1, 191−194.

(33) Akwabi-Ameyaw, A.; Caravella, J. A.; Chen, L.; Creech, K. L.;

Deaton, D. N.; Madauss, K. P.; Marr, H. B.; Miller, A. B.; Navas, F., III;

Parks, D. J.; Spearing, P. K.; Todd, D.; Williams, S. P.; Wisely, G. B.

Conformationally constrained farnesoid X receptor (FXR) agonists:

alternative replacements of the stilbene. Bioorg. Med. Chem. Lett. 2011,

20, 6154−6160.

(34) Di Leva, F. S.; Festa, C.; D’Amore, C.; De Marino, S.; Renga, B.;

D’Auria, M. V.; Novellino, E.; Limongelli, V.; Zampella, A.; Fiorucci, S.

Binding Mechanism of the Farnesoid X Receptor Marine Antagonist

Suvanine Reveals a Strategy To Forestall Drug Modulation on Nuclear

Receptors. Design, Synthesis, and Biological Evaluation of Novel

Ligands. J. Med. Chem. 2013, 11, 4701−4717.

(35) De Gottardi, A.; Dumonceau, J. M.; Bruttin, F.; Vonlaufen, A.;

Morard, I.; Spahr, L.; Rubbia-Brandt, L.; Frossard, J. L.; Dinjens, W.

N.; Rabinovitch, P. S.; Hadengue, A. Expression of the bile acid

receptor FXR in Barrett’s esophagus and enhancement of apoptosis by

guggulsterone in vitro. Mol. Cancer 2006, 5, 48.

(36) Capello, A.; Moons, L. M.; Van de Winkel, A.; Siersema, P. D.;

van Dekken, H.; Kuipers, E. J.; Kusters, J. G. Bile Acid-Stimulated

Expression of the Farnesoid X Receptor Enhances the Immune

Response in Barrett Esophagus. Am. J. Gastroenterol. 2008, 6, 1510−

1516.

(17) Mudaliar, S.; Henry, R. R.; Sanyal, A. J.; Morrow, L.; Marschall,

H. U.; Kipnes, M.; Adorini, L.; Sciacca, C. I.; Clopton, P.; Castelloe, E.;

Dillon, P.; Pruzanski, M.; Shapiro, D. Efficacy and safety of the

farnesoid X receptor agonist obeticholic acid in patients with type 2

diabetes and nonalcoholic fatty liver disease. Gastroenterology 2013, 3,

574−82.e1.

(18) Ryan, K. K.; Tremaroli, V.; Clemmensen, C.; Kovatcheva-

Datchary, P.; Myronovych, A.; Karns, R.; Wilson-Per

́

ez, H. E.;

Sandoval, D. A.; Kohli, R.; Backhed, F.; Seeley, R. J. FXR is a

̈

molecular target for the effects of vertical sleeve gastrectomy. Nature

2014, 509, 183−188.

(19) Merk, D.; Steinhilber, D.; Schubert-Zsilavecz, M. Medicinal

chemistry of farnesoid X receptor ligands: from agonists and

antagonists to modulators. Future Med. Chem. 2012, 8, 1015−1036.

(20) Pellicciari, R.; Fiorucci, S.; Camaioni, E.; Clerici, C.; Costantino,

G.; Maloney, P. R.; Morelli, A.; Parks, D. J.; Willson, T. M. 6alpha-

Ethyl-chenodeoxycholic acid (6-ECDCA), a potent and selective FXR

agonist endowed with anticholestatic activity. J. Med. Chem. 2002, 17,

3569−3572.

(21) Maloney, P. R.; Parks, D. J.; Haffner, C. D.; Fivush, A. M.;

Chandra, G.; Plunket, K. D.; Creech, K. L.; Moore, L. B.; Wilson, J. G.;

Lewis, M. C.; Jones, S. A.; Willson, T. M. Identification of a Chemical

Tool for the Orphan Nuclear Receptor FXR. J. Med. Chem. 2000, 16,

2971−2974.

(22) Akwabi-Ameyaw, A.; Bass, J. Y.; Caldwell, R. D.; Caravella, J. A.;

Chen, L.; Creech, K. L.; Deaton, D. N.; Jones, S. A.; Kaldor, I.; Liu, Y.;

Madauss, K. P.; Marr, H. B.; McFadyen, R. B.; Miller, A. B.; Iii, F. N.;

Parks, D. J.; Spearing, P. K.; Todd, D.; Williams, S. P.; Wisely, G. B.

Conformationally constrained farnesoid X receptor (FXR) agonists:

naphthoic acid-based analogs of GW 4064. Bioorg. Med. Chem. Lett.

2008, 15, 4339−4343.

(23) Chiang, P.; Thompson, D. C.; Ghosh, S.; Heitmeier, M. R. A

formulation-enabled preclinical efficacy assessment of a farnesoid X

receptor agonist, GW4064, in hamsters and cynomolgus monkeys. J.

Pharm. Sci. 2011, 11, 4722−4733.

(24) Howarth, D. L.; Law, S. H. W.; Law, J. M.; Mondon, J. A.;

Kullman, S. W.; Hinton, D. E. Exposure to the synthetic FXR agonist

GW4064 causes alterations in gene expression and sublethal

hepatotoxicity in eleutheroembryo medaka (Oryzias latipes). Toxicol.

Appl. Pharmacol. 2010, 1, 111−121.

(25) Flatt, B.; Martin, R.; Wang, T. L.; Mahaney, P.; Murphy, B.; Gu,

X. H.; Foster, P.; Li, J.; Pircher, P.; Petrowski, M.; Schulman, I.;

Westin, S.; Wrobel, J.; Yan, G.; Bischoff, E.; Daige, C.; Mohan, R.

Discovery of XL335 (WAY-362450), a highly potent, selective, and

orally active agonist of the farnesoid X receptor (FXR). J. Med. Chem.

2009, 4, 904−907.

(26) Singh, N.; Yadav, M.; Singh, A. K.; Kumar, H.; Dwivedi, S. K.;

Mishra, J. S.; Gurjar, A.; Manhas, A.; Chandra, S.; Yadav, P. N.;

Jagavelu, K.; Siddiqi, M. I.; Trivedi, A. K.; Chattopadhyay, N.; Sanyal,

S. Synthetic FXR Agonist GW4064 Is a Modulator of Multiple G

Protein-Coupled Receptors. Mol. Endocrinol. 2014, 5, 659−673.

(27) Merk, D.; Steinhilber, D.; Schubert-Zsilavecz, M. Characterizing

ligands for farnesoid X receptoravailable in vitro test systems for

farnesoid X receptor modulator development. Expert Opin. Drug

Discovery 2014, 1, 27−37.

(37) Lee, J. Y.; Lee, K. T.; Lee, J. K.; Lee, K. H.; Jang, K. T.; Heo, J.

S.; Choi, S. H.; Kim, Y.; Rhee, J. C. Farnesoid X receptor,

overexpressed in pancreatic cancer with lymph node metastasis

promotes cell migration and invasion. Br J. Cancer 2011, 6, 1027−

1037.

(38) De Gottardi, A.; Touri, F.; Maurer, C. A.; Perez, A.; Maurhofer,

O.; Ventre, G.; Bentzen, C. L.; Niesor, E. J.; Dufour, J. F. The bile acid

nuclear receptor FXR and the bile acid binding protein IBABP are

differently expressed in colon cancer. Dig. Dis. Sci. 2004, 6, 982−989.

(39) Journe, F.; Durbecq, V.; Chaboteaux, C.; Rouas, G.; Laurent, G.;

Nonclercq, D.; Sotiriou, C.; Body, J. J.; Larsimont, D. Association

between farnesoid X receptor expression and cell proliferation in

estrogen receptor-positive luminal-like breast cancer from postmeno-

pausal patients. Breast Cancer Res. Treat. 2009, 3, 523−535.

(40) Silva, J.; Dasgupta, S.; Wang, G.; Krishnamurthy, K.; Ritter, E.;

Bieberich, E. Lipids isolated from bone induce the migration of human

breast cancer cells. J. Lipid Res. 2006, 4, 724−733.

(41) Qi, Y.; Jiang, C.; Cheng, J.; Krausz, K. W.; Li, T.; Ferrell, J. M.;

Gonzalez, F. J.; Chiang, J. Y. Bile acid signaling in lipid metabolism:

metabolomic and lipidomic analysis of lipid and bile acid markers

linked to anti-obesity and anti-diabetes in mice. Biochim. Biophys. Acta

2014, 14, 1388−1981.

(42) Fiorucci, S.; Baldelli, F. Farnesoid X receptor agonists in biliary

tract disease. Curr. Opin. Gastroenterol. 2009, 3, 252−259.

(43) Steri, R.; Achenbach, J.; Steinhilber, D.; Schubert-Zsilavecz, M.;

Proschak, E. Investigation of imatinib and other approved drugs as

starting points for antidiabetic drug discovery with FXR modulating

activity. Biochem. Pharmacol. 2012, 12, 1674−1681.

(28) Merk, D.; Gabler, M.; Gomez, R. C.; Flesch, D.; Hanke, T.;

Kaiser, A.; Lamers, C.; Werz, O.; Schneider, G.; Schubert-Zsilavecz, M.

Anthranilic acid derivatives as novel ligands for farnesoid X receptor

(FXR). Bioorg. Med. Chem. 2014, 8, 2447−2460.

T

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry

Article

(44) Ananthanarayanan, M. Human Bile Salt Export Pump Promoter

Is Transactivated by the Farnesoid X Receptor/Bile Acid Receptor. J.

Biol. Chem. 2001, 31, 28857−28865.

(45) Seuter, S.; Vaisanen, S.; Radmark, O.; Carlberg, C.; Steinhilber,

̈

̊

D. Functional characterization of vitamin D responding regions in the

human 5-lipoxygenase gene. Biochim. Biophys. Acta 2007, 7, 864−872.

(46) Rau, O.; Wurglics, M.; Paulke, A.; Zitzkowski, J.; Meindl, N.;

Bock, A.; Dingermann, T.; Abdel-Tawab, M.; Schubert-Zsilavecz, M.

Carnosic acid and carnosol, phenolic diterpene compounds of the

labiate herbs rosemary and sage, are activators of the human

peroxisome proliferator-activated receptor gamma. Planta Med. 2006,

10, 881−887.

U

dx.doi.org/10.1021/jm500937v | J. Med. Chem. XXXX, XXX, XXX−XXX

Article Doi

Extending the structure-activity relationship of anthranilic acid derivatives as farnesoid x receptor modulators: Development of a highly potent partial farnesoid x receptor agonist

DOI: 10.1021/jm500937v

Source and publish data:

Authors:

Article abstract of DOI:10.1021/jm500937v

Full text of DOI:10.1021/jm500937v

Products guided by the article

R&D Labs maybe for 269391-35-7

Relevant to this article

Hot Product