Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

Article abstract of DOI:10.1021/ja010078v

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-

Full text of DOI:10.1021/ja010078v

VOLUME 123, NUMBER 34
AUGUST 29, 2001
© Copyright 2001 by the
American Chemical Society
Acid/Azole Complexes as Highly Effective Promoters in the
Synthesis of DNA and RNA Oligomers via the Phosphoramidite
Method
Yoshihiro Hayakawa,*,† Rie Kawai,† Akiyoshi Hirata,† Jun-ichiro Sugimoto,†
Masanori Kataoka,† Akira Sakakura,† Masaaki Hirose,‡ and Ryoji Noyori‡
Contribution from the Laboratory of Bioorganic Chemistry, Graduate School of Human Informatics, and
Department of Chemistry and Molecular Chirality Research Unit, Nagoya UniVersity, Chikusa,
Nagoya 464-8601, Japan
ReceiVed January 8, 2001
Abstract: The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of
a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate,
N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and
N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents
serve as powerful activators of deoxyribonucleoside 3′-(allyl N,N-diisopropylphosphoramidite)s or 3′-(2-
cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3′-
O-(tert-butyldimethylsilyl)ribonucleoside 2′-(N,N-diisopropylphosphoramidite)s or 2′-O-(tert-butyldimethylsilyl)-
ribonucleoside 3′-(N,N-diisopropylphosphoramidite)s used for the formation of 2′-5′ and 3′-5′ internucleotide
linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation
of the nucleoside phosphoramidite and a 5′-O-free nucleoside, in which equimolar amounts of the reactants
and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been
shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribo-
nucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate
can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, 5′CGACACCCAATTCT-
GAAAAT3′ (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3′-
phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3′-phosphoramidite as
building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate
is useful for the solid-phase synthesis of oligoribonucleotides, such as 5′AGCUACGUGACUACUACUUU3′
(20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has
been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-
5′-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2′-5′)adenylyl(2′-5′)adenosine
(2-5A core).
Introduction
capable of preparing oligonucleotides both with and without
artificial modifications. Among the methods reported thus far,
the phosphoramidite approach1 is considered to be the most
useful, as it allows for high-yield and high-purity preparations
in both solution and solid phases. This approach is especially
useful for the synthesis of medium-size oligonucleotides (longer
Recent advances in and diversity of nucleic acid research have
increased the importance of developing a chemical method
* Corresponding author. Phone: +81 52 789 4848. Fax: +81 52 789
5646. E-mail: yoshi@info.human.nagoya-u.ac.jp.
† Laboratory of Bioorganic Chemistry, Graduate School of Human
Informatics.
(1) Beaucage, S. L.; Iyer, R. P. Tetrahedron 1993, 49, 6123-6194 and
references therein.
‡ Department of Chemistry and Molecular Chirality Research Unit.
10.1021/ja010078v CCC: $20.00 © 2001 American Chemical Society
Published on Web 08/07/2001

8166 J. Am. Chem. Soc., Vol. 123, No. 34, 2001
Hayakawa et al.
than 20mers) with a modified backbone; these oligonucleotides
include H-phosphonate,2 arylphosphonate,3 phosphotriester,3,4
phosphoramidate,5 phosphoramidimidate,6 phosphorothioate,7
phosphorodithioate,8 phosphoroselenate,9 and boranophos-
phate,10 some of which are useful as antisense molecules.11 In
the phosphoramidite strategy, an important research objective
is the invention of a promoter that is useful for the condensation
of a nucleoside phosphoramidite and a nucleoside. A variety
of promoters including 1H-tetrazole,12 5-(p-nitrophenyl)-1H-
tetrazole (NPT),13 5-(ethylthio)-1H-tetrazole (ETT),14 pyridinium
chloride in the presence of imidazole,15 pyridinium trifluoro-
acetate (PyTFA),16 N-methylanilinium trifluoroacetate (N-
MeANTFA),17 pyridinium tetrafluoroborate (PyTFB),8b 2,4-
dinitrophenol,18 4,5-(dicyano)imidazole (DCI),19 2-(bromo)-4,5-
(dicyano)imidazole (BrDCI),20 and 2-(mesityl)-4,5-(dicyano)-
imidazole21 have been reported to date. However, these reagents
have some drawbacks. For example, the existing reagents do
not sufficiently activate poorly reactive ribonucleoside phos-
phoramidites such as 3′-O-(tert-butyldimethylsilyl)ribonucleo-
side 2′-phosphoramidites and 2′-O-(tert-butyldimethylsilyl)-
ribonucleoside 3′-phosphoramidites, which are most widely used
as monomer units in the synthesis of 2′-5′- and 3′-5′-linked
oligoribonucleotides, respectively.22 Reactions using these phos-
phoramidites do not always take place smoothly in the presence
of the existing promoters. In addition, the product yield is
generally not high. Some reagents such as pyridinium chloride
and PyTFA are hygroscopic. In the case of the tetrazole reagents,
potential explosive and biohazadous characteristics23 are prob-
lematic. With regard to NPT, its low solubility in acetonitrile
(ca. 0.1 mol/L) is a drawback to the large-scale synthesis. To
render the phosphoramidite method more useful, it is necessary
to develop more efficient promoters that are capable of
circumventing these disadvantages. This paper suggests certain
acid salts of imidazole- and benzimidazole-related compounds
as being such desirable promoters. Furthermore, the utility of
these salts for the synthesis of various deoxyribonucleotides,
ribonucleotides, and related compounds in solution and solid
phases is described. A mechanism of the condensation of a
deoxyribonucleoside 3′-phosphoramidite and a 5′-O-free deoxy-
ribonucleoside using an acid/azole complex promoter is also
briefly discussed on the basis of 31P NMR study.
Results and Discussion
A variety of acid/azole complexes were prepared by com-
bining acids and azoles that are commercially available at
reasonable prices. The acids include methanesulfonic acid,
trifluoromethanesulfonic acid, p-toluenesulfonic acid, trifluo-
roacetic acid, hydroperchloric acid, tetrafluoroboric acid, and
hexafluorophosphoric acid. The azoles include imidazole, N-
(methyl)imidazole, N-(phenyl)imidazole, N-(p-acetylphenyl)-
imidazole, 2-(methyl)imidazole, 2-(phenyl)imidazole, 4-(methyl)-
imidazole, 4-(phenyl)imidazole, benzimidazole, N-(methyl)benz-
imidazole, 2-(methyl)benzimidazole, and 2-(phenyl)benzimid-
azole.
Reactivity of Promoters and Preparation of Deoxyribo-
nucleotides and Ribonucleotides in Solution. Noncrystalline
and/or hygroscopic compounds are not suitable as promoters
for the phosphoramidite method. Good solubility in acetonitrile
is also a crucial requirement for achieving efficient synthesis.
Accordingly, the following nonhygroscopic, crystalline promot-
ers with high solubility (g0.4 mol/L) were selected for the
following examinations: imidazolium triflate (IMT), imidazo-
lium perchlorate (IMP), imidazolium tetrafluoroborate, N-
(methyl)imidazolium triflate (N-MeIMT),24 N-(phenyl)imid-
azolium triflate (N-PhIMT), N-(phenyl)imidazolium perchlorate
(N-PhIMP), N-(phenyl)imidazolium tetrafluoroborate (N-Ph-
IMTFB), N-(p-acetylphenyl)imidazolium triflate (N-AcPhIMT),
2-(phenyl)imidazolium triflate (2-PhIMT), 4-(methyl)imidazo-
lium triflate (4-MeIMT), 4-(methyl)imidazolium tosylate, 4-(meth-
yl)imidazolium trifluoroacetate, 4-(phenyl)imidazolium triflate
(4-PhIMT), 4-(phenyl)imidazolium trifluoroacetate, benzimid-
azolium triflate (BIT),25 benzimidazolium tetrafluoroborate
(BITFB), N-(methyl)benzimidazolium triflate (N-MeBIT), 2-
(2) Wada, T.; Honda, F.; Sato, Y.; Sekine, M. Tetrahedron Lett. 1999,
40, 915-918.
(3) Hayakawa, Y.; Hirose, M.; Hayakawa, M.; Noyori, R. J. Org. Chem.
1995, 60, 925-930.
(4) (a) Gallo, K. A.; Shao, K.; Phillips, L. R.; Regan, J. B.; Koziolkiewicz,
M.; Uznanski, B.; Stec, W. J.; Zon, G. Nucleic Acids Res. 1986, 14, 7405-
7420. (b) Kuijpers, W. H. A.; Huskens, J.; Koole, L. H.; van Boeckel, C.
A. A. Nucleic Acids Res. 1990, 18, 5197-5205. (c) Alul, R. H.; Singman,
C. N.; Zhang, G.; Letsinger, R. L. Nucleic Acids Res. 1991, 19, 1527-
1532. (d) Vinogradov, S.; Asseline, U.; Thuong, N. T. Tetrahedron Lett.
1993, 34, 5899-5902.
(5) Yamana, K.; Nishijima, Y.; Oka, A.; Nakano, H.; Sangen, O.; Ozaki,
H.; Shimidzu, T. Tetrahedron 1989, 45, 4135-4140.
(6) Bjergårde, K.; Dahl, O.; Caruthers, M. H. Tetrahedron Lett. 1994,
35, 2941-2944.
(7) (a) Stec, W. J.; Wilk, A. Angew. Chem., Int. Ed. Engl. 1994, 33,
709-722 and references therein.
(8) (a) Bjergårde, K.; Dahl, B. H.; Dahl, O. Nucleosides Nucleotides 1991,
10, 461-464. (b) Brill, W. K.-D.; Nielsen, J.; Caruthers, M. H. J. Am.
Chem. Soc. 1991, 113, 3972-3980. (c) Marshall, W. S.; Caruthers, M. H.
Science 1993, 259, 1564-1570. See also: (d) Okruszek, A.; Sierzchala,
A.; Sochacki, M.; Stec. W. J. Tetrahedron Lett. 1992, 33, 7585-7588.
(9) (a) Nemer, M. J.; Ogilvie, K. K. Tetrahedron Lett. 1980, 21, 4149-
4152. (b) Stec, W. J.; Zon, G.; Egan, W.; Stec, B. J. Am. Chem. Soc. 1984,
106, 6077-6079.
(10) (a) Sood, A.; Shaw, B. R.; Spielvogel, B. F. J. Am. Chem. Soc.
1990, 112, 9000-9001. (b) Chen, Y.-Q.; Qu, F.-C.; Zhang, Y.-B.
Tetrahedron Lett. 1995, 36, 745-748.
(11) (a) Uhlmann, E.; Peyman, A. Chem. ReV. 1990, 90, 543-584. (b)
Milligan, J. F., Matteucci, M. D.; Martin, J. C. J. Med. Chem. 1993, 36,
1923-1937. (c) Varma, R. S. Synlett 1993, 621-637.
(12) Beaucage, S. L.; Caruthers, M. H. Tetrahedron Lett. 1981, 22, 1859-
1862.
(13) (a) Froehler, B. C.; Matteucci, M. D. Tetrahedron Lett. 1983, 24,
3171-3174. (b) Pon, R. T. Tetrahedron Lett. 1987, 28, 3643-3646.
(14) Vinayak, R.; Colonna, F.; Tsou, D.; Mullah, B.; Andrus, A.; Sproat,
B. Nucleic Acids Symp. Ser. 1994, 31, 165-166.
(23) Sigma-Aldrich Library of Chemical Safety 2; Sigma-Aldrich:
Milwaukee, WI, 1990; p 3313D (Sigma-Aldrich Material Safety Data Sheets;
Product No. 33644-0).
(24) (a) Hostomsky, Z.; Smrt, J.; Arnold, L.; Toc´ık, Z.; Paces, V. Nucleic
Acids Res. 1987, 15, 4849-4856. (b) Arnold, L.; Toc´ık, Z.; Bradkova´, E.;
Hostomsky, Z.; Paces, V.; Smrt, J. Collect. Czech. Chem. Commun. 1989,
54, 523-532.
(25) We have preliminarily reported some oligonucleotide syntheses via
the phosphoramidite approach using an acid/azole complex as the promoter.
For the synthesis with benzimidazolium triflate as the promoter, see: (a)
Hayakawa, Y.; Kataoka, M.; Noyori, R. J. Org. Chem. 1996, 61, 7996-
7997. (b) Iwai, S.; Mizukoshi, T.; Fujiwara, Y.; Masutani, C.; Hanaoaka,
F.; Hayakawa, Y. Nucleic Acids Res. 1999, 27, 2299-2303. (c) Sakakura,
A.; Hayakawa, Y.; Harada, H.; Hirose, M.; Noyori, R. Tetrahedron Lett.
1999, 40, 4359-4362. (d) Sakakura, A.; Hayakawa, Y. Tetrahedron 2000,
56, 4427-4435. (e) Matsuura, K.; Hibino, M.; Kataoka, M.; Hayakawa,
Y.; Kobayashi, K. Tetrahedron Lett. 2000, 41, 7529-7533. For the synthesis
with imidazolium triflate as the promoter, see: (f) Hayakawa, Y.; Kataoka,
M. J. Am. Chem. Soc. 1998, 120, 12395-12401.
(15) Gryaznov, S. M.; Letsinger, R. L. Nucleic Acids Res. 1992, 20,
1879-1882.
(16) (a) Sanghvi, J.; Guo, Z.; Pfundheller, H. M.; Converso, A. Org.
Process Res. DeV. 2000, 4, 175-181. (b) Eleuteri, A.; Capaldi, D. C.; Krotz,
A. H.; Cole, D. L.; Ravikumar, V. T. Org. Process Res. DeV. 2000, 4,
182-189.
(17) Fourrey, J.-L.; Varenne, J. Tetrahedron Lett. 1984, 25, 4511-4514.
(18) Dabkowski, W.; Tworowska, I.; Michalski, J.; Cramer, F. Tetra-
hedron Lett. 2000, 41, 7535-7539.
(19) Vergeese, C.; Carter, J.; Yegge, J.; Krivjansky, S.; Settle, A.; Kropp,
E.; Peterson, K.; Pieken, W. Nucleic Acids Res. 1998, 26, 1046-1050.
(20) Jin, Y.; Just, G. J. Org. Chem. 1998, 63, 3647-3654.
(21) Lu, Y.; Just, G. Tetrahedron Lett. 2000, 41, 9223-9227.
(22) Beaucage, S. L.; Iyer, R. P. Tetrahedron 1993, 49, 10441-10488
and references therein.

Acid/Azole Promoters of the Phosphoramidite Method
J. Am. Chem. Soc., Vol. 123, No. 34, 2001 8167
Subsequently, we selected N-PhIMT, N-AcPhIMT, BIT, and
N-MeBIT among the azolium promoters due to their high
reactivity in the previous experiment and examined the utility
of these azolium promoters for the liquid-phase preparation of
dinucleoside phosphates on a larger scale and in a higher
concentration of solution using the nucleoside 3′-(allyl phos-
phoramidite)s, 1, 2, 3, and 4, the nucleoside 3′-(2-cyanoethyl
phosphoramidite)s, 5, 6, 7, and 8, and the 5′-O-free nucleosides,
9, 10, and 11, as building blocks. The target product was
prepared via the condensation of the phosphoramidite and the
nucleoside by the use of these reactants and the promoter in
0.1 mmol amounts each in the presence of MS 3A in a 0.1 M
acetonitrile solution at 25 °C, followed by 2-butanone peroxide
oxidation.31 In this process, the condensation of the phosphor-
amidite and the nucleoside was smoothly conducted by the use
of every azolium promoter. Thus, the condensation using the
allyl phosphoramidite was completed in 1-5 min, and the
reaction using the cyanoethyl phosphoramidite required 3-10
min for completion. In both cases, the target compounds, 12-
19, were obtained in excellent yields after the oxidation. Further,
none of the cases caused depurination in deoxyadenosine and
deoxyguanosine derivatives nor cleavage of dimethoxytrityl
(DMTr), allyl (All), allyloxycarbonyl (AOC), tert-butyldimeth-
ylsilyl (TBDMS), 2-cyanoethyl, and acyl protecting group. The
results of the preparation using N-PhIMT as the promoter are
representatively listed in Table 1.
Notable efficiency of the azolium promoters was also
observed in the formation of 2′-5′ and 3′-5′ interribonucleotide
linkage using 3′-O-(tert-butyldimethylsilyl)ribonucleoside 2′-
(phosphoramidite)s and 2′-O-(tert-butyldimethylsilyl)ribonucleo-
side 3′-(phosphoramidite)s, respectively.32 The reactivity of
several azolium reagents, such as IMP, N-PhIMT, N-PhIMP,
N-AcPhIMT, BIT, and N-MeBIT, was representatively exam-
ined by the condensation of 21 and 24, conducted at 25 °C for
5 min by the use of 0.02 mmol each of 21, 24, and the promoter
in a 0.1 M acetonitrile solution of the reactants and the promoter
under conditions similar those described above for the reaction
using the deoxyribonucleoside phosphoramidite. In addition, the
reactivities of ETT, which is among the best invented so far
Figure 1. Reactivity of promoters estimated by yield of the product
15 (31P NMR assay) obtained by the condensation of 4 and 11 with
equimolar amounts (0.02 mmol) of these reactants and the promoter
in a 0.02 M acetonitrile solution (25 °C, 1 min), followed by TBHP
oxidation (25 °C, 5 min).
(phenyl)benzimidazolium triflate, and 2-(phenyl)benzimidazo-
lium perchlorate. First, the reactivity of these azolium promoters
was screened by the condensation of the thymidine 3′-(allyl N,N-
diisopropylphosphoramidite) 4 and the 5′-O-free thymidine 11
in the presence of powdery molecular sieves (MS) 3A26 at 25
°C, where the promoter, the phosphoramidite, and the nucleoside
were used in 0.02 mmol amounts each in a 0.02 M acetonitrile
solution. As the control experiment, condensation using 1H-
tetrazole, NPT, PyTFA, PyTFB, N-MeANTFA, DCI, or BrDCI
as the promoter was also carried out under similar conditions.
The reaction was quenched after 1 min by the addition of a 1.0
M TBHP/toluene solution.27 The mixture was then stirred at
25 °C for 5 min to oxidize the resulting dinucleoside phosphite
to the phosphate 15. The reactivity of promoters was evaluated
on the basis of the yield of 15, determined by the 31P NMR
assay. Figure 1 summarizes the reactivity of several promoters
thus obtained. Among the azolium salts, N-PhIMT and N-PhIMP
showed much better reactivity than existing promoters including
BrDCI and PyTFB, which are among the most reactive
promoters reported so far;28 N-MeBIT, N-AcPhIMT, and
N-PhIMTFB also demonstrated reactivity comparable to that
of BrDCI or PyTFB. IMT29 and BIT exhibited better reactivity
than 1H-tetrazole, but the reactivities of these were lower than
those of BrDCI, PyTFB, and NPT. N-MeIMT, which was
previously reported as an efficient promoter,30 has a low grade
of reactivity among the azolium reagents.
(27) Hayakawa, Y.; Uchiyama, M.; Noyori, R. Tetrahedron Lett. 1986,
27, 4191-4194.
(28) Caruthers et al. reported in ref 8b that PyTFB causes detritylation
to some extent (ca. 5%) in cases using an excess amount of this promoter
with respect to the 5′-O-dimethoxytrityl nucleoside phosphoramidite. Thus,
this reagent seems to be unreliably useful for the phosphoramidite approach.
However, according to our experiments, the detritylation does not take place
in the reaction of 5′-O-dimethoxytrityl deoxyribonucleotide 3′-(allyl N,N-
diisopropylphosphoramidite) or 3′-(2-cyanoethyl N,N-diisopropylphosphor-
amidite) and a 5′-O-free deoxyribonucleoside with a stoichiometric amount
of PyTFB with respect to the phosphoramidite in the presence of MS 3A.
In this manner, an excellent yield of the desired product is obtained. In
addition, PyTFB can be prepared at a lower cost than the acid/azole
complexes as a nonhygroscopic, stable powdery material. Therefore, PyTFB
may be a very useful promoter for the solution-phase synthesis of
deoxyribonucleotides via the procedure described in the present paper.
However, this reagent is not useful for the solid-phase synthesis, which
requires the use of an excess amount of the promoter; this case causes
detritylation and related undesirable side reactions.
(26) We previously reported that it is necessary to use 1.2-1.5 equiv
each of the nucleoside phosphoramidite and the promoter with respect to
the nucleoside for obtaining satisfactory results.25a However, the current
investigation revealed that the reaction in the presence of powdery MS 3A
can be achieved by the use of only 1.0 equiv each of the nucleoside
phosphoramidite, the promoter, and the nucleoside. This reaction was very
cleanly performed; the molecular sieves cause no damage to the reactants,
the promoter, and the nucleotide product. MS 3A may remove water
contaminating the solvent and/or reactants and consequently prevent the
decomposition of the moisture-sensitive phosphoramidite and/or interme-
diately formed reactive species. In fact, in the reaction without MS 3A, the
nucleoside H-phosphonate resulting from hydrolysis of the phosphoramidite
or the reactive intermediate was formed to some extent, thus decreasing
the yield of the desired product. Details of the effect of MS 3A in the
solution-phase phosphoramidite approach are now being investigated and
will be reported in a separated paper in the future.
(29) Although IMT does not have extremely high reactivity, this reagent
shows excellent chemoselectivity toward the N-unprotected derivatives,
allowing for the facile oligodeoxyribonucleotide synthesis without nucleoside
base protection (see ref 25f).
(30) According to ref 24b, N-MeIMT allowed for one-base elongation
in an over 98% yield in the solid-phase synthesis of oligodeoxyribonucleo-
tides via the 2-cyanoethyl-N,N-diisopropylphosphoramidite method. How-
ever, as shown Figure 1, this reagent is less reactive than related azolium
reagents including N-PhIMT, N-PhIMP, N-MeBIT, N-AcPhIMT, N-
PhIMTFB, IMT, and BIT in the solution-phase reaction carried out in our
laboratory. The reactivity is also lower than some non-azolium salt-type
reagents such as PyTFB, N-MeANTFA, and NPT.
(31) Kataoka, M.; Hattori, A.; Okino, S.; Hyodo, M.; Asano, M.; Kawai,
R.; Hayakawa, Y. Org. Lett. 2001, 3, 815-818.

8168 J. Am. Chem. Soc., Vol. 123, No. 34, 2001
Hayakawa et al.
Table 1. Synthesis of Dideoxyribonucleoside Phosphates Using
N-PhIMT as the Promotera
Figure 2. Reactivity of promoters estimated by yield of the product
28 (31P NMR assay) obtained by the condensation of 21 and 24 by the
stoichiometric (0.02 mmol each) use of these reactants and the promoter
in a 0.1 M acetonitrile solution (25 °C, 5 min), followed by TBHP
oxidation (25 °C, 5 min).
Table 2. Synthesis of Diribonucleoside Phosphates Using
N-PhIMT as the Promotera
amidite nucleoside reaction time, min product
yield, %b
1
2
3
4
5
6
7
8
11
9
5
1
12
13
14
15
16
17
18
19
100, 99c
91
9
5
98, >95c
100, 99c
86
11
10
11
11
11
1
5
3
88
10
3
96, 89c
97
a The preparation was carried out on a 0.1-mmol scale in a 0.1 M
solution of the promoter and reactants in acetonitrile. b Determined by
31P NMR analysis unless otherwise noted. c Isolated yield.
amidite
nucleoside
reaction time, min
product
yield, %b
20
21
21
22
23
24
24
26
25
26
10
15
15
15
15
27
28
29
30
31
95
96
97
96
96
for ribonucleotide synthesis, and BrDCI and PyTFB, which
showed the highest reactivity among the existing promoters in
the deoxyribonucleotide synthesis, were also checked in the
same reaction under similar conditions, to serve as a control.
The reactivity was estimated from the yield of the dinucleoside
phosphate 28 obtained after TBHP oxidation of the resulting
dinucleoside phosphite. The results are indicated in Figure 2.
Among the promoters, N-PhIMT is the most reactive, complet-
a The preparation was carried out on a 0.1-mmol scale. b Isolated
yield.
ing the condensation in 5 min. N-MeBIT and BIT also serve as
good promoters, showing similar reactivity. In comparison with
these three reagents, IMP, N-PhIMP, and N-AcPhIMT are
slightly less reactive. ETT, BrDCI, and PyTFB are much less
reactive than all of the above, requiring longer periods for
completion of the reaction. Similar results were obtained in
reactions using other ribonucleoside 3′-phosphoramidites, such
as 20, 22, and 23, and nucleosides, such as 25 and 26. Thus,
the azolium reagent allowed for the general, efficient synthesis
of diribonucleoside phosphates using stoichiometric amounts
of starting materials. For example, 27-31 were prepared in
excellent yields by the use of suitable building blocks among
20-26 and an azolium promoter such as N-PhIMT, BIT, and
(32) Oligoribonucleotides joined by 2′-5′ linkages are an important class
of substances, whose physicochemical and biochemical properties have
recently attracted considerable attention. For representative reports on the
synthesis and properties of 2′-5′-linked oligoribonucleotides, see: (a) Wu,
T.; Ogilvie, K. K. J. Org. Chem. 1990, 55, 4717-4724. (b) Kierzek, R.;
He, L.; Turner, D. H. Nucleic Acids Res. 1992, 20, 1685-1690. (c)
Kandimalla, E. R.; Manning, A.; Zhao, Q.; Shaw, D. R.; Byrn, R. A.;
Sasisekharan, V.; Agrawal, S. Nucleic Acids Res. 1997, 25, 370-378. (d)
Wasner, M.; Arion, D.; Borkow, G.; Noronha, A.; Uddin, A. H.; Parniak,
M. A.; Damha, M. J. Biochemistry 1998, 37, 7478-7486 and references
therein. (e) Damha, M. J.; Noronha, A. Nucleic Acids Res. 1998, 26, 5152-
5156. (f) Burlina, F.; Fourrey, J.-L.; Lefort, V.; Favre, A. Tetrahedron Lett.
1999, 40, 4559-4562.

Acid/Azole Promoters of the Phosphoramidite Method
J. Am. Chem. Soc., Vol. 123, No. 34, 2001 8169
N-MeBIT. Table 2 summarizes some examples of the prepara-
tion using N-PhIMT as the promoter. On the other hand, the
condensation of the nucleoside 24 and the ribonucleoside 2′-
phosphoramidite 32 for the formation of the 2′-5′ internucleo-
tide linkage was achieved more slowly even with N-PhIMT,
requiring 20 min for completion under similar conditions; the
reaction, after oxidation, gave 33 in a 96% yield. In contrast,
the ETT-promoted reaction of 24 and 32 was not completed
for 20 min to give the desired coupling product in a 69% yield
at this stage.
metic amounts of 34 and 35 (25 °C, 5 min). The product 36
was converted to 37 by the reported procedure.34f
Another example of the utility of N-PhIMT for the synthesis
of biologically important substances is the synthesis of adenylyl-
(2′-5′)adenylyl(2′-5′)adenosine (2-5A core) (39).36-38 Thus,
the 5′-O-DMTr protecting group of the above-obtained product
33 was removed by exposure to dichloroacetic acid to provide
the 5′-O-free derivative in a 91% yield. The 5′-O-free nucleoside
was then reacted with 32 (1.0 equiv) with the assistance of
N-PhIMT (1.0 equiv), and the resulting dinucleoside phosphite
was oxidized by a TBHP/toluene solution (2.0 equiv) to give
the fully protected 2-5A core 38. Finally, 38 was deprotected
by the standard method39 to give the target compound 39 in
about 60% overall yield from 33. In this synthesis, the key 2′-
5′ interribonucleotide linkage formation was performed to
produce a higher yield by the method using N-PhIMT rather
than by using ETT.
Solid-Phase Synthesis of Oligodeoxyribonucleotides and
Oligoribonucleotides. Some azolium salts also served as
(34) For previous chemical syntheses of CMP-Neu5Ac and its analogues,
see: (a) Simon, E. S.; Bednarski, M. D.; Whitesides, G. M. J. Am. Chem.
Soc. 1988, 110, 7159-7163. (b) Kondo, H.; Ichikawa, Y.; Wong, C.-H. J.
Am. Chem. Soc. 1992, 114, 8748-8750. (c) Martin, T. J.; Schmit, R. R.
Tetrahedron Lett. 1993, 34, 1765-1768. (d) Makino, S.; Ueno, Y.; Ishikawa,
M.; Hayakawa, Y.; Hata, T. Tetrahedron Lett. 1993, 34, 2775-2778. (e)
Kajihara, Y.; Koseki, K.; Ebata, T.; Kodama, H.; Matsushita, H.; Hashimoto,
H. Carbohydr. Res. 1994, 264, C1-C5. (f) Kajihara, Y.; Ebata, T.; Koseki,
K.; Komada, H.; Matsushita, H.; Hashimoto, H. J. Org. Chem. 1995, 60,
5732-5735. (g) Chappell, M. D.; Halcomb, R. L. Tetrahedron 1997, 53,
11109-11120. (h) Kajihara, Y.; Ebata, T.; Kodama, H. Angew. Chem., Int.
Ed. 1998, 37, 3166-3169. (i) Miyazaki, T.; Sakakibara, T.; Sato, H.;
Kajihara, Y. J. Am. Chem. Soc. 1999, 121, 1411-1412. (j) Miyazaki, T.;
Sato, H.; Sakakibara, T.; Kajihara, Y. J. Am. Chem. Soc. 2000, 122, 5678-
5694. (k) Cohen, S. B.; Halcomb, R. J. Org. Chem. 2000, 65, 6145-6152.
(35) (a) Beyer, T. A.; Sadler, J. E.; Rearick, J. I.; Paulson, J. C.; Hill, R.
L. AdV. Enzymol. Relat. Areas Mol. Biol. 1981, 52, 23-175. (b) Okamoto,
K.; Goto, T. Tetrahedron 1990, 46, 5835-5857.
(36) (a) Roberts, W. K.; Hovanessian, A. G.; Brown, R. E.; Clemens,
M. J.; Kerr, I. M. Nature (London) 1976, 264, 477-480. (b) Hovanessian,
A. G.; Kerr, I. M. Eur. J. Biochem. 1978, 84, 149-159. (c) Kerr, I. M.;
Brown, R. E. Proc. Natl. Acad. Sci. U.S.A. 1978, 75, 256-260. (d) Farrell,
P. J.; Sen, G. C.; Dubois, M. F.; Ratner, L.; Slattery, E.; Lengyel, P. Proc.
Natl. Acad. Sci. U.S.A. 1978, 75, 5893-5897. (e) Ball, L. A. Virology 1979,
94, 282-296.
(37) For the biological activities of the 2-5A core, see: (a) Williams,
B. R. G.; Kerr, I. M. Nature (London) 1978, 276, 88-90. (b) Gresser, I.;
Tovey, M. G. Biochim. Biophys. Acta 1978, 516, 231-247. (c) Devash,
Y.; Gera, A.; Willis, D. H.; Reichman, M.; Pfleiderer, W.; Charubala, R.;
Sela, I.; Suhadolnik, R. J. J. Biol. Chem. 1984, 259, 3482-3486. (d) Rhodes,
C. J.; Taylor, K. W. FEBS Lett. 1985, 180, 69-73. (e) Tominaga, A.; Saito,
S.; Kohno, S.; Sakurai, K.; Hayakawa, Y.; Noyori, R. Microbiol. Immunol.
1990, 34, 737-747.
Application of the New Method to the Synthesis of
Biologically Important Substances. The phosphoramidite
approach with N-PhIMT was applied for the synthesis of some
biologically attractive compounds, showing higher efficiency
than the method using 1H-tetrazole. One notable example was
the preparation of 36, which is a precursor for the synthesis of
cytidine-5′-monophosphono-N-acetylneuraminic acid (CMP-
Neu5Ac) (37),33,34 acting as a source of sialic acid in the
sialyltransferase-catalyzed biosynthesis of sialyl oligosaccha-
rides.35 The compound 36 was provided via the condensation
of 34 and 35. This condensation has been previously achieved
by the use of 1H-tetrazole as the promoter, where excess
amounts of the phosphoramidite 35 and 1H-tetrazole with
respect to the alcohol 34 are required for obtaining an acceptable
yield of 36.34d,f For example, it was reported that 36 was
produced in an 83% yield by the reaction using 3.5 equiv each
of 35 and 1H-tetrazole with respect to 34 (-40 to 25 °C, 30
min).34f In contrast, in the case using N-PhIMT as the promoter,
36 was obtained in a comparable yield by the use of stoichio-
(33) Schauer, R. AdV. Carbohydr. Chem. Biochem. 1982, 40, 131-234.

8170 J. Am. Chem. Soc., Vol. 123, No. 34, 2001
Hayakawa et al.
efficient promoters for the solid-phase synthesis of DNA and
RNA oligomers via the O-allyl/N-AOC-protected40 and O-(2-
cyanoethyl)/N-acetyl,phenoxyacetyl (PAC)-protected41 phos-
phoramidite methods.
We first examined the synthesis of a DNA oligomer,
5′CGACACCCAATTCTGAAAAT3′ (20mer) (40), via the allyl/
AOC-protected approach using 1, 2, 3, and 4 as monomer units,
starting from thymidine 41 covalently attached at the 3′-hydroxyl
to high-cross-linked polystyrene resins,42 via a long-chain
alkylamine spacer arm.43 The synthesis was conducted on a 0.2-
µmol scale. In this synthesis, selection of the promoter was very
important for obtaining desirable results. For example, according
to the trityl assay, chain elongation with BIT was performed to
achieve an average yield of 99.5% (overall yield, 91.7%). In
contrast, the average coupling yield in the elongation using the
promoter N-PhIMT or N-MeBIT in place of BIT exceeded 100%
and indicated the occurrence of some side reactions.44 After the
chain elongation, allylic protecting groups were removed on
the solid supports by the Pd2[(C6H5CHdCH)2CO]3‚CHCl3-
mediated reaction,45 and then the target product 40 was detached
from the supports by exposure to concentrated ammonia. The
synthesis of 40, according to the cyanoethyl/acetyl,PAC-
(38) For previously reported, representative synthesis of 2-5A-related
compounds via the phosphoramidite approach, see: (a) Charubala, R.;
Pfleiderer, W. HelV. Chim. Acta 1992, 75, 471-479. (b) Beigelman, L.;
Matulic-Adamic, J.; Haeberli, P.; Usman, N.; Dong, B.; Silverman, R. H.;
Khamnei, S.; Torrence, P. F. Nucleic Acids Res. 1995, 23, 3989-3994. (c)
Hayakawa, Y.; Hirose, M.; Noyori, R. Tetrahedron 1995, 51, 9899-9916.
(d) Schirmeister-Tichy, H.; Iacono, K. T.; Muto, N. F.; Homan, J. W.;
Suhadolnik, R. J.; Pfleiderer, W. HelV. Chim. Acta 1999, 82, 597-613. (e)
Cramer, H.; Player, M. R.; Torrence, P. F. Bioorg. Med. Chem. Lett. 1999,
9, 1049-1054.
(39) Deprotection was carried out by successive treatment with (1)
dichloroacetic acid for removing the 5′-O-DMTr group, (2) a catalytic
amount of Pd[P(C6H5)3]4 in the presence of P(C6H5)3 and diethylammonium
hydrogencarbonate in dichloromethane for eliminating the allyl and AOC
protecting groups, and (3) tetrabutylammonium fluoride in THF for removal
of the TBDMS protecting group.
(40) For the representative solid-phase synthesis of oligonucleotides and
related compounds via the allyl-protected phosphoramidite method, see refs
3, 25c, and 25d. See also: (a) Matray, T. J.; Greenberg, M. M. J. Am.
Chem. Soc. 1994, 116, 6931-6932. (b) Matray, T. J.; Haxton, K. J.;
Greenberg, M. M. Nucleic Acids Res. 1995, 23, 4642-4648. (c) Bergmann,
F.; Bannwarth, W. Tetrahedron Lett. 1995, 36, 1839-1842. (d) Greenberg,
M. M.; Matray, T. J. Biochemistry 1997, 46, 14071-14079. (e) Greenberg,
M. M.; Barvian, M. R.; Cook, G. P.; Goodman, B. K.; Matray, T. J.;
Tronche, C.; Venkatesan, H. J. Am. Chem. Soc. 1997, 119, 1828-1839. (f)
Bogdan, F. M.; Chow, C. S. Tetrahedron Lett. 1998, 39, 1897-1900. (g)
Manoharan, M.; Lu, Y.; Casper, M. D.; Just, G. Org. Lett. 2000, 2, 243-
246.
Figure 3. CGE and MALDI-TOF mass profiles of crude products of
the DNA oligomer 40. (A) Prepared via the O-allyl/N-AOC-protected
method using BIT as the promoter. (B) Prepared via the O-cyanoethyl/
N-acyl,PAC-protected method using N-PhIMT as the promoter. MALDI-
TOF mass: calcd for C194H246O114N76P19 (M + H) m/z 6052.08.
protected strategy, was also investigated. The chain elongation
was performed using 6, 8, 42, and 43 as monomer units and
N-PhIMT as the promoter. The average coupling yield was
99.9% (overall yield, 97.8%). The resulting product was treated
with concentrated ammonia to give 40. The structure of 40 was
confirmed by MALDI time-of-flight (TOF) mass analysis
(Figure 3). Capillary gel electrophoresis (CGE) (Figure 3)
indicated that oligomers prepared by allyl/AOC-protected and
cyanoethyl/acetyl,PAC-protected approaches have excellent
purity, even in their crude forms.
(41) For representative oligodeoxyribonucleotide synthesis via the PAC-
protected phosphoramidite method in a solid phase, see: Schulhof, J. C.;
Molko, D.; Teoule, R. Nucleic Acids Res. 1987, 15, 397-416. See also ref
25f.
(42) In the case of solid-phase synthesis, the choice of solid supports is
rather important for obtaining high product yields. According to the trityl
assay, the use of high-cross-linked polystyrene resins gave the best results
in the synthesis of oligodeoxyribonucleotides, and the average yield of one-
base elongation was generally >99.5%. By contrast, the use of controlled
pore glass (pore size, 500 Å) decreased the average coupling yield to some
extent (99.1% average).
(43) Efcavitch, J. W.; McBride, L. J.; Eadie, J. S. In Biophosphates and
Thier Analogues: Bruzik, K. S., Stec, W. J., Eds.; Bioactive Molecules
Series 3; Elsevier: Amsterdam, 1987; pp 65-70.
(44) According to some control experiments, treatment of a nucleoside
3′-(allyl N,N-diisopropylphosphoramidite) with N-PhIMT in acetonitrile
generates some extremely reactive species which react with thymine base
at the N(3) or O4 position to give undesired products (structure of byproducts
is not determined). Thus, it is conceived that coupling yields exceeding
100% arise from such byproducts formed by the use of excess amounts of
the phosphoramidite and N-PhIMT.
(45) (a) Hayakawa, Y.; Kato, H.; Uchiyama, M.; Kajino, H.; Noyori, R.
J. Org. Chem. 1986, 51, 2400-2402. (b) Hayakawa, Y.; Hirose, M.; Noyori,
R. Nucleosides Nucleotides 1989, 8, 867-870. (c) Hayakawa, Y.; Waka-
bayashi, S.; Kato, H.; Noyori, R. J. Am. Chem. Soc. 1990, 112, 1691-
1696.
The synthesis of RNA oligomers on a solid support was
efficiently achieved via the strategy using N-PhIMT as the
promoter. First, we compared the effectiveness of N-PhIMT and

Acid/Azole Promoters of the Phosphoramidite Method
J. Am. Chem. Soc., Vol. 123, No. 34, 2001 8171
Figure 4. HPLC profiles of crude products of ACGACUACUU (44):
(A) prepared using N-PhIMT as the promoter; (B) prepared using ETT
as the promoter. Conditions: COSMOSIL 5C18-MS column (4.6 ×
250 mm); buffer A, 5% acetonitrile-0.1 M ammonium acetate; buffer
B, 25% acetonitrile-0.1 M ammonium acetate; gradient, linear 0 to
12.5% B in 30 min; detection: 260 nm; flow rate, 1.0 mL/min;
temperature, 40 °C.
Figure 5. HPLC (A) and MALDI-TOF mass (B) profiles of crude
products of AGCUACGUGACUACUACUUU (46). HPLC condi-
tions: COSMOSIL 5C18-MS column (4.6 × 250 mm); buffer A, 5%
acetonitrile-0.1 M ammonium acetate; buffer B, 25% acetonitrile-
0.1 M ammonium acetate; gradient, linear 0 to 50% B in 30 min;
detection, 260 nm; flow rate, 1.0 mL/min; temperature, 40 °C. MALDI-
TOF mass: calcd for C188H235O140N69P19 (M + H) m/z 6286.84, found
m/z 6287.71.
ETT in the preparation of a 10mer, 5′ACGACUACUU3′ (44),
on a 0.2-µmol scale with a 0.1 M acetonitrile solution of
monomer units, 20, 21, 22, and 23, and a 0.1 M acetonitrile
solution of the promoter.46 Chain elongation was carried out,
starting from the uridine derivative 45 anchored on controlled
pore glass (CPG) supports (pore size, 500 Å).47 The average
coupling yield per elongation cycle was 99.4% in the synthesis
using N-PhIMT; an overall coupling yield of 94.4% was
achieved. On the other hand, the average and overall yields in
the synthesis using ETT were 89.6% and 37.3%, respectively.
These results indicate that N-PhIMT is much more effective
than ETT. The target oligonucleotide 44 was isolated through
(1) removal of allylic protectors using Pd2[(C6H5CHdCH)2CO]3‚
CHCl3,45 (2) detachment of the product from the solid supports
using concentrated ammonia, and (3) deblocking of the silyl
protecting groups of 2′-hydroxyls using triethylamine/3HF
complex.48 Figure 4 exhibits the HPLC profile of the crude
products obtained via these two methods using N-PhIMT and
ETT as the promoter. This result indicates that N-PhIMT-assisted
synthesis affords a much purer product than does the ETT-
assisted approach; these findings demonstrate the superiority
of N-PhIMT over ETT. The method using N-PhIMT is also
effective for the synthesis of longer oligomers. For example,
5′AGCUACGUGACUACUACUUU3′ (46) (20mer) was simi-
larly prepared in a high yield. The chain elongation was carried
out with a 0.1 M acetonitrile solution of the phosphoramidite
building blocks and a 0.25 M acetonitrile solution of the
promoter in a 98.8% average coupling yield (overall yield,
78.8%). The purity of the fully deprotected product 46 was quite
high, even in its crude form, as exhibited on the HPLC and
MALDI-TOF mass profiles (Figure 5).
complex reagent shows higher reactivity than 1H-tetrazole may
be explained as follows.
First, we carried out a typical condensation of 4 and 11
assisted by IMP in order to elucidate the mechanism of the
azolium salt-promoted reaction, and the reaction profile was
monitored by 31P NMR measurement. Addition of an equimolar
amount of IMP to a solution of 4 in CD3CN in the absence of
11 eradicated the 31P singlets due to 4 (two diastereomers)
observed at δ 147.3 and 147.6 ppm (two diastereomers) within
3 min; a new broad 31P singlet appeared at δ 125.8 ppm,
suggesting the formation of the phosphorimidazolidite 47.
Subsequent addition of 1 equiv of 11 to this mixture instanta-
neously led to the disappearance of the signals due to 47. Instead,
two 31P singlets appeared at δ 140.3 and 140.5 ppm, thus
suggesting the formation of the dinucleoside phosphite 50 (two
diastereomers). The 1H NMR analysis also supported this
pathway. Further, the IMP-promoted reaction of 4 and 11, in
which the reactants and the promoter were mixed together in
equimolar amounts from the initial stage, was conducted in a
0.05 M solution in CD3CN at 0 °C, and the reaction profile
was monitored from the 31P NMR spectrum. In this reaction,
the signals due to 4 gradually decreased, and, according to the
consumption of 4, signals indicating the formation of 50 were
increased; in contrast, no signals due to the phosphorimidazo-
lidite 47 were observed at any time. These observations indicate
that the consumption of 47 is faster than the formation of 47.
Thus, the rate-determining step in this reaction is the formation
of 47, i.e., the reaction of the protonated phosphoramidite and
the azole. On the basis of these results, Scheme 1 is proposed
as a mechanism for the condensation of a nucleoside phos-
phoramidite and a nucleoside using an azolium salt, AzH+X-
Explanation for the Higher Reactivity of the Azolium
Promoter than 1H-Tetrazole. The reason that the acid/azole
(46) To render the difference between the efficiency of N-PhIMT and
ETT as plain as possible, the synthesis was conducted using a very low-
concentration solution of the promoter. In this case, a clear result was
obtained as expected, showing that N-PhIMT is more efficient than ETT.
When a higher concentration (e.g., 0.25 M) solution of the promoter was
employed, ETT also afforded a high yield of satisfactorily pure oligonu-
cleotide.
(47) In the synthesis of oligoribonucleotides, CPG performs better than
high-cross-linked polystyrene resins as the solid supports, thus providing a
higher yield of the chain elongation.
(48) (a) Gasparutto, D.; Livache, T.; Bazin, H.; Duplaa, A.-M.; Guy,
A.; Khorlin, A.; Molko, D.; Roget, A.; Te´oule, R. Nucleic Acids Res. 1992,
20, 5159-5166. (b) Westman, E.; Stro¨mberg, R. Nucleic Acids Res. 1994,
22, 2430-2341. (c) Pirrung, M. C.; Fallon, L.; Lever, D. C.; Shuey, S. W.
J. Org. Chem. 1996, 61, 2129-2136.

8172 J. Am. Chem. Soc., Vol. 123, No. 34, 2001
Hayakawa et al.
(HX ) a strong acid; Az ) an azole). Thus, the promoter first
acts as an acid, activating the phosphoramidite 51 by protonation
and forming the activated species 52. This activation cogenerates
a free azole. Subsequently, the resulting azole, but not the less
reactive conjugate base X- of the acid, reacts with 52 to form
the phosphorazolidite 53. Finally, 53 condenses with a nucleo-
side (NucOH) to provide the dinucleoside phosphite 54 and to
regenerate the free azole.49 In this pathway, the second step is
the slowest.
Scheme 2
Scheme 1
imidazole‚H+, 239.7 kcal mol-1; and 1H-tetrazole, 335.8 kcal
mol-1 51
These results suggest that the acidity of azolium salts
.
is higher than or comparable to that of 1H-tetrazole. Subse-
quently, the following examination indicated that the azole is
more reactive than the tetrazolide anion toward the activated
phosphoramidite. Thus, the reaction of 4 with a 1:1:1 mixture
of 1H-tetrazole, benzimidazole,53 and diisopropylammonium
tetrazolide was carried out in acetonitrile (25 °C) and monitored
from the 31P NMR spectrum. In this reaction, 1H-tetrazole,
which is more acidic than benzimidazole [pKa 13 (H2O)], acted
as the proton-transferring agent to 4 to generate the correspond-
ing protonated phosphoramidite and the tetrazolide anion. The
activated phosphoramidite then underwent a nucleophilic attack
from benzimidazole to give the phosphorobenzimidazolidite 49
(δ 129.3 and 130.4 ppm25a). In contrast, no formation of the
phosphorotetrazolidite 48 (δ ca. 127 ppm50a,b), which results
from the reaction between the phosphoramidite and the tetra-
zolide anion, was observed from the early stage to the last stage
of the reaction. This result, particularly the lack of phospho-
rotetrazolidite production at the last stage despite the presence
of a larger amount of the tetrazolide anion than benzimidazole,
suggests that benzimidazole is more reactive than the tetrazolide
anion toward the protonated phosphoramidite. Consequently,
the azolium reagent may serve as a more reactive promoter than
1H-tetrazole in the phosphoramidite method.
In contrast, the 1H-tetrazole (TetH)-promoted condensation
of a nucleoside phosphoramidite and a nucleoside proceeds
through the mechanism illustrated in Scheme 2.50 Thus, the 1H-
tetrazole protonates the phosphoramidite 51 to produce 55.
Subsequently, 55 undergoes a nucleophilic attack by the
tetrazolide anion that is generated in the first step; this process
gives the reactive phosphorotetrazolidite 56. Finally, 56 reacts
with a nucleoside to afford 54. In this pathway, the rate-
determining step is the conversion of 55 to 56, i.e., the reaction
between the protonated phosphoramidite and the tetrazolide
anion.50a
According to the mechanisms shown in Schemes 1 and 2,
the reaction rate depends on the concentration of the protonated
phosphoramidite, which is affected in both cases by the acidity
of the promoter, and/or in the former and latter cases the
reactivity of the azole and the tetrazolide anion, respectively,
to the activated phosphoramidite. Therefore, we next attempted
to elucidate the acidity of IMP, BIT, and N-PhIMT, as typical
azolium salts, and 1H-tetrazole, and the nucleophilicity of
benzimidazole, N-(phenyl)imidazole, and the tetrazolide anion.
First, the acidities of these reagents were estimated by two
methods. The pKa values measured in aqueous solvents were
as follows: IMP, 7.0 (H2O); BIT, 4.5 (1:1 ethanol-H2O);
N-PhIMT, 6.2 (H2O); and 1H-tetrazole, 4.8 (H2O).51 In addition,
the energies of proton dissociation as calculated by ab initio
methods52 were found to be as follows: imidazole‚H+, 233.9
kcal mol-1; benzimidazole‚H+, 236.2 kcal mol-1; N-(phenyl)-
Conclusion
We demonstrate the efficiency of certain acid salts of
imidazole and benzimidazole derivatives such as N-PhIMT,
N-AcPhIMT, BIT, and N-MeBIT as powerful promoters for
synthesis of oligodeoxyribonucleotides and oligoribonucleotides
via the phosphoramidite approach. The reactivity of these
reagents is comparable to the reactivity of BrDCI and PyTFB
and is higher than the reactivity of other existing promoters in
the solution-phase deoxyribonucleotide synthesis using con-
ventional phosphoramidites such as the allyl N,N-diisopropyl-
phosphoramidite and the 2-cyanoethyl N,N-diisopropylphos-
phoramidite. Among the azolium promoters, N-PhIMT is highly
efficient, overwhelming the capacity of both ETT and PyTFB
in the construction of an inter-ribonucleotide bond with low
reactive 2′-O-(tert-butyldimethylsilyl)ribonucleoside 3′-(N,N-
diisopropylphosphoramidite)s and 3′-O-(tert-butyldimethylsilyl)-
ribonucleoside 2′-(N,N-diisopropylphosphoramidite)s. One ad-
vantage of the present method using azolium promoters is that,
even in the case using such a low reactive phosphoramidite,
the smooth, high-yield reaction with a 5′-O-free nucleoside is
achieved by the use of the phosphoramidite, the nucleoside, and
the promoter in an equimolar ratio in a solution phase. In
(49) Since azoles such as imidazole and benzimidazole are generally less
basic than amines such as diisopropylamine generated from the phosphor-
amidite as the reaction progresses, it is conceivable that the azole exists
mainly in the unprotonated form, thus retaining its high nucleophilicity.
(50) For the mechanism of condensation of a nucleoside phosphoramidite
and a nucleoside using 1H-tetrazole as a promoter, see: (a) Dahl, B. H.;
Nielsen, J.; Dahl, O. Nucleic Acids Res. 1987, 15, 1729-1743. (b) Barone,
A. D.; Tang, J.-Y.; Caruthers, M. H. Nucleic Acids Res. 1984, 12, 4051-
4061. (c) Berner, S.; Mu¨hlegger, K.; Seliger, H. Nucleic Acids Res. 1989,
17, 853-864. For related works, see: (d) Nurminen, E. J.; Mattinen, J. K.;
Lo¨nnberg, H. J. Chem. Soc., Perkin Trans. 2 1998, 1621-1628. (e)
Nurminen, E. J.; Mattinen, J. K.; Lo¨nnberg, H. J. Chem. Soc., Perkin Trans.
2 1999, 2551-2556. (f) Nurminen, E. J.; Mattinen, J. K.; Lo¨nnberg, H. J.
Chem. Soc., Perkin Trans. 2 2000, 2238-2240.
(51) The pKa strongly depends on the type of solvent. Accordingly, the
numerical values obtained in aqueous solvents might not be same as those
obtained in acetonitrile. However, the relative strength of acids in acetonitrile
could be estimated from these values. Similarly, the proton dissociation
energy values would tentatively indicate the relative strengths of the acids.
(52) Geometry optimization was carried out at the B3LYP/6-31+G**
level.
(53) The 31P NMR chemical shift of the phosphorimidazolidite is very
similar to that of the phosphorotetrazolidite as described. Thus, in the
reaction using imidazole, it might be very difficult to elucidate the structure
of the product, i.e., the phosphorimidazolidite or the phosphorotetrazolidite,
by 31P NMR analysis. Therefore, benzimidazole was used as the azole in
this experiment.

Acid/Azole Promoters of the Phosphoramidite Method
J. Am. Chem. Soc., Vol. 123, No. 34, 2001 8173
(Aldrich), trifluoroacetic acid (Kishida), hydroperchloric acid (Wako),
tetrafluoroboric acid (Aldrich), hexafluorophosphoric acid (Aldrich),
N6-(benzoyl)-5′-O-(p,p′-dimethoxytrityl)-2′-deoxyadenosine 3′-(2-cy-
anoethyl N,N-diisopropylphosphoramidite) (5) (Glen Research), N4-
(acetyl)-5′-O-(p,p′-dimethoxytrityl)-2′-deoxycytidine 3′-(2-cyanoethyl
N,N-diisopropylphosphoramidite) (6) (Glen Research), N2-(isobutyryl)-
5′-O-(p,p′-dimethoxytrityl)-2′-deoxyguanosine 3′-(2-cyanoethyl N,N-
diisopropylphosphoramidite) (7) (Glen Research), and 5′-O-(p,p′-di-
methoxytrityl)thymidine 3′-(2-cyanoethyl N,N-diisopropylphosphor-
amidite) (8) (Glen Research), Primer Support T (41) (Amersham
Pharmacia Biotech), N6-(phenoxyacetyl)-5′-O-(p,p′-dimethoxytrityl)-
2′-deoxyadenosine 3′-(2-cyanoethyl N,N-diisopropylphosphoramidite)
(42) (Amersham Pharmacia Biotech), N2-(p-isopropylphenoxyacetyl)-
5′-O-(p,p′-dimethoxytrityl)-2′-deoxyguanosine 3′-(2-cyanoethyl N,N-
diisopropylphosphoramidite) (43) (Amersham Pharmacia Biotech), the
uridine derivative anchored on CPG (45) (pore size, 500 Å, Milligen
or Glen Research), a 2-butanone peroxide/dimethyl phthalate solution
(Kishida), and Pd[P(C6H5)3]4 (Aldrich) were commercially supplied.
The following compounds and a solution are reported in the literature
or prepared by reported methods: azolium salts imidazolium triflate,25f
imidazolium perchlorate56 N-(methyl)imidazolium triflate,24 N-(phen-
yl)imidazolium perchlorate,56 and benzimidazolium triflate;25a protected
2′-deoxyribonucleoside 3′-phosphoramidites 1,45c,57 2,45c,57 3,45c,57 and
4;45c 3′-O-protected 2′-deoxyribonucleosides 9,45a 10,58 and 11;59
dideoxyribnonucleoside phosphates 17,31 18,31 and 19;25a protected
ribonucleoside 3′-phosphoramidites 20,57 21,40f and 22;57 2′,3′-O-
protected ribonucleosides 24,38c 25,38c and 26;38c 2′-O-(tert-butyldi-
methylsilyl)-5′-O-(p,p′-dimethoxytrityl)uridine;60 3′-O-(tert-butyldi-
methylsilyl)-5′-O-(p,p′-dimethoxytrityl)-adenosine;57 a 1.0 M tert-butyl
hydroperoxide/toluene solution;27,61 (allyloxy)bis(diisopropylamino)-
phosphine;45c Pd2[(C6H5CHdCH)2CO]3‚CHCl3;45c and diethylammo-
nium hydrogencarbonate.45a
A General Procedure for Preparation of Acid/Azole Complexes.
An acid (34 mmol) was added over 30 min to a solution of an azole
(34 mmol) in dichloromethane (25 mL), and the mixture was stirred
for 30 min. The reaction mixture was diluted with diethyl ether (20
mL). The resultant precipitate was collected by filtration. Melting points
and spectral data of representative new compounds are shown below.
Imidazolium tetrafluoroborate: mp 175-177 °C; IR 3133, 2976,
2843, 2623, 1580, 1418, 1304 cm-1; 1H NMR (CD3OD) 7.55 (s, 2H),
8.82 (s, 1H); 13C NMR (CD3OD) 120, 135.
N-(Phenyl)imidazolium triflate: mp 126-127 °C; IR 3252, 3150,
3127, 1549, 1285, 1252 cm-1; 1H NMR (CD3OD) 7.58-7.67 (m, 3H),
7.71-7.74 (m, 2H), 7.76 (t, J ) 1.5 Hz, 1H), 8.06 (t, J ) 1.5 Hz, 1H),
9.43 (t, J ) 1.5 Hz, 1H); 13C NMR (CD3OD) 120, 122, 123, 124, 131.3,
131.5, 135.6, 136.5.
N-(Phenyl)imidazolium tetrafluoroborate: mp 96-98 °C; IR
3407, 3094, 2845, 2623, 1599, 1543, 1495, 1337 cm-1; 1H NMR (CD3-
OD) 7.55-7.79 (m, 6H), 8.03 (s, 1H), 9.36 (s, 1H); 13C NMR (CD3-
OD) 122, 122.6, 123.5, 131.2, 131.4, 135.5, 136.4.
contrast, the methods using existing promoters such as 1H-
tetrazole usually require excess amounts of the promoter and
the phosphoramidite with respect to the nucleoside for gaining
an acceptable reaction rate and for obtaining the target products
in high yields.54 Since the nucleoside phosphoramidites are
generally expensive, the use of the phosphoramidite in excess
is a serious economical disadvantage with regard to large-scale
synthesis. In addition, even when the reaction is quantitatively
performed, the excessively used phosphoramidites cause the
formation of byproducts which must then be removed; this
process is particularly troublesome in the liquid-phase synthesis.
It is also of benefit that the azolium promoter causes no side
reactions such as detritylation and depurination. The approach
using N-PhIMT allows efficient synthesis of some biologically
important substrates, such as CMP-Neu5Ac and 2-5A core.
Furthermore, BIT is useful for the solid-phase synthesis of
oligodeoxyribonucleotides on high-cross-linked polystyrene
resins via the allyl/allyloxycarbonyl-protected approach, and
N-PhIMT is effective for the synthesis of oligodeoxyribonu-
cleotides on high-cross-linked polystyrene resins via the cy-
anoethyl/PAC-protected method and the synthesis of oligoribo-
nucleotides on CPG via the allyl/allyloxycarbonyl-protected
approach.
Experimental Section
General Methods. Melting points (mp) are uncorrected. IR spectra
were measured in KBr on a JASCO FT/IR-5300 spectrometer. UV
spectra were taken in MeOH on a JASCO Ubest-55/V-550 spectrometer.
NMR spectra were obtained in CDCl3 unless otherwise noted on a JEOL
A-400 or JEOL EX-270 instrument. The 1H NMR and 13C NMR
chemical shifts are described as δ values in ppm relative to (CH3)4Si.
31P NMR chemical shifts are reported as δ values in ppm downfield
from 85% H3PO4. High-performance liquid chromatography (HPLC)
using a COSMOSIL 5C18-MS column (ODS-5 µm, 4.6 × 250 mm)
was carried out on a JASCO PU-980 chromatograph with a JASCO
UV-970-absorption detector. Solid-phase syntheses were conducted on
a model 392 DNA/RNA synthesizer from Applied Biosystems. Capil-
lary gel electrophoresis (CGE) was done with Ohtsuka Electronics
CAPI-3200 capillary electrophoresis systems. Time-of-flight (TOF)
mass analysis was achieved on a Voyager MDE from Applied
Biosystems. Nacalai Tesque silica gel 60 (neutrality, 75 µm) was used
for column chromatography. Unless otherwise stated, reactions were
carried out at 25 °C. Acetonitrile was distilled from CaH2. Powdery
molecular sieves 3A (MS 3A) were used after drying the commercially
supplied one (Nacalai Tesque) at 200 °C for 12 h. Other organic solvents
were used after simple distillation of the commercially supplied ones.
Ab Initio Calculations. All ab initio calculations were carried out
using the Gaussian 98 program.52,55
N-(p-Acetylphenyl)imidazolium triflate: mp 129-131 °C; IR
Materials. Imidazole (Nacalai Tesque), N-(methyl)imidazole (Na-
calai Tesque), N-(phenyl)imidazole (Aldrich), N-(p-acetylphenyl)-
imidazole (Aldrich), 2-(phenyl)imidazole (Nacalai Tesque), 4-(methyl)-
imidazole (Kishida), 4-(phenyl)imidazole (Tokyo Kasei), benzimidazole
(Nacalai Tesque), N-(methyl)benzimidazole (Wako), 2-(methyl)benz-
imidazole (Nacalai Tesque), 2-(phenyl)benzimidazole (Nacalai Tesque),
trifluoromethanesulfonic acid (Central Glass), p-toluenesulfonic acid
3137, 2980, 2886, 2662, 1686, 1605, 1547, 1433, 1368, 1345, 1246
1
cm-1; H NMR (CD3OD) 2.66 (m, 3H), 7.70-8.27 (m, 7H), 9.54 (s,
1H); 13C NMR (CD3OD) 26.9, 122, 124, 130, 132, 135.6, 139, 199.
2-(Phenyl)imidazolium triflate: mp 106-107 °C; IR 3455, 3208,
3146, 3034, 2774, 1634, 1285, 1252 cm-1; 1H NMR (CD3OD) 7.64 (s,
2H), 7.61-7.71 (m, 3H), 7.92 (dd, J ) 1.5, 7.8 Hz, 2H); 13C NMR
(CD3OD) 120, 121, 123, 124, 128, 134, 146.
4-(Methyl)imidazolium triflate: mp 92-93 °C; IR 3152, 1632,
(54) Stec, W. J.; Zon, G. Tetrahedron Lett. 1984, 25, 5513-5516.
(55) Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.; Robb,
M. A.; Cheeseman, J. R.; Zakrzewski, V. G.; Montgomery, J. A., Jr.;
Stratmann, R. E.; Burant, J. C.; Dapprich, S.; Millam, J. M.; Daniels, A.
D.; Kudin, K. N.; Strain, M. C.; Farkas, O.; Tomasi, J.; Barone, V.; Cossi,
M.; Cammi, R.; Mennucci, B.; Pomelli, C.; Adamo, C.; Clifford, S.;
Ochterski, J.; Petersson, G. A.; Ayala, P. Y.; Cui, Q.; Morokuma, K.; Malick,
D. K.; Rabuck, A. D.; Raghavachari, K.; Foresman, J. B.; Cioslowski, J.;
Ortiz, J. V.; Baboul, A. G.; Stefanov, B. B.; Liu, G.; Liashenko, A.; Piskorz,
P.; Komaromi, I.; Gomperts, R.; Martin, R. L.; Fox, D. J.; Keith, T.; Al-
Laham, M. A.; Peng, C. Y.; Nanayakkara, A.; Gonzalez, C.; Challacombe,
M.; Gill, P. M. W.; Johnson, B.; Chen, W.; Wong, M. W.; Andres, J. L.;
Gonzalez, C.; Head-Gordon, M.; Replogle, E. S.; Pople, J. A. Gaussian
98, Revision A.7; Gaussian: Pittsburgh, 1998.
1
1462, 1258 cm-1; H NMR (CD3OD) 2.35 (d, J ) 1.0 Hz, 3H), 7.25
(56) Kiviniemi, S.; Nissinen, M.; La¨msa¨, M. T.; Jalonen, J.; Rissanen,
K.; Pursiainen, J. New J. Chem. 2000, 24, 47-52.
(57) Heidenhain, S. B.; Hayakawa, Y. Nucleosides Nucleotides 1999,
18, 1771-1787.
(58) Saha, A. K.; Schairer, W.; Waychunas, C.; Prasad, C. V. C.; Sardaro,
M.; Upson, D. A.; Kruse, L. I. Tetrahedron Lett. 1993, 34, 6017-6020.
(59) Ogilvie, K. K. Can. J. Chem. 1973, 51, 3799-3807.
(60) Hakimelahi, G. H.; Proba, Z. A.; Ogilvie, K. K. Can. J. Chem. 1982,
60, 1106-1113.
(61) Hill, J. G.; Rossiter, B. E.; Sharpless, K. B. J. Org. Chem. 1983,
48, 3607-3608.

8174 J. Am. Chem. Soc., Vol. 123, No. 34, 2001
Hayakawa et al.
(s, 1H), 8.72 (d, J ) 1.0 Hz, 1H); 13C NMR (CD3OD) 9.6, 117, 120,
123, 131, 134.
(m, 2H), 5.40 (m, 1H), 5.45 (m, 1H), 5.51 (m, 1H), 6.03 (m, 2H), 6.33
(m, 1H), 6.53 (m, 1H), 6.85 (d, J ) 8.0 Hz, 6H), 7.31 (m, 5H), 7.42
(d, J ) 7.6 Hz, 4H), 7.87 (br s, 1H), 8.23 (d, J ) 6.4 Hz, 1H), 8.71 (d,
4-(Methyl)imidazolium tosylate: mp 112-113 °C; IR 3430, 1632,
1458, 1209 cm-1; H NMR (CD3OD) 2.33 (d, J ) 1.0 Hz, 3H), 2.35
J ) 2.0 Hz, 1H), 8.86 (br s, 2H);
31P NMR -1.2, -1.1; TOF-MS of
1
(s, 3H), 7.22 (d, J ) 8.3 Hz, 2H), 7.23 (s, 1H), 7.70 (d, J ) 8.3 Hz,
2H), 8.71 (d, J ) 1.0 Hz, 1H); 13C NMR (CD3OD) 9.6, 21.3, 117,
127, 130, 131, 134, 143, 144.
4-(Methyl)imidazolium trifluoroacetate: mp 92-94 °C; IR 3171,
3131, 3017, 2768, 1915, 1667, 1480, 1431, 1208 cm-1; 1H NMR (CD3-
OD) 2.35 (s, 3H), 7.24 (s, 1H), 8.72 (s, 1H); 13C NMR (CD3OD) 9.5,
117, 120, 131, 134, 163.
the Na salt, calcd for C52H60N7NaO14PSi m/z 1118.41, found m/z
1119.44.
Allyl [N4-(allyloxycarbonyl)-5′-O-(p,p′-dimethoxytrityl)-2′-deoxy-
cytosylyl](3′-5′)[N6-(allyloxycarbonyl)-3′-O-(tert-butyldimethylsilyl)-
2′-deoxyadenosine] (13): IR 1750, 1665, 1615, 1584, 1508, 1466, 1400
1
cm-1; UV λmax 238 (ꢀ 38 200), 267 nm (22 800); H NMR 0.11, 0.12
(2 s, 6H), 0.91, 0.92 (2 s, 9H), 1.26 (s, 2H), 2.30 (m, 1H), 2.48 (m,
1H), 2.85 (m, 2H), 3.42 (m, 2H), 3.79, 3.80 (2 s, 6H), 4.12-4.51 (m,
6H), 4.65 (m, 1H), 4.68 (d, J ) 6.0 Hz, 2H), 4.75 (m, 2H), 5.18-5.43
(m, 7H), 5.78-6.02 (m, 3H), 6.28 (m, 1H), 6.45 (m, 1H), 6.82-7.36
(m, 13H), 8.06 (m, 1H), 8.16 (s, 1H), 8.24 (s, 1H), 8.42, 8.54 (2 s,
1H), 8.74, 8.75 (2 s, 1H); 31P NMR -1.2, -1.1; TOF-MS of the Na
salt, calcd for C57H69N8NaO15PSi m/z 1187.43, found m/z 1188.61.
4-(Phenyl)imidazolium triflate: mp 168-169 °C; IR 3185, 3146,
3086, 3044, 2928, 2903, 1630, 1601, 1508, 1474, 1287, 1240 cm-1
;
1H NMR (CD3OD) 7.44-7.54 (m, 3H), 7.72 (d, J ) 6.8 Hz, 2H), 7.89
(d, J ) 1.0 Hz, 1H), 8.97 (d, J ) 1.0 Hz, 1H); 13C NMR (CD3OD)
116, 120, 123, 127, 128, 130.5, 130.9, 135, 136.
4-(Phenyl)imidazolium trifluoroacetate: mp 111-113 °C; IR
3426, 3167, 3054, 3007, 2772, 2627, 1921, 1653, 1483, 1433, 1271
Allyl[N2-(allyloxycarbonyl)-O6-(allyl)-5′-O-(p,p′-dimethoxytrityl)-
2′-deoxyguanylyl](3′-5′)[N6-(allyloxycarbonyl)-3′-O-(tert-butyldi-
methylsilyl)-2′-deoxyadenosine] (14): IR 1753, 1611, 1510, 1464,
1
cm-1; H NMR (CD3OD) 7.43-7.52 (m, 3H), 7.72 (d, J ) 7.2 Hz,
2H), 7.87 (s, 1H), 8.94 (s, 1H); 13C NMR (CD3OD) 116, 120, 127,
128, 130, 131, 135, 136, 163.
1
1416 cm-1; UV λmax 238 (ꢀ 28 300), 268 nm (31 000); H NMR 0.15
Benzimidazolium tetrafluoroborate: mp 168-170 °C; IR 3418,
3003, 2967, 2363, 1618, 1528, 1449, 1377, 1233 cm-1; 1H NMR (CD3-
OD) 7.61 (dd, J ) 3.6, 6.4 Hz, 2H), 7.82 (dd, J ) 3.6, 6.4 Hz, 2H),
9.29 (d, J ) 12.4 Hz, 1H); 13C NMR (CD3OD) 115, 128, 132, 141.
N-(Methyl)benzimidazolium triflate: mp 129-130 °C; IR 3079,
1562, 1468, 1449, 1294, 1237 cm-1; 1H NMR (CD3OD) 4.15 (s, 3H),
7.79-7.86 (m, 1H), 7.89-7.95 (m, 1H), 9.34 (s, 1H); 13C NMR (CD3-
OD) 33.6, 114, 116, 120, 123, 127.8, 128.2, 132, 133, 142.
2-(Phenyl)benzimidazolium triflate: mp 224-225 °C; IR 3067,
2992, 1636, 1462, 1289, 1236 cm-1; 1H NMR (CD3OD) 7.63 (dd, J )
2.9, 6.3 Hz, 2H), 7.72-7.81 (m, 3H), 7.83 (dd, J ) 2.9, 6.3 Hz, 2H),
8.13 (m, 2H); 13C NMR (CD3OD) 115, 120, 124, 128, 129, 131, 133,
135, 151.
(s, 6H), 0.94 (s, 9H), 2.48 (m, 1H), 2.76 (m, 1H), 2.98 (m, 2H), 3.34
(m, 1H), 3.41 (m, 1H), 3.78 (s, 6H), 4.21 (m, 2H), 4.33 (m, 1H), 4.40
(m, 1H), 4.49 (m, 1H), 4.55 (m, 1H), 4.73 (m, 6H), 5.11 (m, 2H),
5.23-5.51 (m, 8H), 5.87 (m, 1H), 5.97 (m, 2H), 6.16 (m, 1H), 6.46
(m, 2H), 6.78 (t, J ) 8.4, 8.8 Hz, 4H), 7.26 (m, 7H), 7.36 (t, J ) 7.6,
8.4 Hz, 2H), 7.94 (s, 1H), 8.25 (d, J ) 7.6 Hz, 1H), 8.82 (d, J ) 7.6
Hz, 1H); 31P NMR -1.3, -1.1; TOF-MS of the Na salt, calcd for
C61H73N10NaO15PSi m/z 1267.47, found m/z 1268.63.
Allyl [5′-O-(p,p′-dimethoxytrityl)thymidylyl](3′-5′)[3′-O-(tert-bu-
tyldimethylsilyl)thymidine] (15): IR 1698, 1609, 1510, 1468 cm-1
;
1
UV λmax 235 (ꢀ 25 900), 266 nm (20 700); H NMR 0.07-0.09 (m,
6H), 0.88, 0.89 (2 s, 9H), 1.38 (s, 3H), 1.90 (s, 3H), 2.05-2.29 (m,
2H), 2.41 (m, 1H), 2.62 (m, 1H), 3.37 (m, 1H), 3.51 (m, 1H), 3.79 (s,
6H), 3.96-4.01 (m, 1H), 4.15-4.22 (m, 3H), 4.35-4.57 (m, 3H), 5.16-
5.38 (m, 3H), 5.80-5.94 (m, 1H), 6.22 (q, J ) 6.8, 13.6 Hz, 1H), 6.43
(m, 1H), 6.84 (d, J ) 8.8 Hz, 4H), 7.23-7.36 (m, 8H), 7.56 (dd, J )
9.2, 10.4 Hz, 1H), 8.62 (br s, 2H); 31P NMR -1.1; TOF-MS of the Na
salt, calcd for C50H63 N4NaO14PSi m/z 1025.37, found m/z 1026.27.
2-(Phenyl)benzimidazolium perchlorate: mp 205-206 °C; IR
1
3424, 2961, 2724, 1630, 1460, 1375, 1265 cm-1; H NMR (CD3OD)
7.59-7.62 (m, 2H), 7.70-7.83 (m, 5H), 8.11 (dd, J ) 6.4, 6.8 Hz,
2H); 13C NMR (CD3OD) 115, 124, 128, 129, 131, 133, 135, 151.
Screening of the Reactivity of Promoters. A mixture of the
phosphoramidite 4 (14.6 mg, 0.02 mmol), the nucleoside 11 (7.1 mg,
0.02 mmol), and MS 3A (20 mg) in dry acetonitrile (1.0 mL) was stirred
for 30 min. To this mixture was added a promoter (0.02 mmol). After
1 min, the reaction was quenched by the addition of a 1.0 M toluene
solution of TBHP (0.04 mL, 0.04 mmol), and stirring was continued
for 5 min. Insoluble material was removed by filtration. To the solution
was added a 0.1 M acetonitrile solution of triphenylphosphine oxide
(200 µL) as a standard for determining the yield of the target
dinucleoside phosphate. After concentration of the mixture, the residue
was dissolved in CDCl3 (1 mL). An aliquot of the solution was subjected
to the 31P NMR analysis to obtain the yield.
2-Cyanoethyl [N6-(benzoyl)-5′-O-(p,p′-dimethoxytrityl)-2′-deoxy-
adenylyl](3′-5′)[N2-(isobutyryl)-3′-O-(tert-butyldimethylsilyl)-2′-
deoxyguanosine] (16): IR 1686, 1611, 1510, 1462, 1402 cm-1; UV
1
λmax 235 (ꢀ 35 000), 279 nm (28 800); H NMR 0.10, 0.11, 1.12 (3 s,
6H), 0.91 (s, 9H), 1.12-1.28 (m, 8H), 1.73-1.80 (m, 1H), 2.20-2.23
(m, 1H), 2.62-2.80 (m, 3H), 2.87-3.07 (m, 1H), 3.33-3.43 (m, 2H),
3.75 (s, 6H), 4.09-4.30 (m, 4H), 4.42-4.53 (m, 3H), 5.23-5.33 (m,
1H), 6.11-6.19 (m, 1H), 6.33-6.51 (m, 1H), 7.10-7.81 (m, 17H),
7.99 (t, J ) 6.8, 7.2 Hz, 2H), 8.15, 8.21 (2 s, 1H), 8.59, 8.63 (2 s, 1H);
31P NMR -2.6, -2.5; TOF-MS of the Na salt, calcd for C61H70N11-
NaO13PSi m/z 1246.46, found m/z 1247.54.
Preparation of Allyl [N6-(Allyloxycarbonyl)-5′-O-(p,p′-dimethoxy-
trityl)-2′-deoxyadenylyl](3′-5′)[3′-O-(tert-butyldimethylsilyl)-thymi-
dine] (12). A Typical Procedure for the Preparation of Dideoxy-
ribonucleoside Phosphates by the Use of Stoichiometric Amounts
of a Nucleoside 3′-Phosphoramidite, a Nucleoside, and a Promoter
in a Solution Phase. A mixture of the phosphoramidite 1 (82.4 mg,
0.10 mmol), the nucleoside 11 (35.9 mg, 0.10 mmol), and MS 3A (20
mg) in dry acetonitrile (1.0 mL) was stirred for 30 min. N-(Phenyl)-
imidazolium triflate (29.6 mg, 0.10 mmol) was then added to the
mixture, which was stirred for an additional 1 min. To this mixture
was added a 6.7% toluene solution of 2-butanone peroxide (0.20 mL),
and stirring was continued for 5 min. Insoluble material was filtered
off. Concentration of the filtrate afforded crude product, which was
dissolved in dichloromethane (5 mL). The resulting solution was poured
into a vigorously stirred petroleum ether (50 mL) to precipitate 12 as
a colorless powder, which was collected by filtration (109 mg, 99%
yield): IR 1752, 1701, 1613, 1586, 1510, 1466 cm-1; UV λmax 237 (ꢀ
2′-O-(tert-Butyldimethylsilyl)-5′-O-(p,p′-dimethoxytrityl)uridine
3′-O-(Allyl N,N-diisopropylphosphoramidite) (23). To a mixture of
2′-O-(tert-butyldimethylsilyl)-5′-O-(p,p′-dimethoxytrityl)uridine (2.54
g, 3.84 mmol), (allyloxy)bis(diisopropylamino)phosphine (1.26 g, 1.40
mL, 4.38 mmol), and MS 3A (50 mg) in dichloromethane (10 mL)
was added N-(methyl)imidazolium triflate (888 mg, 3.82 mmol), and
the resulting mixture was stirred for 90 min. Insoluble material was
removed by filtration. The filtrate was diluted with dichloromethane
(100 mL) and washed with an aqueous solution saturated with sodium
hydrogencarbonate (10 mL) followed by brine (10 mL). The organic
solution was dried and concentrated to give a viscous oil. The crude
product was subjected to column chromatography on silica gel (80 g)
eluted with a 1:3 mixture of ethyl acetate and hexane containing a trace
amount of triethylamine to give 23 as a mixture of two diastereomers
(2.92 g, 90% yield): IR 1696, 1609, 1510, 1462, 1366, 1302 cm-1
;
UV λmax 235 (ꢀ 21 300), 267 nm (10 600); 1H NMR 0.12 (s, 3H), 0.14
(s, 3H), 0.89, 0.91 (2 s, 9H), 1.02-1.20 (m, 12H), 3.40-3.46 (m, 1H),
3.51-3.65 (m, 3H), 3.79 (s, 6H), 3.94-4.40 (m, 5H), 4.98-5.30 (m,
3H), 5.73-6.00 (m, 2H), 6.80-6.90 (m, 4H), 7.20-7.34 (m, 9H), 7.90-
8.08 (m, 2H); 31P NMR 149.5, 150.1.
1
24 500), 267 nm (26 500); H NMR 0.12 (s, 6H), 0.96 (s, 9H), 1.83
(m, 1H), 1.96 (d, J ) 14.8 Hz, 3H), 2.24 (m, 1H), 2.33 (m, 1H), 2.87
(m, 1H), 3.17 (m, 1H), 3.49 (m, 2H), 3.83 (s, 6H), 4.08 (m, 1H), 4.30
(m, 1H), 4.36 (m, 1H), 4.50 (m, 1H), 4.66 (m, 2H), 4.82 (m, 2H), 5.32

Acid/Azole Promoters of the Phosphoramidite Method
J. Am. Chem. Soc., Vol. 123, No. 34, 2001 8175
Preparation of Allyl [N6-(Allyloxycarbonyl)-2′-O-(tert-butyldi-
methylsilyl)-5′-O-(p,p′-dimethoxytrityl)adenylyl](3′-5′)[N6,2′,3′-O-
tri(allyloxycarbonyl)adenosine] (27). A Typical Procedure for the
Preparation of 2′-5′- or 3′-5′-Linked Diribonucleoside Phosphates
by the Use of Equimolar Amounts of a Nucleoside 2′- or 3′-Phos-
phoramidite, a Nucleoside, and a Promoter in a Solution Phase.
To a stirred mixture of the adenosine 3′-phosphoramidite 20 (96 mg,
0.10 mmol), the 5′-O-free adenosine 24 (52.0 mg, 0.10 mmol), and
molecular sieves 3A (20 mg) in acetonitrile (1.0 mL) was added
N-(phenyl)imidazolium triflate (29.4 mg, 0.10 mmol). After 10 min,
to the reaction mixture was added a 1.0 M solution of TBHP in toluene
(0.20 mL, 0.20 mmol), and the mixture was stirred for 5 min. The
insoluble material was removed by filtration, and the filtrate was washed
with ethyl acetate. The filtrate was diluted with ethyl acetate (10 mL).
The resulting organic solution was washed with an aqueous sodium
hydrogencarbonate-saturated solution (2 mL) followed by brine (2 mL),
dried, and concentrated to give a glassy oil. This crude product was
subjected to column chromatography on silica gel (20 g) using a 1:2
to 2:3 mixture of ethyl acetate and hexane as the eluent to provide the
desired nucleotide 27 (132 mg, 95% yield) as an amorphous solid: IR
1759, 1613, 1510, 1466 cm-1; UV λmax 235 (ꢀ 27 000), 267 nm
(33 900); 1H NMR -0.31, -0.30 (2 s, 6H), 0.08, 0.09 (2 s, 9H), 3.20-
3.55 (m, 1H), 3.58-3.70 (m, 1H), 3.68, 3.73 (2 s, 6H), 4.07-4.80 (m,
15H), 4.85-5.02 (m, 1H), 5.10-5.45 (m, 11H), 5.60-6.31 (m, 8H),
6.69-6.85 (m, 4H), 7.28-7.70 (m, 9H), 8.10-8.20 (m, 4H), 8.57, 8.60
(2 s, 1H), 8.76, 8.77 (2 s, 1H); 31P NMR -0.95, -0.29; TOF-MS calcd
for C66H77N10O20PSi m/z 1388.48, found m/z 1390.35.
dimethoxytrityl)adenosine (1.00 g, 1.30 mmol), (allyloxy)bis(diiso-
propylamino)phosphine (0.52 mL, 0.47 g, 1.63 mmol), N-(methyl)-
imidazolium triflate (341 mg, 1.47 mmol), and MS 3A (50 mg) in
dichloromethane (3.5 mL) was stirred for 75 min. The reaction mixture
was filtered, and the filtrate was diluted with dichloromethane (100
mL). The organic solution was washed with a sodium hydrogencar-
bonate-saturated solution (10 mL) followed by brine (10 mL), dried,
and concentrated to give a viscous oil. This oil was subjected to
chromatography on a silica gel (35 g) column eluted with a 1:3 mixture
of ethyl acetate and hexane containing a trace amount of triethylamine
to give 32 (1.06 g, 85% yield): IR 1611, 1586, 1510, 1464 cm-1; UV
λ
max 236 (ꢀ 23 000), 267 nm (19 100); 1H NMR 0.03, 0.04, 0.09, 0.11
(4 s, 6H), 0.85, 0.87 (2 s, 9H), 1.01-1.22 (m, 14H), 3.25-3.32 (m,
1H), 3.45-3.56 (m, 4H), 3.77, 3.78 (2 s, 6H), 3.92-4.25 (m, 2H),
4.50-4.59 (m, 1H), 4.76 (d, J ) 5.6 Hz, 2H), 4.88-5.13 (m, 3H),
5.29 (dd, J ) 1.0, 10.2 Hz, 1H), 5.41 (d, J ) 17.1 Hz, 1H), 5.51-5.63
(m, 1H), 5.80-6.05 (m, 1H), 6.16-6.22 (m, 1H), 6.76-6.81 (m, 4H),
7.18-7.42 (m, 9H), 8.02 (s, 1H), 8.13, 8.17 (2 s, 1H), 8.65, 8.66 (2 s,
1H); 31P NMR 150.2, 150.4.
Allyl [N6-(allyloxycarbonyl)-3′-O-(tert-butyldimethylsilyl)-5′-O-
(p,p′-dimethoxytrityl)adenylyl](2′-5′)[N6,2′,3′-O-tri(allyloxycarbon-
yl)adenosine] (33): IR 1759, 1613, 1589, 1510, 1466 cm-1; UV λmax
239 (ꢀ 24 000), 267 nm (30 600); 1H NMR 0.79, 0.80 (2 s, 9H), 3.24-
3.26 (m, 1H), 3.50-3.53 (m, 1H), 3.72 (s, 6H), 4.17-4.73 (m, 16H),
4.99-5.38 (m, 10H), 5.50-5.61 (m, 2H), 5.78-5.98 (m, 5H), 6.17-
6.28 (m, 2H), 6.63-6.76 (m, 4H), 7.13-7.46 (m, 9H), 8.14-8.23 (m,
2H), 8.60-8.73 (m, 3H), 8.91 (br s, 1H); 31P NMR -0.51, -0.73;
TOF-MS of the Na salt, calcd for C66H77N10NaO20PSi m/z 1411.47,
found m/z 1412.64.
Condensation of the Pentaacetyl Neuraminic Acid Methyl Ester
34 and the Cytidine 5′-Phosphoramidite 35, Producing the Phos-
phite 36. To a mixture of 34 (48 mg, 0.1 mmol) and 35 (56 mg, 0.1
mmol) in the presence of molecular sieves 3A (20 mg) in acetonitrile
(1.0 mL) was added N-(phenyl)imidazolium triflate (29 mg, 0.1 mmol).
The resulting mixture was stirred for 5 min. The reaction was quenched
by the addition of triethylamine (0.2 mL), and the mixture was diluted
with ethyl acetate (20 mL). The insoluble powder was removed by
filtration and washed with ethyl acetate (5 mL). The organic filtrate
was diluted with ethyl acetate (20 mL) and washed with an aqueous
sodium hydrogencarbonate-saturated solution (10 mL) followed by brine
(10 mL), dried, and concentrated to give a residual oil. This material
was dissolved in dichloromethane (5 mL), and the resulting solution
was poured into petroleum ether (50 mL) to give a colorless precipitate.
The precipitate was collected and dried in vacuo. The 1H NMR spectrum
indicated that the solid product (101 mg) was 36,34f containing a small
amount (ca. 5%) of impurities such as N-(phenyl)imidazole and
triethylamine. Thus, the yield of 36 was ca. 95%. This compound
without further purification could be converted to CMP-Neu5Ac (37)
via the reported procedure.34f
Allyl [N4-(allyloxycarbonyl)-2′-O-(tert-butyldimethylsilyl)-5′-O-
(p,p′-dimethoxytrityl)cytosylyl](3′-5′)[N6,2′,3′-O-tri(allyloxycarbon-
yl)adenosine] (28): IR 1759, 1676, 1613, 1508, 1466 cm-1; UV λmax
1
238 (ꢀ 31 300), 266 nm (20 400); H NMR -0.12, -0.18 (2 m, 6H),
0.84, 0.86 (2 s, 9H), 3.38-3.52 (m, 1H), 3.60-3.72 (m, 1H), 3.76,
3.78 (2 s, 6H), 4.07-4.80 (m, 14H), 4.75 (d, J ) 6.0 Hz, 2H), 4.83-
4.92 (m, 1H), 5.10-5.42 (m, 10H), 5.51-6.03 (m, 8H), 6.17 (d, J )
5.4 Hz, 1H), 6.70-6.88 (m, 5H), 7.17-7.48 (m, 9H), 7.99, 8.14 (2 s,
1H), 8.40 (d, J ) 7.2 Hz, 1H), 8.65-8.77 (m, 1H), 8.97-9.07 (br s,
1H); 31P NMR -0.81; TOF-MS of the Na salt, calcd for C65H77N8-
NaO21PSi m/z 1387.46, found m/z 1388.34.
Allyl [N4-(allyloxycarbonyl)-2′-O-(tert-butyldimethylsilyl)-5′-O-
(p,p′-dimethoxytrityl)cytosylyl](3′-5′)[2′,3′-O-di(allyloxycarbonyl)-
uridine] (29): IR 1757, 1698, 1628, 1559, 1508, 1460 cm-1; UV λmax
238 nm (ꢀ 31 600); 1H NMR 0.14, 0.22 (2 s, 6H), 0.88, 0.89 (2 s, 9H),
3.46-3.52 (m, 1H), 3.72-3.78 (m, 1H), 3.79, 3.80 (2 s, 6H), 3.96-
4.13 (m, 1H), 4.14-4.33 (m, 2H), 4.35-4.45 (m, 2H), 4.50-4.66 (m,
9H), 4.86-4.94 (m, 1H), 5.17-5.39 (m, 10H), 5.57-5.97 (m, 7H),
6.72-6.90 (m, 5H), 7.18-7.48 (m, 9H), 8.15-8.36 (br s, 1H), 8.37-
8.44 (m, 1H), 9.46-9.55 (br s, 1H); 31P NMR -0.66, -0.51; TOF-
MS of the Na salt, calcd for C60H72N5NaO21PSi m/z 1280.41, found
m/z 1281.14.
Allyl [N2-(allyloxycarbonyl)-O6-(allyl)-2′-O-(tert-butyldimethyl-
silyl)-5′-O-(p,p′-dimethoxytrityl)guanylyl](3′-5′)[N4,2′,3′-O-tri(allyl-
oxycarbonyl)cytidine] (30): IR 1759, 1672, 1609, 1557, 1510, 1462,
1416 cm-1; UV λmax 206 (ꢀ 82 600), 238 nm (41 100); 1H NMR -0.26
(s, 3H), -0.03, -0.02 (2 s, 3H), 0.71, 0.74 (2 s, 9H), 3.35-3.60 (m,
2H), 3.74, 3.76 (2 s, 6H), 4.20-4.75 (m, 15H), 5.04-5.52 (m, 18H),
5.73-6.25 (m, 8H), 6.70-6.83 (m, 4H), 7.15-7.49 (m, 9H), 7.63 (br
s, 1H), 7.83 (d, J ) 7.3 Hz, 1H), 8.00, 8.03 (2 s, 1H); 31P NMR -0.84,
-0.51; TOF-MS of the Na salt, calcd for C68H81N8NaO22PSi m/z
1443.49, found m/z 1448.49.
Synthesis of Adenylyl(2′-5′)adenylyl(2′-5′)adenosine (2-5A Core)
(39) from the 2′-5′-Linked Adenylyl Dimer 33. To a solution of 33
(1.32 g, 0.96 mmol) in dichloromethane (14 mL) was added dichlo-
roacetic acid (1.60 mL, 2.50 g, 19 mmol), and the mixture was stirred
at 0 °C for 10 min. The reaction mixture was diluted with dichlo-
romethane (50 mL) and washed with an aqueous solution saturated
with sodium hydrogencarbonate (50 mL) and brine (50 mL). After
drying, the organic layer was concentrated to give an amorphous solid.
This material was chromatographed on silica gel (50 g) eluted with a
1:2 acetone-hexane mixture to afford the 5′-O-free adenylyl dimer
(947 mg, 91% yield): IR 1759, 1614, 1589, 1530, 1468, 1424 cm-1
;
Allyl [2′-O-tert-butyldimethylsilyl)-5′-O-(p,p′-dimethoxytrityl)uri-
dylyl](3′-5′)[2′,3′-O-di(allyloxycarbonyl)uridine] (31): IR 1759,
UV λmax 267 nm (ꢀ 32 000); 1H NMR 0.90, 0.92 (2 s, 9H), 3.65-3.78
(m, 1H), 3.90-3.95 (m, 1H), 4.07-4.28 (m, 6H), 4.56-4.68 (m, 5H),
4.77-4.81 (m, 4H), 5.03-5.14 (m, 2H), 5.25-5.61 (m, 11H), 5.71-
6.09 (m, 6H), 6.17-6.28 (m, 1H), 8.05-8.24 (m, 2H), 8.42-8.58 (m,
2H), 8.67-8.76 (m, 2H); 31P NMR -0.77, -1.21. This product (793
mg, 0.73 mmol) was dissolved in acetonitrile (7.3 mL). To the resulting
solution were successively added MS 3A (50 mg), the phosphoramidite
32 (697 mg, 0.73 mmol), and N-(phenyl)imidazolium triflate (215 mg,
0.73 mmol). The mixture was stirred for 40 min. To this mixture was
added a 1.0 M toluene solution of TBHP (1.5 mL, 1.5 mmol), and
stirring was continued for an additional 5 min. The insoluble material
1
1698, 1607, 1510, 1460 cm-1; UV λmax 236 nm (ꢀ 30 500); H NMR
0.17, 0.18 (2 s, 6H), 0.86, 0.87 (2 s, 9H), 3.38-3.66 (m, 2H), 3.76 (s,
6H), 4.16-4.70 (m, 11H), 4.87-4.96 (m, 1H), 5.18-5.37 (m, 10H),
5.62-5.98 (m, 6H), 6.70-6.87 (m, 4H), 7.21-7.40 (m, 9H), 7.82 (d,
J ) 7.2 Hz, 1H), 9.32-9.48 (m, 2H); 31P NMR -0.99, -0.77; TOF-
MS of the Na salt, calcd for C56H67N4NaO20PSi m/z 1197.38, found
m/z 1197.89.
N6-(Allyloxycarbonyl)-3′-O-(tert-butyldimethylsilyl)-5′-O-(p,p′-
dimethoxytrityl)adenosine 2′-O-(Allyl N,N-diisopropylphosphor-
amidite) (32). A mixture of 3′-O-(tert-butyldimethylsilyl)-5′-O-(p,p′-

8176 J. Am. Chem. Soc., Vol. 123, No. 34, 2001
Hayakawa et al.
was filtered off and washed with ethyl acetate. The filtrate was diluted
with ethyl acetate (50 mL) and washed with an aqueous sodium
hydrogencarbonate-saturated solution (10 mL) and brine (10 mL). After
drying, concentration of the organic layer furnished an amorphous solid.
This crude material was subjected to column chromatography on silica
gel (40 g) eluted with a 1:2 to 2:3 mixture of ethyl acetate and hexane
to provide an amorphous solid (1.36 g) including the fully protected
adenylyl trimer 38 (a mixture of four diastereomers) as the main
component and some undesired products as the minor component. The
1H NMR spectral data of the main product 38 are as follows: 0.02-
0.15 (m, 12H), 0.78-0.94 (m, 18H), 3.21-3.59 (m, 2H), 3.75, 3.76 (2
s, 6H), 3.92-4.81 (m, 27H), 4.92-5.59 (m, 14H), 5.60-6.10 (m, 8H),
6.13-6.31 (m, 2H), 6.72-6.81 (m, 4H), 7.10-7.41 (m, 9H), 8.16-
8.35 (m, 4H), 8.42-8.56 (m, 1H), 8.62-8.76 (m, 2H), 8.89-8.93 (m,
1H), 9.10-9.16 (m, 1H). This material was used without further
purification in the following reaction. To a solution of the amorphous
product (1.30 g, 0.65 mmol) was added dichloroacetic acid (1.1 mL,
1.69 g, 13 mmol), and the solution was stirred at 0 °C for 10 min. The
reaction mixture was diluted with dichloromethane (50 mL), washed
with an aqueous sodium hydrogencarbonate-saturated solution (50 mL)
and brine (50 mL), dried, and concentrated to give an amorphous solid.
Silica gel (40 g) column chromatography of the product with a 1:2
acetone-hexane mixture as the eluent gave an amorphous solid (1.01
g). The product was dissolved in dichloromethane (18 mL), and to the
resulting solution was added with stirring diethylammonium hydro-
gencarbonate (2.36 g, 17 mmol). After 5 min, to the mixture was added
a solution of Pd[P(C6H5)3]4 (202 mg, 0.17 mmol) and triphenylphos-
phine (41 mg, 0.16 mmol) in dichloromethane (6 mL), and stirring
was continued for an additional 1 h. The reaction mixture was diluted
with dichloromethane (100 mL) and extracted with water (100 mL ×
2). Concentration of the combined aqueous extracts provided a colorless
powder (672 mg). This material (658 mg) was dissolved in THF (10
mL). The solution was mixed with a 1.0 M tetrabutylammonium
fluoride-THF solution (11.3 mL, 11.3 mmol) and stirred for 18 h.
The reaction mixture was concentrated to give a viscous oil. The oily
product was diluted with a 0.01 M triethylammonium hydrogencar-
bonate buffer solution (100 mL) and washed with ether (30 mL × 2).
The aqueous layer was concentrated to give a viscous oil, which was
dissolved in ethanol and evaporated. The resulting oil was subjected
to DEAE cellulose ion-exchange column chromatography (40 g,
Table 3. Reaction Sequence of the Solid-Phase Synthesis of DNA
Oligomers
step
operation
reagent(s)
time, min
1
2
3
4
washing
detritylation
washing
CH3CN
3% Cl3CCOOH/CH2Cl2
CH3CN
0.1 M amidite/CH3CN
+ 0.1 M promoter/CH3CN
CH3CN
Ac2O/2,6-lutidine/THF (1:1:8)
+ N-methylimidazole/THF
CH3CN
0.4
1.3
0.8
1.0
coupling
5
6
washing
capping
0.2
0.3
7
8
9
washing
oxidation
washing
0.2
1.0
0.6
1.0 M t-C4H9OOH/toluene
CH3CN
Table 4. Reaction Sequence of the Solid-Phase Synthesis of RNA
Oligomers
step
operation
washing
detritylation 3% Cl3CCOOH/CH2Cl2
washing
coupling
reagent(s)
time, min
0.4
1.3
0.5
0.2
1
2
3
4
CH3CN
CH3CN
0.1 M amidite/CH3CN
+ 0.1 or 0.25 M promoter/
CH3CN
× 2
{
}
5
6
7
wait
washing
capping
CH3CN
CH3CN
2.0
0.2
Ac2O/2,6-lutidine/THF (1:1:8) 0.3
+ N-methylimidazole/THF
1.0 M t-C4H9OOH/toluene
8
9
oxidation
washing
1.0
0.6
CH3CN
preparation of several azolium salts and in ab initio calculations,
respectively. We also acknowledge Professor Nobuaki Koga,
Nagoya University, for his valuable suggestion and help in the
ab initio calculation, and Professor Yasuhiro Kajihara, Yoko-
1
hama City University, for generously supplying the H NMR
spectrum of the compound 36. This work was supported in part
by the Asahi Glass Foundation and the Daiko Foundation (Y.H.),
by Grants-in-Aid for Scientific Research (Nos. 10554042 and
11101001) (Y.H.) and a Grant-in-Aid for JSPS Fellows (No.
12003794) (R.K.) from the Ministry of Education, Science,
Sports and Culture, and by a grant from the “Research for the
Future” Program of the Japan Society for the Promotion of
Science (JSPS-RFTF97I00301) (Y.H.).
-
2.4 × 22 cm, HCO3 form). Elution with a triethylammonium
hydrogencarbonate buffer solution (pH 7.6, 0.001-0.3 M linear
gradient, 1000 mL/1000 mL) afforded 39 (60% overall yield from 33
according to the UV analysis), which was identical with an authentic
sample by HPLC.62
Solid-Phase Synthesis of Oligonucleotides. The syntheses of
oligodeoxyribonucleotides and oligoribonucleotides were carried out
according to the reaction cycle shown in Tables 3 and 4, respectively,
using suitable phosphoramidites as monomer units. In the synthesis
via the allyl/AOC-protected phosphoramidite approach, the solid-
anchored product after chain elongation was treated with a mixture of
Pd2[(C6H5CHdCH)2CO]3‚CHCl3 and (C6H5)3P in the presence of
diethylammonium carbonate in THF at 50 °C for 60 min and then with
concentrated ammonia at 25 °C for 60 min to give the target oligomer.
In the synthesis according to the cyanoethyl/acetyl,PAC-protected
method, the chain-elongation product was exposed to concentrated
ammonia at 25 °C for 60 min and then at 65 °C for 30 min to afford
the target oligomer.
Supporting Information Available: Characterization data
1
including IR, H NMR, 13C NMR, and/or 31P NMR spectral
charts for new compounds including 12, 13, 14, 15, 16, 23, 27,
28, 29, 30, 31, 32, and 33; acid/azole complexes examined in
this work and their melting points and the solubility in
acetonitrile; examples of solution-phase synthesis of deoxyribo-
nucleoside and ribonucleoside phosphates using promoters other
than N-PhIMT for the condensation of a nucleoside phosphor-
amidite and a nucleoside; the MALDI-TOF mass spectrum of
the oligoribonucleotide 44 prepared by the method using
N-PhIMT as the promoter; the 31P NMR spectrum of the reaction
of 4, 11, and IMP (1 equiv each) in a 0.05 M acetonitrile solution
after 40-min treatment at 0 °C (PDF). This material is available
free of charge via the Internet at http://pubs.acs.org.
Acknowledgment. We thank Ms. Fumi Urano and Mr.
Mamoru Hyodo in our laboratory for their contributions in
(62) Noyori, R.; Uchiyama, M.; Nobori, T.; Hirose, M.; Hayakawa, Y.
Aust. J. Chem. 1992, 45, 205-225.
JA010078V