A new lead for nonpeptidic active-site-directed inhibitors of the severe acute respiratory syndrome coronavirus main protease discovered by a combination of screening and docking methods

Article abstract of DOI:10.1021/jm0501782

The coronavirus main protease, M^pro, is considered to be a major target for drugs suitable for combating coronavirus infections including severe acute respiratory syndrome (SARS). An HPLC-based screening of electrophilic compounds that was perf

Full text of DOI:10.1021/jm0501782

6832
J. Med. Chem. 2005, 48, 6832-6842
A New Lead for Nonpeptidic Active-Site-Directed Inhibitors of the Severe Acute
Respiratory Syndrome Coronavirus Main Protease Discovered by a
Combination of Screening and Docking Methods|
Ulrich Kaeppler,† Nikolaus Stiefl,† Markus Schiller,† Radim Vicik,† Alexander Breuning,† Werner Schmitz,‡
Daniel Rupprecht,§ Carsten Schmuck,§ Knut Baumann,† John Ziebuhr,# and Tanja Schirmeister*,†
Institute of Pharmacy and Food Chemistry, University of Wu¨rzburg, Am Hubland, D-97074 Wu¨rzburg, Germany,
Department of Physiological Chemistry II, Theodor-Boveri-Institute, University of Wu¨rzburg, Am Hubland, D-97074 Wu¨rzburg,
Germany, Institute of Organic Chemistry, University of Wu¨rzburg, Am Hubland, D-97074 Wu¨rzburg, Germany, and
Institute of Virology and Immunology, University of Wu¨rzburg, Versbacher Strasse 7, D-97078 Wu¨rzburg, Germany
Received February 24, 2005
The coronavirus main protease, Mpro, is considered to be a major target for drugs suitable for
combating coronavirus infections including severe acute respiratory syndrome (SARS). An
HPLC-based screening of electrophilic compounds that was performed to identify potential
Mpro inhibitors revealed etacrynic acid tert-butylamide (6a) as an effective nonpeptidic inhibitor.
Docking studies suggested a binding mode in which the phenyl ring acts as a spacer bridging
the inhibitor’s activated double bond and its hydrophobic tert-butyl moiety. The latter is
supposed to fit into the S4 pocket of the target protease. Furthermore, these studies revealed
etacrynic acid amide (6b) as a promising lead for nonpeptidic active-site-directed Mpro inhibitors.
In a fluorimetric enzyme assay using a novel fluorescence resonance energy transfer (FRET)
pair labeled substrate, compound 6b showed a Ki value of 35.3 µM. Since the novel lead
compound does not target the S1′, S1, and S2 subsites of the enzyme’s substrate-binding pockets,
there is room for improvement that underlines the lead character of compound 6b.
Introduction
attractive target for new antiviral drugs against SARS
and other coronavirus infections.12
Coronaviruses are important pathogens that mainly
cause respiratory and enteric disease in humans, live-
stock, and domestic animals.1 For example, transmis-
sible gastroenteritis virus (TGEV), a group I coronavi-
rus, causes diarrhea in young piglets,2 and SARS-CoV,
a group II coronavirus, causes severe acute respiratory
syndrome (SARS).3-5 It is generally believed that SARS-
CoV only very recently crossed the species barrier from
an unknown animal reservoir to humans,6 thus causing
the severe SARS epidemic in 2002-2003 with more
than 800 deaths worldwide.7 With genome sizes of about
30 kilobases, coronaviruses are the largest plus-strand
RNA viruses currently known. In their life cycles,
coronaviruses employ several unique mechanisms and
enzymes that discriminate them from all other RNA
viruses.8,9 Following receptor-mediated entry into the
host cell, the genome RNA is translated to produce two
large replicase polyproteins that are autocatalytically
cleaved by two or three viral proteases.10 The key
enzyme in this process is the coronavirus main protease,
Mpro, a cysteine protease featuring a two-â-barrel fold,
which cleaves the replicase polyproteins at as many as
11 conserved sites.10-13 Because of its essential role in
proteolytic processing, the Mpro is considered to be an
A number of potential inhibitors have been proposed
employing molecular modeling and virtual screening
techniques.14-22 However, the inhibitory potency of
these compounds has not yet been verified. Only a small
number of potent protease inhibitors were identified by
screening assays thus far. These include an HIV pro-
tease inhibitor identified by a broad cell-based screen-
ing,23 two nonpeptidic heterocyclic compounds that were
identified by a broad protease inhibition screening,24
a
3-quinolinecarboxylic acid ester and an imidazolidine
identified by a cell-based assay,25 mercury and zinc
containing inhibitors,26 and boronic acid derivatives that
are supposed to target serine residues of the protease.27
Most of these studies used commercially available
compound libraries for their screening assays. With the
exception of a peptidyl chloromethyl ketone13 and the
peptidomimetic inhibitor AG-7088,28,29 none of the
compounds identified to date were developed and pre-
dicted to target the active site cysteine residue. This lack
of active-site-directed lead structures motivated the
search for new leads with proven active-site-directed
activity.
The scrutinized compounds contain electrophilic build-
ing blocks (aziridine, epoxide, Michael system) that are
known to react with nucleophilic amino acids within the
active site of proteases.28,30-32 Derivatives of etacrynic
acid (5a) (Scheme 1), which is a well-known diuretic
drug33 and which also contains an activated double
bond, were chosen as potential nonpeptidic leads owing
to their activity toward the cysteine protease papain.34
The properties of these compounds as new nonpeptidic
SARS-CoV Mpro inhibitors are presented herein.35
| Dedicated to Prof. Dr. Claus Herdeis, Institute of Pharmacy and
Food Chemistry, University of Wu¨rzburg, on the occasion of his 60th
birthday.
* To whom correspondence should be addressed. Phone: ++49-
(0)931-888-5440. Fax: ++49-(0)931-888-5494. E-mail: schirmei@
pzlc.uni-wuerzburg.de.
† Institute of Pharmacy and Food Chemistry.
‡ Theodor-Boveri-Institute.
§ Institute of Organic Chemistry.
# Institute of Virology and Immunology.
10.1021/jm0501782 CCC: $30.25 © 2005 American Chemical Society
Published on Web 10/01/2005

Inhibitors of Coronavirus Main Protease
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22 6833
Scheme 1. Synthesis of Etacrynic Acid (5a, X ) Y ) Cl, R1 ) Et) and Derivativesa
a (i) 1.5 equiv of R1-CH2-C(O)Cl, CH2Cl2, 3 equiv of AlCl3, 3 h, 0°C, 3 h reflux; (ii) Br-CH2-CO2Et, K-tert-butylate, KI, THF; (iii)
TMDM, Ac2O, CHCl3; (iv) HCHO, EtOH, K2CO3;34 (v) HOSuc, DCC, HN(R2)(R3), CH2Cl2;34 (vi) R1-CH2-C(O)Cl, CH2Cl2, 1.5 equiv of
AlCl3, 3 h, 0°C.34
Results and Discussion
Syntheses. Etacrynic acid (5a) and its analogues and
ester derivatives were prepared according to a previ-
ously described pathway (Scheme 1, Table 1).34 Anisoles
(1) (X, Y ) H, Cl, CH3) were acylated with acid chlorides
(R1 ) CH3, C2H5) by Friedel-Crafts acylation. Depend-
ent on the acylation conditions, the acylated phenols (2,
9) or anisoles (7) were obtained. The phenols (2, 9) were
alkylated to yield phenoxy acetic acid esters (3, 10).
These compounds and the anisoles (7) were subjected
to the Mannich reaction with TMDM to yield compound
series 4, 8, and 11, containing the desired Michael
system. Aldol condensation of phenoxy acetic acid esters
(3) with HCHO yielded the acids (5). Aminolysis of the
active ester of etacrynic acid (5a) gave the amides (6).34
Enzyme Inhibition and Docking. First, a compre-
hensive screening35 was performed with an HPLC-based
assay using VSYGSTLQ|AGLRKMA36,37 for TGEV Mpro
and VSVNSTLQ|SGLRKMA12,37,38 for SARS-CoV Mpro
as substrates (Table 2). As the most promising inhibitor,
etacrynic acid tert-butylamide (6a) was identified by the
screening (Figure 1, >80% inhibition of both enzymes
at 100 µM).
This derivative is one of a series of etacrynic acid
amides that were developed as new nonpeptidic cysteine
protease inhibitors containing a Michael system as the
electrophilic fragment.34 Only the amide 6a showed
inhibition of the coronaviral Mpro compounds, whereas
the acid 5a is only weakly active in the HPLC assay
(approximately 20% inhibition at 100 µM, Table 2). To
better understand the relevant interactions between
this inhibitor and the SARS-CoV Mpro, docking experi-
ments using FlexX39 were carried out. The binding site
Figure 1. HPLC profiles of proteolytic reactions for deter-
mination of enzymatic activity of SARS-CoV Mpro and of
inhibition by 6a ([I] ) 100 µM): E, enzyme (1.4 µg in a final
volume of 30 µL); S, substrate VSVNSTLQ|SGLRKMA, [S] )
0.50 mM; P1 and P2, hydrolysis products. The enzyme was
incubated for 30 min with the inhibitor followed by an
incubation period of 60 min with the substrate. After the
incubation, a 2% TFA solution was added and the mixture was
separated on an HPLC system (Zorbax SB-Aq RP-C18 column
with a linear gradient from 5% to 90% acetonitrile in water
containing 0.1% TFA). Peaks were detected at 215 nm.
was extracted from the recently published structure of
an enzyme inhibitor complex13 of SARS Mpro (PDB
code: 1UK4).
In the best docking pose40 (Figure 2) compound 6a is
spanning across the binding pockets with the tert-butyl
group located in the hydrophobic S4 pocket, the dichlo-
robenzyl moiety located close to S3, and the terminal
ethyl group at the Michael system pointing away from
the active site (Figure 2). Hydrogen bonds can be formed
between the ligand and amino acids His163, Glu166,
and Gln189 (Figure 3).41
The docking suggests that the reactive center of the
inhibitor, namely, the activated double bond, is located

6834 Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22
Kaeppler et al.
Table 1. Etacrynic Acid Derivatives Tested for SARS-CoV Mpro
Inhibition
compd
R1
Y
X
Figure 2. Docking overlay of the hexapeptidyl CMK13 (light
brown) and the etacrynic acid amide (6a) (colored by atom).
Compound 6a is spanning across the binding pockets with the
tert-butyl group located in the hydrophobic S4 pocket, the
dichlorobenzyl moiety located close to S3, and the terminal
ethyl group at the Michael system pointing away from the
active site.
4a
4b
4c
4d
4e
4f
Et
Me
Et
Me
Me
Et
Et
Et
Et
Et
Et
Et
Et
Et
Et
Cl
Cl
CH3
CH3
H
H
H
H
H
Cl
Cl
Cl
CH3
Cl
Cl
Cl
Cl
Cl
Cl
Cl
H
5a
5b
6a
6b
6c
6d
6e
6f
Cl
CH3
Cl
NH-tert-butyl
NHC(CH3)2CONH2
(S)-AlaOBn
(R)-AlaOBn
Gly-(S)-PheNH2
NH-n-butyl
Cl
Cl
Cl
Cl
Cl
6g
Cl
6h
Et
Cl
Cl
6i
6k
6l
8a
8b
8c
Et
Et
Et
Me
Et
Cl
Cl
Cl
H
Cl
Cl
Cl
Cl
Cl
Cl
NH-phenyl
NH-n-hexyl
NH-benzyl
Figure 3. Proposed binding mode of 6a. Hydrogen bonds are
formed between the ligand and amino acids His163, Glu166,
and Gln189 of the enzyme. The docking suggests that the
reactive center of the inhibitor, namely, the activated double
bond, is located in proximity to the sulfur of Cys145, pinpoint-
ing that these compound targets the active site.
H
H
11a
Et
Cl
H
Table 2. Inhibition of TGEV Mpro and SARS-CoV Mpro by
Etacrynic Acid Derivatives As Obtained in the HPLC-Based
Assaya
compd
TGEV Mpro
SARS-CoV Mpro
5a
6a
+
+ (100 µM)
+++
+++ (100 µM)
++ (50 µM)
++ (20 µM)
+++ (100 µM)
++ (50 µM)
++ (20 µM)
6b
+++
Figure 4. Proposed binding mode of 6b. This compound is
predicted to form hydrogen bonds with Gln189, Glu166,
Thr190, and Gln192 via its terminal amino group. The
carbonyl group of the Michael system interacts with Gly143.
The reactive double bond is still close to the sulfur of Cys145.
a (+) 10-50% inhibition; (++) 50-80% inhibition; (+++) >80%
inhibition.
active site and because it was thought to be syntheti-
cally accessible. To double-check whether this manually
derived modification actually results in an improved
interaction, compound 6b was automatically docked into
the enzyme. It was predicted to form the same hydrogen
bonds with Gln189 and Glu166 as compound 6a.43 In
addition to that, compound 6b also has the potential to
form two additional hydrogen bonds to Thr190 and
Gln192 via its terminal amino group (see Figure 4).44
in proximity to the sulfur of Cys145 (3.40 Å),42 pinpoint-
ing that these compounds target the active-site. Next,
the S4 pocket was inspected to figure out whether a
modification of the tert-butyl moiety could enhance affin-
ity. It was deduced from this analysis that the introduc-
tion of an additional hydrogen bond donor may increase
affinity. Compound 6a was extended with an R-methyl-
alanine amide residue attached to the terminal carbox-
ylic acid to compound 6b (Table 1). This was done be-
cause the latter compound was thought to be able to form
an additional hydrogen bond, because it still fits the
Because of the additional hydrogen bonds, the mol-
ecule slightly turns around within the active site so that
the carbonyl group of the Michael system is no longer

Inhibitors of Coronavirus Main Protease
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22 6835
Figure 5. Hydrolysis of the FRET pair labeled substrate o-aminobenzoic acid Ser-Val-Thr-Leu-Gln-|-Ser-Gly-(o-NO2)Tyr-Arg-
(Mts)-OH by SASR-CoV Mpro. For determination of the Km value, the substrate was used in concentrations between 50 and 300
µM. Fluorescence increase was measured over a period of 10 min. Values were corrected for the inner filter effect. Km was determined
as 190 ( 23 µM, the mean value from three independent assays.
in the proximity of His163 but instead interacts with
Gly143. However, the reactive double bond is still close
to the sulfur of Cys145 (3.48 Å).42 Docking of a few more
not yet synthesized compounds with amines and alkyl
chains and aliphatic rings of various length and com-
plexity did not result in as good docking scores and as
plausible binding modes as those of compound 6b.
Hence, it was decided to synthesize the latter compound
to verify the predictions derived from docking.
Compound 6b was synthesized via aminolysis of the
active ester of etacrynic acid with R-methylalanine
amide. HPLC assays on SARS-CoV Mpro with the above-
Figure 6. Percent inhibition of SARS-CoV Mpro by etacrynic
mentioned peptide substrate showed the inhibitors (6a
acid derivatives 4-6, 8, and 11 as determined in the FRET
and 6b) to be equipotent between 20 and 100 µM (Table
assay. o-Aminobenzoic acid Ser-Val-Thr-Leu-Gln-|-Ser-Gly-(o-
2). Since the HPLC assay is time-consuming and
NO2)Tyr-Arg(Mts)-OH was used as substrate in a final con-
intricate and only allows for crude differentiation
centration of 50.0 µM; the final enzyme concentration was 4.25
µg mL-1. Inhibitors were used at 100 µM final concentrations.
Fluorescence increase was measured over a period of 20 min.
Inhibitors are ranked according to their inhibition potency.
For structures of compounds, see Scheme 1 and Table 1.
between the inhibitors, we performed fluorimetric as-
says at 100 µM inhibitor concentrations using a fluo-
rescence resonance energy transfer (FRET) pair labeled
substrate. The substrate o-aminobenzoic acid Ser-Val-
Thr-Leu-Gln-|-Ser-Gly-(o-NO2)Tyr-Arg(Mts)-OH, which
was chosen according to previously described assays,24,45
was synthesized by automated solid-phase peptide
synthesis. In contrast to the substrate described in ref
24, we omitted deprotection of the arginine side chain
and used o-nitro-Tyr (3-nitro-Tyr)45 instead of m-nitro-
Tyr as the fluorescence acceptor.46 These modifications
do not decrease the affinity to the enzymes but in
contrast enhance it (TGEV Mpro Km ) 85.5 µM, SARS-
CoV Mpro Km ) 190 µM (Figure 5); the reference value
for o-aminobenzoic acid Ser-Val-Thr-Leu-Gln-|-Ser-Gly-
(m-NO2)Tyr-Arg-OH on SARS-CoV Mpro is Km ) 820 (
130 µM).24
Table 3). Some of these derivatives have already also
been tested on the CAC1 model cysteine protease papain
(Table 3).34
Among these derivatives, the most potent SARS-CoV
Mpro inhibitor is indeed amide 6b (Figures 6 and 7),
which corroborates the predicted binding of the R-me-
thylalanine amide residue into the S4 pocket. In addi-
tion, the results clearly show that at least one chloro
substituent at the phenyl moiety is necessary for SARS-
CoV Mpro inhibition (Figure 6). Compounds with an
unsubstituted phenyl ring or a methyl substituent (4b-
d) are inactive at 100 µM. This also applies to the
dimethyl substituted phenoxy acetic acid 5b. With
respect to this latter finding, the inhibition of the
coronaviral cysteine protease follows a different trend
than the inhibition of papain for which a quite good Ki
To check the validity of the docking results, we tested
several other etacrynic acid derivatives in addition to
amide 6b in the fluorimetric assay (Figures 6 and 7,

6836 Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22
Kaeppler et al.
Figure 7. Inhibition of SARS-CoV Mpro by 6b: (left) progress curves at increasing inhibitor concentrations of 0, 10, 20, 40, 60,
80, 100, 140 µM; (right) nonlinearized and linearized Dixon plot. F is in fluorescence units. o-Aminobenzoic acid Ser-Val-Thr-
Leu-Gln-|-Ser-Gly-(o-NO2)Tyr-Arg(Mts)-OH was used as substrate in a final concentration of 50.0 µM; the final enzyme
concentration was 4.25 µg mL-1. Fluorescence increase was measured over a period of 20 min.
Table 3. Comparison of Inhibition of SARS-CoV Mpro and
Papain34 by Etacrynic Acid Derivatives 4-6
published.63 According to the predicted binding mode,
the phenyl moiety of the etacrynic acid derivatives
serves as a spacer that links the active site and the S4
pocket. The fact that there are no interactions with
other subsites known to contribute to the Mpro substrate
binding (S1′, S1, and S2) might explain the not yet
optimal inhibitory potency (6b: Ki ) 35.3 µM) and the
missing selectivity of this inhibitor class. Interactions
with these binding sites could be achieved with ad-
ditional substituents attached to the phenyl ring that
might lead to superior activity and improved selectivity
compared to CAC1 proteases. Our future efforts will
therefore concentrate on variations of the substituents
at the phenyl ring of 6b.
SARS-CoV Mpro
SARS-CoV Mpro
papain
compd % inhibition at 100 µMa,b
Ki [µM]b
Ki [µM]c
4a
4d
5a
5b
6a
6b
6e
6f
55
nic
20
nic
75
88
54
64
33
45
ndd
13.0
1960
375
33
ndd
ndd
ndd
45.8 ( 3.2
35.3 ( 3.0
ndd
3.2
ndd
188
6.2
413
204
ndd
6g
6h
ndd
ndd
a Values corresponding to Figure 6. b For details see Experi-
mental Section. c Taken from ref 34. c ni: no inhibition. d nd: not
determined.
Experimental Section
value of 33 µM was obtained for 5b (Table 3).34 In
contrast to this, the other derivatives listed in Table 3
exhibit the same order of inhibition potency for SARS-
CoV Mpro and for papain.
Concerning the possible diuretic activity of etacrynic
acid derivatives, it is quite promising that only the
amides and esters display SARS-CoV Mpro inhibition.
Diuretic activity of etacrynic acid is connected to the
free acid group because of active transport of the drug
to its site of diuretic action (the luminal membrane of
the cells of the thick ascending loop) via the organic acid
transport mechanism.47,48 Thus, hydrolytically stable
amides or esters should be void of diuretic side effects.
General Information. Melting points were determined in
open capillary on a melting point apparatus, model 530, from
Bu¨chi, Switzerland. CHN analyses were detemined with a
CHNS-932, Leco. HR-EI mass spectra were recorded on a
Finnigan MAT 90, Thermo Electron GmbH, Germany, at 70
eV ionization energy. HR-ESI-MS spectra were recorded on a
FT-ICR APEX II from Bruker, Germany. ESI mass spectra
were recorded on an Agilent 1100 ion trap equipped with an
HPLC system from Agilent. NMR spectra were recorded on
an AVANCE 400 MHz spectrometer from Bruker Biospin
1
GmbH, Germany (solvent, CDCl3. H NMR, 400.13 MHz; 13C
NMR, 100.61 MHz). IR spectra were recorded on a Pharma-
lyzIR FT-IR spectrometer from BioRad. The R values were
detemined on a 241 polarimeter from Perkin-Elmer. The
refractive indices were determined on an apparatus from ATG
GmbH, Germany. Hydrostatic column chromatography was
performed with silica gel from Merck (silica gel 60, 0.063-0.2
mm or 70-230 mesh).
Summary
A comprehensive HPLC-based screening with various
protease inhibitors containing electrophilic moieties
revealed nonpeptidic etacrynic acid tert-butyl amide (6a)
as the most promising lead for new inhibitors of coro-
naviral main proteases. Docking experiments with 6a
and other etacrynic acid amides led to the development
of 6b, which exhibits slightly improved affinity to SARS-
CoV Mpro. To the best of our knowledge, this compound
is the first nonpeptidic inhibitor targeting the active site
cysteine residue of the SARS-CoV Mpro. Recently and
independently of our work a paper concerning the
development of inhibitors derived from AG-7088 was
All solvents were purified and dried prior to use according
to standard literature procedures.
Protein Expression and Purification. The TGEV Mpro
was expressed in Escherichia coli and purified to near homo-
geneity using amylose agarose (New England Biolabs), phenyl
Sepharose HP (Pharmacia), and Superdex 75 (Pharmacia)
columns using previously described protocols.11,36 The purified
enzyme was stored at -70 °C in buffer containing 12 mM Tris-
HCl, pH 7.4, 120 mM NaCl, 0.1 mM EDTA, and 1 mM DTT.
To express the SARS-CoV Mpro, the coding sequence of amino
acid residues from 3236 to 3544 of SARS-CoV (strain Frankfurt
1) polyprotein 1a was amplified by RT-PCR from poly(A) RNA
isolated from SARS-CoV-infected Vero E6 cells49 using oligo-

Inhibitors of Coronavirus Main Protease
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22 6837
nucleotides JZ468 (5′-TCTGCTGTTCTGCAGAGTGGTTTTAG-
GAAAATGGCATTCC-3′) and JZ429N (5′-AAAGAATTCTTAAT-
GTGTATGTGTATGTGTGGTAACACCAGAGCATTGTCTAA
CAACATC-3′). The PCR product was 5′-phosphorylated using
T4 polynucleotide kinase, digested with EcoRI and ligated with
XmnI/EcoRI-digested pMal-c2 plasmid DNA (New England
Biolabs). The resultant plasmid, pMal-SARS-CoV-Mpro-His,
encoded the E. coli maltose-binding protein (MBP) fused to
the SARS-CoV Mpro (residues 1-304). At the MBP-Mpro
junction, the plasmid encoded five amino acid residues,
SAVLQ, that precede the SARS-CoV Mpro sequence in the viral
replicase polyprotein. This N-terminal extension of the Mpro
sequence reconstituted the natural N-terminal Mpro autopro-
cessing site (SAVLQ|SGFRK) and thus resulted in a very
efficient intracellular autocatalytic release of the Mpro's N-
terminus (H2N-SGFRK...) from the MBP fusion protein. This
generated the authentic Mpro N-terminus, which is known to
be required for the full enzymatic activities of coronavirus
main proteases.11,12 At its C-terminus, the Mpro domain was
extended by six consecutive His residues, allowing for affinity
chromatography purification of the protein on Ni-NTA agarose
columns. The pMal-SARS-CoV-Mpro-His plasmid DNA was
used to transform competent E. coli TB1 cells. Following
induction of expression with 1 mM isopropyl â-D-thiogalacto-
pyranoside, the cells were grown at 25°C for 3 h. Cell lysates
were prepared as described previously,36 and the His-tagged
SARS-CoV Mpro was purified on Ni-NTA agarose (Qiagen) and
Superdex 75 (Pharmacia) columns. The purified protein was
concentrated using Centricon YM-3 filter units (Millipore) and
stored at -70°C in buffer containing 15 mM Tris-HCl, pH 8.0,
200 mM NaCl, 0.1 mM EDTA, and 1 mM DTT.
HPLC Assays. The peptide substrate VSYGSTLQAGL-
RKMA was purchased from Jerini, Berlin, Germany, and
VSVNSTLQSGLRKMA was purchased from Bachem. The
assays were performed using a 20 mM Tris-HCl buffer at pH
7.5 containing 15% DMSO (final concentration), 200 mM NaCl,
1 mM DTT, and 1 mM EDTA. An amount of 1.4 µg of enzyme
(TGEV Mpro or SARS-CoV Mpro), either 0.44 mM VSYGSTLQ|-
AGLRKMA36 as substrate for TGEV Mpro or 0.50 mM
VSVNSTLQ|SGLRKMA12,37,38 as substrate for SARS-CoV Mpro
and 20, 50, or 100 µM inhibitor were used in a final volume of
30 µL.36 Stock solutions of substrates and inhibitors were
prepared in DMSO and diluted with assay buffer, and enzymes
were dissolved in buffer. The enzymes were incubated 30 min
with each inhibitor followed by an incubation period with the
respective substrate for 30 min (TGEV Mpro) or 60 min (SARS-
CoV Mpro). After the incubation, a 2% TFA solution was added
and the mixture was separated on a Varian ProStar HPLC
system using an Agilent Zorbax SB-Aq RP-C18 column with
a linear gradient from 5% to 90% acetonitrile in water (flow:
1 mL min-1) containing 0.1% TFA. Peaks were detected at 215
nm. Calculations of inhibition were performed by comparing
the peak integrals of the two hydrolysis products (P1 and P2,
Figure 1) and the substrate peak integrals (S, Figure 1)
relative to the corresponding signal areas in the absence of
inhibitor. All assays were done in triplicate.
between 20 and 100 µM (TGEV Mpro). Values were corrected
for the inner filter effect according to refs 24 and 50.
Fluorescence increase was measured over a period of 10 min
for Km determination and 20 min for inhibition assays.
Substrate and inhibitor stock solutions were prepared in
DMSO and were diluted with assay buffer, and enzymes were
dissolved in buffer.
Km and Ki 51 values were calculated by nonlinear regression
analyses using the program GraFit.52 All values are mean
values from at least three independent assays.
Synthesis of the FRET Pair Labeled Substrate. The
substrate was synthesized by solid-phase peptide synthesis on
a Milligen 9050 PepSynthesiser using standard Fmoc protocol.
Synthesis was performed in DMF/DCM (60:40) with DIC/HOBt
activation starting from Fmoc-Arg(Mts)-Wang-resin. The sub-
strate was cleaved from the resin by treatment with TFA/DCM
(1:1). The product substrate as TFA salt was purified and
characterized by HPLC (see Supporting Information) and LC-
MS. ESI-MS calcd for C59H85N15O20S, [M - H]+: 1357.48.
Found: 1357.0.
Syntheses of Inhibitors. The syntheses of compounds
4a,d, 5a,b, 6a,c,f-h,k are described in ref 34.
General Methods for Syntheses of Etacrynic Acid
Derivatives 4b,c,e,f, 8a-c, and 11a.
Method A: Friedel-Crafts Acylation to Compounds
2 and 9. Amounts of 1 equiv of anisole and 1.5 equiv of acid
chloride are dissolved under N2 atmosphere in 50-100 mL of
absolute CH2Cl2, and the mixture is cooled to 0-5 °C. An
amount of 1.5 equiv of AlCl3 is added within 30 min, and the
mixture is stirred for 2-3 h. A total of 75-100 mL of CH2Cl2
is removed by distillation and is substituted by the same
amount of CH2Cl2. This procedure is repeated twice. An
additional amount of 1.5 equiv of AlCl3 is added, and the
mixture is heated under reflux for 2.5-3 h. The mixture is
pourred on ice and acidified with concentrated HCl to pH 1.
Tartaric acid is added for the complexation of aluminum until
the solution is cleared up. The solution is extracted with
EtOEt, and the organic layer is washed with water and KOH
solution (10%). The organic layer is dried with Na2SO4, filtered
off, and the crude product obtained after removal of the solvent
is recrystallized.
Method B: Syntheses of Phenoxyacetic Acid Esters
(3). An amount of 1 equiv of phenol is dissolved in THF under
N2 atmosphere. Then 1 equiv of K-tert-butylate and a catalytic
amount (0.1 equiv) of KI are added. The mixture is heated at
60 °C, and an amount of 1.1-2.0 equiv of ethyl bromoacetate
is added slowly. The mixture is stirred for 30-60 min, poured
into water, acidified to pH 1 with concentrated HCl, and
extracted with EtOEt. The organic layer is washed with 10%
KOH, water, and brine and dried with Na2SO4. After filtration,
the solvent is removed in vacuo and the remaining residue is
recrystallized or distilled.
Method C: Mannich Reaction with TMDM To Pro-
duce 4. Amounts of 1 equiv of phenoxy acetic acid ester
derivative, 20 equiv of TMDM, and 20 equiv of Ac2O are mixed.
The mixture is heated under reflux at 85 °C. The reaction is
followed by 1H NMR spectroscopy. After completion of the
reaction, the mixture is dissolved in 200 mL of CHCl3. Satured
K2CO3 solution is added until gas evolvement stops. The
mixture is filtered through Celite, and the filtrate is dried with
Na2SO4. After filtration, the solvent is removed in vacuo. The
product is purified by column chromatography.
Fluorimetric Enzyme Assays. The fluorimetric enzyme
assays were performed on a Cary Eclipse fluorescence spec-
trophotometer from Varian, Darmstadt, Germany, using a
microplate reader (excitation 325 nm, emission 425 nm). For
the inhibition assays 96-well microplates from Nunc GmbH,
Wiesbaden, Germany, were used. Assays were performed at
25 °C in a 20 mM Tris-HCl buffer, pH 7.5, containing 0.1 mM
EDTA, 1 mM DTT, 200 mM NaCl, and 12.5% DMSO (final
concentration) in a total volume of 200 µL. The final substrate
concentration for inhibition assays was 50 µM, and the final
enzyme concentration was 4.25 µg mL-1. Inhibitors were used
at 100 µM final concentration for preliminary screening
(results shown in Figure 6) or at concentrations between 10
and 140 µM for determination of Ki values (results shown in
Figure 7 and Table 3).
The syntheses of etacrynic acid amides 6b, 6d, 6e, 6i,53 and
6l were performed starting from etacrynic acid (5a) and the
corresponding amines as described earlier.34
Ethyl [3-Methyl-4-(2-methylacryloyl)phenoxy]acetate
(4b). Synthesis of Ethyl (3-Methyl-4-propionylphenoxy)-
acetate (3b). Method B is used. Starting from 13.7 g (83.4
mmol) of 1-(4-hydroxy-2-methylphenyl)propane-1-one (2b),54
9.23 g (84 mmol) K-tert-butylate, and 20.9 g (125.1 mmol) of
ethyl bromoacetate in 75 mL of THF, an amount of 10.75 g
(43.0 mmol, 52%) of ethyl-(3-methyl-4-propionylphenoxy)-
acetate (3b) is obtained as a colorless solid; mp 33-34 °C
(ethanol). Anal. (C14H18O4) C, H, N. 1H NMR (400.13 MHz,
For determination of Km values, the substrate was used in
concentrations between 50 and 300 µM (SARS-CoV Mpro) and

6838 Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22
Kaeppler et al.
CDCl3, 300 K, TMS): δ 1.18 (3H, t, J ) 7.33 Hz, H3C-CH2-
O), 1.30 (3H, t, J ) 7.07 Hz, H3C-CH2-C), 2.53 (3H, s, Ar-
CH3), 2.90 (2H, q, J ) 7.33 Hz, H3C-CH2-O-), 4.28 (2H, q, J
) 7.07 Hz, H3C-CH2-C), 4.65 (2H, s, -O-CH2-), 6.75 (2H,
mc, arom H2 + H6), 7.70 (1H, d, J ) 8.34 Hz, arom H5). 13C
NMR (100.61 MHz, CDCl3, 300 K, TMS): δ 8.59 (CH3-CH2-
CO), 14.17 (O-CH2-CH3), 22.27 (Ar-CH3), 34.01 (CH3-CH2-
CO), 61.53 (O-CH2-CH3), 65.13 (O-CH2-CO), 111.09 (arom
C2 or C6, CH), 118.10 (arom C2 or C6, CH), 131.22 (arom qC3),
132.16 (arom C5, CH), 141.82 (arom qC4), 159.70 (arom qC1),
168.42 (O-CH2-CO), 202.74 (Ar-CO).
Synthesis of Ethyl [3-Methyl-4-(2-methylacryloyl)phe-
noxy]acetate (4b). Method C is used. Starting from 1.31 g
(5 mmol) of ethyl (3-methyl-4-propionylphenoxy)acetate (3b),
1.40 g (13.6 mmol) of TMDM, and 5.4 g (52.5 mmol) of acetic
anhydride, an amount of 179 mg (14%) of 4b is obtained as a
colorless liquid after purification by column chromatography
on silica gel 60 (cyclohexane/ethyl acetate 10/1). nD22 )1.5240.
HR-EI-MS (70 eV, m/z, [M]+) calcd for C15H18O4: 262.1200.
Found: 262.1201. 1H NMR (400.13 MHz, CDCl3, 300 K,
TMS): δ 1.30 (3H, t, J ) 7.07 Hz, CH2-CH3), 2.03 (3H, s,
H3C-CdCH2), 2.33 (3H, s, Ar-CH3), 4.28 (2H, q, J ) 7.07 Hz,
-CH2-CH3), 4.64 (2H, s, O-CH2-CO-), 5.54 (1H, s, dCH2),
5.90 (1H, s, dCH2), 6.70 (1H, dd, J ) 2.40 Hz, J ) 8.48 Hz,
arom H6), 6.77 (1H, d, J ) 2.40 Hz, arom H2), 7.27 (1H, d, J )
8.48 Hz, arom H5). 13C NMR (100.61 MHz, CDCl3, 300 K): δ
14.18 (O-CH2-CH3), 17.68 (H3C-CdCH2), 20.32 (Ar-CH3),
61.47 (O-CH2-CH3), 65.26 (O-CH2-CO), 100.63 (arom C6,
CH), 117.26 (arom C2, CH), 128.57 (dCH2), 130.64 (arom C5,
CH), 132.23 (arom qC4), 139.47 (H3C-CdCH2), 145.42 (arom
qC1), 158.95 (O-CH2-CO), 168.59 (Ar-CO-).
Ethyl [2-Chloro-4-(2-methylacryloyl)phenoxy]acetate
(4e). Synthesis of Ethyl (2-Chloro-4-propionylphenoxy)-
acetate (3e). Method B is used. Starting from 13.85 g (75
mmol) of 1-(3-chloro-4-hydroxyphenyl)propane-1-one (2e),56
8.42 g (75 mmol) of K-tert-butylate, and 18.78 g (122.5 mmol)
of ethyl bromoacetate in 75 mL of THF, an amount of 13.0 g
(48.02 mmol, 64%) of ethyl (2-chloro-4-propionylphenoxy)-
acetate (3e) is obtained as a colorless solid, mp 125-126.5 °C
(ethanol). Anal. (C13H15ClO4) C, H, N. 1H NMR (400.13 MHz,
CDCl3, 300 K, TMS): δ 1.20 (3H, t, J ) 7.33 Hz, H3C-CH2-
CO), 1.29 (3H, t, J ) 7.20 Hz, H3C-CH2-O), 2.93 (2H, q, J )
7.33 Hz, H3C-CH2-CO), 4.27 (2H, q, J ) 7.20 Hz, H3C-CH2-
O), 4.76 (2H, s, O-CH2-CO), 6.84 (1H, d, J ) 8,58 Hz, arom
H6), 7.83 (1H, dd, J ) 2.02 Hz, J ) 8.59 Hz, arom H5), 8.02
(1H, d, J ) 2.02 Hz, arom H3). 13C NMR (100.61 MHz, CDCl3,
300 K, TMS): δ 8.23 (H3C-CH2-CO), 14.13 (H3C-CH2-O),
31.55 (H3C-CH2-CO), 61.74 (H3C-CH2-O), 65.96 (O-CH2-
CO), 112.52 (arom C6, CH), 123.49 (arom qC4 or qC2-Cl),
128.03 (arom C5, CH), 130.73 (arom C3, CH), 131.51 (arom qC4
or qC2-Cl), 156.96 (arom qC1), 167.70 (O-CH2-CO), 198.32
(Ar-CO).
Synthesis of Ethyl [2-Chloro-4-(2-methylacryloyl)phe-
noxy]acetate (4e). Method C is used. Starting from 1.35 g (5
mmol) of ethyl (2-chloro-4-propionylphenoxy)acetate (3e), 766
mg (7.5 mmol) of TMDM, and 5.4 g (52.5 mmol) of acetic
anhydride, an amount of 225 mg (0.8 mmol, 16%) of 4e was
obtained as a colorless solid, mp 55-56 °C (cyclohexane). Anal.
1
(C14H15ClO4) C, H, N. H NMR (400.13 MHz, CDCl3, 300 K,
TMS): δ 1.30 (3H, t, J ) 7.16 Hz, -CH2-CH3), 2.05 (3H, s,
CH3), 4.29 (2H, q, J ) 7.16 Hz, -CH2-CH3), 4.77 (2H, s,
O-CH2-), 5.57 (1H, s, dC-H), 5.87 (1H, s, dC-H), 6.84 (1H,
d, J ) 8.53 Hz, Ar-H), 7.66 (1H, dd, J ) 2.15 Hz, J ) 8.83
Hz, Ar-H), 7.85 (1H, d, J ) 2.15 Hz, Ar-H). 13C NMR (100.61
MHz, CDCl3, 300 K): δ 14.12 (-CH2-CH3), 18.81 (-CH3),
61.70 (-CH2-CH3), 65.97 (-O-CH2-), 112.37 (arom C6, CH),
123.13 (arom C2/4, q), 125.99 (dCH2), 129.59 (arom C5, CH),
131.74 (arom qC2/4), 132.12 (arom C3, CH), 143.46 (H2C)C),
156.56 (arom qC1), 167.73 (-CH2-CO-O-), 195.76 (-CO-
Ar).
Ethyl [3-Methyl-4-(2-methylenebutyryl)phenoxy]ace-
tate (4c). Synthesis of Ethyl (4-Butyryl-3-methylphe-
noxy)acetate (3c). Method B is used. Starting from 8.02 g
(45 mmol) 1-(4-hydroxy-2-methylphenyl)butane-1-one (2c),55
5.05 g (45 mmol) of K-tert-butylate, 8.26 g (49.5 mmol) of ethyl
bromoacetate, an amount of 9.2 g (34.8 mmol, 77%) of ethyl
(4-butyryl-3-methylphenoxy)acetate (3c) is obtained as color-
22
1
less liquid. nD ) 1.5200. Anal. (C15H20O4) C, H, N. H NMR
(400.13 MHz, CDCl3, 300 K, TMS): δ 0.97 (3H, t, J ) 7.33
Hz, H3C-CH2-CH2), 1.30 (3H, t, J ) 7.08 Hz, H3C-CH2-O),
1.72 (2H, sext, J ) 7.33 Hz, H3C-CH2-CH2), 2.52 (3H, s, Ar-
CH3), 2.84 (2H, t, J ) 7.33 Hz, H3C-CH2-CH2), 4.28 (2H, q,
J ) 7.08 Hz, H3C-CH2-O), 4.65 (2H, s, O-CH2-CO), 6.73-
6.76 (2H, m, arom H2 + H6), 7.69 (1H, d, J ) 8.34 Hz, arom
H5). 13C NMR (100.61 MHz, CDCl3, 300 K): δ 13.77 (H3C-
CH2-CH2), 14.06 (H3C-CH2-O), 17.98 (H3C-CH2-CH2),
22.05 (Ar-CH3), 42.81 (H3C-CH2-CH2), 61.40 (H3C-CH2-
O), 65.01 (O-CH2-CO), 110.97 (arom C2, CH), 117.98 (arom
C6, CH), 131.16 (arom C5, CH), 131.32 (arom qC4), 141.60
(arom qC3, C-CH3), 159.58 (arom qC1), 168.32 (O-CH2-CO),
202.38 (Ar-CO).
Ethyl [2-Chloro-4-(2-methylenebutyryl)phenoxy]ace-
tate (4f). Synthesis of Ethyl (4-Butyryl-2-chlorophenoxy)-
acetate (3f). Method B is used. Starting from 9.93 g (50 mmol)
of 1-(3-chloro-4-hydroxyphenyl)butane-1-one (2f),57 5.61 g (50
mmol) of K-tert-butylate, 9.18 g (55 mmol) of ethyl bromoac-
etate in 75 mL of THF, an amount of 10.37 g (36.42 mmol,
73%) of the target compound is obtained as colorless solid, mp
97-98 °C (ethanol). Anal. (C14H17ClO4) C, H, N. 1H NMR
(400.13 MHz, CDCl3, 300 K, TMS): δ 1.00 (3H, t, J ) 7.46
Hz, H3C-CH2-CH2), 1.30 (3H, t, J ) 7.20 Hz, H3C-CH2-O),
1.75 (2H, sext, J ) 7.33 Hz, 7.46 Hz, H3C-CH2-CH2), 2.88
(2H, t, J ) 7.33 Hz, H3C-CH2-CH2), 4.28 (2H, q, J ) 7.20
Hz, H3C-CH2-O), 4.77 (2H, s, O-CH2-CO), 6.84 (1H, d, J )
8.59 Hz, arom H6), 7.83 (1H, dd, J ) 2.27 Hz, J ) 8.59 Hz,
arom H5), 8.02 (1H, d, J ) 2.27 Hz, arom H3). 13C NMR (100.61
MHz, CDCl3, 300 K, TMS): δ 13.86 (H3C-CH2-CH2), 14.14
(H3C-CH2-O), 17.79 (H3C-CH2-CH2), 40.25 (H3C-CH2-
CH2), 61.74 (H3C-CH2-O), 65.97 (O-CH2-CO), 112.52 (arom
C6, CH), 123.49 (arom qC4), 128.11 (arom C5, CH), 130.80
(arom C3, CH), 131.71 (arom qC2, C-Cl), 156.96 (arom qC1),
167.71 (O-CH2-CO), 197.88 (Ar-CO).
Synthesis of Ethyl [3-Methyl-4-(2-methylenebutyryl)-
phenoxy]acetate (4c). Method C is used. Starting from 1.38
g (5 mmol) of ethyl (4-butyryl-3-methylphenoxy)acetate (3c),
1.40 g (13.6 mmol) of TMDM, and 5.4 g (52.5 mmol) of acetic
anhydride and after purification by column chromatrography
on silica gel 60 (cyclohexane/ethyl acetate 9/1), an amount of
390 mg (1.4 mmol, 28%) of 4c is obtained as a colorless liquid.
nD ) 1.5243. HR-EI-MS (70 eV, m/z, [M]+) calcd for
22
C16H20O4: 276.1362. Found: 276.1357. 1H NMR (400.13 MHz,
CDCl3, 300 K, TMS): δ 1.13 (3H, t, J ) 7.46 Hz, H3C-CH2),
1.31 (3H, t, J ) 7.07 Hz, H3C-CH2-O), 2.34 (3H, s, Ar-CH3),
2.46 (2H, q, J ) 7.46 Hz, H3C-CH2), 4.28 (2H, q, J ) 7.07 Hz,
H3C-CH2-O), 4.64 (2H, s, O-CH2-CO), 5.53 (1H, s, dCH),
5.82 (1H, s, dCH), 6.70 (1H, dd, J ) 2.53 Hz, J ) 8.71 Hz,
arom H6), 6.77 (1H, d, J ) 2.53 Hz, arom H2), 7.28 (1H, d, J )
8.71 Hz, arom H5). 13C NMR (100.61 MHz, CDCl3, 300 K): δ
12.51 (H3C-CH2), 14.15 (H3C-CH2-O), 20.38 (Ar-CH3), 24.17
(H3C-CH2), 61.46 (H3C-CH2-O), 65.23 (O-CH2-CO), 110.62
(arom C6, CH), 117.20 (arom C2, CH), 126.23 (dCH2), 130.87
(arom C5, CH), 132.47 (arom qC4), 139.64 (arom qC3, C-CH3),
151.33 (qCdCH2), 158.98 (arom qC1), 168.56 (O-CH2-CO),
199.61 (Ar-CO).
Synthesis of Ethyl [2-Chloro-4-(2-methylenebutyryl)-
phenoxy]acetate (4f). Method C is used. Starting from 2.85
g (10 mmol) of ethyl-(4-butyryl-2-chlorophenoxy)acetate (3f)
9.53 g (93.23 mmol) of TMDM, and 10.8 g (105.8 mmol) of
acetic anhydride, an amount of 990 mg (3.34 mmol, 33%) of
4f is obtained as a colorless liquid. nD22 ) 1.5398. Anal. (C15H17-
ClO4) C, H, N. 1H NMR (400.13 MHz, CDCl3, 300 K, TMS): δ
1.11 (3H, t, J ) 7.45 Hz, H3C-CH2), 1.30 (3H, t, J ) 7.08 Hz,
O-CH2-CH3), 2.46 (2H, q, J ) 7.45 Hz, H3C-CH2), 4.28 (2H,
q, J ) 7.08 Hz, O-CH2-CH3), 4.77 (2H, s, O-CH2-CO), 5.52
(1H, s, dCH), 5.78 (1H, s, dCH), 6.84 (1H, d, J ) 8.59 Hz,
arom H6), 7.68 (1H, dd, J ) 2.27 Hz, J ) 8.59 Hz, arom H5),
7.87 (1H, d, J ) 2.27 Hz, arom H3). 13C NMR (100.61 MHz,
CDCl3, 300 K): δ 12.28 (H3C-CH2-Cd), 14.09 (O-CH2-CH3),

Inhibitors of Coronavirus Main Protease
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22 6839
25.42 (H3C-CH2-Cd), 61.69 (O-CH2-CH3), 65.94 (O-CH2-
CO), 112.33 (arom C6, CH), 123.13 (C)CH2 + arom qC2, C-Cl),
129.64 (arom C5, CH), 132.02 (arom qC4), 132.13 (arom C3,
CH), 149.38 (C)CH2), 156.64 (arom qC1), 167.71 (O-CH2-
CdO), 195.98 (Ar-CdO).
1H NMR (400.13 MHz, CDCl3, 300 K, TMS): δ 1.16 (3H, t, J
) 7.33 Hz, H3C-CH2), 2.48 (2H, q, J ) 7.33 Hz, H3C-CH2),
4.70 (2H, s, O-CH2-CO), 5.60 (1H, s, CdCH2), 5.97 (1H, s,
CdCH2), 6.93 (1H, d, J ) 8.34 Hz, arom H6), 7.18 (1H, t, J )
7.58 Hz, arom H4, anilide), 7.22 (1H, d, J ) 8.34 Hz, arom
H5), 7.39 (2H, t, J ) 7.58 Hz, arom H3 + arom H5, anilide),
7.62 (2H, d, J ) 7.58 Hz, arom H2 + arom H6, anilide), 8.53
(1H, s, NH). 13C NMR (100.61 MHz, CDCl3, 300 K): δ 12.40
(H3C-CH2), 23.42 (H3C-CH2), 68.38 (O-CH2-CO), 111.20
(arom C6, CH), 120.01 (arom C2 + C6, CH, anilide), 123.07
(arom qC4), 125.11 (arom C4, CH, anilide), 127.33 (arom C5,
CH), 128.79 (qCdCH2), 129.21 (arom C3 + C5, CH, anilide),
131.64 (arom qC3, C-Cl), 134.60 (arom qC2, C-Cl), 136.71
(arom qC1, anilide), 150.22 (qCdCH2), 154.31 (arom qC1),
164.56 (O-CH2-CO), 195.43 (Ar-CO).
N-Benzyl-2-[2,3-dichloro-4-(2-methylenebutyryl)phe-
noxy]acetamide (6l). Colorless solid, mp 90-92°C (cyclohex-
ane). Anal. (C20H19Cl2NO3) C, H, N. 1H NMR (400.13 MHz,
CDCl3, 300 K, TMS): δ 1.15 (3H, t, J ) 7.46 Hz, H3C-CH2),
2.47 (2H, q, J ) 7.46 Hz, H3C-CH2), 4.58 (2H, d, J ) 6.07 Hz,
benzyl-CH2), 4.63 (2H, s, O-CH2-CO), 5.57 (1H, s, CdCH2),
5.95 (1H, s, CdCH2), 6.87 (1H, d, J ) 8.47 Hz, arom H6), 7.07
(1H, s, NH), 7.18 (1H, d, J ) 8.47 Hz, arom H5), 7.28-7.38
(5H, m, arom H benzyl residue). 13C NMR (100.61 MHz, CDCl3,
300 K): δ 12.38 (H3C-CH2), 23.40 (H3C-CH2), 43.13 (benzyl-
CH2-), 68.32 (-O-CH2-CO), 110.97 (arom C6, CH), 123.00
(arom qC4), 127.18 (arom C5, CH), 127.54 (arom benzyl-CH),
127.72 (arom benzyl-CH), 128.66 (qCdCH2), 128.82 (arom
benzyl-CH), 131.50 (arom qC3, C-Cl), 134.27 (arom qC2,
C-Cl), 137.46 (arom benzyl-qC1), 150.19 (qCdCH2), 154.48
(arom qC1), 166.61 (O-CH2-CO), 195.46 (Ar-CO).
1-(3-Chloro-4-methoxyphenyl)-2-methylpropenone (8a).
Method C is used. Starting from 1.98 g (10 mmol) of 1-(3-
chloro-4-methoxyphenyl)propane-1-one (7a),59 11.42 g (112
mmol) of TMDM, and 16.2 g (158 mmol) of acetic anhydride,
the crude product obtained is purified by column chromatog-
raphy on silica gel 60 (cyclohexane/ethyl acetate 19/1). Yield
433 mg (2.1 mmol, 21%), colorless solid, mp 49-50 °C (cyclo-
hexane/ethyl acetate). HR-EI-MS (70 eV, m/z, [M]+) calcd for
C11H11ClO2: 210.0442. Found: 210.0441. 1H NMR (400.13
MHz, CDCl3, 300 K, TMS): δ 2.06 (3H, s, CH3), 3.97 (3H, s,
O-CH3), 5.56 (1H, s, CdCH2), 5.85 (1H, s, CdCH2), 6.96 (1H,
d, J ) 8.59 Hz, arom H6), 7.72 (1H, dd, J ) 2.02 Hz, J ) 8.59
Hz, arom H5), 7.85 (1H, d, J ) 2.02 Hz, arom H3). 13C NMR
(100.63 MHz, CDCl3, 300 K): δ 18.91 (CH3), 56.34 (O-CH3),
111.08 (arom C5, CH), 122.47 (arom qC4), 125.54 (qCdCH2),
129.98 (arom C6, CH), 130.66 (arom qC2, C-Cl), 131.81 (arom
C3, CH), 143.56 (qCdCH2), 158.22 (arom qC1), 195.92 (Ar-
CO).
2-{2-[2,3-Dichloro-4-(2-methylenebutyryl)phenoxy]-
acetylamino}-2-methylpropionic Acid Carboxamide (6b).
Colorless solid, mp 157-158 °C (ethyl acetate). Anal. (C17H20-
Cl2N2O4) C, H, N. 1H NMR (400.13 MHz, CDCl3, 300 K,
TMS): δ 1.15 (3H, t, J ) 7.47 Hz, H3C-CH2), 1.67 (6H, s,
C-(CH3)2), 2.47 (2H, q, J ) 7.47 Hz, H3C-CH2), 4.54 (2H, s,
O-CH2-CO-), 5.58 (1H, s, CdCH2), 5.63 (1H, s, CO-NH2),
5.95 (1H, s, CdCH2), 6.44 (1H, s, CO-NH2), 6.87 (1H, d, J )
8.49 Hz, arom H6), 7.19 (1H, d, J ) 8.49 Hz, arom H5), 7.45
(1H, s, CO-NH-). 13C NMR (100.61 MHz, CDCl3, 300 K,
TMS): δ 12.38 (H3C-CH2), 23.40 (H3C-CH2), 25.16 (C-(CH3)2),
57.25 (qC-(CH3)2), 68.24 (O-CH2-CO), 110.90 (arom C6, CH),
123.04 (arom qC2, C-Cl or qC4), 127.16 (arom C5, CH), 128.73
(dCH2), 131.54 (arom qC3, C-Cl), 134.28 (arom qC2, C-Cl or
qC4), 150.17 (qCdCH2), 154.37 (arom qC1), 166.59 (O-CH2-
CO), 176.08 (CO-NH2), 195.53 (Ar-CO).
The amine used for coupling with etacrynic acid (5a),
namely, 2-amino-2-methylpropionic acid carboxamide HCl (R-
methylalaninecarboxamide HCl), was synthesized according
to ref 58.
(R)-Benzyl 2-{2-[2,3-Dichloro-4-(2-methylenebutyryl)-
phenoxy]acetylamino}propionate (6d). Yellowish liquid;
R25 +11.95° (methanol, c 2.18). Anal. (C23H23Cl2NO5) C, H,
D
N. HR-EI-MS (70 eV, m/z, [M - Cl]+) calcd for C23H23Cl2NO5:
428.1259. Found: 428.1261. 1H NMR (400.13 MHz, CDCl3, 300
K, TMS): δ 1.15 (3H, t, J ) 7.33 Hz, H3C-CH2), 1.51 (3H, d,
J ) 7.33 Hz, Ala-CH3), 2.48 (2H, q, J ) 7.33 Hz, H3C-CH2),
4.58 (dd, J ) 2.02 Hz, J ) 14.40 Hz, O-CH2-CO-NH), 4.73
(1H, q, J ) 7.07 Hz, J ) 7.33 Hz, Ala-CH), 5.21 (dd, J ) 2.28
Hz, J ) 12.25 Hz, benzyl-CH2), 5.58 (1H, s, CdCH2), 5.95 (1H,
s, CdCH2), 6.85 (1H, d, J ) 8.46 Hz, arom H6, 7.17 (1H, d, J
) 8.46 Hz, arom H5), 7.34-7.40 (6H, m, benzyl-CH, NH). 13
C
NMR (100.61 MHz, CDCl3, 300 K): δ 12.40 (H3C-CH2), 18.39
(Ala-CH3), 23.42 (H3C-CH2), 48.02 (Ala-CH), 67.26 (benzyl-
CH2), 68.18 (O-CH2-CO-NH), 110.96 (arom C6, CH), 123.71
(arom qC3, C-Cl or arom qC4), 127.13 (arom C5, CH), 128.21
(arom benzyl-CH), 128.55 (arom benzyl-CH), 128.67 (qC-
CH2), 131.54 (arom qC3, C-Cl or arom qC4), 134.29 (arom qC2,
C-Cl), 135.17 (arom qC1, benzyl), 150.21 (qCdCH2), 154.53
(arom qC1), 166.31 (O-CH2-CO-NH), 172.02 (Ala-CO),
195.54 (Ar-CO).
(S)-2-(2-{2-[2,3-Dichloro-4-(2-methylenebutyryl)phen-
oxy]acetylamino}acetylamino)-3-phenylpropionamide
(6e). Colorless solid; R25D +7.27° (methanol, c 1.10); mp 146-
148 °C (methanol). HR-ESI-MS (m/z, [M + H]+) calcd for
C24H25Cl2N3O5: 506.1250. Found: 506.1258. 1H NMR (400.13
MHz, DMSO-d6, 300 K): δ 1.07 (3H, t, J ) 7.33 Hz, H3C-
CH2), 2.36 (2H, q, J ) 7.33 Hz, H3C-CH2), 2.76 (1H, m, J )
13.64 Hz, Phe-CH2), 3.02 (1H, m, J ) 13.64 Hz, Phe-CH2),
3.67 (1H, dd, J ) 5.56 Hz, J ) 16.65 Hz, Gly-CH2), 3.83 (1H,
dd, J ) 5.56 Hz, J ) 16.65 Hz, Gly-CH2), 4.44 (1H, m, J )
4.30 Hz, J ) 4.80 Hz, Phe-CH), 4.75 (2H, s, O-CH2-CO),
7.09 (1H, s, Phe-NH2), 7.12 (1H, d, J ) 8.59 Hz, arom H6),
7.14-7.26 (5H, m, arom H (Phe)), 7.30 (1H, d, J ) 8.59 Hz,
arom H5), 7.43 (1H, s, Phe-NH2), 8.11 (1H, d, J ) 5.56 Hz,
Gly-NH), 8.14 (1H, d, J ) 8.34 Hz, Phe-NH). 13C NMR
(100.61 MHz, DMSO-d6, 300 K): δ 12.32 (H3C-CH2), 22.89
(H3C-CH2), 37.54 (Phe-CH2), 41.67 (Gly-CH2), 53.78 (Phe-
CH), 67.75 (O-CH2-CO), 112.04 (arom C6, CH), 121.09 (arom
qC4), 126.19 (arom C4′, Phe-CH), 127.48 (arom C5, CH), 128.01
(arom Phe-CH), 129.08 (arom Phe-CH), 129.30 (arom qC3,
C-Cl), 129.40 (CdCH2), 132.53 (arom qC2, C-Cl), 137.91
(arom qC1′), 149.30 (qCdCH2), 155.28 (arom qC1), 166.86 (O-
CH2-CO), 168.00 (Gly-CO), 172.75 (Phe-CO), 195.07 (Ar-
CO).
1-(3-Chloro-4-methoxyphenyl)-2-methylenebutane-1-
one (8b). Method C is used. Starting from 2.13 g (10 mmol)
of 1-(3-chloro-4-methoxyphenyl)butane-1-one (7b),57 9.21 g (90
mmol) of TMDM, and 16.2 g (158 mmol) of acetic anhydride,
the crude product obtained is purified by column chromatog-
22
raphy. Yield 941 mg (4.19 mmol, 42%), colorless liquid. nD
)
1.5620. HR-EI-MS (70 eV, m/z, [M]+) calcd for C12H13ClO2:
224.0599. Found: 224.0596. 1H NMR (400.13 MHz, CDCl3, 300
K, TMS): δ 1.12 (3H, t, J ) 7.33 Hz, CH2-CH3), 2.47 (2H, q,
J ) 7.33 Hz, CH2-CH3), 3.97 (3H, s, O-CH3), 5.51 (1H, s, d
CH), 5.76 (1H, s, dCH), 6.96 (1H, d, J ) 8.58 Hz, arom H5),
7.73 (1H, dd, J ) 2.02 Hz, J ) 8.58 Hz, arom H6), 7.86 (1H, d,
J ) 2.02 Hz, arom H2). 13C NMR (100.63 MHz, CDCl3, 300 K,
TMS): 12.33 (H3C-CH2-), 25.56 (H3C-CH2-), 56.37 (O-CH3),
111.11 (arom C5, CH), 122.52 (arom qC1), 122.71 (dCH2),
130.08 (arom C6, CH), 131.00 (arom qC3, C-Cl), 131.85 (arom
C2, CH), 149.51 (CdCH2, q), 158.34 (arom qC4), 196.20 (Ar-
CO).
1-(3-Chloro-4-methoxyphenyl)-2-methylene-4-(4-nitro-
phenyl)butane-1-one (8c). Synthesis of 1-(3-Chloro-4-
methoxyphenyl)-4-(4-nitrophenyl)butane-1-one(7c).Method
A is used. Starting from 1.90 g (13.3 mmol) of 2-chloro anisole
(1c), 4.89 g (21.5 mmol) of 4-(4-nitrophenyl)butyryl chloride,60
and 2 × 2.66 g (2 × 20 mmol) of AlCl3 in 50 mL of CH2Cl2, an
amount of 4.09 g (12.25 mmol, 92%) of the desired compound
2-[2,3-Dichloro-4-(2-methylenebutyryl)phenoxy]-N-phe-
nylacetamide (6i). Colorless solid, mp 125-126 °C (cyclo-
hexane/ethyl acetate) [ref 53, 145-147 °C]. HR-EI-MS (70 eV,
m/z, [M]+) calcd for C19H17Cl2NO3: 377.0580. Found: 377.0580.

6840 Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22
Kaeppler et al.
is obtained as yellow crystals after purification by column
300 K): δ 12.41 (H3C-CH2), 14.09 (H3C-CH2-O), 23.51
(H3C-CH2), 61.48 (H3C-CH2-O), 65.91 (O-CH2-CO), 113.22
(arom C2, CH), 121.66 (arom C4, CH), 127.13 (qCdCH2), 128.65
(arom qC6), 130.13 (arom C5, CH), 136.60 (arom qC3, C-Cl),
150.70 (qCdCH2), 155.90 (arom qC1), 167.86 (O-CH2-CO),
196.91 (Ar-CO).
chromatography, mp 84-85 °C (ethanol). Anal. (C17H16ClNO4)
1
C, H, N. H NMR (400.13 MHz, CDCl3, 300 K, TMS): δ 2.11
(2H, quin, J ) 7.71 Hz, J ) 7.08 Hz, -CH2-CH2-CO-), 2.82
(2H, t, J ) 7.71 Hz, CH2-CH2-CH2-CO), 2.94 (2H, t, J )
7.08 Hz, -CH2-CO), 3.97 (3H, s, O-CH3), 6.96 (1H, d, J )
8.79 Hz, arom H5), 7.37 (2H, d, J ) 8.72 Hz, arom H2′ + H6′),
7.84 (1H, dd, J ) 2.09 Hz, J ) 8.79 Hz, arom H6), 7.96 (1H, d,
Enzyme Preparation for Docking Procedure. The
starting conformation for the docking procedure was the
crystal structure of the SARS-CoV Mpro in complex with Cbz-
Val-Asn-Ser-Thr-Leu-Gln-CMK (PDB code: 1UK4).13 Owing
to the covalent binding mode of the cocrystallized ligand Cbz-
Val-Asn-Ser-Thr-Leu-Gln-CMK, the active center of SARS-CoV
Mpro as found in the crystal structure is very tight. Hence, prior
to docking, the covalent bond between ligand and receptor was
eliminated, the ligands’ chloromethyl ketone substructure was
rebuilt, and water molecules were deleted. Then the enzyme
was relaxed using SYBYL 6.9 (hot region around the ligand,
6 Å; interesting region, 12 Å; 5000 steps; Tripos force field).62
Since the water molecule in subpocket S2 (HOH16) is deeply
buried, the relaxation was also done with this water molecule
kept in place. However, no obvious differences in the resulting
geometries were observed in both structures. Put differently,
for both enzyme conformations, this part of S2 is without reach
for a potential ligand; therefore, the conformation obtained
with all water molecules deleted was used for docking.
Active Site Definition. Using the SETREF directive
within FlexX, the active site was defined as the complete
amino acids found within 8 Å of the heavy atoms of the
cocrystallized ligand. For interpretation purposes, only those
docking poses located within this active site were considered.
Ligand Preparation. All compounds were sketched in 2D
and then converted to 3D structures using SYBYL 6.9. Since
FlexX is working in torsional space only (i.e., bond lengths and
angles are kept constant), a geometry optimization of the
ligands (500 steps, Gasteiger-Hueckel charges, dielectric
constant of 4.0, Tripos force field) was performed.
J ) 2.09 Hz, arom H2), 8.16 (2H, d, J ) 8.72 Hz, arom H3′
+
H5′). 13C NMR (100.61 MHz, CDCl3, 300 K): δ 25.13 (-CH2-
CH2-CO), 35.00 (-CH2-CH2-CH2-CO), 36.98 (-CH2-CO),
56.37 (O-CH3), 111.31 (arom C5, CH), 122.92 (arom qC3,
C-Cl), 123.71 (arom C3′ + C5′, CH), 128.35 (arom C6, CH),
129.24 (arom C2′ + C6′, CH), 130.31 (arom C2, CH), 130.39
(arom qC1), 146.50 (arom qC4′), 149.54 (arom qC1′), 158.80
(arom qC4), 196.94 (C)O).
Synthesis of 1-(3-Chloro-4-methoxyphenyl)-2-methyl-
ene-4-(4-nitrophenyl)butane-1-one (8c). Method C is used.
Starting from 1.67 g (5 mmol) of 1-(3-chloro-4-methoxyphenyl)-
4-(4-nitrophenyl)butane-1-one (7c), 4.46 g (40.9 mmol) of
TMDM, and 5.4 g (52.9 mmol) of acetic anhydride, the crude
product 8c was purified by column chromatography on silica
gel 60 (CHCl3). Yield 789 mg (2.28 mmol, 46%), yellow crystals,
mp 86-87 °C (CHCl3). HR-EI-MS (70 eV, m/z, [M]+) calcd for
1
C18H16ClNO4: 345.0762. Found: 345.0769. H NMR (400.13
MHz, CDCl3, 300 K, TMS): δ 2.82 (2H, t, J ) 7.64 Hz, Ar-
CH2-CH2-), 2.95 (2H, t, J ) 7.64 Hz, Ar-CH2-CH2-), 3.98
(3H, s, O-CH3), 5.58 (1H, s, dCH2), 5.76 (1H, s, dCH2), 6.95
(1H, d, J ) 8.59 Hz, arom H5), 7.35 (2H, d, J ) 8.72 Hz, arom
H2′ + H6′), 7.65 (1H, dd, J ) 2.27, J ) 8.59 Hz, arom H6), 7.78
(1H, d, J ) 2.27 Hz, arom H2), 8.15 (2H, d, J ) 8.72 Hz, arom
H3′ + H5′). 13C NMR (100.61 MHz, CDCl3, 300 K): δ 33.87
(Ar-CH2-CH2), 34.19 (Ar-CH2-CH2), 56.38 (O-CH3), 111.12
(arom C6, CH), 122.61 (arom qC2, C-Cl), 123.67 (arom C3′ +
C5′, CH), 125.70 (dCH2), 129.37 (arom C2′ + C6′, CH), 130.02
(arom C5, CH), 130.50 (arom qC4), 131.85 (arom C3, CH),
146.07 (qCdCH2), 146.54 (arom qC4′), 148.98 (arom qC1′),
158.52 (arom qC1), 195.26 (Ar-CO).
Docking Procedure. FlexX was used with standard set-
tings. Base fragment selection was done automatically, and
for base fragment placement, the triangle matching strategy
was applied. For each ligand, a maximum of 100 placements
were stored; however, only those placements where the ligand
was positioned within the active site were inspected in detail.
Ethyl [5-Chloro-2-(2-methylenebutyryl)phenoxy]ace-
tate (11a). Synthesis of Ethyl (2-Butyryl-5-chlorophen-
oxy)acetate (10a). Method B is used. Starting from 9.48 g
(47.7 mmol) of 1-(4-chloro-2-hydroxyphenyl)butane-1-one (9a),61
8.35 g (50 mmol) of ethyl bromoacetate, and 5.35 g (47.7 mmol)
of K-tert-butylate in 75 mL of THF, an amount of 9.62 g (33.79
mmol, 71%) of ethyl (2-butyryl-5-chlorophenoxy)acetate (10a)
is obtained as a colorless solid, mp 51-52 °C (ethanol). Anal.
Acknowledgment. Financial support of this work
by the DFG (Deutsche Forschungsgemeinschaft) (Grants
DFG SCHI 441/3-1, SCHI 441/4-1, and SFB 630, TP A4
to T.S.) (Grant DFG ZI 618/3-1 to J.Z.) (Grant SFB 630,
TP C5 to K.B.) (Grants DFG SCHM 1501/6-1 and SFB
630, TP A3 to C.S.) is gratefully acknowledged. We
thank Sonja Bayer for excellent technical assistance. We
also thank Josef Scheiber for his kind assistance in
preparing Figures 2-4.
1
(C14H17ClO4) C, H, N. H NMR (400.13 MHz, CDCl3, 300 K,
TMS): δ 0.96 (3H, t, J ) 7.46 Hz, H3C-CH2-CH2), 1.32 (3H,
t, J ) 7.20 Hz, H3C-CH2), 1.71 (2H, sext, J ) 7.46 Hz, H3C-
CH2-CH2), 3.04 (2H, t, J ) 7.20 Hz, H3C-CH2-CH2), 4.30
(2H, q, J ) 7.20 Hz, H3C-CH2), 4.70 (2H, s, O-CH2-CO), 6.81
(1H, d, J ) 1.77 Hz, arom H2), 7.03 (1H, dd, J ) 1.77 Hz, J )
8.34 Hz, arom H4), 7.66 (1H, d, J ) 8.34 Hz, arom H5). 13C
NMR (100.61 MHz, CDCl3, 300 K, TMS): δ 13.86 (H3C-CH2-
CH2), 14.16 (H3C-CH2-O), 17.73 (H3C-CH2-CH2), 45.80
(H3C-CH2-CH2), 61.71 (H3C-CH2-O), 65.71 (O-CH2-CO),
112.89 (arom C6, CH), 122.12 (arom C4, CH), 127.62 (arom qC5,
C-Cl), 131.79 (arom C3, CH), 138.77 (arom qC2), 156.99 (arom
qC1), 167.58 (O-CH2-CdO), 201.40 (Ar-CdO).
Appendix
Abbreviations. Amino acids are (S)-configured
unless otherwise indicated; either the one- or the three-
letter code is used. AG-7088, (E)-(S)-4-{(2R,5S)-2-(4-
fluorobenzyl)-6-methyl-5-[(5-methylisoxazole-3-carbon-
yl)amino]-4-oxoheptanoylamino}-5-((S)-2-oxopyrrolidin-
3-yl)pent-2-enoic acid ethyl ester; DCC, dicyclohexylcar-
bodiimide; CMK, chloromethyl ketone; DCM, dichlo-
romethane; DIC, 1,3-diisopropylcarbodiimide; DMF,
dimethylformamide; DMSO, dimethyl sulfoxide; DPPA,
diphenylphosphorazidate; DTT, dithiothreitol; EDTA,
ethylenediaminetetraacetic acid; EEDQ, 1-ethoxycar-
bonyl-2-ethoxy-1,2-dihydroquinolone; FRET, fluores-
cence resonance energy transfer; HOBt, 1-hydroxyben-
zotriazole; HOSuc, N-hydroxysuccinimide; Mpro, main
protease; Mts, 2,4,6-trimethylbenzenesulfonyl (mesity-
lenesulfonyl); SARS-CoV, severe acute respiratory syn-
Synthesis of Ethyl [5-Chloro-2-(2-methylenebutyryl)-
phenoxy]acetate (11a). Method C is used. Starting from 2.85
g (10 mmol) of ethyl (2-butyryl-5-chlorophenoxy)acetate (10a),
19.75 g (193.3 mmol) of TMDM, and 16.2 g (158.7 mmol) of
acetic anhydride, the crude product obtained is purified by
column chromatography on silica gel 60 (cyclohexane/ethyl
acetate). Yield 2.0 g (6.75 mmol, 68%), colorless solid, mp 25-
26 °C (cyclohexane/ethyl acetate). Anal. (C15H17ClO4) C, H, N.
1H NMR (400.13 MHz, CDCl3, 300 K, TMS): δ 1.12 (3H, t, J
) 7.46 Hz, H3C-CH2), 1.28 (3H, t, J ) 7.20 Hz, H3C-CH2-
O), 2.45 (2H, q, J ) 7.46 Hz, H3C-CH2), 4.25 (2H, q, J ) 7.20
Hz, H3C-CH2-O), 4.59 (2H, s, O-CH2-CO), 5.67 (1H, s, Cd
CH2), 5.87 (1H, s, CdCH2), 6.81 (1H, d, J ) 1.77 Hz, arom
H2), 7.03 (1H, dd, J ) 1.77 Hz, J ) 8.08 Hz, arom H4), 7.21
(1H, d, J ) 8.08 Hz, arom H5). 13C NMR (100.63 MHz, CDCl3,

Inhibitors of Coronavirus Main Protease
Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22 6841
(19) Du, Q.; Wang, S.; Wei, D.; Sirois, S.; Chou, K.-C. Molecular
modeling and chemical modification for finding peptide inhibitor
against severe acute respiratory syndrome coronavirus main
proteinase. Anal. Biochem. 2005, 337, 262-270.
(20) Xiong, B.; Gui, C.-S.; Xu, X.-Y.; Luo, C.; Chen, J.; Luo, H.-B.;
Chen, L.-L.; Li, G.-W.; Sun, T.; Yu, C.-Y.; Yue, L.-D.; Duan, W.-
H.; Shen, J.-K.; Qin, L.; Li, Y.-X.; Chen, K.-X.; Luo, X.-M.; Shen,
X.; Shen, J.-H.; Jiang, H.-L. A 3D model of SARS-CoV 3CL
proteinase and its inhibitors design by virtual screening. Acta
Pharm. Sin. 2003, 24, 497-504.
(21) Zhang, X.-W.; Yap, Y. L. Old drugs as lead compounds for a new
disease? Binding analysis of SARS coronavirus main proteinase
with HIC, psychotic and parasitic drugs. Bioorg. Med. Chem.
2004, 12, 2517-2521.
(22) Toney, J. H.; Navas-Martin, S.; Weiss, S. R.; Koeller, A. Saba-
dinine: A potential non-peptide anti-severe acute-respiratory-
syndrome agent identified using structure-aided design. J. Med.
Chem. 2004, 47, 1079-1080.
(23) Wu, C. Y.; Jan, J. T.; Ma, S. H.; Kuo, C. J.; Juan, H. F.; Cheng,
Y. S.; Hsu, H. H.; Huang, H. C.; Wu, D.; Brik, A.; Liang, F. S.;
Liu, R. S.; Fang, J. M.; Chen, S. T.; Liang, P. H.; Wong, C. H.
Small molecule targeting severe acute respiratory syndrome
human coronavirus. Proc. Nat. Acad. Sci. U.S.A. 2004, 101,
10012-10017.
(24) Blanchard, J. E.; Elowe, N. H.; Huitema, C.; Fortin, P. D.;
Cechetto, J. D.; Eltis, L. D.; Brown, E. D. High-throughput
screening identifies inhibitors of the SARS coronavirus main
proteinase. Chem. Biol. 2004, 11, 1445-1453.
(25) Kao, R. Y.; To, A. P. C.; Ng, L. W. Y.; Tsui, W. H. W.; Lee, T. S.
W.; Tsoi, H.-W.; Yuen, K.-Y. Characterization of SARS-CoV main
protease and identification of biologically active small molecule
inhibitors using a continuous fluorescence-based assay. FEBS
Lett. 2004, 576, 325-330.
(26) Hsu, J. T.-A.; Kuo, J.-C.; Hsieh, H.-P.; Wang, Y.-C.; Huang, K.-
K.; Lin, C. P.-C.; Huang, P.-F.; Chen, X.; Liang, P.-H. Evaluation
of metal-conjugated compounds as inhibitors of 3CL protease of
SARS-CoV. FEBS Lett. 2004, 574, 116-120.
(27) Bacha, U.; Barrila, J.; Velazquez-Campoy, A.; Leavitt, S. A.;
Freire, E. Identification of novel inhibitors of the SARS coro-
navirus main protease 3CLpro. Biochemistry 2004, 43, 4906-
4912.
(28) Matthews, D. A.; Dragovich, P. S.; Webber, S. E.; Fuhrman, S.
A.; Patick, A. K.; Zalman, S. L.; Hendrickson, T. F.; Love, R. A.;
Prins, T. J.; Marakovits, J. T.; Zhou, R.; Tikhe, J.; Ford, C. E.;
Meador, J. W.; Ferre, R. A.; Brown, E. L.; Binford, S. L.;
Brothers, M. A.; DeLisle, D. M.; Worland, S. T. Structure-
assisted design of mechanism-based irreversible inhibitors of
human rhinovirus 3C protease with potent antiviral activity
against multiple rhinovirus serotypes. Proc. Natl. Acad. Sci.
U.S.A. 1999, 96, 11000-11007.
(29) AG-7088 (ruprintrivir) contains a Michael system (vinyl-Gln
mimetic) as electrophile. It is in clinical development as an
inhibitor of 3C proteases of human rhinoviruses. It is reported
to exhibit low affinity to the SARS-CoV protease.17
(30) Schirmeister, T.; Klockow, A. Cysteine protease inhibitors
containing small rings. Mini-Rev. Med. Chem. 2003, 3, 585-
596.
(31) Powers, J. C.; Asgian, J. L.; Ekici, O. D.; James, K. E. Irreversible
inhibitors of serine, cysteine, and threonine proteases. Chem.
Rev. 2002, 102, 4639-4750.
(32) Ro, S.; Baek, S. G.; Lee, B.; Ok, J. H. Conformational studies of
irreversible HIV-1 protease inhibitors containing cis-epoxide as
an amide isostere. J. Pept. Res. 1999, 54, 242-248.
(33) Sprague, J. M. Diuretics. Top. Med. Chem. 1986, 2, 1-63.
(34) Kaeppler, U.; Schirmeister, T. New nonpeptidic inhibitors of
papain derived from etacrynic acid. Med. Chem. 2005, 1, 361-
370.
(35) Martina, E.; Stiefl, N.; Degel, B.; Schulz, F.; Breuning, A.;
Schiller, M.; Vicik, R.; Baumann, K.; Ziebuhr, J.; Schirmeister,
T. Screening of electrophilic compounds yields an aziridinyl
peptide as new active-site directed SARS CoV main protease
inhibitor. Bioorg. Med. Chem. Lett. 2005, in press.
(36) Ziebuhr, J.; Heusipp, G.; Siddell, S. G. Biosynthesis, purification,
and characterization of the human 229E 3C-like proteinase. J.
Virol. 1997, 71, 3992-3997.
drome coronavirus; TEA, triethylamine; TFA, trifluo-
roacetic acid’ TGEV, transmissible gastroenteritis virus;
THF, tetrahydrofurane; TMDM, N,N,N′,N′-tetrameth-
yldiaminomethane.
Supporting Information Available: IR data and data
confirming the purity of the target compounds (HPLC, HRMS,
combustion analyses). This material is available free of charge
via the Internet at http://pubs.acs.org.
References
(1) Siddell, S. G.; Ziebuhr, J.; Snijder, E. J. Coronaviruses, torovi-
ruses, and arteriviruses. In Topley and Wilson’s Microbiology
and Microbial Infections, 10th ed.; Mahy, B. W. J., ter Meulen,
V., Eds.; Virology, Vol. 1.; Hodder Arnold: London, 2005; pp
823-856.
(2) Enjuanes, L.; van der Zeijst, B. A. M. Molecular basis of
transmissible gastroenteritis virus epidemiology. In The Coro-
naviridae; Siddell, S. G., Ed.; Plenum Press: New York, 1995;
pp 337-376.
(3) Drosten, C.; Gu¨nther, S.; Preiser, W.; van der Werf, S.; Brodt,
H. R.; Becker, S.; Rabenau, H.; Panning, M.; Kolesnikova, L.;
Fouchier, R. A.; Berger, A.; Burguiere, A. M.; Cinatl, J.; Eick-
mann, M.; Escriou, N.; Grywna, K.; Kramme, S.; Manuguerra,
J. C.; Muller, S.; Rickerts, V.; Sturmer, M.; Vieth, S.; Klenk, H.
D.; Osterhaus, A. D.; Schmitz, H.; Doerr, H. W. Identification of
a novel coronavirus in patients with severe acute respiratory
syndrome. N. Engl. J. Med. 2003, 348, 1967-1976.
(4) Ksiazek, T. G.; Erdman, D.; Goldsmith, C. S.; Zaki, S. R.; Peret,
T.; Emery, S.; Tong, S.; Urbani, C.; Comer, J. A.; Lim, W.; Rollin,
P. E.; Dowell, S. F.; Ling, A. E.; Humphrey, C. D.; Shieh, W. J.;
Guarner, J.; Paddock, C. D.; Rota, P.; Fields, B.; DeRisi, J.; Yang,
J. Y.; Cox, N.; Hughes, J. M.; LeDuc, J. W.; Bellini, W. J.;
Anderson, L. J. A novel coronavirus associated with severe acute
respiratory syndrome. N. Engl. J. Med. 2003, 348, 1953-1966.
(5) Peiris, J. S.; Lai, S. T.; Poon, L. L.; Guan, Y.; Yam, L. Y.; Lim,
W.; Nicholls, J.; Yee, W. K.; Yan, W. W.; Cheung, M. T.; Cheng,
V. C.; Chan, K. H.; Tsang, D. N.; Yung, R. W.; Ng, T. K.; Yuen,
K. Y. Coronavirus as a possible cause of severe acute respiratory
syndrome. Lancet 2003, 361, 1319-1325.
(6) Guan, Y.; Zheng, B. J.; He, Y. Q.; Liu, X. L.; Zhuang, Z. X.;
Cheung, C. L.; Luo, S. W.; Li, P. H.; Zhang, L. J.; Guan, Y. J.;
Butt, K. M.; Wong, K. L.; Chan, K. W.; Lim, W.; Shortridge, K.
F.; Yuen, K. Y.; Peiris, Y. S.; Poon, L. L. Isolation and charac-
terization of viruses related to the SARS coronavirus from
animals in southern China. Science 2003, 302, 276-278.
(7) Peiris, J. S.; Yuen, K. Y.; Osterhaus, K. D.; Sto¨hr, K. The severe
acute respiratory syndrome. N. Engl. J. Med. 2003, 349, 2431-
2441.
(8) Ziebuhr, J. Molecular biology of severe acute respiratory syn-
drome coronavirus. Curr. Opin. Microbiol. 2004, 7, 412-419.
(9) Ziebuhr, J. The coronavirus replicase. Curr. Top. Microbiol.
Immunol. 2005, 287, 57-94.
(10) Ziebuhr, J.; Snijder, E. J.; Gorbalenya, A. E. Virus-encoded
proteinases and proteolytic processing in the Nidovirales. J. Gen.
Virol. 2000, 81, 853-879.
(11) Anand, K.; Palm, G. J.; Mesters, J. R.; Siddell, S. G.; Ziebuhr,
J.; Hilgenfeld, R. Structure of coronavirus main proteinase
reveals combination of chymotrypsin fold with an extra alpha-
helical domain. EMBO J. 2002, 21, 3213-3224.
(12) Anand, K.; Ziebuhr, J.; Wadhwani, P.; Mesters, J. R.; Hilgenfeld,
R. Coronavirus main proteinase (3CLpro) structure: basis for
design of anti-SARS drugs. Science 2003, 300, 1763-1767.
(13) Yang, H.; Yang, M.; Ding, Y.; Liu, Y.; Lou, Z.; Zhou, Z.; Sun, L.;
Mo, L.; Ye, S.; Pang, H.; Gao, G. F.; Anand, K.; Bartlam, M.;
Hilgenfeld, R.; Rao, Z. The crystal structures of severe acute
respiratory syndrome virus main protease and its complex with
an inhibitor. Proc. Natl. Acad. Sci. U.S.A. 2003, 100, 13190-
13195.
(14) Liu, B.; Zhou, J. SARS-CoV protease inhibitors design using
virtual screening method from natural products libraries. J.
Comput. Chem. 2005, 26, 484-490.
(15) Rajnarayanan, R. V.; Dakshanamurthy, S.; Pattabiranam, N.
“Teaching old drugs to kill new bugs”: structure-based discovery
of anti-SARS drugs. Biochem. Biophys. Res. Commun. 2004, 321,
370-378.
(16) Chou, K.-C.; Wei, D.-Q.; Zhong, W.-Z. Binding mechanism of
coronavirus main proteinase with ligands and its implication
to drug design against SARS. Biochem. Biophys. Res. Commun.
2003, 308, 148-151.
(17) Jenwitheesuk, E.; Samudrala, R. Identifying inhibitors of the
SARS coronavirus proteinase. Bioorg. Med. Chem. Lett. 2003,
13, 3989-3992.
(18) Zhang, X. W.; Yap, Y. L.; Altmeyer, R. M. Generation of
predictive pharmacophore model for SARS-coronavirus main
proteinase. Eur. J. Med. Chem. 2005, 40, 57-62.
(37) Hegyi, A.; Ziebuhr, J. Conservation of substrate specificities
among coronavirus main proteases. J. Gen. Virol. 2002, 83, 595-
599.
(38) The first peptide substrate VSYGSTLQ|AGLRKMA repre-
sents an HCoV-229E Mpro cleavage site.36 The second peptide
VSVNSTLQ|SGLRKMA was also shown to be cleaved effectively
12
by SARS-CoV Mpro and, for this reason, is now being sold by
Bachem as an SARS-CoV Mpro substrate (although it does not
represent a cognate SARS-CoV Mpro cleavage site). The lower
enzyme activity against this substrate is reflected in the higher
incubation time used in the HPLC-based assays.
(39) FlexX, version 1.12; BioSolveIT (An der Ziegelei 75, 53757): St.
Augustin, Germany, 2003.

6842 Journal of Medicinal Chemistry, 2005, Vol. 48, No. 22
Kaeppler et al.
(40) In some of the docking poses the studied compounds were not
located within the binding site but were docked to the surface
of the protein. Consequently, the “best” docking pose in this
study was defined as the pose with the most favorable docking
score for compounds that were located inside the binding pocket.
For all virtual compounds (i.e., those that were not readily
synthesized when the docking study was carried out) a further
constraint was added. Since the activated double bond of
compound 6a was predicted to be in proximity to the active site
Cys145 and since it was the working hypothesis that this double
bond reacts with Cys145, only those docking poses were scru-
tinized where the double bond was close to Cys145.
(41) His163 N-H T OdC: 1.76 Å, angle NHO 153.1. Glu166 CdO
T H-N: 1.97 Å, angle NHO 169.3. Gln189 N-H T OdC: 1.94
Å, angle NHO 141.1.
(42) Adding the van der Waals radii of the involved heavy atoms
sulfur and carbon results in 3.4 Å. Hence, when only noncovalent
interactions are modeled, the two atoms cannot move closer
because clashes are penalized by the scoring function of the
docking tool.
(43) Glu166 CdO T H-N: 1.66 Å, angle NHO 159.5. Gln189 N-H
T OdC: 2.03 Å, angle NHO 170.2.
(44) Thr190 CdO T H-N: 1.70 Å, angle NHO 147.6. Gln192 N-H
T OdC: 2.03 Å, angle NHO 147.0.
(45) Wang, Q. M.; Johnson, R. B.; Sommergruber, W.; Shepherd, T.
A. Development of in vitro peptide substrates for human
rhinovirus-12 2A protease. Arch. Biochem. Biophys. 1998, 356,
12-18.
(46) The descriptors ortho and meta are used with respect to the
phenolic hydroxyl group.
(47) Rang, H. P.; Dale, M. M.; Ritter, J. M.; Moore, P. K. Pharmacol-
ogy, 5th ed.; Churchill Livingstone: Edinburgh, U.K., 2003; p
362.
(48) Hasannejad, H.; Takeda, M.; Taki, K.; Shin, H. J.; Babu, E.;
Jutabha, P.; Khamdang, S.; Aleboyeh, M.; Onozato, M. L.; Tojo,
A.; Enomoto, A.; Anzai, N.; Narikawa, S.; Huang, X.-L.; Niwa,
T.; Endou, H. Interactions of human organic anion transporters
with diuretics. J. Pharmacol. Exp. Ther. 2004, 308, 1021-1029.
(49) Thiel, V.; Ivanov, K. A.; Putics, A.; Hertzig, T.; Schelle, B.; Bayer,
S.; Weissbrich, B.; Snijder, E. J.; Rabenau, H.; Doerr, H. W.;
Gorbalenya, A: E.; Ziebuhr, J. Mechanisms and enzymes
involved in SARS coronavirus genome expression. J. Gen. Virol.
2003, 84, 2305-2315.
(50) Liu, Y: Y.; Kati, W.; Chen, C. M.; Tripathi, R.; Molla, A.;
Kohlbrenner, W. Use of a fluorescence plate reader for measur-
ing kinetic parameters with inner filter effect correction. Anal.
Biochem. 1999, 267, 331-335.
(51) Since no time-dependent inhibition was observed with the tested
compounds, only Ki values could be determined. Dialysis assays
with the CAC1 cysteine protease cathepsin B showed the
inhibitors to act reversibly (unpublished results).
(52) GraFit; Erithacus Software Ltd.: London, 1994.
(53) Diago-Meseguer, J.; Palomo-Coll, A. L.; Fernandez-Lizarbe, J.
R.; Zugaza-Bilbao, A. A new reagent for activating carboxyl
groups: preparation and reactions of N,N-bis[2-oxo-3-oxazolidi-
nyl]phosphorodiamidic chloride. Synthesis 1980, 547-551.
(54) Robertson, A. Experiments on the synthesis of rotenone and its
derivatives. Part II. The synthesis of rissic acid and of derric
acid, and the constitution of rotenone, deguelin, and tephrosin.
J. Chem. Soc., Abstr. 1932, 1380-1388.
(55) Coulthard, C. E.; Marshall, J.; Payman, F. L. The variation of
phenol coefficients in homologous series of phenols. J. Chem.
Soc., Abstr. 1930, 280-291.
(56) Buu-Hoi, N P.; Xuong, N. D.; Lavit, D. Halogenated o- and
p-phenolic ketones. J. Chem. Soc. 1954, 1034-1038.
(57) Nguyen, H.; Buu, H. Ketones derived from o-halogenated ani-
soles and phenetoles. C. R. Hebd. Seances Acad. Sci. 1947, 224,
1363.
(58) Pinchuk, A. M.; Kosinskaya, I. M.; Shevchenko, V. I. N-
(Cyanoalkyl)- and N-(cyanocycloalkyl)phosphorimidic trichlo-
rides. Zh. Obshch. Khim. 1967, 37, 856-859.
(59) Ziegler, E.; Schredt, H.; Gitschthaler, K. Synthesis of benzoful-
venes. Monatsh. Chem. 1954, 85, 1234-1239.
(60) Feniak, G.; Reckhow, W. A. Procede de photographie en couleurs
et nouveaux produits pour sa mise en oeuvre (Procedure for color
photography and new products for its implementation). Patent
BE 560859, 1957 (Eastman Kodak Co.).
(61) Pawar, R. A.; Shingte, R. D.; Gogte, V. N. Synthesis of potential
plant growth regulators. Synthesis of 2-N-alkyl-5-chlorophe-
noxyacetic acids. Indian J. Chem. 1970, 8, 522-525.
(62) SYBYL, version 6.9; Tripos Inc. (1699 South Hanley Road, St.
Louis, MO 63144), 2001.
(63) Yang, H.; Xie, W.; Xue, X.; Yang, K.; Ma, J.; Liang, W.; Zhao,
Q.; Zhou, Z.; Pei, D.; Ziebuhr, J.; Hilgenfeld, R.; Yuen, K. Y.;
Wong, L.; Gao, G.; Chen, S.; Chen, Z.; Ma, D.; Bartlam, M.; Rao,
Z. Design of wide-spectrum inhibitors targeting coronavirus
main proteases. PLOS Biol. 2005, 3, (10).
JM0501782