Molecular cloning and characterization of a novel thermostable xylanase from Paenibacillus campinasensis BL11

Article abstract of DOI:10.1016/j.procbio.2010.06.015

An open reading frame (XylX) with 1131 nucleotides from Paenibacillus campinasensis BL11 was cloned and expressed in E. coli. It encodes a family 11 endoxylanase, designated as XylX, of 41kDa. The homology of the amino acid sequence deduced from XylX is only 73% identical to the next closest sequence. XylX contains a family 11 catalytic domain of the glycoside hydrolase and a family 6 cellulose-binding module. The recombinant xylanase was fused to a His-tag for affinity purification. The XylX activity was 2392IU/mg, with a K_m of 6.78mg/ml and a V_max of 4953mol/min/mg under optimal conditions (pH 7, 60°C). At pH 11, 60°C, the activity was still as high as 517IU/mg. Xylanase activities at 60°C under pH 5 to pH 9 remained at more than 69.4% of the initial activity level for 8h. The addition of Hg²⁺ at 5mM almost completely inhibited xylanase activity, whereas the addition of tris-(2-carboxyethyl)-phosphine (TCEP) and 2-mercaptoethanol stimulated xylanase activity. No relative activities for Avicel, CMC and d-(+)-cellobiose were found. Xylotriose constitutes the majority of the hydrolyzed products from oat spelt and birchwood xylan. Broad pH and temperature stability shows its application potentials for biomass conversion, food and pulp/paper industries.

Full text of DOI:10.1016/j.procbio.2010.06.015

Process Biochemistry 45 (2010) 1638–1644
Contents lists available at ScienceDirect
Process Biochemistry
journal homepage: www.elsevier.com/locate/procbio
Molecular cloning and characterization of a novel thermostable xylanase from
Paenibacillus campinasensis BL11
Chun-Han Koa,b, Chung-Hung Tsaia,c,∗, Jenn Tuc,∗∗, Hang-Yi Leea, Lan-Ting Kua,
Pei-An Kuod, Yiu-Kay Laid
a School of Forestry and Resource Conservation, National Taiwan University, Taipei 10617, Taiwan, ROC
b Bioenergy Research Center, National Taiwan University, Taipei 10617, Taiwan, ROC
c Institute of Plant and Microbial Biology, Academia Sinica, Taipei 11529, Taiwan, ROC
d Institute of Biotechnology, National Tsing Hua University, Hsinchu 30013, Taiwan, ROC
a r t i c l e i n f o
a b s t r a c t
Article history:
An open reading frame (XylX) with 1131 nucleotides from Paenibacillus campinasensis BL11 was cloned
and expressed in E. coli. It encodes a family 11 endoxylanase, designated as XylX, of 41 kDa. The homol-
ogy of the amino acid sequence deduced from XylX is only 73% identical to the next closest sequence.
XylX contains a family 11 catalytic domain of the glycoside hydrolase and a family 6 cellulose-binding
module. The recombinant xylanase was fused to a His-tag for affinity purification. The XylX activity was
2392 IU/mg, with a Km of 6.78 mg/ml and a Vmax of 4953 mol/min/mg under optimal conditions (pH 7,
60 ◦C). At pH 11, 60 ◦C, the activity was still as high as 517 IU/mg. Xylanase activities at 60 ◦C under pH
5 to pH 9 remained at more than 69.4% of the initial activity level for 8 h. The addition of Hg2+ at 5 mM
almost completely inhibited xylanase activity, whereas the addition of tris-(2-carboxyethyl)-phosphine
(TCEP) and 2-mercaptoethanol stimulated xylanase activity. No relative activities for Avicel, CMC and d-
(+)-cellobiose were found. Xylotriose constitutes the majority of the hydrolyzed products from oat spelt
and birchwood xylan. Broad pH and temperature stability shows its application potentials for biomass
conversion, food and pulp/paper industries.
Received 30 March 2010
Received in revised form 31 May 2010
Accepted 17 June 2010
Keywords:
Alkaline-tolerant
Cloning
Paenibacillus
Paenibacillus campinasensis
Thermostability
Xylanase
© 2010 Elsevier Ltd. All rights reserved.
1. Introduction
interest in using xylan and its hydrolytic enzymatic complex [4,5] as
a supplement in animal feed; for the manufacture of bread, food and
Xylan is the second most common hemicellulose found in plant
cell walls after cellulose. The xylans are complex heteropolysac-
charides consisting of a backbone chain of 1,4-␤-d-xylopyranose
units with a variety of side linkages, including acetyl groups, arabi-
nofuranose, ferulic acid, methyl glucuronic acid, and others [1–3].
Several enzymes are involved in the breakdown of xylan. Endo-1,4-
␤-xylanases (E.C.3.2.1.8) depolymerize xylan by random hydrolysis
of the xylan backbone, whereas 1,4-␤-d-xylosidases (E.C.3.2.1.37)
remove successive d-xylose residues from the non-reducing end
group. There are also several specific hydrolases that are able to
release the aforementioned side-groups presented in xylan [4].
The potential uses of microbial xylolytic enzymes have garnered
significant attention. Recently, there has been much industrial
drinks; in textiles; and in ethanol and xylitol production, especially
for pulp and paper processing [4–6].
Diverse microbes have been explored as invaluable xylanase
resources, e.g., Alicyclobacillus sp. [7], Arthrobacter sp. MTCC 5214
[8], Bacillus coagulans [9], Bacillus pumilus [10], and Neocallimas-
tix patriciarum [11]. Xylanases from thermophilic organisms have
received the most attention due to their greater application poten-
tial rendered by their enhanced stability in wide temperature and
pH ranges [6,12,13].
Paenibacillus species are capable of hydrolyzing plant materials
and are currently isolated and identified from soil- and plant-
related sources [14–17]. Several members of the genus Paenibacillus
secrete diverse assortments of extracellular polysaccharide-
hydrolyzing enzymes, and their xylanolytic systems are gradually
being identified [18–22].
The Paenibacillus campinasensis BL-11 strain was identified and
isolated from a high temperature and alkaline environment [23]. It
is able to produce xylanase, cellulase, pectinase and cyclodextrin
glucanotransferase [23]. In this work, gene cloning and expression
of a xylanase (denoted as XylX) from P. campinasensis BL11 was
conducted. However, the characterization of a purified xylanase
∗
Corresponding author at: Institute of Plant and Microbial Biology, Academia
Sinica, 128 Academia Road, Section 2, Nan-Kang, Taipei 11529, Taiwan, ROC. Tel.:
+886 2 2787 1185; fax: +886 2 2787 1076.
∗∗
Corresponding author. Tel.: +886 2 2787 1185; fax: +886 2 2787 1076.
E-mail addresses: jo0610@gate.sinica.edu.tw (C.-H. Tsai),
jenntu@gate.sinica.edu.tw (J. Tu).
1359-5113/$ – see front matter © 2010 Elsevier Ltd. All rights reserved.
doi:10.1016/j.procbio.2010.06.015

C.-H. Ko et al. / Process Biochemistry 45 (2010) 1638–1644
2.7. Effects of pH and temperature on xylanase activity and stability
1639
from P. campinasensis BL11 has not yet been reported. A 6× histidine
tag was fused to the recombinant XylX to facilitate its purification
by affinity chromatography.
His-tagged XylX was used in the remainder of this study for characterization
and application. The effect of pH and temperature on xylanase activity was studied
in the presence of different buffers for 20 min under various conditions. The buffers
used were 100 mM acetate buffer (pH 5–6), 100 mM phosphate buffer (pH 6–8) and
25 mM borate buffer (pH 8–11).
2. Materials and methods
2.1. Materials, bacterial strains and plasmids
All of the xylanase assays were carried out by the protocols described by König
et al. [28]. A concentration of 1.5% (w/v) oat spelt xylan (Sigma) was used as the
substrate, and it was reacted with the xylanase solution at various pH and temper-
ature values for 20 min. The amount of released sugar was then determined by the
dinitrosalicylic acid (DNSA) method [28].
The effects of temperature and pH on xylanase stability were assessed by incu-
bating the reaction mixtures from 5 min up to 8 h at different temperatures ranging
from 40 to 80 ◦C at pH 7 and at pH values ranging from 4 to 11 at 60 ◦C. The residual
activity of each sample was then quantified by the DNSA method at pH 7, 60 ◦C.
All chemicals used were either from Sigma (St. Louis, USA) or of analytical
grade from E. Merck (Darmstadt, Germany), unless specified otherwise. Bacteria
were routinely cultured in Luria–Bertani (LB) medium. LB medium contained 10 g/L
Bacto-tryptone, 5 g/L yeast extract, and 5 g/L NaCl. P. campinasensis BL11 was isolated
from a high temperature, alkaline environment and then phylogenically identified
[23]. The vector pBCKS(+) was from Stratagene (La Jolla, CA). Vector pET25b and
E. coli HMS174 (DE3) were from Novagen (Madison, WI). The PCR primers were
synthesized by Bio Basic, Inc. (Markham, Ontario, Canada).
2.8. Effect of additives on xylanase activity
2.2. DNA isolation, genomic library construction and screening
The effect of various additives on XylX xylanase activity was determined by
the presence of metal ions and other reagents. The additives used in this study
were CaCl2, CoCl2, HgCl2, MnCl2, KCl, MgCl2, FeCl2, FeCl3, SrCl2, ZnCl2, CuSO4,
NiCl2, PbCl2, EDTA, tris-(2-carboxyethyl)-phosphine (TCEP), N-bromosuccinimide,
2-mercaptoethanol, Tween 20, Tritone X-100 and SDS at various concentrations.
The reaction mixtures containing the various additives were incubated for 60 min
at 60 ◦C, and the xylanase activity was assayed by the DNSA method. The presented
values are the averages of triplicate assays.
Genomic DNA of P. compinasensis BL11 was isolated [24]. Sau3AI-digested 3-
to 5-kb fragment pools were recovered and cloned into the BamHI-digested vector
pBCKS(+). Ligated DNA was used to transform E. coli NM 522 cells. Transformants
able to degrade oat spelt xylan were identified by the Congo red assay [25].
2.3. DNA sequencing and protein analysis
The nucleotide sequences of both strands were determined by FS DNA poly-
merase fluorescent dye terminator reactions. Sequencing products were detected
using an Applied Biosystems 377 stretch automated sequencer (Applied Biosys-
tems, Foster City, CA, USA). Nucleotide and deduced amino acid sequences
were analyzed with the sequence analysis tools of EMBL Computational Services
(http://www.ebi.ac.uk/Tools/sequence.html). Related sequences were obtained
from database searches (SwissPort, PIR, PRF, and GenBank) using the programs
BLASTP 2.0 and FASTA. The XylX sequence determined in the present study has
been deposited in the GenBank database under accession No. DQ241676.
2.9. Substrate specificity
To identify the substrate specificity of XylX under optimal conditions, substrates
including cellobiose, laminarin, barley ␤-glucan, oat spelt xylan, birchwood xylan,
laminarin, p-nitrophenyl-xylopyranoside and Avicel (Fluka) were employed at 1%
(w/v) in an enzyme assay. The enzyme assays were run for 120 min under optimal
conditions, and the enzyme activities were determined by measuring the generated
reduced sugar using the DNSA method.
Potential proteins encoded by the BL11 xylanase gene were analyzed using var-
ious software programs. The predicted signal peptides and their cleavage sites were
analyzed using the NN (neural networks) and HMM (hidden Markov models) meth-
ods. Conserved domains were searched using InterProScan (EMBL-EBI) and PSI-CD
(NCBI). Finally, multiple alignments of the deduced amino acid sequence of XylX
with its related xylanases were performed using ClustalW (EMBL-EBI).
2.10. Kinetic parameters
Reactions were conducted at the optimal condition, pH 7 and 60 ◦C, using
5–40 mg/mL oat spelt xylan solutions. Double reciprocal Lineweaver–Burk plots
for xylanase activity versus substrate concentration were constructed to estimate
kinetic parameters (Km and Vmax) by linear regression.
2.4. Construction of a xylanase expression system
2.11. Xylan hydrolysis and product analysis
For gene expression in E. coli,
a pET25b expression system (Novagen,
A concentration of 10 mg/mL of oat spelt xylan and birchwood xylan were
reacted with 10 IU/mL XylX solution in 100 mM phosphate buffer at pH 7 and 50 ◦C.
Hydrolyzed products were analyzed by a HPLC system equipped with a RI detec-
tor (Jasco RI-930, Tokyo, Japan). A 250 mm × 4.6 mm Asahipak NH2P-50 4E column
(Showa Denko, Tokyo, Japan) was employed. The mobile phase consisted of acetoni-
trile and distilled water (70/30) with a flow rate of 1 mL/min at room temperature.
Xylo-oligomer standards (X2–X5) from Megazyme (Wicklow, Ireland) and xylose
were used for system calibration.
Madison, WI) was used. The DNA fragment containing the xylanase-encoding
sequence was amplified from one of the correct xylanase-positive pBCKS(+) clones
with primers xylX-F (5ꢀ-CTAGCCAGCATATGA AAATCTATGGGA-3ꢀ) and xylX-R (5ꢀ-
AGAATTCACCGGATCTCGAGATAGTCA-3ꢀ). The underlined sequences are the NdeI
(xylX-F), EcoRI and XhoI (xylX-R) sites, respectively. The 1.1-kb PCR-amplified prod-
uct was subjected to digestion with NdeI and XhoI. The fragments were ligated
between the NdeI and XhoI sites of pET25b, resulting in the plasmid pETBX. Plasmid
pETBX was then used to transform E. coli strain HMS174 (DE3).
2.5. Expression and purification of cloned xylanase
3. Results and discussion
One colony of the expression strain was inoculated into 2 mL of Luria–Bertani
medium containing 100 ␮g of ampicillin/mL and allowed to grow overnight at 37 ◦C
in a rotary shaker. The overnight culture was then transferred to 30 mL of the same
medium and grown to an A600 of 0.4–0.5. Protein production was induced by the
addition of IPTG (isopropyl-␤-d-thio-galactopyranoside) to a final concentration
of 1 mM and grown for an additional 3, 6 and 12 h at 28 ◦C, after which the cells
were harvested by centrifugation, washed and disrupted by sonication in 50 mM
PBS (sodium phosphate). A clear lysate from the extracts was loaded on a Ni-NTA
agarose (Novagen, Madison, WI) column. The resulting protein was then eluted by
addition of 200 ␮L elution buffer (300 mM sodium chloride, 50 mM sodium phos-
phate, 50 mM imidazole, pH 7.0). The protein concentration was analyzed by the
Bradford assay using a spectrophotometer.
3.1. Isolation of xylanolytic clones
Genomic DNA of P. compinasensis BL11 was partially digested
with Sau3A, recovered from the agrose gel, and ligated to
BamHI-digested vector pBCKS(+). Recombinant plasmids were
transformed into E. coli NM522 cells. Positive clones, presenting
clear zones around colonies and suggesting xylan hydrolysis, were
obtained. Harvested cells of the clone were subjected to zymo-
graphic analysis, and the results are shown in Fig. 1. The exhibited
extracellular xylanase activity bands of about 41 kDa coincide per-
fectly with our former description [23].
2.6. SDS-PAGE and zymogram
Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was
performed with a 10% polyacrylamide gel [26]. Proteins were fixed in the gels by
soaking in a solution containing 40% (v/v) methanol and 10% (v/v) acetic acid for
approximately 1 h and subsequently visualized by Coomassie blue staining. Zymo-
graphic detection of xylanase activity was carried out by modifying the protocol of
Blanco et al. [27].
3.2. DNA sequence analysis of the xylanase gene, XylX
The DNA fragments harboring xylanolytic activity were verified
by restriction mapping, subcloning in pUC19 and sequencing.
The determined fragments matched the complete nucleotide

1640
C.-H. Ko et al. / Process Biochemistry 45 (2010) 1638–1644
Table 1
Similarity of other xylanases in the databases based on the XylX amino acid
sequence.
Strain
Similarity (%)
Amino acid
differences/compared
Bacillus sp. YA-335
Paenibacillus
76
71
83/360
108/379
curdlanolyticus
Bacillus pumilus
69
67
66
65
69/226
74/225
81/241
80/233
Bacillus sp. HBP8
Bacillus pumilus ATCC 7061
Clostridium papyrosolvens
DSM 2782
Dictyoglomus turgidum
DSM 6724
Dictyoglomus thermophilum
H-6-12
60
56
133/340
148/340
Dictyoglomus thermophilum
Anaerocellum thermophilum
DSM 6725
55
54
151/340
167/365
Caldicellulosiruptor sp.
Rt69B.1
Clostridium thermocellum
53
52
170/362
155/325
3.3. Cloning, over-expression and purification of recombinant
xylanase
The positive construct was confirmed and selected for PCR and
sequencing analysis. A Ni-NTA histidine-binding resin was used for
purification of the His-tagged recombinant XylX. The cell lysate
and eluted fractions were analyzed by SDS-PAGE, as shown in
Fig. 3. Under the induction of 1 mM IPTG at 28 ◦C, the yield of
purified recombinant XylX demonstrated a minor portion of the
total soluble protein, shown as the supernatant in the third lane of
Fig. 3. Recombinant enzymes formed inclusion bodies, as shown in
the fourth lane corresponding to the pellet. The soluble recombi-
nant enzyme was effectively eluted from the column with 50 mM
imidazole (lane E50) by loading the sample in the presence of
20 mM imidazole, shown in lane NB and lane W20. In a one-step
purification, the majority of the induced recombinant enzyme was
recovered, and a very high purity was demonstrated in lane E50 in
Fig. 3. Purity was also verified by the observation that no further
protein was eluted by 100 mM imidazole, as shown in the last lane
(E100) in Fig. 3.
Fig. 1. The E. coli clones harboring plasmids containing xylanase genes exhibited
xylanase activity. Lane M, molecular mass markers; lanes 1, 2 and 3, crude enzyme
extract of 3 individual clones. Molecular weights of markers (left) and xylanase
(right) are denoted next to the respective band.
sequences. One open reading frame (ORF) of 1131 bp, desig-
nated XylX (DQ241676), was identified to code for a polypeptide
of 377 amino acids with a molecular mass of about 41 kDa.
This ORF was translated to protein and analyzed in silico for
its promoter, ribosome-binding site, signal peptide and func-
tional domains. About 200 bp upstream of this ORF, there
were two predicted promoters (sequence: tgaatttttcaaggtat-
gaccttaattttgataatggaataataaggcaa from the 45th to 90th base;
sequence:
tgataatggaataataaggcaaattttgataaattactaattgtaatcgc
from the 73rd to 118th base) that might modulate the expression of
XylX.
3.4. Effect of temperature and pH on xylanase activity
The deduced amino acid sequence of XylX is shown in the
upper part of Fig. 2. The results suggest that the first 39 amino
acids constitute a signal peptide (lower part in the schematics
of Fig. 2). The signal peptidase cutting site was located between
the 39th and the 40th residues and possessed a typical AXA
motif for signal peptidase I. The full molecular mass of the 377-
amino acid protein was predicted to be about 41 kDa, which
corresponded to the results obtained by SDS-PAGE shown in
Fig. 1.
Two functional domains were found in the enzyme, as shown in
the schematic shown in Fig. 2: a catalytic domain (glycosyl hydro-
lases domain, family 11) located between 49 and 235 aa (amino
acid) and a unique carbohydrate-binding domain (carbohydrate-
binding module, family 6) located between 263 and 377 aa.
When comparing the amino acid sequence of XylX to those
of other xylanases, the highest similarity scores were only 76%
to Bacillus sp. YA-335 and 71% to Paenibacillus curdlanolyticus, as
shown in Table 1. These results suggest that the cloned xylanase is
a new xylanase. The difference in homology between xylanases of
P. compinasensis BL11 and Xyn11A of P. curdlanolyticus B-6 was also
verified in a recent study [22].
The activities of recombinant XylX at various pH and tempera-
ture values were measured using oat spelt xylan as the substrate.
The reaction pH values were 4.0–11.0, and the temperature ranged
from 40 to 75 ◦C. The purified XylX showed enzymatic activity over
broad pH and temperature ranges, as shown in Fig. 4. The enzyme
functioned reasonably well between 45 and 65 ◦C in the pH range of
5–9 (>60% activity). The activity optima were pH 7.0 and 60 ◦C, with
the activity reaching 2392 IU/mg. The temperature and pH optima
are rather consistent with those of xylanase isolated from all Bacil-
lus spp. reviewed by Sá-Pereira et al. [29]. The optimal activity of
XylX is higher than the values of xylanases from all Bacillus spp.
[29] and of xylanases from the recently reported Paenibacillus sp.
[20] and Alicyclobacillus sp. [7].
The activity of the enzyme decreased dramatically when the
reaction was performed at pH 5. In contrast to acidic conditions,
xylanase activity diminished gradually between pH 7 and pH 11.
Compared to temperatures at or below 60 ◦C, the activity also
decreased above 65 ◦C. However, minimal xylanase activity was
observed at 78.7 IU/mg under very strict conditions of pH 11 and
75 ◦C.

C.-H. Ko et al. / Process Biochemistry 45 (2010) 1638–1644
1641
Fig. 2. Alignment of predicted amino acid sequences of the XylX xylanase (top). Schematic representation of the different domains and connecting sequences of XylX are
indicated in the center. Cutting sites for restriction enzymes of the ORF are shown at the bottom.
3.5. Effect of temperature and pH on xylanase stability
xylanase was more sensitive to metals than was the Alicyclobacillus
sp. A4 xylanase.
The effect of temperature on recombinant XylX stability was
investigated from 40 to 80 ◦C at pH 7 and is shown in the upper part
of Fig. 5. Xylanase activity at pH 7 from 40 to 60 ◦C remained at more
than 88.6% of its initial level for 8 h. At 70 and 80 ◦C, the retained
activity of xylanase was around 11 and 8% of its initial level after
8 h, respectively. The projected half-lives of XylX xylanase activity
from 40 to 60 ◦C are greater than those of most bacterial xylanases
reviewed [30] and of the recently published Alicyclobacillus sp. A4
[7] and Paenibacillus sp. DG-22 xylanases [20]. Even at 70 and 80 ◦C,
the interpolated half-lives were 120 and 50 min, respectively. XylX
The effect of pH on recombinant XylX stability was investigated
from pH 4 to 11 at 60 ◦C and is shown in the lower part of Fig. 5. At
the 8th hour, retained xylanase activity at 60 ◦C between pH 5 and
pH 9 was more than 69.4% of the initial level. The enzyme stability
at pH 9 was comparable to that of a 43-kDa xylanase from Bacillus
halodurans S7 [31]. At pH 10 and 60 ◦C, the interpolated half-life
of XylX was approximately 45 min, which is less than that value
(3.5 h) of the aforementioned xylanase. Very little activity remained
at both pH 4 and 11 at 60 ◦C. Again, the projected half-lives from
pH 5 to 10 at 60 ◦C were much greater than those of most bacterial
xylanases reviewed [30].
Wide pH adaptability and high thermostability render XylX an
attractive candidate for biomass conversion applications in con-
junction with acid or alkaline pretreatment and for many potential
industrial applications. Stability at alkaline pH and 60–70 ◦C makes
XylX particularly suitable for kraft pulp bleaching pretreatment,
Fig. 3. XylX xylanase purification. M: marker; NI: non-induced; I: induced; S: super-
natant; P: pellet; NB: non-binding protein; W20: washed by 20 mM imidazole;
E50: eluted by 50 mM imidazole; E100: subsequently eluted by 100 mM imidazole.
Molecular weights of markers (left) and xylanase (right) are denoted next to the
respective band.
Fig. 4. Xylanase activities of recombinant XylX assayed under the respective pH
values and temperatures.

1642
C.-H. Ko et al. / Process Biochemistry 45 (2010) 1638–1644
Table 2
Effects of various additives on XylX xylanase activity by the presence of metals and
other reagents.
Agent
Concentration
Residual activity (%)
Control
–
100 1.77
88.18 4.14
85.30 9.13
2.21 0.77
Ca2+
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
0.5 mM
0.5%
Co2+
Hg2+
Mn2+
65.44 3.47
96.39 2.50
98.14 1.21
45.27 2.11
23.21 2.31
85.43 1.70
29.01 1.16
20.29 3.34
70.51 3.19
48.75 2.66
50.10 3.23
67.93 2.29
0.44 0.03
115.09 23.51
107.15 20.63
158.37 10.23
131.65 16.20
91.02 7.78
36.46 0.90
K+
Mg2+
Fe2+
Fe3+
Sr2+
Zn2+
Cu2+
Ni2+
Fig. 5. Eight-hour stability at pH 7 (A) and at 60 ◦C (B) while assaying under optimal
conditions for the His-tagged XylX xylanase.
Pb2+
EDTA
Dithiothreitol
N-bromosuccinimide
TCEPa
because the conditions above are within the range of the practical
prebleaching environment [12].
TCEPa
2-Mercaptoethanol
2-Mercaptoethanol
Tritone X-100
SDS
3.6. Effect of various additives on xylanase activity
0.05%
0.25%
0.25%
The effects of various additives on XylX xylanase activity due
to the presence of metal ions and other organic reagents are
shown in Table 2. All metal ions used in the present study inhib-
ited XylX xylanase activity to different extents. Mg2+, K+ and Ca2+
a
Tris-(2-carboxyethyl)-phosphine.
slightly inhibited XylX xylanase activities. Cu2+, Fe3+, Zn2+, Fe2+
,
and d-(+)-cellobiose were found. Trace relative activity for p-
nitrophenyl-␤-d-xylopyranoside was found to be 2.24 0.01%. The
absence of cellulase activity renders XylX an excellent candidate for
pulp bleaching pretreatment [30].
Pb2+ and Mn2+ also led to strong inhibition of XylX xylanase, with
20.29, 23.21, 29.01, 45.27, 48.75 and 65.44% activity remaining,
respectively. XylX xylanase is more sensitive to metals than is Ali-
cyclobacillus sp. A4 xylanase [7]. Hg2+ (5 mM) almost completely
inhibited xylanase activity, and this effect might be due to the
presence of the catalytically important cysteine [31]. Increasing
stimulations with increasing TCEP and 2-mercaptoethanol are con-
sistent with the observations of Sá-Pereira et al. for a Bacillus subtilis
xylanase [32]. TCEP [33] and 2-mercaptoethanol counteract the
oxidative effects of S–S linkages from cysteine residues, thereby
stabilizing or even stimulating the xylanase [34]. Complete inhibi-
tion by N-bromosuccinimide, a tryptophan modifier, suggests the
involvement of tryptophan residues in the active site of XylX, as
reported for other xylanases [35,36].
3.8. Kinetic parameters
The kinetic parameters of xylanase were determined from a
Lineweaver–Burk double reciprocal plot of xylanase activity at
60 ◦C, pH 7. The Km of the purified xylanase was 6.78 0.59 mg/mL,
and the Vmax was 4953 73 mol/min/mg. The kinetic parameters
of XylX were higher than the values obtained for all Bacillus spp.
xylanases reviewed by Beg et al. [4], except those from Ther-
momyces sp. and from Thermotoga sp.
3.9. Xylan hydrolysis product analysis
3.7. Substrate specificity
Hydrolysis products of oat spelt xylan and birchwood xylan
by XylX were analyzed by HPLC, and the results are shown in
Table 3. Fig. 6 shows the chromatogram of the hydrolysis prod-
ucts of oat spelt xylan by XylX at the 72nd hour. For oat spelt
xylan, the concentrations of xylobiose (X2), xylotriose (X3), xylotet-
rose (X4), xylopentose (X5), and xylohexose (X6) increased with
By conducting a reducing sugar assay with different substrates,
the substrate specificity of the purified XylX was investigated. The
purified xylanase could degrade oat spelt xylan and birchwood
xylan, with 100.00 0.02% and 100.52 0.04% relative activities.
No relative activities for barley ␤-glucan, laminarin, Avicel, CMC
Table 3
Xylan hydrolysis products (mg/mL) by XylX.
Reaction time (h)
X6
X5
X4
X3
X2
X1
Oat spelt xylan
3
6
12
24
48
72
0.405
0.494
0.561
0.622
0.622
0.714
0.532
0.621
0.700
0.777
0.887
0.973
0.455
0.562
0.643
0.707
0.714
0.783
0.437
0.560
0.720
0.858
1.059
1.224
0.184
0.267
0.416
0.542
0.766
1.042
0.00
0.00
0.00
0.018
0.023
0.076
Birchwood xylan
3
6
12
24
48
72
1.498
1.788
1.353
1.149
1.279
1.423
0.915
0.892
1.472
1.742
1.724
1.739
1.259
1.325
1.376
1.267
0.970
0.925
1.389
1.664
2.006
2.103
2.223
2.337
0.674
0.825
1.105
1.244
1.633
1.688
0.00
0.00
0.00
0.003
0.020
0.024

C.-H. Ko et al. / Process Biochemistry 45 (2010) 1638–1644
1643
[4] Beg QK, Kapoor M, Mahajan L, Hoondal GS. Microbial xylanases and their indus-
trial applications: a review. Appl Microbiol Biotechnol 2001;56:326–38.
[5] Polizeli MLTM, Rizzatti ACS, Monti R, Terenzi HF, Jorge JA, Amorim DS.
Xylanases from fungi: properties and industrial applications. Appl Microbiol
Biotechnol 2005;67(5):577–91.
[6] Subramaniyan S, Prema P. Biotechnology of microbial xylanases: enzymology,
molecular biology and application. Crit Rev Biotechnol 2002;22: 33–64.
[7] Bai YG, Wang JS, Zhang ZF, Yang PL, Shi PJ, Luo HY, et al. A new xylanase from
thermoacidophilic Alicyclobacillus sp. A4 with broad-range pH activity and pH
stability. J Ind Microbiol Biotechnol 2010;37:187–94.
[8] Khandeparkar R, Bhosle NB. Application of thermoalkalophilic xylanase from
Arthrobacter sp. MTCC 5214 in biobleaching of kraft pulp. Bioresour Technol
2007;98:897–903.
[9] Choudhury B, Chauhan S, Singh SN, Ghosh P. Production of Xylanase of
Bacillus coagulans and its bleaching potential. World J Microbiol Biotechnol
2006;22:283–8.
[10] Poorna CA, Prema P. Production of cellulase-free endoxylanase from novel alka-
lophilic thermotolerent Bacillus pumilus by solid-state fermentation and its
application in wastepaper recycling. Bioresour Technol 2007;98: 485–90.
[11] Pai CK, Wu ZY, Chen MJ, Zeng YF, Chen JW, Duan CH, et al. Molecular cloning
and characterization of a bifunctional xylanolytic enzyme from Neocallimastix
patriciarum. Appl Microbiol Biotechnol 2010;85(5):1451–62.
[12] Bajpai P. Application of enzymes in the pulp and paper industry. Biotechnol
Prog 1999;15:147–57.
Fig. 6. Hydrolysis products of 10 mg/mL oat spelt xylan by XylX at the 72nd hour.
X1: xylose; X2: xylobiose; X3: xylotriose; X4: xylotetrose; X5: xylopentose; X6:
xylohexose.
[13] Haki GD, Rakshit SK. Developments in industrially important thermostable
enzymes: a review. Bioresour Technol 2003;89(1):17–34.
[14] Rivas R, Mateos PF, Martínez-Molina E, Velázquez E. Paenibacillus xylanilyti-
cus sp. nov., an airborne xylanolytic bacterium. Int J Syst Evol Microbiol
2005;55:405–8.
[15] Rivas R, Mateos PF, Martínez -Molina E, Velázquez E. Paenibacillus phyl-
losphaerae sp. nov., a xylanolytic bacterium isolated from the phyllosphere of
Phoenix dactylifera. Int J Syst Evol Microbiol 2005;55:476–743.
[16] Rivas R, Garcia-Fraile P, Mateos PF, Martínez-Molina E, Velázquez E. Paeni-
bacillus cellulosilyticus sp nov., a cellulolytic and xylanolytic bacterium isolated
from the bract phyllosphere of Phoenix dactylifera. Int J Syst Evol Microbiol
2006;56:2777–81.
[17] Sanchez MM, Fritze D, Blanco A, Sproer C, Tindall BJ, Schumann P, et al.
Paenibacillus barcinonensis sp nov., a xylanase-producing bacterium isolated
from a rice field in the Ebro River delta. Int J Syst Evol Microbiol 2005;55:
935–9.
[18] Gallardo O, Diaz P, Pastor FIJ. Cloning and production of Xylanase B from
Paenibacillus barcinonensis in Bacillus subtilis hosts. Biocatal Biotransform
2007;25(2–4):157–62.
increasing hydrolysis time. Xylotriose was the major hydrolytic
product of oat spelt xylan, with 1.224 mg/mL produced after 72 h of
hydrolysis. Of the total hydrolysis products, 25.42% were xylotriose.
The late appearance of xylose after the 12th hour correlated with
the observation of trace relative activities for p-nitrophenyl-␤-d-
xylopyranoside in Section 3.7. More xylo-oligomers were produced
by XylX hydrolysis from birchwood xylan than from oat spelt xylan,
as shown in Table 3. Xylotriose was also the major hydrolytic
product of oat spelt xylan, with 2.337 mg/mL produced after 72 h
of hydrolysis. A total of 28.72% of the hydrolysis products were
xylotriose. The above result demonstrates that XylX is an endo-type
xylanase. It also validates that XylX can be employed to produce
xylo-oligomers, which are increasingly important prebiotic food
additives.
[19] Khianngam S, Akaracharanya A, Tanasupawat S. Paenibacillus thailandensis sp.
nov. and Paenibacillus nanensis sp. nov., xylanase-producing bacteria isolated
from soil. Int J Syst Evol Microbiol 2009;59(Pt 3):564–8.
[20] Lee TH, Lim PO, Lee YE. Cloning, characterization, and expression of xylanase A
gene from Paenibacillus sp. DG-22 in Escherichia coli. J Microbiol Biotechnol Jan
2007;17(1):29–36.
4. Conclusions
[21] Pason P, Kyu KL, Ratanakhanokchai K. Paenibacillus curdlanolyticus strain B-6
xylanolytic-cellulolytic enzyme system that degrades insoluble polysaccha-
rides. Appl Environ Microbiol 2006;72:2483–90.
[22] Pason P, Kosugi A, Waeonukul R, Tachaapaikoon C, Ratanakhanokchai K,
Arai T, et al. Purification and characterization of a multienzyme complex
produced by Paenibacillus curdlanolyticus B-6. Appl Microbiol Biotechnol
2010;85(3):573–80.
[23] Ko CH, Chen WL, Tsai CH, Jane WN, Liu CC, Tu J. Paenibacillus campinasensis BL11:
a wood material-utilizing bacterial strain isolated from black liquor. Bioresour
Technol 2007;98:2727–33.
[24] Srivastava R, Gopinathan KP, Ramakrishnan T. Deoxyribonucleic acid methyla-
tion in mycobacteria. J Bacteriol 1981;148(2):716–9.
[25] Wood PJ, Erfle JD, Teather RM. Use of complex formation between Congo red
and polysaccharide in detection and assay of polysaccharide hydrolases. Meth-
ods Enzymol 1988;160:59–74.
[26] Laemmli UK. Cleavage of structural proteins during the assembly of the head
of bacteriophage T4. Nature 1970;227:680–5.
A high temperature, alkaline environment is best for isolat-
ing microorganisms and associated enzymes for specific industrial
applications. This concept is also proposed in a recent study [37].
This is the first report of a 41-kDa xylanase identified from Paeni-
bacillus sp. with only 73% homology to the next closest sequence in
NCBI database. Wide pH adaptability, high thermostability, specific
xylanase activity and a complete lack of cellulase activity render
XylX an excellent candidate for many potential applications, espe-
cially kraft pulp bleaching pretreatment. The crude xylanase from
Paenibacillus sp. BL-11 was already proved successful for applica-
tion in hardwood kraft pulp bleaching pretreatment [38].
[27] Blanco A, Diaz P, Zueco J, Parascandola P, Pastor FIJ. A multidomain xylanase
from a Bacillus sp. with a region homologous to thermostabilizing domains of
thermophilic enzymes. Microbiology 1999;145:2163–70.
[28] König J, Grasser R, Pikor H, Vogel K. Determination of xylanase, beta-glucanase,
and cellulase activity. Anal Bioanal Chem 2002;374(1):80–7.
Acknowledgements
We thank Ms. Mei-Jane Fang for her technical assistance in DNA
sequencing. We thank the support of the grants from NSC, Taiwan,
ROC here. We also thank the funding support by National Science
Council, Taiwan, ROC for two grants: 92-2313-B-002-125 and 94-
2313-B-002-083.
[29] Sá-Pereira P, Paveia H, Costa-Ferreira M, Aires-Barros M.
A new look at
xylanases: an overview of purification strategies. Mol Biotechnol 2003
Jul;24(3):257–81.
[30] Techapun C, Poosaran N, Watanabe M, Sasaki K. Thermostable and alkaline-
tolerant microbial cellulase-free xylanases produced from agricultural wastes
and the properties required for use in pulp bleaching bioprocesses: a review.
Process Biochem 2003;38:1327–40.
[31] Mamo G, Hatti-Kaul R, Mattiasson B. A thermostable alkaline active endo-␤-
1,4-xylanase from Bacillus halodurans S7: purification and characterization.
Enzyme Microb Technol 2006;39:1492–8.
[32] Sá-Pereira P, Mesquita A, Duarte JC, Barros MRA, Costa-Ferreira M. Rapid pro-
duction of thermostable cellulase-free xylanase by a strain of Bacillus subtilis
and its properties. Enzyme Microb Technol 2002;30:924–33.
References
[1] Kulkarni N, Shendye A, Rao M. Molecular and biotechnological aspects of
xylanases. FEMS Microbiol Rev 1999;23:411–56.
[2] Sjöström E. Wood chemistry: fundamentals and applications. 2nd ed. New York,
NY, USA: Academic Press; 1993, 293 pp.
[3] Teleman A, Tenkanen M, Jacobs A, Dahlman O. Characterization of O-acetyl-
(4-O-methylglucurono) xylan isolated from birch and beech. Carbohyd Res
2002;337:373–7.
[33] Burns JA, Butler JC, Moran J, Whitesides GM. Selective reduction of disulfides
by tris(2-carboxyethyl)phosphine. J Org Chem 1991;56:2648–50.

1644
C.-H. Ko et al. / Process Biochemistry 45 (2010) 1638–1644
[34] Bataillon M, Nunes Cardinali A, Castillon N, Duchiron F. Purification and charac-
terization of a moderately thermostable xylanase from Bacillus sp. strain SPS-0.
Enzyme Microb Technol 2000;26:187–92.
[35] Deshpande V, Hinge J, Rao MD. Chemical modification of xylanases: evidence
for essential tryptophan and cysteine residues at the active site. Biochim Bio-
phys Acta 1990;1041:172–7.
[37] Yang CY, Niu Y, Su HJ, Wang Z, Tao F, Wang X, et al. A novel microbial habitat of
alkaline black liquor with very high pollution load: microbial diversity and the
key members in application potentials. Bioresour Technol 2010;101:1737–44.
[38] Ko CH, Lin ZP, Tu J, Tsai CH, Liu CC, Chen HT, et al. Xylanase production by
Paenibacillus campinasensis BL11 and its pretreatment of hardwood kraft pulp
bleaching. Int Biodeterior Biodegrad 2010;64:13–9.
[36] Blanco A, Vidal T, Colom JF, Pastor FIJ. Purification and properties of xylanase
A
from alkali-tolerant Bacillus sp. strain BP-23. Appl Environ Microbiol
1995;61:4468–70.