Light-regulated release of DNA and its delivery to nuclei by means of photolabile gold nanoparticles

Article abstract of DOI:10.1002/anie.200600214

(Figure Presented) Light and life: A photolabile gold nanoparticle has been constructed to serve as a DNA carrier. UV irradiation causes the reversal of the nanoparticle surface charge, resulting in effective DNA release and reactivation of suppressed DNA

Full text of DOI:10.1002/anie.200600214

Angewandte
Chemie
DNA Carriers
DOI: 10.1002/anie.200600214
Light-Regulated Release of DNA and Its Delivery
to Nuclei by Means of Photolabile Gold
Nanoparticles**
Gang Han, Chang-Cheng You, Byoung-jin Kim,
Rosemary S. Turingan, Neil S. Forbes, Craig T. Martin,
andVincent M. Rotello*
Gene therapy is one of the most promising prospects in
biomedical and bioorganic realms.[1] The success of gene
therapy benefits mainly from having effective gene-delivery
vectors for transporting plasmid DNA, small interfering
RNA, or antisense oligonucleotides into target cells. The
delivery of therapeutic nucleotides using nanomaterials such
as polymeric micelles,[2] dendrimers,[3] nanorods,[4] nano-
tubes,[5] and nanoparticles[6] is attracting increasing attention
as a consequence of their unique dimensions and proper-
ties.[7–10]Despite much progress, unpacking DNA inside target
cells in a spatiotemporally controlled fashion is a major
limiting factor in designing these artificial carriers.[11]
Although several intracellular release strategies have been
employed, including low pH,[12] high enzyme concentration,[13]
and redox materials inside the cells,[14] the use of light as an
external stimulus represents a unique site- and time-specific
means of unloading DNA. As such, photosensitive synthetic
DNA carriers will provide new directions for gene delivery
owing to the potential for versatile and facile chemical
modifications and the modularity of the carrier–DNA com-
plex.
As a highly orthogonal external stimulus, photochemical
processes enjoy wide use in surface patterning,[15] advanced
materials,[16] biochemistry,[17] and drug-delivery systems.[18,19]
Light-regulated methods uniquely limit the resultant biolog-
ical effects to the illuminated areas with temporal control.[20]
For example, biologically active molecules can be modified
with photosensitive groups to be essentially bioinert; they can
then be reactivated by photointervention.[21] Such caged
compounds have shown tremendous applications in chemical
[*] G. Han, Dr. C.-C. You, R. S. Turingan, Prof. Dr. C. T. Martin,
Prof. Dr. V. M. Rotello
Department of Chemistry, University of Massachusetts
710 North Pleasant Street, Amherst, MA 01003 (USA)
Fax: (+1)413-545-4490
E-mail: Rotello@Chem.umass.edu
B. J. Kim, Prof. Dr. N. S. Forbes
Department of Chemical Engineering, University of Massachusetts
Amherst, MA 01003 (USA)
[**] This research was supported by the NIH (EB 004503(VR) and
GM55002 (CTM)). Confocal images were taken at the Central
Microscopy Facility at the University of Massachusetts at Amherst,
which is supported by a grant from the National Science Foundation
(NSF BBS 8714235).
Supporting information for this article is available on the WWW
under http://www.angewandte.org or from the author.
Angew. Chem. Int. Ed. 2006, 45, 3165 –3169
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
3165

Communications
biology, such as the control of DNA hybridization,[22] DNA
transcription,[23] RNA ribosome function,[24] and modulation
of aptamer function.[25] Recently, the delivery of caged DNA
or proteins into cells by microinjection followed by uncaging
with light at desired times or locations has become a valuable
tool for studying living organisms.[26] However, construction
of the caged genetic materials can be costly and involves
complicated handling, purification, and storage. Furthermore,
the microinjection approach is limited in allowing high-
throughput DNA delivery, as only one cell can be manipu-
lated at a time, and the DNA itself may suffer degradation
inside cells. Caged-delivery vectors bearing light-controlled
DNA-binding functionality provide a means for overcoming
these challenges. Systems of this type can be easily con-
structed and manipulated in a modular fashion and provide
potential protection for DNA. Thus, they offer a simple and
novel approach for the functional delivery of DNA in a well-
regulated fashion.
Our recent studies demonstrated that cationic gold nano-
particles provide an efficient platform for DNA surface
binding. These nanoparticles display a high affinity for
electrostatic interactions with DNA, which results in the
suppression of DNA transcription by T7 RNA polymerase
in vitro[27] and effective DNA delivery in mammalian cells.[28]
Herein, we construct a positively charged gold nanoparticle
bearing a photoactive o-nitrobenzyl ester linkage, which
allows temporal and spatial release of DNA by light. These
cationic photocleavable nanoparticles (NP-PC) initially asso-
ciate with DNA through charge pairing (Figure 1a). Near-UV
irradiation (> 350 nm) cleaves the nitrobenzyl linkage, releas-
ing the positively charged alkyl amine and leaving behind a
negatively charged carboxylate group (NP-TCOOH). This
reversal in electrostatics leads to the efficient release of DNA
from the nanoparticle, resulting in a high level of recovery of
DNA transcription in vitro. Moreover, effective DNA deliv-
ery and release in living cells with significant nuclear local-
ization of the DNA were obtained with this system, thus
providing an important proof of concept for the development
of light-regulated biological-macromolecule and drug-deliv-
ery systems.
Figure 1. a) Schematic illustration of the release of DNA from the NP-
PC–DNA complex upon UV irradiation within the cell; b) schematic
presentation of light-induced surface transformation of NP-PC.
over time (Figure 2), thus indicating the breakage of the
photolabile ester bond and the generation of o-nitrobenzal-
dehyde concomitant with charge conversion on the NP-PC
Photolabile gold nanoparticles (NP-PC, Figure 1b) were
prepared by place exchange of 1-pentanethiol-capped 2-nm
gold clusters with o-nitrobenzyl ester functionalized thiol
ligands.[29] The o-nitrobenzyl ester group is a commonly used
biocompatible species that is photocleavable. It has long-term
stability under ambient light, but can be removed quickly and
efficiently by UV light (> 350 nm) with minimal adverse
effects on biological systems.[30] The positively charged
dimethylethylammonium functionalities at the periphery of
the nanoparticles provide good water solubility and allow
interaction with DNA through complementary charges.
Furthermore, tetraethylene glycol (TEG) was incorporated
as a tether to increase both the biocompatibility and water
solubility of the particles.[31]
A solution of NP-PC was irradiated with UV light (l =
350 nm), and the course of the photochemical reaction was
monitored by UV/Vis spectroscopy to establish the cleavage
of the o-nitrobenzyl ester linkage. Irradiation led to a
decrease in absorption at 304 nm and an increase at 342 nm
Figure 2. UV/Vis spectral changes of NP-PC (1.0 mm) upon irradiation
with UV light (l=350 nm). Inset: The plot of absorbance at 304 nm
against irradiation time shows that the photochemical reaction
approached maximum conversion within 10 min.
3166
www.angewandte.org
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Angew. Chem. Int. Ed. 2006, 45, 3165 –3169

Angewandte
Chemie
monolayer. The photochemical conversion on the monolayer
of the gold particles approached maximum within 10 min.
An ethidium bromide (EtdBr) fluorescence assay was
used to follow the interaction between NP-PC and DNA.
EtdBr is weakly fluorescent in aqueous solution but exhibits
strong fluorescence upon intercalation into the DNA
duplex.[32] It is expected that the complementary electrostatic
interaction of NP-PC with DNAwould block the hydrophobic
grooves of DNA and thus diminish the EtdBr–DNA inter-
action, which should be reflected by fluorescence changes in
EtdBr. Indeed, drastic fluorescence quenching was observed
when NP-PC was added to a solution of DNA and EtdBr,
suggesting that EtdBr is expelled from the DNA duplex, and
its intrinsic fluorescence is quenched by the bulk water
molecules.[25,28,33] Because anionic gold nanoparticles cannot
bind with negatively charged DNA molecules, the absorption
effect of the gold core on fluorescence quenching was
subtracted with NP-TCOOH as a reference. The corrected
fluorescence titration curve shows that the fluorescence
quenching due to complex formation is dependent on nano-
particle concentration, and a plateau is reached at a NP-PC/
37-mer DNA ratio of 6:1 (see Supporting Information),
indicating a binding stoichiometry of 6:1.
DNA transcription by T7 RNA polymerase was studied
in vitro to determine the impact of complex formation on
DNA function and the functional efficiency of DNA
release.[34] Premixed (5 min) 37-mer DNA/NP-PC (1:6) sol-
utions were exposed to UV light (l = 350 nm) for varying
periods of time followed by a T7 RNA polymerase tran-
scription assay.[27] The product 20-mer RNA transcripts were
subjected to gel electrophoresis for quantitative determina-
tion of the extent of reaction, with the transcription level
obtained in the absence of nanoparticles set to 100%. Before
UV irradiation, the transcription was less than 5% of the
control (Figure 3). Upon irradiation, however, the transcrip-
tion level increased significantly, reaching a maximum of
about 75% recovery in 8 min (Figure 3). A control experi-
ment showed that DNA alone irradiated by UV light for
10 min has essentially identical levels of transcription to that
without UV irradiation, which suggests that DNA function is
retained in the presence of UV light. Such a high level of
restoration of DNA-transcription ability indicates that the
DNA–NP-PC complexes are efficiently dissociated upon
irradiation. As discussed previously, the cationic NP-PC
electrostatically associates with DNA to afford DNA–nano-
particle supramolecular complexes. Therefore, the initially
observed transcription inhibition is ascribed to competition
between the nanoparticles and the RNA polymerase for
binding to the DNA. Upon UV irradiation, the cationic NP-
PC is converted into the anionic NP-TCOOH, which is no
longer able to associate with DNA molecules, thus releasing
the DNA for transcription. This result not only provides
evidence for functional DNA release in vitro through the light
regulation of our photolabile nanoparticles, but also demon-
strates the feasibility of NP-PC as a novel photocontrolled
bioactive system.
Next, light-triggered DNA delivery and release were
investigated in living cells by fluorescence microscopy. Gold
nanoparticles are reported to quench conjugated fluoro-
phores effectively through energy transfer.[35] Once detached
from the nanoparticles, the fluorophores “light up” as the
energy-transfer pathway is removed. Herein, as a model
system, we used fluorescein (FAM)-labeled 37-mer DNA (F-
DNA), which bears the same sequence as that used in the T7
RNA polymerase assay, to detect DNA delivery and release
in vivo. On the basis of the 6:1 binding stoichiometry, NP-PC–
F-DNA complexes were prepared at a slight molar excess of
10:1 for optimal cellular internalization.[24,36] Mouse embry-
onic fibroblast cells were incubated with NP-PC–F-DNA for
6 h in 96-well plates and then washed with phosphate-
buffered saline (PBS) to remove the uninternalized nano-
particles. The cells were irradiated for 2 h with a hand-held
low-power UV lamp, and fluorescence-microscopy images
were taken before and after irradiation. Significant fluores-
cence with UV irradiation was observed inside most cells
(Figure 4, right), whereas the control experiment without
irradiation did not show observable fluorescence (Figure 4,
left). No fluorescence was observed in cells incubated with
merely F-DNA, thus indicating that the cellular uptake of
naked DNA is inefficient. Furthermore, untreated cells with
and without NP-PC incubation also showed no observable
fluorescence after irradiation; autofluorescence from nano-
particles or cells is therefore precluded.[29] Taken together, the
results clearly show that cationic NP-PC can effectively carry
DNA into the cells and that the DNA is successfully unloaded
Figure 3. Normalized transcription level (NTL) of 20-mer RNA prod-
ucts upon irradiation at 350 nm for different times, showing the
efficient transcription restoration by T7 RNA polymerase (T7 Pol.).
Inset: Proposed mechanism of light-triggered transcription recovery.
Figure 4. Representative fluorescence-microscopy images showing the
phototriggered DNA release from the NP-PC–F-DNA complex.
Angew. Chem. Int. Ed. 2006, 45, 3165 –3169
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.angewandte.org
3167

Communications
from gold nanoparticles with the intervention of UV light,
thus demonstrating that light provides effective spatiotempo-
ral control.
Effective accumulation of DNA in the nucleus after
dissociation from transporting vectors is an essential step in
gene delivery, as gene expression takes place inside the cell
nucleus.[37] To evaluate the subcellular distribution of the
released DNA, specifically with respect to its nuclear local-
ization within cells after UV irradiation, the nuclear stain 4’,6-
diamidino-2-phenylindole (DAPI) was used. A sample of the
NP-PC–F-DNA complex (10:1) was incubated with mouse
embryonic fibroblast cells for 6 h in glass-bottomed dishes
and washed with PBS buffer. After UV irradiation for 2 h,
fluorescence-microscopy images were taken immediately.
Although some F-DNA molecules were found in the cyto-
plasm, significant nuclear localization of the DNA is clearly
demonstrated by colocalization of F-DNA (red) and DAPI
(yellow) (Figure 5a). In accord with the fluorescence-micros-
copy results, confocal microscopic studies further confirmed
that the unloaded F-DNA accumulated inside the nucleus
(Figure 5b).
In summary, we have developed a photolabile gold
nanoparticle that provides effective light-regulated control
over DNA–nanoparticle interactions. We have demonstrated
that light is effective in triggering DNA release from gold
clusters both in vitro and in vivo. These cationic nanoparticles
bind with DNA through complementary surface electrostatic
interactions; upon UV irradiation, the electrostatic nature of
the surface of the nanoparticles is converted, thus resulting in
effective DNA release. We have demonstrated that such
release leads to a high level of DNA-transcription recovery
in vitro. Most importantly, effective DNA delivery and
release were also observed in cells, with significant nuclear
localization of the DNA molecules. This light-mediated
release strategy paves a simple and unique way for delivering
therapeutic materials into cells in a spatiotemporally con-
trolled fashion. Furthermore, versatile surface modification of
gold nanoparticles combined with the controlled interactions
of biomolecules could be used to enhance the transfection of
genetic materials as well as protein and drug delivery.
Figure 5. a) Fluorescence- and bright-field-microscopy images illustrat-
ing nuclear localization of DNA released from the NP-PC–DNA
complex by photo-triggering. For an improved observation of over-
lapping F-DNA and nuclei stained with DAPI, we colored the green
(fluorescein) and blue (DAPI) channels red and yellow, respectively.
b) Confocal-microscopy images showing that the photoreleased DNA
effectively accumulates inside the nucleus of cells. Panels 1–4 show
four consecutive slices of the middle sections of z-series confocal
images (interval=1.0 mm).
Experimental Section
All chemicals were obtained from Sigma–Aldrich (St. Louis, MO,
USA) unless otherwise noted. Two complementary 37-mer unlabeled
DNA single strands S1 (5’-TAATACGACTCACTATAGGGAGAC-
CACAACGGTTTCC-3’) and S2 (3’-ATTATGCTGAGTGA-
TATCCCTCTGGTGTTGCCAAAGG-5’) were synthesized and
purified according to the method reported previously.[30] The FAM-
labeled DNA single strand S3 (5’-(FAM)TAATACGACTCACTAT-
AGGGAGACCACAACGGTTTCC(FAM)-3’) was purchased from
Integrated DNA Technologies, Inc (Coralville, IA, USA). Concen-
trations of single-stranded DNA stock solutions in tris-EDTA (TE)
buffer (pH 7.8, tris = tris(hydroxymethyl)aminomethane (10 mm),
EDTA = ethylenediaminetetraacetate (1 mm)) were calculated using
the weighted sums of the different measured molar-extinction
coefficients for each base at 253, 259, and 267 nm. S2 was annealed
with S1 and S3 separately by combining equivalent molar amounts of
the individual sequences (final concentration 50 mm), heating to 908C
for 5 min, and slowly cooling to room temperature. DNA was stored
at À208C. The detailed experimental procedure for the synthesis of
the photolabile thiol ligand and the corresponding NP-PC is
described in the Supporting Information.
UV: Samples were irradiated in quartz cuvettes using a Rayonet
photochemical reactor (Southern N.E. Ultraviolet Co., Middletown,
CT, USA) at the wavelength of 350 nm. UV/Vis spectra of NP-PC
were recorded with a HP 8452A spectrophotometer.
EtdBr: This assay was modified from a reported procedure.[33]
Samples were prepared in PBS buffer (pH 7.8, potassium phosphate
(20 mm), sodium chloride (100 mm)) unless otherwise noted. Fluores-
cence spectra were recorded in a conventional quartz cuvette (10 ”
10 ” 35 mm3) on a Shimadzu RF-5301 PC spectrofluorometer with
excitation at 545 nm. Both the excitation and emission slit widths
were 5 nm. During the titration, a mixture (2 mL) of 37-mer DNA
(0.1 mm) and EtBr (1 mm) was placed in the cuvette, and the initial
3168
www.angewandte.org
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Angew. Chem. Int. Ed. 2006, 45, 3165 –3169

Angewandte
Chemie
emission spectrum was recorded. Aliquots (10 mL) of a solution of 37-
mer DNA (0.1 mm), EtBr (1 mm), and NP-PC (3.5 mm) or NP-TCOOH
(3.5 mm, as control) were subsequently added to the solution in the
cuvette. After each addition, a fluorescence spectrum was recorded.
The normalized fluorescence intensities calibrated by respective
controls at a selected wavelength (589 nm) were plotted against the
ratio [NP-PC]/[DNA] (see Supporting Information).
[5] W. Wu, S. Wieckowski, G. Pastorin, M. Benincasa, C. Klumpp,
J. P. Briand, R. Gennaro, M. Prato, A. Bianco, Angew. Chem.
2005, 117, 6516 – 6520; Angew. Chem. Int. Ed. 2005, 44, 6358 –
6362.
[6] D. Luo, W. M. Saltzman, Nat. Biotechnol. 2000, 18, 893 – 895.
[7] E. Katz, I. Willner, Angew. Chem. 2004, 116, 6166 – 6235; Angew.
Chem. Int. Ed. 2004, 43, 6042 – 6108.
T7 RNA Polymerase: This assay was modified according to that
previously described.[34] The assay was carried out in PBS buffer. To
mediate the reversal of inhibition of transcription, DNA/NP-PC (1:6)
solutions were premixed for 5 min and then irradiated at 350 nm for
different times (0, 0.5, 1, 2, 3, 4, 5, 6, 8, and 10 min) in a Rayonet
photochemical reactor. DNA solutions irradiated for 0 and 10 min
served as controls. T7 RNA polymerase (enzyme/DNA = 5:1,
[DNA] = 0.1 mm) and excess nucleotide triphosphates were then
added to the mixture. The nucleotide triphosphates included 32P-
labeled guanosine 5’-triphosphate (GTP) for isotopic detection. The
enzymatic reaction proceeded for 5 min at 378C before being
quenched with EDTA (15 mm) in formamide (95%). The 20-mer
RNA transcripts were resolved by electrophoresis in a polyacryl-
amide (20%) and urea (7m) gel (Supporting Information) and
visualized and quantified with a Storm 840 phosphorimager to
determine the extent of reaction. Transcription levels obtained in
the absence of NP-PC were set to 100%.
Cell culture: Mouse embryonic fibroblast cell lines were gifts
from Dr. R. Johnson, University of California, San Diego. Cells were
grown in a cell-culture flask in high-glucose Dulbeccoꢀs Modified
Eagle Medium (DMEM; glucose (4.5 gLÀ1)) containing 4-(2-hydroxy-
ethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (pH 7.4,
25 mm) supplemented with fetal bovine serum (FBS; 10%). Cultures
were maintained at 378C under a humidified condition with CO2
(5%).
[8] C. M. Niemeyer, Angew. Chem. 2001, 113, 4254 – 4287; Angew.
Chem. Int. Ed. 2001, 40, 4128 – 4158.
[9] L. Pasquato, P. Pengo, P. Scrimin, J. Mater. Chem. 2004, 14, 3481 –
3487.
[10] A. Verma, V. M. Rotello, Chem. Commun. 2005, 303 – 312.
[11] D. Luo, MRS Bull. 2005, 30, 654 – 658.
[12] W. J. Li, Z. H. Huang, J. A. MacKay, S. Grube, F. C. Szoka, J.
Gene Med. 2005, 7, 67 – 79.
[13] C. A. H. Prata, Y. X. Zhao, P. Barthelemy, Y. G. Li, D. Luo, T. J.
McIntosh, S. J. Lee, M. W. Grinstaff, J. Am. Chem. Soc. 2004,
126, 12196 – 12197.
[14] S. Giri, B. G. Trewyn, M. P. Stellmaker, V. S. Y. Lin, Angew.
Chem. 2005, 117, 5166 – 5172; Angew. Chem. Int. Ed. 2005, 44,
5038 – 5044.
[15] a) D. Ryan, B. A. Parviz, V. Linder, V. Semetey, S. K. Sia, J. Su,
M. Mrksich, G. M. Whitesides, Langmuir 2004, 20, 9080 – 9088;
b) A del Campo, D. Boos, H. W. Spiess, U. Jonas, Angew. Chem.
2005, 117, 4785 – 4791; Angew. Chem. Int. Ed. 2005, 44, 4707 –
4712.
[16] K. N. Plunkett, A. Mohraz, R. T. Haasch, J. A. Lewis, J. S.
Moore, J. Am. Chem. Soc. 2005, 127, 14574 – 14575.
[17] H. Bayley, Nat. Chem. Biol. 2006, 2, 11 – 13.
[18] N. Nishiyama, A. Iriyama, W. D. Jang, K. Miyata, K. Itaka, Y.
Inoue, H. Takahashi, Y. Yanagi, Y. Tamaki, H. Koyama, K.
Kataoka, Nat. Mater. 2005, 4, 934 – 941.
Images: All fluorescence images were obtained with an Olympus
X71 inverted microscope with excitation at 470 nm and emission at
525 nm for the green (fluorescein) channel, and with excitation at
360 nm and emission at 460 nm for the blue (DAPI) channel.
Confocal images were obtained with a Zeiss LSM510 microscope
equipped with a 40 ” objective lens. An argon laser (488 nm) was
used to provide the excitation for fluorescein-labeled DNA.
Plates (96-well): Mouse embryonic fibroblast cells (12000 cells/
well) were incubated with the NP-PC–F-DNA complex (10:1, [F-
DNA] = 0.2 mm) for 6 h on the culture plates followed by washing
with PBS buffer. Fluorescence-microscopy images were taken
(magnification 20 ” , exposure time 500 ms) before and after 2 h of
irradation at 365 nm using a hand-held low-power Spectroline ENF-
240C UV lamp.
[19] N. K. Mal, M. Fujiwara, Y. Tanaka, Nature 2003, 421, 350 – 353.
[20] K. Berg, P. K. Selbo, L. Prasmickaite, A. Hogset, Curr. Opin.
Mol. Ther. 2004, 6, 279 – 287.
[21] H. Ando, T. Furuta, R. Y. Tsien, H. Okamoto, Nat. Genet. 2001,
28, 317 – 325.
[22] B. Ghosn, F. R. Haselton, K. R. Gee, W. T. Monroe, Photochem.
Photobiol. 2005, 81, 953 – 959.
[23] L. Krock, A. Heckel, Angew. Chem. 2005, 117, 475 – 477; Angew.
Chem. Int. Ed. 2005, 44, 471 – 473.
[24] S. G. Chaulk, A. M. MacMillan, Nucleic Acids Res. 1998, 26,
3173 – 3178.
[25] A. Heckel, G. Mayer, J. Am. Chem. Soc. 2005, 127, 822 – 823.
[26] J. P. Pellois, T. W. Muir, Angew. Chem. 2005, 117, 5859 – 5863;
Angew. Chem. Int. Ed. 2005, 44, 5713 – 5717.
Glass-bottomed dishes: Mouse embryonic fibroblast cells (3000
cells/dish) were plated overnight, then incubated with the NP-PC–F-
DNA complex (10:1, [F-DNA] = 0.2 mm) for 6 h on the dishes
followed by washing with PBS buffer. After 2 h of irradiation with a
hand-held UV lamp, fluorescence-microscopy images were taken
(magnification 40 ” , exposure time 1000 ms). The confocal-micro-
scope image was taken by using the parameters noted above.
[27] C. M. McIntosh, E. A. Esposito, A. K. Boal, J. M. Simard, C. T.
Martin, V. M. Rotello, J. Am. Chem. Soc. 2001, 123, 7626 – 7629.
[28] K. K. Sandhu, C. M. McIntosh, J. M. Simard, S. W. Smith, V. M.
Rotello, Bioconjugate Chem. 2002, 13, 3 – 6.
[29] See Supporting Information for details.
[30] D. M. Rothman, M. E. Vazquez, E. M. Vogel, B. Imperiali, J.
Org. Chem. 2003, 68, 6795 – 6798.
[31] R. Hong, N. O. Fischer, A. Verma, C. M. Goodman, T. Emrick,
V. M. Rotello, J. Am. Chem. Soc. 2004, 126, 739 – 743.
[32] J. Olmsted III, D. R. Kearns, Biochemistry 1977, 16, 3647 – 3654.
[33] D. L. Boger, B. E. Fink, S. R. Brunette, W. C. Tse, M. P. Hedrick,
J. Am. Chem. Soc. 2001, 123, 5878 – 5891.
Received: January 18, 2006
Published online: March 30, 2006
Keywords: DNA · gold · nanoparticles · photochemistry ·
.
[34] P. Gong, E. A. Esposito, C. T. Martin, J. Biol. Chem. 2004, 279,
44277 – 44285.
transcription
[35] C. H. Fan, S. Wang, J. W. Hong, G. C. Bazan, K. W. Plaxco, A. J.
Heeger, Proc. Natl. Acad. Sci. USA 2003, 100, 6297 – 6301.
[36] H.-T. Song, J.-S. Choi, Y.-M. Huh, S. Kim, Y.-W. Jun, J.-S. Suh, J.
Cheon, J. Am. Chem. Soc. 2005, 127, 9992 – 9993.
[37] a) O. Zelphati, F. C. Szoka, Pharm. Res. 1996, 13, 1367 – 1372;
b) O. Zelphati, F. C. Szoka, Proc. Natl. Acad. Sci. USA 1996, 93,
11493 – 11498.
[1] W. F. Anderson, Science 1992, 256, 808 – 813.
[2] D. W. Pack, A. S. Hoffman, S. Pun, P. S. Stayton, Nat. Rev. Drug
Discovery 2005, 4, 581 – 593.
[3] U. Boas, P. M. H. Heegaard, Chem. Soc. Rev. 2004, 33, 43 – 63.
[4] A. K. Salem, P. C. Searson, K. W. Leong, Nat. Mater. 2003, 2,
668 – 671.
Angew. Chem. Int. Ed. 2006, 45, 3165 –3169
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.angewandte.org
3169