A two-unnatural-base-pair system toward the expansion of the genetic code

Article abstract of DOI:10.1021/ja047201d

Toward the site-specific incorporation of amino acid analogues into proteins, a two-unnatural-base-pair system was developed for coupled transcription-translation systems with the expanded genetic code. A previously designed unnatural base pair between 2-

Full text of DOI:10.1021/ja047201d

Published on Web 09/23/2004
A Two-Unnatural-Base-Pair System toward the Expansion of
the Genetic Code
Ichiro Hirao,*,†,‡ Yoko Harada,‡ Michiko Kimoto,‡ Tsuneo Mitsui,†
Tsuyoshi Fujiwara,‡ and Shigeyuki Yokoyama*,‡,§,¶
Contribution from the Research Center for AdVanced Science and Technology,
The UniVersity of Tokyo, 4-6-1 Komaba, Meguro-ku, Tokyo 153-8904, Japan,
Protein Research Group, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi-ku,
Yokohama, Kanagawa 230-0045, Japan, Department of Biophysics and Biochemistry,
Graduate School of Science, The UniVersity of Tokyo, 7-3-1 Hongo,
Bunkyo-ku, Tokyo 113-0033, Japan, and RIKEN Harima Institute at SPring-8, 1-1-1 Kohto,
Mikazuki-cho, Sayo, Hyogo 679-5148, Japan
Received May 13, 2004; E-mail: ihirao@postman.riken.jp; yokoyama@biochem.s.u-tokyo.ac.jp
Abstract: Toward the site-specific incorporation of amino acid analogues into proteins, a two-unnatural-
base-pair system was developed for coupled transcription-translation systems with the expanded genetic
code. A previously designed unnatural base pair between 2-amino-6-(2-thienyl)purine (denoted by s) and
pyridin-2-one (denoted by y) was used for the site-specific incorporation of yTP into RNA opposite s in
templates by T7 RNA polymerase. For the site-specific incorporation of sTP into RNA, a newly developed
unnatural base, imidazolin-2-one (denoted by z), is superior to y as a template base for pairing with s in
T7 transcription. The combination of the s-y and s-z pairs provides a powerful tool to prepare both
y-containing mRNA and s-containing tRNA for efficient coupled transcription-translation systems, in which
the genetic code is expanded by the codon-anticodon interactions mediated by the s-y pair. In addition,
the nucleoside of s is strongly fluorescent, and thus the s-z pair enables the site-specific fluorescent labeling
of RNA molecules. These unnatural-base-pair studies provide valuable information for understanding the
mechanisms of replication and transcription.
Introduction
to a cell-free translation system for the incorporation of
3-iodotyrosine into a peptide.7 In this translation system,
The creation of unnatural base pairs for the expansion of the
genetic alphabet and code allows us to incorporate various
unnatural, functional components into nucleic acids and proteins
at desired positions.1-3 For this purpose, unnatural base pairs
that have exclusive selectivity and work together with the natural
A-T(U) and G-C pairs in replication, transcription, and
translation are required.
Previous efforts pursued the use of unnatural base pairs, such
as isoG and isoC, with hydrogen-bonding patterns different from
those of the natural Watson-Crick base pairs.4-6 These un-
natural base pairs functioned with moderate selectivity in
replication and transcription, and the isoG-isoC pair was applied
however, the mRNA and tRNA containing the unnatural bases
were prepared by laborious chemical synthesis. Although the
isoG can be incorporated into RNA opposite isoC by T7
transcription, the isoC incorporation into RNA is not useful,
due to the instability of isoCTP and the misincorporation of T
by the tautomerization of isoG.5 On the other hand, recent
studies of unnatural hydrophobic base analogues, such as
4-methylbenzimidazole and 2,4-difluorotoluene, revealed that
the steric effects between pairing bases are important for DNA
replication.8,9 Although hydrophobic base pairs are also potential
candidates for unnatural base pairs,10,11 there have been no
reports on transcription mediated by hydrophobic base pairs.
However, these studies have shed light on several factors, such
as hydrogen bonding, steric interactions, base-stacking, and
hydrophobicity, as the design principles for the further develop-
ment of unnatural base pairs.12,13
† Research Center for Advanced Science and Technology, The University
of Tokyo.
‡ RIKEN Genomic Sciences Center.
§ Department of Biophysics and Biochemistry, Graduate School of
Science, The University of Tokyo.
¶ RIKEN Harima Institute at SPring-8.
(1) Benner, S. A.; Burgstaller, P.; Battersby, T. R.; Jurczyk, S. In The RNA
World, 2nd ed.; Gesteland, R. F., Cech, T. R., Atkins, J. F., Eds.; Cold
Spring Harbor Laboratory Press: Cold Spring Harbor, NY, 1999; p 163.
(2) Henry, A. A.; Romesberg, F. E. Curr. Opin. Chem. Biol. 2003, 7, 727.
(3) Bergstrom, D. E. Chem. Biol. 2004, 11, 18.
(4) Piccirilli, J. A.; Krauch, T.; Moroney, S. E.; Benner, S. A. Nature 1990,
343, 33.
(7) Bain, J. D.; Switzer, C.; Chamberlin, A. R.; Benner, S. A. Nature 1992,
356, 537.
(8) Moran, S.; Ren, R. X.-F.; Kool, E. T. Proc. Natl. Acad. Sci. U.S.A. 1997,
94, 10506.
(9) Morales, J. C.; Kool, E. T. Nat. Struct. Biol. 1998, 5, 950.
(10) McMinn, D. L.; Ogawa, A. K.; Wu, Y.; Liu, J.; Schultz, P. G.; Romesberg,
F. E. J. Am. Chem. Soc. 1999, 121, 11585.
(5) Switzer, C. Y.; Moroney, S. E.; Benner, S. A. Biochemistry 1993, 32, 10489.
(6) Horlacher, J.; Hottiger, M.; Podust, V. N.; Hu¨bscher, U.; Benner, S. A.
Proc. Natl. Acad. Sci. U.S.A. 1995, 92, 6329.
(11) Wu, Y.; Ogawa, A. K.; Berger, M.; McMinn, D. L.; Schultz, P. G.;
Romesberg, F. E. J. Am. Chem. Soc. 2000, 122, 7621.
(12) Kool, E. T. Curr. Opin. Chem. Biol. 2000, 4, 602.
9
13298
J. AM. CHEM. SOC. 2004, 126, 13298-13305
10.1021/ja047201d CCC: $27.50 © 2004 American Chemical Society

A Two-Unnatural-Base-Pair System for Specific Transcription
A R T I C L E S
especially A, are partially incorporated into RNA opposite y in
templates (Figure 1c), and the incorporation fidelity of s opposite
y was reduced by 70-80%. Consequently, this insufficient
selectivity of s incorporation opposite y hampers the transcrip-
tional preparation of RNA fragments containing s.
To overcome this problem with the s-y pair, we designed
imidazolin-2-one (denoted by z) as an efficient pairing partner
of s (Figure 1d). The shape fitting between the five-membered
ring of z and s was expected to be better than that between the
six-membered ring of y and s. Although the hydrogen bonding
between s and z is less effective than that between s and y,
both the hydrogen bonding and shape fitting in the noncognate
G-z and A-z pairs (Figure 1e) should be much less effective
than those in the G-y and A-y pairs (Figure 1c). As compared
to the six-membered ring of y, the loose fitting of the five-
membered ring of z with the natural purines may not effectively
exclude water molecules on the pairing surface of A or G in
replication.16 Thus, the s-z pairing was expected to be more
selective than the s-y pairing. Here, we compare the potential
of the s-z pairing to the s-y pairing through experiments in
transcription and replication, and by the thermal stability of the
s-z pair in duplex DNA. We also report the synthesis of tRNA
containing s in the anticodon, by T7 transcription mediated by
the s-z pairing, and discuss the two-unnatural-base-pair system
for the expansion of the genetic code.
Figure 1. Cognate unnatural base pairs and their noncognate pairs: the
cognate s-y (a), noncognate s-T (b) and A-y (c), cognate s-z (d), and
noncognate A-z (e) pairs.
Results and Discussion
The 2′-deoxyribonucleoside of z was synthesized by the
glycosidation of 1-chloro-2-deoxy-3,5-di-O-toluoyl-R-D-eryth-
ropentofuranose and trimethylsilylated imidazolin-2-one with
SnCl4 (Scheme 1). After deprotection of the toluoyl groups, both
the â-isomer and R-isomer were isolated with total yields of
19 and 24%, respectively. These structures were confirmed by
1H NMR and mass spectrometry; the â-isomer generated NOEs
between H1′ and H4′, and H1′ and H2′′, unlike the R-isomer
(see Supporting Information). Furthermore, the 1H NMR
spectrum of the â-isomer was identical to that of the product
obtained by a different synthesis route, in which the â-isomer
was derived from the â-D-ribonucleoside of z17 by deoxygen-
ation of the 2′-hydroxy group.18 For DNA chemical synthesis,
the base moiety was protected with a diphenylcarbamoyl group,
and then the nucleoside was converted to the amidite. The
stability of the z nucleoside in DNA fragments, under the
deprotection conditions after DNA synthesis, was tested using
the trimer, d(TzT), and no decomposition was observed after
treatment with concentrated NH4OH at 55 °C for 6 h. DNA
templates (35-mer and 104-mer) containing z were synthesized.
The coupling efficiency of the amidite was >98% on a DNA
synthesizer (Applied Biosystems). Furthermore, the 2′-deox-
yribonucleoside of z was converted to the nucleoside 5′-
triphosphate (dzTP), to function as a substrate in replication.
First, we examined the thermal stability of a duplex DNA
(12-mer) containing the s-z pair, to assess the specificity of the
unnatural base pair formation. The DNA duplex containing the
s-z pair (Tm ) 42.3 °C) was as stable as that containing the s-y
pair (Tm ) 42.9 °C), even though the stacking ability of the
five-membered ring of z might be inferior to that of the six-
By combining the concepts of hydrogen-bonding patterns and
steric interactions, we previously developed an unnatural base
pair between 2-amino-6-(2-thienyl)purine (denoted by s) and
pyridin-2-one (denoted by y) (Figure 1a).14,15 The bulky thienyl
group of s effectively excludes the pairing with natural bases,
enabling the specific pairing between s and y (Figure 1a,b). The
s-y pair functions specifically in DNA duplex formation,
replication, translation, and especially transcription. The sub-
strate of y (denoted by yTP) can be site-specifically incorporated
by T7 RNA polymerase into RNA opposite s in templates, and
the incorporation fidelity of y opposite s is more than 95%.
Using the s-y pair, we created an extra codon-anticodon
interaction and achieved the site-specific incorporation of an
amino acid analogue, 3-chlorotyrosine, into the human Ha-Ras
protein by coupled transcription-translation in a cell-free
system15 (see Figure 4).
Although this cell-free coupled transcription-translation
system has the potential for the efficient synthesis of artificial
proteins with amino acid analogues, the s-y pair still has some
shortcomings for practical uses. In this system, the tRNA
molecule containing s in the anticodon had to be prepared by a
laborious method combining chemical synthesis and enzymatic
ligation.15 This is because of the unidirectional complementarity
of the s-y pair; the incorporation of s into RNA opposite y is
less selective than that of y opposite s in T7 transcription. The
unnatural base s has the bulky thienyl group, which prevents
pairing with the natural bases. On the other hand, y has no such
functional group. Thus, the substrates of the natural purines,
(13) Kool, E. T. Annu. ReV. Biophys. Biomol. Struct. 2001, 30, 1.
(14) Fujiwara, T.; Kimoto, M.; Sugiyama, H.; Hirao, I.; Yokoyama, S. Bioorg.
Med. Chem. Lett. 2001, 11, 2221.
(15) Hirao, I.; Ohtsuki, T.; Fujiwara, T.; Mitsui, T.; Yokogawa, T.; Okuni, T.;
Nakayama, H.; Takio, K.; Yabuki, T.; Kigawa, T.; Kodama, K.; Yokogawa,
T.; Nishikawa, K.; Yokoyama, S. Nat. Biotechnol. 2002, 20, 177.
(16) Kool, E. T.; Morales, J. C.; Guckian, K. M. Angew. Chem., Int. Ed. 2000,
39, 990.
(17) Haines, D. R.; Leonard, N. J.; Wiemer, D. F. J. Org. Chem. 1982, 47, 474.
(18) Ishikawa, M.; Hirao, I.; Yokoyama, S. Tetrahedron Lett. 2000, 41, 3931.
9
J. AM. CHEM. SOC. VOL. 126, NO. 41, 2004 13299

A R T I C L E S
Hirao et al.
Scheme 1. Synthesis of the Amidite and the Triphosphate of za
a Reagents: (a) hexamethyldisilazane, ammonium sulfate, dichloroethane; (b) SnCl4, acetonitrile; (c) methanolic ammonia, â-isomer (19%) and R-isomer
(24%) from 1; (d) 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane, DMF, pyridine, 78%; (e) diphenylcarbamoyl chloride, iPr2EtN, pyridine, 60%; (f)
i
tetrabutylammonium fluoride, THF, 96%; (g) 4,4′-dimethoxytrityl chloride, pyridine, 86%; (h) ClP(N-iPr2)(OCH2CH2CN), Pr2EtN, THF, 86%; (i) POCl3,
proton sponge, PO(OCH3)3, then tri-n-butylamine, bis(tributylammonium)pyrophosphate, DMF. Abbreviations: DMTr, dimethoxytrityl; iPr, isopropyl; Tol,
toluoyl.
Table 1. Steady-State Kinetic Parameters for Insertion of Single Nucleotides into a Template-Primer Duplex by the Exonuclease-Deficient
Klenow Fragment
primer
−
template
(N)
nucleoside
Km
M)
Vmax
Vmax/Km
1
a
1
1
entry
template set
triphosphate
(
µ
(%
‚
min-
)
(%‚
min-
‚
M-
)
1
2
3
4
5
6
7
8
1
1
1
1
1
2
2
2
2
2
1
1
1
1
1
2
2
2
2
2
1
1
2
2
s
A
G
C
T
z
z
z
z
z
z
z
z
z
z
600 (210)b
1800 (500)
770 (540)
ndc
900 (700)
95 (30)
540 (140)
270 (170)
nd
34 (6)
5.0 (1.9)
2.1 (1.3)
nd
0.065 (0.030)
55 (17)
8.9 (2.4)
0.57 (0.20)
nd
0.041 (0.027)
10 (4)
11 (3)
1.1 (0.3)
nd
nd
69 (11)
56 (12)
4.2 (1.0)
0.19 (0.01)
0.78 (0.39)
1.8 (0.3)
1.7 (0.7)
11 (2)
5.7 × 104
2.8 × 103
2.7 × 103
7.2 × 101
5.8 × 105
1.6 × 104
2.1 × 103
7.1 × 102
5.9 × 104
5.0 × 104
7.9 × 103
s
A
G
C
T
y
y
y
y
y
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
58 (56)
s
170 (60)
220 (90)
140 (30)
nd
nd
68 (19)
370 (190)
310 (110)
1000 (300)
4.8 (4.9)
1.5 (0.5)
2000 (1500)
3.9 (1.3)
490 (80)
A
G
C
T
y
y
y
y
y
A
A
T
C
s
1.0 × 106
1.5 × 105
1.4 × 104
1.9 × 102
1.6 × 105
1.2 × 106
8.5 × 102
2.8 × 106
5.9 × 103
A
G
C
T
T
C
A
A
2.9 (0.9)
a The values were normalized to the enzymatic concentration (20 nM) for the various enzyme concentrations used. b Standard deviations are given in
parentheses. c nd, no inserted products were detected after an incubation for 20 min with 2100 or 2400 µM nucleoside triphosphate and 45 nM enzyme.
membered ring of y. Interestingly, the selectivity of the s-z pair
was significantly improved, and the duplex DNA containing
the s-z pair (Tm ) 42.3 °C) was stabilized by 2.8-6.8 °C relative
to the mispairs between z and the natural purine bases (Tm’s )
35.5 and 39.5 °C for the A-z and G-z pairs, respectively). In
contrast, the stability of the duplex DNA containing the
noncognate G-y pair (Tm ) 43.1 °C) was as high as that of the
duplex DNA containing the s-y pair (Tm ) 42.9 °C), although
the s-y pair was more stable than the A-y pair (Tm ) 36.2 °C).
Before we tested the s-z pair in transcription, we examined
the potential of the s-z pairing in replication, since the
determination of the kinetic parameters of base pairings in
replication is much easier than that in transcription, and the
structures and mechanisms between DNA polymerases and RNA
polymerases are quite similar.19-21 Thus, the selectivity of the
s-z pairing against the noncognate pairings was compared with
(19) Sousa, R.; Chung, Y. J.; Rose, J. P.; Wang, B.-C. Nature 1993, 364, 593.
(20) Cheetham, G. M. T.; Jeruzalmi, D.; Steitz, T. A. Nature 1999, 399, 80.
9
13300 J. AM. CHEM. SOC. VOL. 126, NO. 41, 2004

A Two-Unnatural-Base-Pair System for Specific Transcription
A R T I C L E S
that of the s-y pairing by the steady-state kinetics of single-
nucleotide insertion experiments. The exonuclease-deficient
Klenow fragment of Escherichia coli DNA polymerase I was
used with combinations between nucleoside triphosphates and
double-stranded templates (35-mer; template 1 and template 2)
with a 32P-labeled primer (20-mer), in which various bases in
the templates were adjacent to the 3′ end of the primer (Table
1).
The selectivity of the s-z pairing was greatly improved (Table
1, entries 1-10), in comparison to that of the s-y pairing (Table
1, entries 11-20), and the efficiencies of the s-z pairing (Table
1, entries 1 and 6) were as high as those of the s-y pairing (Table
1, entries 11 and 16). The incorporation efficiency of dzTP
opposite s was 20- and 21-fold higher than those of dzTP
opposite A and G, respectively (Table 1, entries 1-3), and the
incorporation efficiency of dsTP opposite z was 36- and 276-
fold higher than those of dATP and dGTP, respectively, opposite
z (Table 1, entries 6-8). In contrast, the incorporation efficiency
of dyTP opposite s was only 1.2- and 7-fold higher than those
of dyTP opposite A and G, respectively (Table 1, entries 11-
13), and the incorporation efficiency of dsTP opposite y was
7- and 71-fold higher than those of dATP and dGTP, respec-
tively, opposite y (Table 1, entries 16-18). In addition, the
noncognate pairings of z with natural pyrimidines (Table 1,
entries 4, 5, 9, and 10) showed much lower efficiencies than
the s-z pairing (Table 1, entries 1 and 6). Unexpectedly, T was
efficiently incorporated opposite y (Vmax/Km ) 1.6 × 105, Table
1, entry 20), and the T incorporation opposite z (Vmax/Km ) 7.1
× 102) was rarely observed (Table 1, entry 10). Thus, the s-z
pair showed highly exclusive selectivity in the single-nucleotide
insertion by the DNA polymerase. Interestingly, the pairing
between dsTP and z in the template was favored over that
between dzTP and s in the template; the incorporation of dsTP
opposite z (Vmax/Km ) 5.8 × 105) was 10-fold more efficient
than the incorporation of dzTP opposite s (Vmax/Km ) 5.7 ×
104). This suggests that z has potential as a template base, rather
than a triphosphate substrate.
Since the s-z pair showed high selectivity in replication and
thermal selectivity in duplex DNA, we examined its pairing
selectivity in transcription. The incorporation of sTP into RNA
was carried out by T7 RNA polymerase, using DNA templates
(temp35z, temp35y, temp35C, and temp35T) in which z, y, C,
or T was located at a complementary site corresponding to
position 11 in the transcripts (Figure 2a). The internally labeled
transcripts were analyzed on a gel (Figure 2b), and then were
fully digested to nucleoside 3′-phosphates for a nucleotide-
composition analysis on a 2D-TLC plate (Figure 2c). Afterward,
the amount of each nucleoside 3′-phosphate was quantified
(Table 2). Since [R-32P]UTP was used for labeling in transcrip-
tion, the 3′-phosphates of the nucleotides that became the 5′-
neighbor of U in the transcripts were labeled. Thus, the digestion
of the transcripts by RNase T2 generated three labeled Cp’s,
one labeled Up, and a labeled nucleotide at position 11.
After 3 h of transcription, the relative yields of the 17-mer
transcripts (Figure 2b, lanes 3 and 6) were 40-60% relative to
those obtained from the natural templates (N ) T or C) with
the natural NTPs (data not shown), although truncated transcripts
(10-mer and 11-mer in Figure 2b) from temp35y and temp35z
Figure 2. Unnatural T7 transcription employing s-z pairing. Schemes of
the experiments (a). Gel electrophoresis of transcripts using the templates
(N ) y or z) in the presence or in the absence of the substrate of s (sTP)
(b). 2D-TLC for nucleotide-composition analyses of transcripts, isolated
by the gel electrophoresis shown in panel b (lanes 3 and 6), and the
transcripts from templates (N ) T or C) (c). The quantitative data are shown
in Table 2.
were observed. As shown in Figure 2b,c, the s incorporation
opposite z showed higher selectivity than that opposite y in T7
transcription. No 17-mer transcript was generated from temp35z
in the absence of sTP (Figure 2b, lane 4). However, in the s-y
pairing, even in the absence of sTP, the full-length transcript
(17-mer) was produced with temp35y (Figure 2b, lane 1).
The nucleotide-composition analysis of the 17-mer transcripts
confirmed the high selectivity of the s incorporation opposite z
in transcription (Figure 2c and Table 2). Among the purine
substrates, only a spot corresponding to s, which originated from
the incorporation opposite z, was observed in the transcription
using temp35z (Figure 2c, N ) z, and Table 2, entries 1 and
2), and no misincorporation of sTP opposite T or C occurred
in the transcription using temp35T and temp35C (Figure 2c, N
) T and C, and Table 2, entries 6, 7, 9, and 10). In contrast,
even in the presence of a 3-fold excess of sTP (3 mM) relative
to the natural NTPs (1 mM), a few misincorporations of GTP
and ATP opposite y were observed in the transcription using
temp35y (Figure 2c, N ) y, and Table 2, entry 4). The
specificity of the s incorporation opposite z was more than 96%
(21) Temiakov, D.; Patlan, V.; Anikin, M.; McAllister, W. T.; Yokoyama, S.;
Vassylyev, D. G. Cell 2004, 116, 381.
9
J. AM. CHEM. SOC. VOL. 126, NO. 41, 2004 13301

A R T I C L E S
Hirao et al.
Table 2. Nucleotide Composition Analysis of T7 Transcripts
composition of nucleotides incorporated as 5
′
neighbor of U or A or Ga
Up
[
R
-
32P]
NTP
sTP
entry
template
(mM)
Ap
Gp
Cp
sp
1
2
3
4
5
6
7
8
temp35z
temp35z
temp35y
temp35y
UTP
UTP
UTP
UTP
UTP
UTP
UTP
UTP
UTP
UTP
ATP
ATP
ATP
GTP
GTP
GTP
1
3
1
3
0
1
3
0
1
3
3
0
3
3
0
3
0.04b [0]c (<0.01)d
0.02 [0] (<0.01)
0.07 [0] (0.01)
0.04 [0] (<0.01)
1.00 [1] (<0.01)
1.00 [1] (0.02)
0.99 [1] (0.04)
0.01 [0] (<0.01)
0.01 [0] (<0.01)
<0.01 [0] (<0.01)
5.12 [5] (0.12)
6.13 [6] (0.08)
5.98 [6] (0.07)
5.12 [5] (0.04)
5.01 [5] (0.01)
5.10 [5] (0.05)
0.02 [0] (<0.01)
0.01 [0] (<0.01)
0.18 [0] (0.02)
0.09 [0] (<0.01)
<0.01 [0] (<0.01)
<0.01 [0] (<0.01)
<0.01 [0] (<0.01)
0.99 [1] (0.02)
1.00 [1] (0.04)
0.99 [1] (<0.01)
5.99 [6] (0.12)
5.90 [6] (0.08)
5.98 [6] (0.08)
6.79 [7] (0.06)
6.84 [7] (0.04)
6.95 [7] (0.06)
2.92 [3] (0.06)
2.96 [3] (0.08)
2.98 [3] (0.06)
2.98 [3] (0.03)
1.08 [1] (0.04)
1.05 [1] (0.06)
1.07 [1] (0.03)
1.06 [1] (0.01)
0.95 [1] (0.02)
0.96 [1] (0.02)
0.71 [1] (0.08)
0.82 [1] (0.01)
nde [0]
<0.01 [0] (<0.01)
<0.01 [0] (<0.01)
nd [0]
<0.01 [0] (<0.01)
<0.01 [0] (<0.01)
0.96 [1] (0.05)
nd [0]
0.09 [0] (0.05)
0.05 [0] (<0.01)
nd [0]
temp35T
temp35T
temp35T
temp35C
temp35C
temp35C
tRNA104z
tRNA104T
tRNA104T
tRNA104z
tRNA104T
tRNA104T
2.97 [3] (<0.01)
2.97 [3] (0.03)
2.98 [3] (0.04)
3.00 [3] (0.01)
2.98 [3] (0.04)
2.99 [3] (0.02)
5.88 [6] (0.07)
5.98 [6] (0.07)
5.96 [6] (0.09)
6.16 [6] (0.05)
6.10 [6] (0.05)
6.01 [6] (0.11)
1.03 [1] (<0.01)
1.02 [1] (0.02)
1.03 [1] (<0.01)
1.00 [1] (0.01)
1.02 [1] (<0.01)
1.02 [1] (0.02)
0.04 [0] (<0.01)
0.99 [1] (0.01)
0.99 [1] (0.02)
1.97 [2] (0.03)
2.16 [2] (0.01)
2.00 [2] (0.04)
9
10
11
12
13
14
15
16
0.05 [0] (0.04)
a Composition of nucleotides incorporated as 5′ neighbor of U (Entries 1-10) or A (Entries 11-13) or G (Entries 14-16), as shown in Figures 2 and 3.
b The values were determined using the following formula: (radioactivity of each nucleotide)/[total radioactivity of all nucleotides (3′-monophosphates)] ×
(total number of nucleotides at 5′ neighbor of [R-32P]NTP). c The theoretical number of each nucleotide is shown in brackets. d Standard deviations are
shown in parentheses. e Not detected.
combination of the tRNA and the tRNA synthetase variant with
highly orthogonal specificity is available for eukaryotic transla-
tion systems.22-25 The DNA templates (104-mer, tRNA104z and
tRNA104T) of the E. coli tRNATyr with a CUs or CUA
anticodon for T7 transcription were chemically synthesized,
using the amidite of z. As the complementary base opposite z
in the duplex DNA template of tRNA104z, A was introduced
into the nontemplate strand. In addition, the last two nucleosides
(G and T) at the 5′-termini of the template strand were replaced
with their 2′-O-methylribonucleosides, which can reduce the
addition of one or more nontemplated nucleotides at the 3′-
terminus of the nascent transcript.26 Transcription was performed
with 3 mM sTP, 1 mM natural NTPs, 10 mM GMP, and [R-32P]-
ATP or [R-32P]GTP, using 1 µM template, for 6 h at 37 °C
(Figure 3b). The transcription efficiency for the synthesis of
the tRNA with the CUs anticodon was as high as that for the
control synthesis of the tRNA with the CUA anticodon (data
not shown).
Internally labeled tRNA transcripts were isolated by gel
electrophoresis and digested to nucleoside 3′-phosphates by
RNase T2. The labeled nucleoside 3′-phosphates were analyzed
by 2D-TLC, as mentioned above (Figure 3c and Table 2). As
shown in Figure 3c and Table 2, these data confirmed the site-
specific incorporation of sTP into the anticodon of the tRNA
by T7 transcription mediated by the s-z pairing. The nucleotide-
composition analysis indicated that sTP was incorporated at
Figure 3. tRNA synthesis by T7 transcription mediated by the s-z pairing.
position 36 in the tRNA opposite z in the template, and the
misincorporation of sTP opposite the natural bases was negli-
gible. In the presence of sTP, only the [R-32P]ATP-labeled
transcript obtained from the template, tRNA104z, gave a spot
corresponding to the ribonucleoside 3′-phosphate of s (denoted
The secondary structure of E. coli suppressor tRNATyr, in which the base
at position 36 is s or A (a). Preparation of the tRNA containing s at position
36 by T7 transcription (b). 2D-TLC for nucleotide-composition analyses
of tRNA transcripts labeled with [R-32P]ATP or [R-32P]GTP (c). The
quantitative data are shown in Table 2.
in the transcription using the combination of 3 mM sTP and 1
mM natural NTPs (Table 2, entry 2).
(22) Kiga, D.; Sakamoto, K.; Kodama, K.; Kigawa, T.; Matsuda, T.; Yabuki,
T.; Shirouzu, M.; Harada, Y.; Nakayama, H.; Takio, K.; Hasegawa, Y.;
Endo, Y.; Hirao, I.; Yokoyama, S. Proc. Natl. Acad. Sci. U.S.A. 2002, 99,
9715.
We synthesized tRNA containing s in the anticodon by T7
transcription, using a DNA template containing z. The sequence
of E. coli suppressor tRNATyr was employed (Figure 3a). This
tRNA was specifically aminoacylated with an amino acid
analogue, 3-iodotyrosine, by an E. coli tyrosyl-tRNA synthetase
variant (V35C195), but was not aminoacylated with natural
amino acids by the eukaryotic tRNA synthetases.22 Thus, the
(23) Sakamoto, K.; Hayashi, A.; Sakamoto, A.; Kiga, D.; Nakayama, H.; Soma,
A.; Kobayashi, T.; Kitabatake, M.; Takio, K.; Saito, K.; Shirouzu, M.; Hirao,
I.; Yokoyama, S. Nucleic Acids Res. 2002, 30, 4692.
(24) Chin, J. W.; Cropp, T. A.; Anderson, J. C.; Mukherji, M.; Zhang, Z.;
Schultz, P. G. Science 2003, 301, 964.
(25) Ko¨hrer, C.; Yoo, J.-H.; Bennett, M.; Schaack, J.; RajBhandary, U. L. Chem.
Biol. 2003, 10, 1095.
(26) Kao, C.; Ru¨disser, S.; Zheng, M. Methods 2001, 23, 201.
9
13302 J. AM. CHEM. SOC. VOL. 126, NO. 41, 2004

A Two-Unnatural-Base-Pair System for Specific Transcription
A R T I C L E S
by sp) (Figure 3c). Since the incorporated s became the
5′-neighbor of A, the 3′-phosphate of s was labeled with only
[R-32P]ATP, and the sp spot was detected by 2D-TLC. Thus,
no spot corresponding to sp was observed on the 2D-TLC of
the [R-32P]GTP-labeled transcript from tRNA104z with sTP.
As a control, the transcripts from the template consisting of the
natural bases, tRNA104T, did not yield the sp spot on the 2D-
TLC, even in the presence of sTP. From the nucleotide-
composition analysis, the incorporation selectivity of s opposite
z was 96% (Table 2, entry 11). Although the values of the
misincorporations of sTP opposite the natural bases were 0.05-
0.09 (Table 2, entries 13, 14, and 16), these misincorporations
correspond to only 0.3-0.5% per position in the transcripts, as
determined by the following formula: [s composition]/[total
numbers of nucleotides as 5′ neighbors of A or G] × 100 (%).
In contrast to the high selectivity of the s incorporation
opposite z into RNA, the z incorporation opposite s was less
selective than the y incorporation opposite s by T7 RNA
polymerase; the incorporation fidelity of zTP opposite s was
only 50-70% (data not shown). This tendency also appeared
in the single-nucleotide insertion experiments with the Klenow
fragment, as mentioned above; the z incorporation efficiency
opposite s into DNA was 10-fold lower than the s incorporation
efficiency opposite z (Table 1, entries 1 and 6). This difference
in the incorporation efficiencies mainly depends on the complex
stabilities among the substrate, the template, and the polymerase;
the Km value of z incorporation opposite s (Km ) 600 µM) was
much larger than that of s incorporation opposite z (Km ) 95
µM). This suggests that the low hydrophobicity and low stacking
ability of z reduced the affinity between the z substrate and the
polymerases. This is quite consistent with the fact that unnatural
hydrophobic bases show good potential as substrates in single-
nucleotide insertion experiments with the Klenow fragment.8-11
Consequently, the z base can be unidirectionaly used as a
template base, instead of y, for s incorporation into RNA.
In addition to the practical use of the s-z pair, these studies
provide valuable information for understanding the mechanisms
of replication and transcription. The differences in the selectivity
between the s-z and s-y pairs in replication and transcription
highlight the importance of the steric interactions between
pairing bases. The bulky thienyl group of s efficiently excludes
the pairing with the natural pyrimidine bases in transcription,
but the pyrimidine-like base, y, tends to pair with the natural
purine bases, as well as s, because of their favorable shape
complementarity. In contrast, the five-membered ring of z does
not fit as well with the natural purines, unlike s, and the
specificity of the s incorporation into DNA and RNA opposite
z is higher than that opposite y. This relationship between the
steric interaction and the incorporation specificity has been found
in other unnatural base pairs. For example, a hydrophobic five-
membered ring, pyrrole-2-carbaldehyde (Pa), preferred another
hydrophobic base, 9-methylimidazo[(4,5)-b]pyridine (Q), rather
than the natural A or G, as a pairing partner in replication, but
a hydrophobic six-membered ring, 2,4-difluorotoluene (F),
preferred both Q and A.27 The incomplete shape complemen-
tarity between the five-membered-ring bases and the natural
purine bases is less favorable for removing the solvating waters
on the purine bases. Interestingly, the addition of an acetyl group
Figure 4. Two-unnatural-base-pair system mediated by the s-y and s-z
pairs for the site-specific incorporation of amino acid analogues into proteins
at desired positions. In the system, mRNA containing y and tRNA containing
s were obtained from DNA templates containing s and z, respectively. unAA
means an unnatural amino acid.
at position 4 of z improved the shape fitting between 4-acetyl-z
and A, and d(4-acetyl-z)TP was efficiently incorporated into
DNA opposite A by HIV reverse transcriptase.28 Similarly, the
bulky thienyl group at position 6 of s can also fill the space
between s and z. In contrast to the fitting between A and
4-acetyl-z or A and y, the noncognate pairs between the natural
purines and z or s and the natural pyrimidines exhibit poor shape
complementarity, resulting in the high specificity of the s-z
pairing in replication and especially in transcription.
In this study, we have achieved the site-specific incorporation
of sTP into RNA by T7 transcription mediated by the s-z pair.
The five-membered ring of the z base effectively excludes the
pairing with the natural purine bases. In combination with the
s-y pair, the s-z pair can be applied to a coupled transcription-
translation system,15 in which the extra codon-anticodon
interaction is created by the s-y pair; the transcription mediated
by the s-y pairing generates mRNAs containing y, and the
transcription mediated by the s-z pairing produces tRNAs
containing s (Figure 4). This two-unnatural-base-pair system
can be combined with the orthogonal tRNA-aminoacyl tRNA
synthetase for amino acid analogues,22-25 providing a convenient
and powerful method for the site-specific incorporation of amino
acid analogues into proteins at desired positions. Furthermore,
the nucleoside of s exhibited a fluorescence emission centered
at 430 nm, characterized by two major excitation maxima (299
and 352 nm), and its fluorescence quantum yield was 0.41 at
pH 7.0. Thus, the s-z pair will also enable the site-specific
fluorescent labeling of RNA fragments by T7 transcription.
Materials and Methods
General. Reagents and solvents were purchased from standard
suppliers and were used without further purification. Reactions were
monitored by thin-layer chromatography (TLC) using 0.25 mm silica
gel 60F254 plates (Merck). 1H NMR (270 MHz), 13C NMR (68 MHz),
and 31P NMR (109 MHz) spectra were recorded on a JEOL EX270
magnetic resonance spectrometer. Purification of nucleosides was
performed on a Gilson HPLC system with a preparative C18 column
(Waters Microbond Sphere, 150 × 19 mm). Triphosphates were purified
on a DEAE-Sephadex A-25 column (300 × 15 mm), and the final
purification was achieved by a Gilson HPLC system with an analytical
column (Synchropak RPP, 250 × 4.6 mm, Eichrom Technologies).
High-resolution mass spectra (HRMS) and electrospray ionization mass
spectra (ESI-MS) were recorded on a JEOL HX-110 or JM-700 mass
spectrometer and a Waters micromass ZMD 4000, equipped with a
Waters 2690 LC system, respectively.
(27) Mitsui, T.; Kitamura, A.; Kimoto, M.; To, T.; Sato, A.; Hirao, I.; Yokoyama,
S. J. Am. Chem. Soc. 2003, 125, 5298.
(28) Kalman, T. I.; Sen, K.; Jiang, X.-J. Nucleosides Nucleotides 1999, 18, 847.
9
J. AM. CHEM. SOC. VOL. 126, NO. 41, 2004 13303

A R T I C L E S
Hirao et al.
Synthesis of 1-(2-Deoxy-â-D-ribofuranosyl)imidazolin-2-one (2).
A mixture of imidazolin-2-one29 (505 mg, 6 mmol), hexamethyldisi-
lazane (HMDS) (20 mL, 20 mmol), ammonium sulfate (60 mg, 0.45
mmol), and dichloroethane (5 mL) was refluxed for 2 h, and then the
excess HMDS and dichloroethane were removed from the mixture by
evaporation. The residue was dissolved in acetonitrile (10 mL), and
the solution was mixed with an acetonitrile solution (10 mL) containing
1-chloro-2-deoxy-3,5-di-O-toluoyl-R-D-erythropentofuranose (1.56 g,
4 mmol). To the mixture was added a solution of SnCl4 (0.1 mL, 0.85
mmol) in acetonitrile (5 mL) dropwise at -15 °C, and the solution
was stirred for 1 h at room temperature. The reaction mixture was
poured onto a dichloromethane (100 mL) and saturated NaHCO3
solution (100 mL). The organic layer was washed with a saturated
sodium chloride solution (100 mL), dried with MgSO4, and evaporated
in vacuo. The product was purified by silica gel column chromatography
to give the fully protected mixture of R- and â-isomers (1.31 g, 75%).
The mixture was dissolved in methanolic ammonia (100 mL), stirred
for 12 h at room temperature, and evaporated. The residue was dissolved
in H2O, and each isomer (â-isomer, 155 mg; R-isomer, 193 mg) was
separated by reversed-phase HPLC (Waters Microbond Sphere model
C18, with a gradient from 0% to 7.5% (15 min) CH3CN in H2O).
1-(2-Deoxy-3,5-di-O-tetraisopropyldisiloxanyl-â-D-ribofuranosyl)-
imidazolin-2-one. To a stirred solution of 2 (73 mg, 0.36 mmol) in
DMF (1.8 mL) and pyridine (278 µL) in an ice-cold bath was added
1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane (111 µL, 0.36 mmol). The
reaction mixture was stirred at room temperature for 12 h and was
partitioned with 5% NaHCO3 and EtOAc. The organic layer was washed
with 5% NaHCO3 followed by saturated NaCl, dried over Na2SO4, and
concentrated in vacuo. The product (120 mg, 78%) was purified from
the residue by silica gel column chromatography (2% MeOH in CH2-
Cl2).
1-(2-Deoxy-3,5-di-O-tetraisopropyldisiloxanyl-â-D-ribofuranosyl)-
2-diphenylcarbamoyloxyimidazole. To a stirred solution of 1-(2-
deoxy-3,5-di-O-tetraisopropyldisiloxanyl-â-D-ribofuranosyl)imidazolin-
2-one (120 mg, 0.27 mmol) and diphenylcarbamoyl chloride (150 mg,
2.4 equiv) in pyridine (2.7 mL) was added N,N-diisopropylethylamine
(57 µL, 1.2 equiv). The solution was stirred at room temperature for
12 h and was partitioned with CH2Cl2 and water after the addition of
MeOH. The organic layer was washed with 5% NaHCO3 three times,
dried over Na2SO4, and concentrated in vacuo. The product (100 mg,
60%) was purified from the residue by silica gel column chromatog-
raphy (1% MeOH in CH2Cl2).
1-(2-Deoxy-â-D-ribofuranosyl)-2-diphenylcarbamoyloxyimida-
zole (3). To a stirred solution of 1-(2-deoxy-3,5-di-O-tetraisopropyl-
disiloxanyl-â-D-ribofuranosyl)-2-diphenylcarbamoyloxyimidazole (100
mg, 0.16 mmol) in THF (1.6 mL) was added 1 M TBAF in a THF
solution (0.24 mL, 1.5 equiv). The reaction mixture was stirred at room
temperature for 30 min and was partitioned with EtOAc and water.
The organic layer was washed with saturated NaCl, dried over Na2-
SO4, and concentrated in vacuo. The product (60 mg, 96%) was purified
by silica gel column chromatography (5% MeOH in CH2Cl2).
1-[2-Deoxy-5-O-(4,4′-dimethoxytrityl)-â-D-ribofuranosyl]-2-diphe-
nylcarbamoyloxyimidazole. A quantity of 1-(2-deoxy-â-D-ribofura-
nosyl)-2-diphenylcarbamoyloxyimidazole (60 mg, 0.15 mmol) was
coevaporated with dry pyridine three times. The residue was dissolved
in pyridine (1.5 mL) with 4,4′-dimethoxytrityl chloride (52 mg, 1.0
equiv), and the solution was stirred at room temperature for 12 h. Water
was added to the solution, and the product was extracted with EtOAc.
The organic layer was washed with 5% NaHCO3 twice and then with
saturated NaCl, dried over Na2SO4, and concentrated in vacuo. The
product was purified by silica gel column chromatography (2% MeOH
in CH2Cl2) to give the dimethoxytrityl derivative (92 mg, 86%).
1-[2-Deoxy-5-O-(4,4′-dimethoxytrityl)-â-D-ribofuranosyl]-2-diphe-
nylcarbamoyloxyimidazole 2-Cyanoethyl-N,N′-diisopropylamino-
phosphoramidite (4). A quantity of 1-[2-deoxy-5-O-(4,4′-dimethox-
ytrityl)-â-D-ribofuranosyl]-2-diphenylcarbamoyloxyimidazole (92 mg,
0.13 mmol) was coevaporated with dry pyridine and dry THF three
times each, and was dissolved in THF (650 µL). To the solution were
added diisopropylethylamine (34 µL, 1.5 equiv) and 2-cyanoethyl-N,N′-
diisopropylamino-chlorophosphoramidite (44 µL, 1.5 equiv). The
reaction mixture was stirred at room temperature for 1 h. After the
addition of MeOH (50 µL), the mixture was diluted with EtOAc/TEA
(10 mL, 20:1, v/v). The mixture was washed with 5% NaHCO3,
followed by saturated NaCl three times. The organic layer was dried
over Na2SO4 and concentrated in vacuo. The product was purified on
a silica gel column, which was eluted with hexane:EtOAc (3:2, v/v)
containing 2% TEA, to give the amidite (100 mg, 86%).
Synthesis of 1-(2-Deoxy-â-D-ribofuranosyl)imidazolin-2-one 5′-Tri-
phosphate (dzTP, 5) and 1-(â-D-Ribofuranosyl)imidazolin-2-one 5′-
Triphosphate (zTP). The ribonucleoside of z was synthesized accord-
ing to the literature procedure.17 To a solution of the 2′-deoxyribonu-
cleoside of z or the ribonucleoside of z (0.1 mmol) and a proton sponge
(33 mg, 0.15 mmol), in trimethyl phosphate (500 µL), was added POCl3
(12 µL, 0.13 mmol) at 0 °C.30 The reaction mixture was stirred at 0 °C
for 2 h (for the 2′-deoxyribonucleoside of z), or for 6 h (for the
ribonucleoside of z). Tri-n-butylamine (120 µL, 0.5 mmol) was added
to the reaction mixture, followed by 0.5 M bis(tributylammonium)-
pyrophosphate in a DMF solution (1.0 mL, 0.5 mmol). After 5 min,
the reaction was quenched by the addition of 0.5 M triethylammonium
bicarbonate (TEAB, 500 µL). The resulting crude product was purified
by DEAE Sephadex A-25 column chromatography (eluted by a linear
gradient of 50 mM to 1 M TEAB), and then by C18-HPLC (eluted by
a gradient of 0% to 30% CH3CN in 100 mM triethylammonium acetate).
Thermal Denaturation. The absorbance at 260 nm of the DNA
fragments was monitored as a function of temperature (15-65 °C) on
a Beckman DU650 spectrophotometer. The duplexes of 5′-GGTAAC-
NATGCG and 5′-CGCATN′GTTACC (N ) s or natural bases and N′
) z, y, or natural bases) were dissolved in 10 mM sodium phosphate
(pH 7.0), 100 mM NaCl, and 0.1 mM EDTA, to give a duplex
concentration of 5 µM. Tm values were calculated by the first derivatives
of the melting curves.
Single-Nucleotide Insertion Experiments. Steady-state kinetics for
single-nucleotide insertions were carried out according to the litera-
ture,31,32 using the templates shown in Table 1. Primers were 5′-labeled
by using [γ-32P]ATP and T4 polynucleotide kinase. Primer-template
duplexes (10 µM) were annealed, in a buffer containing 100 mM Tris-
HCl (pH 7.5), 20 mM MgCl2, 2 mM DTT, and 0.1 mg/mL bovine
serum albumin, by heating at 95 °C and slow-cooling to 4 °C. The
duplex solution (5 µL) was mixed with 2 µL of a solution containing
the exonuclease-deficient Klenow fragment (Amersham USB, OH)
diluted in a buffer containing 50 mM potassium phosphate (pH 7.0), 1
mM DTT, and 50% glycerol, and was incubated at 37 °C for more
than 2 min. Reactions were initiated by adding 3 µL of a dNTP solution
to the DNA-enzyme mixture at 37 °C. The amount of polymerase
used (5-50 nM), the reaction time (1-20 min), and the gradient
concentration of dNTP (0.6-2400 µM) were adjusted to give reaction
extents of 25% or less. Reactions were quenched by adding 10 µL of
a dye solution containing 0.05% BPB, 89 mM Tris-borate, 2 mM
EDTA, and 10 M urea, and the mixtures were immediately heated at
75 °C for 3 min. The products were analyzed on a 15-20%
polyacrylamide gel containing 7 M urea. The reaction extents were
measured with a Bio-imaging analyzer (Fuji BAS 2500). Relative
velocities (V0) were calculated as the extents of the reaction divided by
the reaction time, and were normalized to the enzyme concentration
(20 nM) for the various enzyme concentrations used. The kinetic
(30) Kova´cs, T.; O¨ tvo¨s, L. Tetrahedron Lett. 1988, 29, 4525-4528.
(31) Petruska, J.; Goodman, M. F.; Boosalis, M. S.; Sowers, L. C.; Cheong, C.;
Tinoco, I. Proc. Natl. Acad. Sci. U.S.A. 1988, 85, 6252.
(32) Goodman, M. F.; Creighton, S.; Bloom, L. B.; Petruska, J. Crit. ReV.
(29) Hilbert, G. E. J. Am. Chem. Soc. 1932, 54, 3413.
Biochem. Mol. Biol. 1993, 28, 83.
9
13304 J. AM. CHEM. SOC. VOL. 126, NO. 41, 2004

A Two-Unnatural-Base-Pair System for Specific Transcription
A R T I C L E S
parameters (Km and Vmax) were obtained from Hanes-Woolf plots of
[dNTP]/V0 against [dNTP]. Each parameter was averaged from 3-4
data sets.
and Gm ) 2′-O-methylguanosine], 10 µM) and the nontemplate strand
(5′-GATAATACGACTCACTATAGGTGGGGTTCCCGAGCGGC-
CAAAGGGAGCAGACTCTAAATCTGCCGTCATCGACTTCGAAG-
GTTCGAATCCTTCCCCCACCACCA, 10 µM) were annealed in 10
mM Tris-HCl buffer (pH 7.6) containing 10 mM NaCl, by heating at
90 °C for 3 min and cooling to 4 °C at a rate of 0.3 °C/sec. Transcription
was carried out in 40 mM Tris-HCl buffer (pH 8.0) (20 µL) with 24
mM MgCl2, 2 mM spermidine, 5 mM DTT, 0.01% Triton X-100, 10
mM GMP, 1 mM each NTP, 0 or 3 mM sTP, 2 µCi of [R-32P]ATP or
[R-32P]GTP, 1 µM template, and 50 units of T7 RNA polymerase. After
incubation for 6 h at 37 °C, the reaction was quenched by the addition
of 20 µL of the dye solution. This mixture was heated at 75 °C for 3
min, and then was loaded onto a 10% polyacrylamide-7 M urea gel.
The transcripts were eluted from the gel with water, and were
precipitated with ethanol. The transcripts were digested by 1.5 units of
RNase T2 in 10 µL of 15 mM sodium acetate buffer (pH 4.5), containing
0.05 A260 unit of E. coli tRNA, at 37 °C overnight. The digestion
products were analyzed by 2D-TLC, as mentioned above.
T7 Transcription. Templates (10 µM) were annealed in 10 mM
Tris-HCl buffer (pH 7.6) containing 10 mM NaCl, by heating at 95 °C
for 3 min and cooling to 4 °C. Transcription was carried out in 40 mM
Tris-HCl buffer (pH 8.0) (20 µL) containing 24 mM MgCl2, 2 mM
spermidine, 5 mM DTT, 0.01% Triton X-100, 10 mM GMP, 1 mM
each NTP, 0-3 mM sTP, 2 µCi [R-32P]UTP (Amersham), 2 µM
template, and 50 units of T7 RNA polymerase (Takara Shuzo, Kyoto,
Japan). The addition of GMP reduced the production of the full-length
+1 product yielded by the random incorporation of an uncoded extra
base, and facilitated the analysis.33 After incubation for 3 h at 37 °C,
the reaction was quenched by the addition of 20 µL of the dye solution.
This mixture was heated at 75 °C for 3 min, and then was loaded onto
a 20% polyacrylamide-7 M urea gel. The transcription products were
eluted from the gel with water, and were precipitated with ethanol.
The transcripts were digested by 0.75 unit of RNase T2 at 37 °C for 90
min, in 10 µL of 15 mM sodium acetate buffer (pH 4.5) and 0.05 A260
unit of Escherichia coli tRNA. The digestion products were analyzed
by 2D-TLC using a Merck HPTLC plate (100 × 100 mm) (Merck,
Darmstadt, Germany) with the following developing solvents: isobu-
tyric acid-ammonia-water (66:1:33 v/v/v) for the first dimension, and
isopropyl alcohol-HCl-water (70:15:15 v/v/v) for the second dimen-
sion. The products on the gels and the TLC plates were analyzed with
the Bio-imaging analyzer.
Acknowledgment. This work was supported by the RIKEN
Structural Genomics/Proteomics Initiative (RSGI), the National
Project on Protein Structural and Functional Analyses, Ministry
of Education, Culture, Sports, Science and Technology of Japan,
and by a Grant-in-Aid for Scientific Research (KAKENHI
15350097) from the Ministry of Education, Culture, Sports,
Science, and Technology.
For the tRNA synthesis, the template strand (5′-TmGmGTG-
GTGGGGGAAGGATTCGAACCTTCGAAGTCGATGACGGCAG-
ATTN [N ) z or T] AGAGTCTGCTCCCTTTGGCCGCTCGG-
GAACCCCACCTATAGTGAGTCGTATTATC [denoted by tRNA104z
(N ) z) and tRNA104T (N ) T), where Tm ) 2′-O-methylthymidine
Supporting Information Available: NMR and MS data for
2-5 and NMR charts for the characterization of the nucleoside
derivatives of z (2). This material is available free of charge
via the Internet at http://pubs.acs.org.
(33) Ohtsuki, T.; Kimoto, M.; Ishikawa, M.; Mitsui, T.; Hirao, I.; Yokoyama,
S. Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 4922.
JA047201D
9
J. AM. CHEM. SOC. VOL. 126, NO. 41, 2004 13305