Small Molecule Inhibition of MicroRNA miR-21 Rescues Chemosensitivity of Renal-Cell Carcinoma to Topotecan

Article abstract of DOI:10.1021/acs.jmedchem.7b01891

Chemical probes of microRNA (miRNA) function are potential tools for understanding miRNA biology that also provide new approaches for discovering therapeutics for miRNA-associated diseases. MicroRNA-21 (miR-21) is an oncogenic miRNA that is overexpressed in most cancers and has been strongly associated with driving chemoresistance in cancers such as renal cell carcinoma (RCC). Using a cell-based luciferase reporter assay to screen small molecules, we identified a novel inhibitor of miR-21 function. Following structure-activity relationship studies, an optimized lead compound demonstrated cytotoxicity in several cancer cell lines. In a chemoresistant-RCC cell line, inhibition of miR-21 via small molecule treatment rescued the expression of tumor-suppressor proteins and sensitized cells to topotecan-induced apoptosis. This resulted in a >10-fold improvement in topotecan activity in cell viability and clonogenic assays. Overall, this work reports a novel small molecule inhibitor for perturbing miR-21 function and demonstrates an approach to enhancing the potency of chemotherapeutics specifically for cancers derived from oncomir addiction.

Full text of DOI:10.1021/acs.jmedchem.7b01891

Article
pubs.acs.org/jmc
Cite This: J. Med. Chem. XXXX, XXX, XXX−XXX
Small Molecule Inhibition of MicroRNA miR-21 Rescues
Chemosensitivity of Renal-Cell Carcinoma to Topotecan
Yuta Naro, Nicholas Ankenbruck, Meryl Thomas, Yaniv Tivon, Colleen M. Connelly, Laura Gardner,
and Alexander Deiters*
Department of Chemistry, University of Pittsburgh, Pittsburgh, Pennsylvania 15260, United States
S
* Supporting Information
ABSTRACT: Chemical probes of microRNA (miRNA) function are
potential tools for understanding miRNA biology that also provide
new approaches for discovering therapeutics for miRNA-associated
diseases. MicroRNA-21 (miR-21) is an oncogenic miRNA that is
overexpressed in most cancers and has been strongly associated with
driving chemoresistance in cancers such as renal cell carcinoma
(RCC). Using a cell-based luciferase reporter assay to screen small
molecules, we identified a novel inhibitor of miR-21 function.
Following structure−activity relationship studies, an optimized lead
compound demonstrated cytotoxicity in several cancer cell lines. In a
chemoresistant-RCC cell line, inhibition of miR-21 via small
molecule treatment rescued the expression of tumor-suppressor
proteins and sensitized cells to topotecan-induced apoptosis. This
resulted in a >10-fold improvement in topotecan activity in cell
viability and clonogenic assays. Overall, this work reports a novel small molecule inhibitor for perturbing miR-21 function and
demonstrates an approach to enhancing the potency of chemotherapeutics specifically for cancers derived from oncomir
addiction.
dysfunction of this post-transcriptional gene-regulatory mech-
anism has been implicated in contributing to human disease,4
most notably cancer,5−8 highlighting the potential of miRNAs
as novel therapeutic targets9−13 and motivating the identi-
fication of chemical probes that perturb miRNA function.14−23
Arguably the most prominent of these oncogenic miRNAs is
miR-21,24 which is responsible for repressing several important
tumor-suppressor proteins and thereby contributing to chemo-
resistance in cancers,25,26 including renal cell carcinoma (RCC,
Figure 1A).27 Programmed cell death protein 4 (PDCD4) has
been identified as an important target of miR-21, and it has
been hypothesized that miR-21 overexpression promotes drug
resistance through inhibition of PDCD4 and the subsequent
increase in cellular inhibitor of apoptosis protein 2 (c-IAP2)
activity.28 The silencing of phosphatase and tensin homologue
(PTEN) as the result of high levels of cellular miR-21 has been
implicated in modulating chemoresistance in cancer cells via
activation of the Akt and ERK pathways.25 Furthermore, the
fact that miR-21 has a direct role in promoting cell
transformation, proliferation, and metastasis in RCC29 and
that its up-regulation correlates with lower survival rates30
supports miR-21 as an attractive therapeutic target. RCC
remains the ninth most common cancer, with incidence rates
of all stages of this cancer increasing over recent years.31
INTRODUCTION
■
MicroRNAs (miRNAs) belong to a family of short, noncoding
RNAs that have been predicted to play a regulatory role in
numerous protein-coding genes.1,2 Biogenesis of most miRNAs
proceeds via a dedicated maturation pathway, starting with
transcription of a primary miRNA transcript (pri-miRNA)
from the genome. This pri-miRNA is then cleaved into a 60−
70-nucleotide stem-loop precursor miRNA (pre-miRNA) by
the nuclear RNase III endonuclease Drosha and is sub-
sequently exported from the nucleus. Once in the cytoplasm,
the pre-miRNA is recognized and cleaved by an additional
endonuclease, Dicer, resulting in a ∼22-nucleotide miRNA
duplex comprising the mature miRNA guide strand and its
complementary passenger strand. The miRNA guide strand is
subsequently loaded into the RNA-induced silencing complex
(RISC), where it carries out its regulatory function on target
mRNAs. The miRNA-loaded RISC suppresses gene expression
by binding to complementary sequences in the 3′ untranslated
regions (3′-UTRs) and coding sequences (CDSs) of mRNAs,
inducing translational repression.
Using in silico predictions and transcriptome-wide profiling
methods, hundreds of miRNAs have been identified in
humans. A study using photoactivatable ribonucleoside-
enhanced cross-linking and immunoprecipitation (PAR-
CLIP) identified that miRNAs regulate upward of 21% of
mRNA transcripts.3 Because of the vast and diverse targets
miRNAs regulate within the proteome, it is not surprising that
Received: December 27, 2017
© XXXX American Chemical Society
A
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
the firefly luciferase gene, resulting in down-regulation of
luciferase expression in cells that express miR-21. Inhibition of
miR-21 function rescues luciferase expression and results in an
increased luminescence signal. The resultant reporter construct
was then stably introduced into HeLa cells in order to provide
an assay amenable to high-throughput screening (Figure 1B).
This assay, along with secondary confirmation assays, was used
in a high-throughput screen of 333,519 compounds (PubChem
AID 2289). As a result, 58 small molecules were confirmed as
potential inhibitors of miR-21. Of these 58 compounds, two
structurally similar small molecules, 1 and 2 (Figure 1C), were
selected for further investigation. These two hit compounds
were chosen because of their structural similarities and their
promising efficacy in the HeLa-miR21-Luc stable cell-line assay
relative to that of other hit compounds. Furthermore,
secondary confirmation screens also provided evidence that
these two compounds demonstrated selectivity for miR-21
(PubChem AID 2507) and were not firefly-luciferase inhibitors
(PubChem AID 493175).
Synthesis of hit compounds 1 and 2 and analogues 3−20
was accomplished via a convergent synthesis by coupling
azidobenzenes with cyanomethylene-functionalized oxadiazole
derivatives (Scheme 1). Azidobenzenes were obtained in good
Figure 1. (A) Inhibition of the expression of tumor-suppressor genes
PTEN and PDCD4 by increased miR-21 levels in cancer cells.
Treatment with a miR-21 inhibitor can rescue PTEN and PDCD4
expression and increase chemosensitivity. (B) Design of the high-
throughput luciferase-based live-cell reporter based on the endoge-
nous miR-21 mechanism. Binding of miR-21 to target site in the 3′-
UTR of a firefly-luciferase gene results in decreased expression of
luciferase. Treatment with a miR-21 inhibitor perturbs miR-21
function and results in increased luciferase expression. (C) Chemical
structures of primary hits 1 and 2 from the high-throughput screen
(HTS).
a
Scheme 1. Synthesis of Derivatives 1−22
a
Reagents and conditions: (a) NaNO2, H2SO4, NaN3, H2O; (b)
Although surgical approaches to RCC have been successful in
treating the disease, they require highly invasive procedures
and are only effective if the cancer has not become metastatic.
Patients with metastatic RCC must turn to systemic therapies;
however, very few targeted agents exist, and the lack of
response to therapies demands chronic treatment in most
patients, providing a 5 year survival rate of less than 20%.32,33
On-going efforts have been focused on the discovery of novel
chemotherapeutics or identification of combination drug
therapies that can alleviate chemoresistance and enhance the
responses to existing chemotherapeutics.
Here, we report the identification of a novel class of small
molecule miR-21 inhibitors using our previously reported high-
throughput live-cell assay.20 Through structure−activity
relationship (SAR) studies, we discovered an analogue with
significantly improved efficacy over the initial hit compounds.
We demonstrate that small molecule inhibition of miR-21 is
capable of inhibiting cell viability in several diverse cancer-cell
models. Furthermore, inhibition of miR-21 was capable of
rescuing the chemosensitivity of RCC cells to treatment with
topotecan. Mechanism-of-action studies confirm miR-21-
dependent activation of apoptosis, thereby providing support-
ing evidence that small molecule inhibition of miR-21 may
serve as an effective strategy for combating chemoresistance in
RCC.
hydroxylamine HCl, DIPEA, EtOH; (c) 1-cyanoacetyl-3,5 dimethyl-
1H-pyrazole, dioxane; (d) azide, sodium methoxide, methanol.
yield through the conversion of commercially available anilines
to their diazonium salts using sodium nitrite in concentrated
sulfuric acid, followed by treatment with sodium azide.
Synthesis of the cyanomethylene-functionalized thiophene-
oxadiazole was achieved by conversion of the carbonitrile to
the carboximidamide using hydroxylamine. Cyclization to form
the oxadiazole ring was accomplished by heating the solution
with 1-cyanoacetyl-3,5-dimethyl-1H-pyrazole. Finally, triazole-
ring formation was completed using sodium methoxide to
provide the final compounds (Table 1).
Activity of 1 and 2 was confirmed in the HeLa-miR21-Luc
cell-based assay. Compound 1 exhibited a 2.84-fold increase in
luminescence signal, indicative of a reduction in miR-21
suppression of firefly luciferase expression. Compound 2
exhibited a 1.89-fold increase in signal, slightly lower than
that obtained in the initial high-throughput screen (HTS)
results. To generate an activity profile for a better under-
standing of the essential structural motifs and to improve the
efficacy of compound 1,34 we first introduced modifications to
the benzene ring. Demethylation (3) and halogenation (4, 5,
and 6) at the meta position resulted in modest losses in
activity, whereas removal of the methoxy group altogether (7)
exhibited a complete loss in activity. Aliphatic (8 and 9) and
aromatic substitutions (10, 11, and 12) were not well tolerated
and resulted in significant losses in activity (>36%), whereas
introduction of a meta-dimethylamine (13) retained 90%
activity compared with that of 1. Movement of the meta-
RESULTS AND DISCUSSION
■
Previously, we reported the development of a high-throughput
luciferase-based live-cell reporter assay for the identification of
small molecule inhibitors of miR-21.20 In brief, a comple-
mentary miRNA binding site was placed into the 3′-UTR of
B
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
a
oxidation of the alcohol to a carboxylic acid using Jones
reagent. Finally, oxadiazole-ring formation was completed by
reaction with hydroxythiophene-2-carboximidamide and EDC
to generate the final products (Table 2).
Table 1. Structures and Activities of Derivatives 1−22
a
Table 2. Structures and Activities of 23−25
a
RLU values represent fold-changes in luminescence signal in the
HeLa-miR21-Luc stable cell line normalized to cell viability and
relative to a DMSO control. Data represent the means standard
deviations from at least three independent experiments.
Compound 23, lacking the amino group, displayed 77%
activity relative to that of 1. Removal of the methoxy group on
the benzene ring (24) or its replacement with a fluorine (25)
resulted in derivatives with similar activities to those of their
counterparts containing the amine. These results suggest that
the amine has only a modest effect on activity, and thus no
further modifications to the triazole ring were pursued.
To determine the importance of the 1,2,4-oxadiazole
configuration, several 1,3,4-oxadiazole derivatives were synthe-
sized (Scheme 3). To generate the cyano-functionalized
a
RLU values represent fold-changes in luminescence signal in the
HeLa-miR21-Luc stable cell line normalized to cell viability and
relative to a DMSO control. Data represent the means standard
deviations from at least three independent experiments.
a
Scheme 3. Synthesis of 26−28
methoxy group to the ortho position (14) or incorporation of a
meta-dimethoxy (15) elicited only modest losses in activity,
and replacement of the methoxy group with propargyloxy (16
and 17) or meta-benzylalcohol (18) also led to decreased
activity. Incorporation of ortho- and para-benzylalcohol (19
and 20) rescued some activity, whereas incorporation of a
meta-methylketone (21) resulted in similar activity relative to
that of 1. However, conversion of the methylketone to an
oxime (22) displayed a 60% improvement in activity relative to
that of 1. On the basis of these results, we hypothesized that
the functionalization of the meta position is most tolerated.
The importance of the amino substituent on the triazole was
investigated through the synthesis of several analogues lacking
the amino group (Scheme 2). Azidobenzenes were cyclized
with propargyl alcohol via a [3 + 2] cycloaddition, followed by
a
Reagents and conditions: (a) oxalyl chloride, catalytic DMF,
CH2Cl2; (b) thiophene-2-carbohydrazide, TEA, CH2Cl2; (c) POCl3
(d) azide, sodium methoxide, methanol.
thiophene-1,3,4-oxadiazole, cyanoacetic acid was converted to
the corresponding chloride via oxalyl chloride with a catalytic
amount of DMF. Reaction of the resulting acyl chloride with
thiophene-2-carbohydrazide, followed by cyclization using neat
phosphoryl chloride yielded the corresponding cyano-function-
alized thiophene-1,2,4-oxadiazole, which was subjected to the
same cyclization conditions as previously described to provide
the final 1,3,4-oxadiazole products (Table 3).
a
Scheme 2. Synthesis of 23−25
The 1,3,4-oxadiazole derivative (26) displayed similar
activity as that of its parent 1,2,4-oxadiazole, 1. Additional
analogues containing meta-fluoro (27) and meta-isopropyl
(28) substituents also displayed similar activities to those of
their 1,2,4,-oxadiazole counterparts; thus it was determined
that the exact configuration of the oxadiazole ring was not
critical for activity.
Lastly, modifications to the thiophene were explored (Table
4). To this end, the synthesis of the cyano-functionalized
oxadiazoles (Scheme 4) was adopted; however, alternative aryl
groups were introduced in place of the thiophene. Introduction
of a furan (29), benzene (30), and 2-pyridine (31) all resulted
a
Reagents and conditions: (a) propargyl alcohol, sodium ascorbate,
copper(II) sulfate pentahydrate, t-butanol/H2O; (b) Jones reagent,
acetone; (c) hydroxythiophene-2-carboximidamide, EDC, acetoni-
trile.
C
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
a
reduced activity, whereas introduction of a para-ethoxy (34)
rescued activity to 111% relative to that of 1. However, further
increased steric bulk as with a para-isopropoxy substituent
(35) abolished activity, whereas introduction of a para-allyloxy
group (36) retained activity. Lastly, oxidation of the allyl group
to a propargyl group (37) resulted in a significant improve-
ment in activity, yielding a 448% increase in activity relative to
that of 1. On the basis of these SAR results, it appears that
modification of the distal ring systems elicits the largest
changes in activity, whereas the core oxadiazole and triazole
rings have limited effect on the miR-21-inhibitory activity of
this scaffold.
Table 3. Structures and Activities of 26−28
a
RLU values represent fold-changes in luminescence signal in the
HeLa-miR21-Luc stable cell line normalized to cell viability and
relative to a DMSO control. Data represent the means standard
deviations from at least three independent experiments.
The significantly improved inhibitor, 37, was tested in a
dilution series in the HeLa-miR21-Luc assay, revealing an EC50
of 5.3 μM (Figure 2A). Recent concerns with the identification
a
Scheme 4. Synthesis of Derivatives 29−37
a
Reagents and conditions: (a) hydroxylamine HCl, DIPEA, ethanol;
Figure 2. (A) Dose−response assay of 37 using the HeLa-miR21-Luc
reporter cell line. This revealed an EC50 of 5.3 μM. (B) No decrease
detected after the treatment of HeLa cells with 37 for 48 h, followed
by qPCR analysis of mature miR-21 and primary miR-21 RNA levels.
(C) Transfection of HeLa cells with a miR-21-promoter gene-
expression reporter, followed by treatment with 37. This also showed
no decrease in activity, supporting a mode of action different than the
inhibition of miR-21 transcription. Data represent the means
standard deviations from at least three independent experiments.
Statistical significance was determined using an unpaired t test; ns
indicates P > 0.05.
(b) 1-cyanoacetyl-3,5 dimethyl-1H-pyrazole, dioxane; (c) sodium
methoxide, methanol.
a
Table 4. Structures and Activities of Derivatives 29−37
of firefly luciferase inhibitors and the appearance of false-
positive hits in firefly luciferase assays as the result of protein
stabilization in cells35 urged us to test the effect of 37 on
luciferase activity in a biochemical assay. Importantly, we did
not observe any inhibition of firefly luciferase activity at
concentrations up to 50 μM (Supporting Information, Figure
S1).
A previously described Huh7-psiCHECK-miR122 reporter
cell line that expressed Renilla luciferase under the control of
miR-122 activity19 was used to determine the selectivity of 37
for miR-21. Following treatment of the reporter cell line with
compound 37 at 10 μM for 48 h, no inhibition of miR-122 was
observed (Supporting Information, Figure S2). Additional
psiCHECK reporters monitoring miR-125b, miR-182, and
miR-221 were constructed, and their function and dynamic
range were confirmed using antagomir treatment as a positive
control. These miRNAs were selected because of their
established classification as oncomirs and their up-regulation
in several different types of cancers.36−39 Following trans-
fection of the psiCHECK plasmids, cells were treated with 37
at 10 μM for 48 h. None of the reporters showed statistically
significant inhibition of miRNA function under these
conditions because no increase in luminescence was observed
following treatments (Supporting Information, Figure S3).
Taken together, these results provide evidence that 37 shows
some level of selectivity for miR-21 and is not a general
miRNA pathway inhibitor.
a
RLU values represent fold-changes in luminescence signal in the
HeLa-miR21-Luc stable cell line normalized to cell viability and
relative to a DMSO control. Data represent the means standard
deviations from at least three independent experiments.
in slight decreases in activity. Because of the significant activity
improvement observed with the introduction of the meta-
oxime in analogue 22, several analogues were synthesized
containing additional benzene modifications in conjunction
with the previously described meta-oxime moiety. Introduction
of a para-phenol (32) or para-methoxy (33) group resulted in
The mechanism of action of 37 was investigated via
quantitative reverse-transcription PCR (qRT-PCR) of both
D
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
mature and primary miR-21 levels in HeLa cells following
treatment with DMSO or 37 (10 μM) for 48 h. We observed
that 37 has no effect on either mature or primary miR-21 levels
(Figure 2B). Compound 37 also elicited no reduction of
mature miR-21 levels in three other cancer cell lines
(Supporting Information, Figure S4). To further confirm that
compound 37 has no effect on miR-21 transcription, a
previously described luciferase reporter construct pGL4-
miR21P18 which monitors miR-21 promoter activity was
transfected into HeLa cells followed by treatment with DMSO
or 10 μM 37 for 48 h. As expected, no changes in reporter
gene expression were observed (Figure 2C). These results
indicate that 37 may act by inhibiting the function of mature
miR-21, without affecting primary or mature miR-21 levels in
cells. Small molecules that inhibit miRNA function through
direct binding to nucleic acids have been previously
reported,14,22,40 and thus we decided to explore whether 37
may interact directly with RNA and more specifically miR-21.
To this end, melting-curve analyses using precursor miR-21
RNA were carried out in the presence of DMSO, 37, and
tobramycin. Tobramycin was employed as a positive control as
it has been previously reported to bind and stabilize RNA,
leading to increased melting temperatures.41 As expected, in
the presence of 10 μM tobramycin, the melting temperature of
pre-miR-21 increased by 19 °C relative to that with DMSO.
However, in the presence of 10 μM 37, no change in melting
temperature was observed (Supporting Information, Figures
S5 and S6), suggesting that 37 does not directly interact with
RNA. Overall, this demonstrates that 37 does not effect the
maturation of miR-21, while also excluding the possibility of
destabilization or degradation of mature miR-21 being the
mechanism of action. Continuing work is focused on
investigating the potential of 37 to perturb functional aspects
of mature miR-21, such as RISC regulation, miR-21 subcellular
localization, and miR-21 interactions with RNA-binding
proteins. Regulation of RISC function relies on numerous
accessory proteins, some of which have been identified as
capable of modulating the miRNA activity of only select
miRNAs.42 For example, several TRIM-NHL E3 ubiquitin
ligases have been shown to selectively regulate miRNA activity
downstream of biogenesis leading to either enhancement or
repression of miRNA activity.43,44 The mechanism by which
regulation takes place is not completely understood, and it is
likely that additional proteins with the ability to modulate
RISC function are yet to be discovered. Alternatively, although
a majority of miR-21 exists in the cytoplasm, the primary
location of its activity, it has been shown that up to 20% of
mature miR-21 can exist in the nucleus.45,46 Therefore, it could
be possible that changes in the nucleo−cytoplasmic partition-
ing of miR-21 could elicit diminished translational repres-
sion.42 Lastly, it was recently shown that the RNA-binding
protein HuR is capable of sequestering miR-21 by binding to
the UUAU sequence within the seed region, in turn
diminishing miR-21 function.47 We are currently investigating
whether 37 could be eliciting an effect on the function or
expression of HuR and other RNA-binding proteins.
Consequently, elucidation of the mechanism of action of 37
may provide new insight into how miR-21 activity is regulated,
making 37 an encouraging chemical tool for the study of
miRNA function.
were subjected to cell viability studies using XTT assays.
Treatment of cancer cells with increasing concentrations of
compound 37 for 72 h exhibited low micromolar potency
(IC50) in nearly all the cell lines tested (Table 5).
Table 5. Pre-therapeutic Evaluation of miR-21 Inhibitors in
Various Cancer-Cell Models As Determined via XTT Cell
a
Viability Assays
cell type
cell line
IC50 (μM)
pancreatic carcinoma
glioblastoma
glioblastoma
renal cell carcinoma
breast carcinoma
colorectal carcinoma
MIA PaCa-2
A172
U-87
A498
MCF-7
HCT-116
6.7 1.0
4.6 1.2
3.3 1.5
>100
4.5 0.8
5.9 2.2
a
Data represent the means standard deviations from at least three
independent experiments. Full dose−response graphs are available in
the Supporting Information, Figure S7.
NIH 3T3 mouse fibroblasts were also treated with 37 in a
dilution series to demonstrate that this effect was not due to
potential general toxicity.48 As expected, 37 displayed no
toxicity to 3T3 cells at concentrations up to 100 μM
(Supporting Information, Figure S7). Interestingly, the RCC
cell line A498 also displayed very low sensitivity to 37, with an
IC50 of >100 μM in the XTT assays. This was not completely
unexpected because there have been reports of miR-21
inhibition via antagomir treatment in RCC leading to
modulation of chemoresistance rather than any significant
induction of apoptosis.49 Because silencing of miR-21 has been
previously shown to enhance chemosensitivity in a variety of
human cancer cells,26,50−52 including RCC,49 we hypothesized
that the inhibition of miR-21 via 37 at concentrations well
below its IC50 may not directly impact cell viability but may
sensitize A498 cells to treatment with established chemo-
therapeutics. To this end, we screened chemotherapeutic
agents that cover different modes of action in combination
with 37, including 5-fluorouracil (thymidylate synthase
inhibitor), docetaxel (microtubule stabilizer), and topotecan
(topoisomerase inhibitor). Although treatment with 5-
fluorouracil or docetaxel in combination with 37 showed little
to no enhancement in their activities, combination treatment
of 37 with topotecan revealed encouraging results. Topotecan,
an FDA-approved chemotherapeutic, has demonstrated
success in the treatment of ovarian cancer,53 cervical cancer,54
and small-cell lung carcinoma;55 however, it has been found
ineffective in the treatment of RCC,56 possibly because of
reduced topoisomerase I expression in RCC.57 Although
exposure of A498 cells to topotecan alone exhibited a
dissatisfactory IC50 of 1 μM, the combination of topotecan
with 37 produced a dose-dependent sensitization resulting in
an IC50 of 90 nM, a greater than 11-fold increase in potency
compared with that of the topotecan treatment alone (Figure
3A). NIH 3T3 cells were also treated with increasing
concentrations of topotecan in the presence of 37; however,
no sensitization was observed, supporting the specificity of the
37-induced chemosensitization of cancer cells (Supporting
Information, Figure S8). Additionally, we investigated the
effect that topotecan may have on miR-21 function using the
HeLa-miR21-Luc stable cell line. Following treatment of
HeLa-miR21-Luc cells with increasing concentrations of
We next investigated whether inhibition of miR-21 via 37
could elicit therapeutic effects in cancers that overexpress miR-
21. A panel of several different established cancer-cell models
E
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
as a result of combination treatment acts via a miR-21-
dependent pathway, immunoblot detections of the levels of
tumor-suppressor proteins PDCD4 and PTEN were carried
out. A498 cells were treated with DMSO or 37 (10 μM) for 48
h, which was followed by protein isolation and quantification.
As expected, 37 showed significant rescue of both PDCD4
(9.5-fold increase) and PTEN (1.5-fold increase) levels in
A498 cells (Figure 4B). These results propose a possible
mechanism behind the chemosensitization effect observed
following treatment with miR-21 inhibitor 37 and provide
additional evidence that although compound 37 does not affect
mature miR-21 levels or directly bind miR-21, it is capable of
rescuing the expression of tumor-suppressor proteins, resulting
in a pro-apoptotic response in A498 cells. This proposed
mechanism of chemosensitization is in good agreement with
published evidence that suppression of PDCD4 and PTEN by
miR-21 is capable of mediating chemoresistance in
RCC,49,58,59 as well as in other cancers.25,50,60,61 Taken
together, our results support a mechanism in which 37-
mediated inhibition of miR-21 rescues PDCD4 and PTEN
protein levels and improves chemosensitivity and therapeutic
response.
Figure 3. Pre-therapeutic evaluation of miR-21 inhibitors in A498
RCC cells. (A) Combination treatment of A498 cells with topotecan
(TT) and 37 in a dose−response cell viability assay. (B) Combination
treatment of A498 cells with topotecan (TT) and 37 in a two-week
clonogenic assay. Data represent the means
from at least three independent experiments.
standard deviations
topotecan for 48 h, we observed no significant changes in miR-
21 activity (Supporting Information, Figure S9).
The long-term cytostatic effects of co-treatment and the
ability to inhibit microtumor formation were evaluated using a
clonogenic assay. A498 cells were plated in an agar suspension
along with compound combinations and incubated for 2-weeks
at 37 °C prior to imaging (Supporting Information, Figure
S10). Treatment with 37 up to 10 μM elicited no inhibition of
colony formation, whereas topotecan alone exhibited an IC50
of 2 μM. Importantly, combination of 37 (10 μM) with
topotecan resulted in sensitization of A498 cells and an IC50 of
74 nM, representing a 27-fold enhancement in activity
compared with that of topotecan alone (Figure 3B). These
results indicate that the co-treatment of A498 cells is capable of
inhibiting microtumor formation in a long-term clonogenic
assay.
Next, the mechanism of cell death and potential mode of
action for the enhanced chemosensitivity were investigated.
We first examined caspase-3/7 activation as an indicator of
apoptosis in A498 cells. Treatment of A498 cells with 37 (10
μM) for 24 h elicited a modest 20% increase in caspase-3/7
activity, whereas treatment with 1 μM topotecan alone resulted
in a 3-fold increase in caspase-3/7 activity compared with that
of the DMSO-treated control. However, co-treatment with 37
(10 μM) and topotecan (1 μM) resulted in a 512% increase in
caspase activity, representing a 1.6-fold increase over that of
the topotecan treatment alone (Figure 4A). These results
support our hypothesis that the inhibition of miR-21 via small
molecule treatment can sensitize A498 cells to topotecan-
induced apoptosis. To confirm that the induction of apoptosis
CONCLUSIONS
■
In summary, oxadiazole inhibitors of miR-21 were identified
via a high-throughput screen, and subsequent structure−
activity relationship studies identified the small molecule 37 as
a potent inhibitor of miR-21 function. In contrast to earlier
discovered miR-21 inhibitors,20 preliminary mechanistic
studies suggest a mode of action independent of the regulation
of miR-21 expression levels. To evaluate therapeutic efficacy, a
panel of several cancer cell lines were treated with 37 and
demonstrated cancer-specific inhibition of cell viability at low
micromolar concentrations. Although the RCC cell line A498
appeared resistant to the effects of 37, further investigation
revealed that 37 was capable of sensitizing A498 cells to the
known chemotherapeutic topotecan by significantly increasing
the expression of the tumor suppressors PDCD4 and PTEN,
targets of miR-21-induced silencing. Therapeutic effects were
confirmed through studies of cell viability and clonogenicity, as
well as caspase activation. These results suggest that
restoration of tumor-suppressor function, although challenging
to achieve through existing small molecule therapeutics, could
play a crucial role in mitigating chemoresistance in RCC.
Overall, these discoveries support the development of small
molecule miR-21 inhibitors as potential agents to sensitize
cancer cells for chemotherapeutic treatment. Small molecule
inhibition of a particular miRNA may provide a new approach
to enhance the selectivity and precision of chemotherapy,
specifically for cancers derived from oncomir overexpression.
EXPERIMENTAL SECTION
■
General Synthesis Methods. All reagents were purchased from
commercial suppliers and used without further purification. Flash
chromatography was performed using an ISCO CombiFlash RF with
normal-phase silica-gel cartridges. NMR spectra were recorded on
Bruker spectrometers. Analytical LCMS data were collected on a
Shimadzu LCMS-2020 and a ThermoScientific Q-Exactive Orbitrap.
The purity of final compounds were determined to be ≥95% by
HPLC analysis on a Shimadzu LC-20AD monitored at 280 nm.
Cell Culture. Experiments performed using HeLa-miR-21-Luc,
HeLa (ATCC), NIH 3T3 (ATCC), A498 (ATCC), MIA PaCa-2
(ATCC), A172 (ATCC), and HCT-116 (ATCC) cell lines were
cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco). U-
Figure 4. Mechanism of therapeutic response to miR-21 inhibition.
(A) Significant increase in caspase-3/7 activity in A498 cells as a
result of combination treatment with topotecan (TT) and 37. (B)
Treatment of A498 cells with DMSO or 37 for 48 h, followed by
Western blot detection of PDCD4, PTEN, and GAPDH (loading
control). The blot exhibits rescued expression of anti-apoptotic
protein targets of miR-21 relative to that in a DMSO control. Data
represent the means
standard deviations from at least three
independent experiments. Statistical significance was determined
using an unpaired t test; **P < 0.001; ns indicates P > 0.05.
F
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
87 (ATCC) cells were cultured in Eagle’s minimum essential medium
(EMEM, Gibco), MCF-7 (ATCC) cells were cultured in EMEM
supplemented with insulin (0.01 mg/mL), and PC-3 (ATCC) cells
were cultured in F-12K medium (Sigma). All media was
supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich)
and 5% penicillin/streptomycin (VWR) and maintained at 37 °C in a
5% CO2 atmosphere. Huh7 psiCHECK-miR122 cells were cultured in
Dulbecco’s DMEM (Hyclone) supplemented with 10% FBS (VWR),
500 μg/mL G418 (Sigma-Aldrich), and 5% penicillin/streptomycin
(VWR) and maintained at 37 °C in a 5% CO2 atmosphere. All cell
lines are tested for mycoplasma contamination every three months.
Assay for Small Molecule Inhibitors of miR-21. Our
previously described HeLa-miR21-Luc cell line (a stably transfected
line harboring a miR-21 binding sequence in the 3′-UTR of a firefly-
luciferase gene) was used.20 Cells were seeded at a density of 1000
cells per well in white, clear-bottom, 384-well plates (Greiner). After
overnight incubation, cells were treated with the compound to the
desired concentration or with DMSO as the control (0.1% DMSO
final concentration) in triplicate. The cells were incubated for 48 h;
this was followed by analysis with a Bright Glo Luciferase Reporter
Assay Kit (Promega) and an XTT cell viability assay. The
luminescence was measured on a microplate reader (Tecan M1000)
with a measurement time of 1 s. For the XTT assay, the absorbance
was measured on a microplate reader (Tecan M200) at 450 nm. The
luminescence signal was normalized to cell viability, and the data were
set relative to the results from the DMSO control.
Quantitative RT-PCR Analysis. HeLa cells were seeded at a
density of 150,000 cells per well in six-well plates, grown overnight,
and treated with compounds (10 μM) or DMSO (1% final DMSO
concentration). The cells were then incubated at 37 °C for 48 h
(DMEM, 5% CO2). The media was removed, and the cells were
washed with PBS buffer (1 mL, pH 7.4); this was followed by RNA
isolation with the miRNeasy mini kit (Qiagen). The RNA was
quantified using a Nanodrop ND-1000 spectrophotometer, and 100
ng of each RNA sample was reverse-transcribed using the TaqMan
microRNA Reverse Transcription Kit (Life Technologies) in
conjunction with either the miR-21 or RNU19 (control) TaqMan
RT primer (16 °C, 30 min; 42 °C, 30 min; 85 °C, 5 min).
Quantitative real-time PCR was conducted with TaqMan 2×
Universal PCR Master Mix and the appropriate TaqMan miRNA
assay (Life Technologies) on a BioRad CFX96 RT-PCR thermocycler
(1.3 μL of RT-PCR product; 95 °C, 10 min; followed by 40 cycles of
95 °C, 15 s, and 60 °C, 60 s). The triplicate threshold cycles (CT)
obtained for each small molecule treatment were used to determine
the relative levels of miR-21 in the small molecule-treated cells relative
those in the DMSO controls using the 2−ΔΔCt method. The samples
were also analyzed by qRT-PCR to measure the expression levels of
pri-miR-21. After RNA isolation, 50 ng of each RNA sample was
reverse-transcribed using the iScript cDNA synthesis kit (BioRad; 25
°C, 5 min; 42 °C, 30 min; 85 °C, 5 min). Quantitative real-time PCR
was conducted with TaqMan 2× Universal PCR Master Mix and the
appropriate TaqMan primers for hsa-pri-miR-21 and GAPDH (Life
Technologies) on a BioRad CFX96 RT-PCR thermocycler (2 μL of
RT-PCR product; 95 °C, 10 min; followed by 40 cycles of 95 °C, 15
s, and 60 °C, 60 s). The triplicate threshold cycles (CT) obtained for
each small molecule treatment were used to determine the relative
levels of pri-miR-21 in the small molecule-treated cells relative to
those in the DMSO controls and normalized to the GAPDH
endogenous control using the 2−ΔΔCt method.
incubation, cells were treated with a compound (10 μM) or DMSO as
the control (0.1% DMSO final concentration) in triplicate. Following
48 h of incubation, the cells were transfected for 3 h with 100 ng of
pGL4-miR21P or pGL4.10 (empty construct) using Lipofectamine
2000 (Life Technologies) in OptiMEM (Life Technologies).
Following transfection, the media was replaced with DMEM
supplemented with the compounds (10 μM) or DMSO as the
control (0.1% DMSO final concentration) and incubated an
additional 24 h before the cells were assayed with a Bright-Glo
luciferase-reporter assay. The luminescence was measured on a
microplate reader (Tecan M1000) with a measurement time of 1 s.
Cell Viability Assays. A498, U-87, MCF-7, HCT-116, MIA-
PaCa-2, A172, or NIH 3T3 cells were seeded at 500 cells per well in
white, clear-bottom, 384-well plates (Greiner). Following an over-
night incubation, cells were treated with increasing concentrations of
the compounds or with the DMSO control (0.1% DMSO final
concentration) in triplicate. For combination treatment of the
compounds and chemotherapeutic agent, the cells were treated with
increasing concentrations of the chemotherapeutic agent while the
miR-21 inhibitor concentration remained constant. The cells were
incubated for 72 h; this was followed by analysis with an XTT assay
(Roche).62 Briefly, activated XTT reagent was added to each well.
Absorbance was measured at 450 and 630 nm (background) after
initial addition (tinitial) of the reagent. Then, the cells were incubated
at 37 °C in a 5% CO2 atmosphere for 4 h, which was followed by
measurement of the end-point absorbance (tfinal) on a Tecan M1000
plate reader. Following background subtraction of the absorbance
measurements at 630 nm, the difference in the tinitial and tfinal 450 nm
absorbance measurements was calculated. The difference in
absorbance for each well was normalized to that of the DMSO
control, then averaged, and multiplied by 100 to determine the
percent cell viability relative to that of the DMSO control. Error bars
represent the standard deviations of three independent measurements.
IC50 values were calculated by fitting the data with a variable-slope
sigmoidal dose−response curve using Graphpad (Prism) software.
Clonogenic Assays. The clonogenic assay was performed as
described previously.63 Briefly, a base layer consisting of 0.7% agarose
in DMEM growth medium was added to 12-well plates (Greiner) and
allowed to solidify. Cells were then seeded at a density of 10,000 cells
per well in 0.45% low-melt agarose in DMEM growth medium
supplemented with increasing concentrations of a compound or the
DMSO control (0.1% DMSO final concentration) in triplicate. After 2
weeks, cells were stained with 0.1% crystal violet. Images of each well
were captured using an MRm camera (Axiocam) and an N-Achroplan
5×/0.13 M27 objective on an Axio Observer Z1 microscope (Zeiss).
In order to capture images of the whole well, a z-stack of 17 slices
over 800 μm of the well was obtained. Each slice contained 114 tiles
which were stitched together immediately following image capture
using Zen 2012 software. Z-stacks were exported as TIF files and
focus stacking was used to convert the individual slices to generate an
extended-depth-of-field image using Helicon Focus software (Sup-
porting Information, Figure S10). Extended-depth-of-field images
were analyzed using ImageJ.64 Briefly, identical contrast settings were
applied to each image by adjusting the maximum and minimum pixel
values to match the histogram. The threshold for each image was then
set to 1.03%. Colonies were counted using the “Colony Counter”
plugin with a particle size of 500 to infinity. Total colonies per well
were averaged and normalized to that of the DMSO control. Error
bars represent the standard deviations of three independent
measurements. IC50 values were calculated by fitting the data with a
variable-slope sigmoidal dose−response curve using Graphpad
(Prism) software.
Effect of miR-21 Inhibitors on miR-21-Promoter Activity.
The miR-21 promoter region was PCR amplified (forward primer: 5′-
TAAGCAGGTACCTTTCTCTATCGATAGGTA, reverse primer:
5′-TGCTTAAAGCTTATAAAATATAAAAATCAG) from a reporter
construct containing the miR-21 promoter region, which was
graciously supplied by the Andersen lab (University of California,
Irvine). This insert was then cloned into the pGL4.10 backbone
(Promega Inc.) in front of the firefly luciferase gene using the KpnI
and HindIII restriction sites to generate the pGL4-miR21P
construct.18 HeLa cells were seeded at a density of 10,000 cells per
well in a white, clear-bottom, 96-well plate (Greiner). After overnight
Caspase-Glo 3/7 Assays. A498 cells were seeded into white,
clear-bottomed, 96-well plates (Greiner) at a density of 10,000 cells
per well. Following overnight incubation, the cells were treated with
either DMSO (0.1%), 400 nM topotecan, 10 μM 37, or a
combination of 400 nM topotecan and 10 μM 37 for 24 h. Following
incubation, caspase-3/7 activity was measured using the Caspase-Glo
3/7 assay (Promega) according to the manufacturer’s protocol.
Luminescence was read on a Tecan M1000 plate reader. Data was
G
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
normalized to the results of the DMSO control and represent the
Society. Y.N. was supported, in part, by an Andrew Mellon
Predoctoral Fellowship.
means
standard deviations from at least three independent
experiments. Statistical significance was calculated in GraphPad
Prism and determined using an unpaired t test, ***P < 0.001.
PTEN and PDCD4 Western Blot. A498 cells were seeded into a
six-well plate at a density of 250,000 cells per well. Following
overnight incubation, cells were treated with either DMSO (0.1%) or
10 μM 37 for 48 h. Cell lysis and protein extraction were carried out
using RIPA lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 0.5%
sodium deoxycholate, 1% Triton X-100) supplemented with Halt
Protease Inhibitor Cocktail (ThermoFisher). Whole cell lysates were
boiled in Laemmli sample buffer and separated on a 10% SDS-PAGE
gel. Following separation, proteins were transferred to a PVDF
membrane (GE Healthcare), and the membrane was blocked in TBS
with 0.1% Tween 20 containing 5% BSA for 1 h at room temperature.
The blots were probed with the primary antibodies rabbit mAb anti-
PTEN (Cell Signaling), rabbit pAb anti-PDCD4 (Rockland), and
rabbit mAb anti-GAPDH (Cell Signaling) in blocking buffer at 4 °C
overnight, followed by secondary antibody detection using an anti-
rabbit-IgG HRP-linked antibody (Cell Signaling) in TBS with 0.1%
Tween 20 for 1 h at room temperature. Chemiluminescence was
developed using SuperSignal West Pico Chemiluminescent Substrate
(ThermoFisher) and imaged on a ChemiDock imaging system
(BioRad). Densitometry analysis was carried out using Image Lab
software (BioRad), where PTEN and PDCD4 protein bands were
normalized to the levels of GAPDH, followed by normalization to the
levels of the DMSO control.
ABBREVIATIONS USED
■
miRNA, microRNA; miR-21, microRNA-21; RISC, RNA-
induced silencing complex; pri-miRNA, primary microRNA;
pre-miRNA, precursor microRNA; 3′-UTR, 3′ untranslated
region; CDS, coding DNA sequence; PAR-CLIP, photo-
activatable-ribonucleoside-enhanced cross-linking and immu-
noprecipitation; PDCD4, programmed-cell-death protein 4;
PTEN, phosphatase and tensin homologue; cIAP2, baculoviral
IAP-repeat-containing protein 3; DIPEA, N,N-diisopropyle-
thylamine; EtOH, ethanol; EDC, N-(3-(dimethylamino)-
propyl)-N′-ethylcarbodiimide hydrochloride; TEA, triethyl-
amine; qRT-PCR, quantitative reverse-transcription polymer-
ase chain reaction
REFERENCES
■
(1) Friedman, R. C.; Farh, K. K.-H.; Burge, C. B.; Bartel, D. P. Most
mammalian mRNAs are conserved targets of microRNAs. Genome
Res. 2009, 19 (1), 92−105.
(2) Hammond, S. M. An overview of microRNAs. Adv. Drug Delivery
Rev. 2015, 87, 3−14.
(3) Hafner, M.; Landthaler, M.; Burger, L.; Khorshid, M.; Hausser,
J.; Berninger, P.; Rothballer, A.; Ascano, M., Jr.; Jungkamp, A.-C.;
Munschauer, M.; Ulrich, A.; Wardle, G. S.; Dewell, S.; Zavolan, M.;
Tuschl, T. Transcriptome-wide identification of RNA-binding protein
and microRNA target sites by PAR-CLIP. Cell 2010, 141 (1), 129−
141.
(4) Tatsuguchi, M.; Seok, H. Y.; Callis, T. E.; Thomson, J. M.; Chen,
J.-F.; Newman, M.; Rojas, M.; Hammond, S. M.; Wang, D.-Z.
Expression of microRNAs is dynamically regulated during cardio-
myocyte hypertrophy. J. Mol. Cell. Cardiol. 2007, 42 (6), 1137−1141.
(5) Peng, Y.; Croce, C. M. The role of microRNAs in human cancer.
Signal. Transduct. Target. Ther 2016, 1, 15004.
ASSOCIATED CONTENT
* Supporting Information
■
S
The Supporting Information is available free of charge on the
ACS Publications website at DOI: 10.1021/acs.jmed-
chem.7b01891.
Compounds 1−37 as molecular-formula strings (CSV)
Additional biological protocols and supplementary
figures and tables (in vitro firefly luciferase activity
assay; Huh7-psiCHECK-miR122 assay; sense and
antisense DNA sequences for psiCHECK-based reporter
plasmid inserts; psiCHECK miRNA assays; treatment of
A498 (RCC), SKOV3 (ovarian carcinoma), or A549
(NSCLC) with 37; melting curves for pre-miR-21 in the
absence and presence of tobramycin; melting curves for
pre-miR-21 in the absence and presence of 37;
treatment of different cell lines with 37 at varying
concentrations; treatment of mouse fibroblast NIH 3T3
cells with varying concentrations of topotecan with and
without the addition of 37; treatment of HeLa-miR21-
Luc cells with varying concentrations of topotecan; and
representative images from clonogenic assays) and
synthetic procedures and analytical data for compounds
1−37. (PDF)
(6) Jin, D.; Lee, H. Prioritizing cancer-related microRNAs by
integrating microRNA and mRNA datasets. Sci. Rep. 2016, 6, 35350.
(7) Jafri, M. A.; Al-Qahtani, M. H.; Shay, J. W. Role of miRNAs in
human cancer metastasis: Implications for therapeutic intervention.
Semin. Cancer Biol. 2017, 44, 117−131.
(8) Hammond, S. M. MicroRNAs as oncogenes. Curr. Opin. Genet.
Dev. 2006, 16 (1), 4−9.
(9) Xia, T.; Li, J.; Cheng, H.; Zhang, C.; Zhang, Y. Small-molecule
regulators of microRNAs in biomedicine. Drug Dev. Res. 2015, 76 (7),
375−381.
(10) Li, J.; Tan, S.; Kooger, R.; Zhang, C.; Zhang, Y. MicroRNAs as
novel biological targets for detection and regulation. Chem. Soc. Rev.
2014, 43 (2), 506−517.
(11) Li, J.; Zhang, W.; Zhou, M.; Kooger, R.; Zhang, Y. Small
molecules modulating biogenesis or processing of microRNAs with
therapeutic potentials. Curr. Med. Chem. 2013, 20 (29), 3604−3612.
(12) Costales, M. G.; Haga, C. L.; Velagapudi, S. P.; Childs-Disney,
J. L.; Phinney, D. G.; Disney, M. D. Small molecule inhibition of
microRNA-210 reprograms an oncogenic hypoxic circuit. J. Am.
Chem. Soc. 2017, 139 (9), 3446−3455.
AUTHOR INFORMATION
Corresponding Author
*E-mail: deiters@pitt.edu.
■
(13) Arenz, C. MicroRNAsfuture drug targets? Angew. Chem., Int.
Ed. 2006, 45 (31), 5048−5050.
ORCID
(14) Connelly, C. M.; Boer, R. E.; Moon, M. H.; Gareiss, P.;
Schneekloth, J. S. Discovery of inhibitors of microRNA-21 processing
using small molecule microarrays. ACS Chem. Biol. 2017, 12 (2),
435−443.
Alexander Deiters: 0000-0003-0234-9209
Notes
The authors declare no competing financial interest.
(15) Neubacher, S.; Dojahn, C. M.; Arenz, C. A Rapid Assay for
miRNA Maturation by Using Unmodified pre-miRNA. ChemBioChem
2011, 12 (15), 2302−2305.
(16) Davies, B. P.; Arenz, C. A fluorescence probe for assaying micro
RNA maturation. Bioorg. Med. Chem. 2008, 16 (1), 49−55.
ACKNOWLEDGMENTS
A.D. acknowledges support by a Research Scholar Grant
(120130-RSG-11-066-01-RMC) from the American Cancer
■
H
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
(17) Davies, B. P.; Arenz, C. A homogenous assay for microRNA
maturation. Angew. Chem., Int. Ed. 2006, 45 (33), 5550−5552.
(18) Naro, Y.; Thomas, M.; Stephens, M. D.; Connelly, C. M.;
Deiters, A. Aryl amide small-molecule inhibitors of microRNA miR-21
function. Bioorg. Med. Chem. Lett. 2015, 25 (21), 4793−4796.
(19) Young, D. D.; Connelly, C. M.; Grohmann, C.; Deiters, A.
Small molecule modifiers of microRNA miR-122 function for the
treatment of hepatitis C virus infection and hepatocellular carcinoma.
J. Am. Chem. Soc. 2010, 132 (23), 7976−7981.
(38) Tang, T.; Wong, H. K.; Gu, W.; Yu, M.-y.; To, K.-F.; Wang, C.
C.; Wong, Y. F.; Cheung, T. H.; Chung, T. K. H.; Choy, K. W.
MicroRNA-182 plays an onco-miRNA role in cervical cancer. Gynecol.
Oncol. 2013, 129 (1), 199−208.
(39) Mercatelli, N.; Coppola, V.; Bonci, D.; Miele, F.; Costantini, A.;
Guadagnoli, M.; Bonanno, E.; Muto, G.; Frajese, G. V.; De Maria, R.;
et al. The inhibition of the highly expressed miR-221 and miR-222
impairs the growth of prostate carcinoma xenografts in mice. PLoS
One 2008, 3 (12), e4029.
(20) Gumireddy, K.; Young, D. D.; Xiong, X.; Hogenesch, J. B.;
Huang, Q.; Deiters, A. Small-molecule inhibitors of microRNA miR-
21 function. Angew. Chem., Int. Ed. 2008, 47 (39), 7482−7484.
(21) Childs-Disney, J. L.; Disney, M. D. Small molecule targeting of
a microRNA associated with hepatocellular carcinoma. ACS Chem.
Biol. 2016, 11 (2), 375−380.
(40) Maiti, M.; Nauwelaerts, K.; Herdewijn, P. Pre-microRNA
binding aminoglycosides and antitumor drugs as inhibitors of Dicer
catalyzed microRNA processing. Bioorg. Med. Chem. Lett. 2012, 22
(4), 1709−1711.
(41) Jin, E.; Katritch, V.; Olson, W. K.; Kharatisvili, M.; Abagyan, R.;
Pilch, D. S. Aminoglycoside binding in the major groove of duplex
RNA: the thermodynamic and electrostatic forces that govern
recognition1. J. Mol. Biol. 2000, 298 (1), 95−110.
(42) Krol, J.; Loedige, I.; Filipowicz, W. The widespread regulation
of microRNA biogenesis, function and decay. Nat. Rev. Genet. 2010,
11, 597.
(22) Velagapudi, S. P.; Gallo, S. M.; Disney, M. D. Sequence-based
design of bioactive small molecules that target precursor microRNAs.
Nat. Chem. Biol. 2014, 10 (4), 291−297.
(23) Velagapudi, S. P.; Disney, M. D. Two-dimensional
combinatorial screening enables the bottom-up design of a micro-
RNA-10b inhibitor. Chem. Commun. 2014, 50 (23), 3027−3029.
(24) Medina, P. P.; Nolde, M.; Slack, F. J. OncomiR addiction in an
in vivo model of microRNA-21-induced pre-B-cell lymphoma. Nature
2010, 467, 86.
(43) Loedige, I.; Filipowicz, W. TRIM-NHL proteins take on
miRNA regulation. Cell 2009, 136 (5), 818−820.
(44) Wulczyn, F. G.; Cuevas, E.; Franzoni, E.; Rybak, A. miRNAs
need a trim. In Regulation of microRNAs; Grobhans, H., Ed.; Springer:
New York, NY, 2010; pp 85−105.
(25) Shen, H.; Zhu, F.; Liu, J.; Xu, T.; Pei, D.; Wang, R.; Qian, Y.;
Li, Q.; Wang, L.; Shi, Z.; Zheng, J.; Chen, Q.; Jiang, B.; Shu, Y.
Alteration in miR-21/PTEN expression modulates gefitinib resistance
in non-small cell lung cancer. PLoS One 2014, 9 (7), e103305.
(26) Li, Y.; Zhu, X.; Gu, J.; Hu, H.; Dong, D.; Yao, J.; Lin, C.; Fei, J.
Anti-miR-21 oligonucleotide enhances chemosensitivity of leukemic
HL60 cells to arabinosylcytosine by inducing apoptosis. Hematology
2010, 15 (4), 215−221.
(45) Bai, B.; Liu, H.; Laiho, M. Small RNA expression and deep
sequencing analyses of the nucleolus reveal the presence of nucleolus-
associated microRNAs. FEBS Open Bio 2014, 4, 441−449.
(46) Leung, A. K. L. The whereabouts of miRNA actions: cytoplasm
and beyond. Trends Cell Biol. 2015, 25 (10), 601−610.
(47) Poria, D. K.; Guha, A.; Nandi, I.; Ray, P. S. RNA-binding
protein HuR sequesters microRNA-21 to prevent translation
repression of proinflammatory tumor suppressor gene programmed
cell death 4. Oncogene 2016, 35 (13), 1703−1715.
(27) Zhang, A.; Liu, Y.; Shen, Y.; Xu, Y.; Li, X. MiR-21 modulates
cell apoptosis by targeting multiple genes in renal cell carcinoma.
Urology 2011, 78 (2), 474.e13−474.e19.
(48) Xia, M.; Huang, R.; Witt, K. L.; Southall, N.; Fostel, J.; Cho,
M.-H.; Jadhav, A.; Smith, C. S.; Inglese, J.; Portier, C. J.; Tice, R. R.;
Austin, C. P. Compound cytotoxicity profiling using quantitative high-
throughput screening. Environ. Health Perspect. 2008, 116 (3), 284−
291.
(28) Chan, J. K.; Blansit, K.; Kiet, T.; Sherman, A.; Wong, G.; Earle,
C.; Bourguignon, L. Y. W. The inhibition of miR-21 promotes
apoptosis and chemosensitivity in ovarian cancer. Gynecol. Oncol.
2014, 132 (3), 739−744.
(29) Li, X.; Xin, S.; He, Z.; Che, X.; Wang, J.; Xiao, X.; Chen, J.;
Song, X. MicroRNA-21 (miR-21) post-transcriptionally down-
regulates tumor suppressor PDCD4 and promotes cell transformation,
proliferation, and metastasis in renal cell carcinoma. Cell. Physiol.
Biochem. 2014, 33 (6), 1631−1642.
(30) Zaman, M. S.; Shahryari, V.; Deng, G.; Thamminana, S.; Saini,
S.; Majid, S.; Chang, I.; Hirata, H.; Ueno, K.; Yamamura, S.; et al. Up-
regulation of microRNA-21 correlates with lower kidney cancer
survival. PLoS One 2012, 7 (2), e31060.
(31) Jonasch, E.; Gao, J.; Rathmell, W. K. Renal cell carcinoma. BMJ
2014, 349, g4797.
(32) Rini, B. I.; Campbell, S. C.; Escudier, B. Renal cell carcinoma.
Lancet 2009, 373 (9669), 1119−1132.
(33) Pantuck, A. J.; Zisman, A.; Belldegrun, A. S. The changing
natural history of renal cell carcinoma. J. Urol. 2001, 166 (5), 1611−
1623.
(34) Guha, R. On exploring structure activity relationships. Methods
Mol. Biol. 2013, 993, 81−94.
(35) Thorne, N.; Inglese, J.; Auld, D. S. Illuminating insights into
firefly luciferase and other bioluminescent reporters used in chemical
biology. Chem. Biol. 2010, 17 (6), 646−657.
́
(49) Gaudelot, K.; Gibier, J.-B.; Pottier, N.; Hemon, B.; Van
Seuningen, I.; Glowacki, F.; Leroy, X.; Cauffiez, C.; Gnemmi, V.;
Aubert, S.; Perrais, M. Targeting miR-21 decreases expression of
multi-drug resistant genes and promotes chemosensitivity of renal
carcinoma. Tumor Biol. 2017, 39 (7), 1010428317707372.
(50) Ren, Y.; Zhou, X.; Mei, M.; Yuan, X.-B.; Han, L.; Wang, G.-X.;
Jia, Z.-F.; Xu, P.; Pu, P.-Y.; Kang, C.-S. MicroRNA-21 inhibitor
sensitizes human glioblastoma cells U251 (PTEN-mutant) and
LN229 (PTEN-wild type) to taxol. BMC Cancer 2010, 10 (1), 27.
(51) Zhang, S.; Wan, Y.; Pan, T.; Gu, X.; Qian, C.; Sun, G.; Sun, L.;
Xiang, Y.; Wang, Z.; Shi, L. MicroRNA-21 inhibitor sensitizes human
glioblastoma U251 stem cells to chemotherapeutic drug Temozolo-
mide. J. Mol. Neurosci. 2012, 47 (2), 346−356.
(52) Park, J.-K.; Lee, E. J.; Esau, C.; Schmittgen, T. D. Antisense
inhibition of microRNA-21 or-221 arrests cell cycle, induces
apoptosis, and sensitizes the effects of gemcitabine in pancreatic
adenocarcinoma. Pancreas 2009, 38 (7), e190−e199.
(53) ten Bokkel Huinink, W.; Lane, S. R.; Ross, G. A. Long-term
survival in a phase III, randomised study of topotecan versus paclitaxel
in advanced epithelial ovarian carcinoma. Ann. Oncol. 2004, 15 (1),
100−103.
(54) Brave, M.; Dagher, R.; Farrell, A.; Abraham, S.; Ramchandani,
R.; Gobburu, J.; Booth, B.; Jiang, X.; Sridhara, R.; Justice, R.
Topotecan in combination with cisplatin for the treatment of stage
IVB, recurrent, or persistent cervical cancer. Oncology 2006, 20 (11),
1401−4.
(55) Ardizzoni, A. Topotecan in the Treatment of Recurrent Small
Cell Lung Cancer: An Update. Oncologist 2004, 9 (suppl 6), 4−13.
(36) Lee, Y. S.; Kim, H. K.; Chung, S.; Kim, K.-S.; Dutta, A.
Depletion of human micro-RNA miR-125b reveals that it is critical for
the proliferation of differentiated cells but not for the down-regulation
of putative targets during differentiation. J. Biol. Chem. 2005, 280
(17), 16635−16641.
(37) Amir, S.; Ma, A.-H.; Shi, X.-B.; Xue, L.; Kung, H.-J.; deVere
White, R. W. Oncomir miR-125b suppresses p14ARF to modulate
p53-dependent and p53-independent apoptosis in prostate cancer.
PLoS One 2013, 8 (4), e61064.
I
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX

Journal of Medicinal Chemistry
Article
(56) Law, T. M.; Ilson, D. H.; Motzer, R. J. Phase II trial of
topotecan in patients with advanced renal cell carcinoma. Invest. New
Drugs 1994, 12 (2), 143−145.
(57) Gupta, D.; Bronstein, I. B.; Holden, J. A. Expression of DNA
topoisomerase I in neoplasms of the kidney: Correlation with
histological grade, proliferation, and patient survival. Hum. Pathol.
2000, 31 (2), 214−219.
(58) Chen, J. U. N.; Zhu, H. E.; Zhang, Y. A. N.; Cui, M.-H.; Han,
L.-Y.; Jia, Z.-H.; Wang, L.; Teng, H.; Miao, L.-N. Low expression of
phosphatase and tensin homolog in clear-cell renal cell carcinoma
contributes to chemoresistance through activating the Akt/HDM2
signaling pathway. Mol. Med. Rep. 2015, 12 (2), 2622−2628.
(59) Yuan, H.; Xin, S.; Huang, Y.; Bao, Y.; Jiang, H.; Zhou, L.; Ren,
X.; Li, L.; Wang, Q.; Zhang, J. Downregulation of PDCD4 by miR-21
suppresses tumor transformation and proliferation in a nude mouse
renal cancer model. Oncol. Lett. 2017, 14 (3), 3371−3378.
(60) Ren, W.; Wang, X.; Gao, L.; Li, S.; Yan, X.; Zhang, J.; Huang,
C.; Zhang, Y.; Zhi, K. miR-21 modulates chemosensitivity of tongue
squamous cell carcinoma cells to cisplatin by targeting PDCD4. Mol.
Cell. Biochem. 2014, 390 (1), 253−262.
(61) Shi, G.-h.; Ye, D.-w.; Yao, X.-d.; Zhang, S.-l.; Dai, B.; Zhang, H.-
l.; Shen, Y.-j.; Zhu, Y.; Zhu, Y.-p.; Xiao, W.-j.; Ma, C.-g. Involvement
of microRNA-21 in mediating chemo-resistance to docetaxel in
androgen-independent prostate cancer PC3 cells. Acta Pharmacol. Sin.
2010, 31, 867.
(62) Scudiero, D. A.; Shoemaker, R. H.; Paull, K. D.; Monks, A.;
Tierney, S.; Nofziger, T. H.; Currens, M. J.; Seniff, D.; Boyd, M. R.
Evaluation of a soluble tetrazolium/formazan assay for cell growth
and drug sensitivity in culture using human and other tumor cell lines.
Cancer res 1988, 48 (17), 4827−4833.
(63) Zhou, Y.; Zhou, Y.; Shingu, T.; Feng, L.; Chen, Z.; Ogasawara,
M.; Keating, M. J.; Kondo, S.; Huang, P. Metabolic Alterations in
Highly Tumorigenic Glioblastoma Cells: Preference for hypoxia and
high dependency on glycolysis. J. Biol. Chem. 2011, 286 (37), 32843−
32853.
(64) Schneider, C. A.; Rasband, W. S.; Eliceiri, K. W. NIH Image to
ImageJ: 25 years of image analysis. Nat. Methods 2012, 9 (7), 671−
675.
J
DOI: 10.1021/acs.jmedchem.7b01891
J. Med. Chem. XXXX, XXX, XXX−XXX