I. Nudelman et al. / Bioorg. Med. Chem. Lett. 16 (2006) 6310–6315
6315
8. Vicens, Q.; Westhof, E. Chembiochem. 2003, 4,
1018.
Acknowledgments
9. Michael, K.; Wang, H.; Tor, Y. Bioorg. Med. Chem. 1999,
7, 1361.
10. Wang, H.; Tor, Y. Angew. Chem., Int. Ed. 1998, 37, 109.
11. Ding, Y.; Swayze, E. E.; Hofstadler, S. A.; Griffey, R. H.
Tetrahedron Lett. 2000, 41, 4049.
This research was supported by the Israel Science
Foundation founded by the Israel Academy of Sciences
and Humanities (Grant No. 766/04), by the German-
Israeli Foundation for Scientific Research
&
Development (Grant no. 1-2104-1432.2/2004 to
T.B.Y), by the Mizutani Foundation for Glycoscience
(Grant No. 060012, T.B. and T.B.Y.), and in part by
the B. E. Lusting Fund for Cystic Fibrosis Research at
the Technion. D. Shallom-Shezifi is supported in part
at the Technion by a Neaman Fellowship. The authors
thank David M. Bedwell (University of Alabama at
Birmingham) for providing the pDB650 plasmid and
John F. Atkins (University of Utah) for providing the
p2luc plasmid.
12. Fridman, M.; Belakhov, V.; Lee, L. V.; Liang, F. S.;
Wong, C. H.; Baasov, T. Angew. Chem., Int. Ed. Engl.
2005, 44, 447.
13. Mutations in the PCDH15 gene (which encodes proto-
cardherin 15) cause type 1 Usher syndrome (USH1), which
is characterized by profound prelingual hearing loss,
vestibular areflexia, and prepubertal onset of retinitis
pigmentosa (RP) (Petit, C. Annu. Rev. Genomics Hum.
Genet. 2001, 2, 271). In humans, four different PCDH15
USH1-causing nonsense mutations (R3X, R245X, R643X,
and R929X) have been reported. Interestingly, while the
above nonsense mutations of PCDH15 cause USH1,
certain missense mutations in the same gene cause only
nonsyndromic deafness, which is not associated with RP.
Such observations suggest that partial or low level activity
of the protein encoded by this gene may be sufficient for
normal retinal function, making it a suitable candidate for
read-through therapy.
14. Suppression of nonsense mutations by compounds 1–9
was tested in vitro using a reporter plasmid harboring the
R3X mutation of the PCDH15 gene (Ahmed, Z. M.;
Riazuddin, S.; Bernstein, S. L.; Ahmed, Z.; Khan, S.;
Griffith, A. J.; Morell, R. J.; Friedman, T. B.; Riazuddin,
S.; Wilcox, E. R. Am. J. Hum. Genet. 2001, 69, 25). To
create this plasmid, the oligonucleotides GATCCATGT
TTTGACAGTTTTATCTCTGGACA and AGCTTGTC
CAGAGATAAAACTGTCAAAACATG were annealed
to each other, and inserted into the BamHI and HindIII
sites of plasmid pDB650.6
References and notes
1. Atkinson, J.; Martin, R. Nucleic Acids Res. 1994, 22, 1327.
2. Magnet, S.; Blanchard, J. S. Chem. Rev. 2005, 105, 477.
3. (a) Keeling, K. M.; Bedwell, D. M. Curr. Pharmacoge-
nomics 2005, 3, 259; (b) Kerem, E. Curr. Opin. Pulm. Med.
2004, 10, 547.
4. Wilschanski, M.; Yahav, Y.; Yaacov, Y.; Blau, H.;
Bentur, L.; Rivlin, J.; Aviram, M.; Bdolah-Abram, T.;
Bebok, Z.; Shushi, L.; Kerem, B.; Kerem, E. N. Engl. J.
Med. 2003, 349, 1433.
5. (a) Carter, A. P.; Clemons, W. M.; Brodersen, D. E.;
Morgan-Warren, R. J.; Wimberly, B. T.; Ramakrishnan, V.
Nature 2000, 407, 340; (b) Francois, B.; Russell, R. J.;
Murray, J. B.; Aboul-ela, F.; Masquida, B.; Vicens, Q.;
Westhof, E. Nucleic Acids Res. 2005, 33, 5677; (c) Kaul, M.;
Barbieri, C. M.; Pilch, D. S. J. Mol. Biol. 2005, 346, 119.
6. Manuvakhova, M.; Keeling, K.; Bedwell, D. M. RNA
2000, 6, 1044.
15. (a) Forge, A.; Schacht, J. Audiol. Neurootol. 2000, 5, 3; (b)
Mingeot-Leclercq, M. P.; Tulkens, P. M. Antimicrob.
Agents Chemother. 1999, 43, 1003.
7. Fujisawa, K.; Hoshiya, T.; Kawaguchi, H. J. Antibiot.
(Tokyo) 1974, 27, 677.
16. Grentzmann, G.; Ingram, J. A.; Kelly, P. J.; Gesteland, R.
F.; Atkins, J. F. RNA 1998, 4, 479.