Assessment of 4-nitrogenated benzyloxymethyl groups for 2′-Hydroxyl protection in solid-phase RNA synthesis

Article abstract of DOI:10.1021/ol0629824

The search for a 2′-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2′-0-(4-nitrogenated benzyloxy)m

Full text of DOI:10.1021/ol0629824

ORGANIC
LETTERS
2007
Vol. 9, No. 4
671-674
Assessment of 4-Nitrogenated
Benzyloxymethyl Groups for 2
′
-Hydroxyl
Protection in Solid-Phase RNA
Synthesis
Jacek Cies´lak,† Jon S. Kauffman,‡ Michelle J. Kolodziejski,‡ John R. Lloyd,§ and
Serge L. Beaucage*,†
DiVision of Therapeutic Proteins, Center for Drug EValuation and Research,
Food and Drug Administration, 8800 RockVille Pike, Bethesda, Maryland 20892,
Lancaster Laboratories, 2425 New Holland Pike, Lancaster, PennsylVania 17605, and
Laboratory of Bioorganic Chemistry, National Institute of Diabetes and DigestiVe and
Kidney Diseases, The National Institutes of Health, 9000 RockVille Pike,
Bethesda, Maryland 20892
serge.beaucage@fda.hhs.goV
Received December 9, 2006
ABSTRACT
The search for a 2
comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2
solid-phase RNA synthesis using phosphoramidites 2a d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties.
Particularly noteworthy is the cleavage of the 2 -O-[4-(N-methylamino)benzyloxy]methyl groups in 0.1 M AcOH, which led to U19dT within 15
min at 90 C.
′
-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies
′
-O-(4-nitrogenated benzyloxy)methyl groups through
−
′
°
With the advent of RNA interference as a means to silence
gene expression,1,2 small interfering RNA (siRNA) oligo-
nucleotides have been recognized as powerful tools for
targeting mRNAs and eliciting their demises.3 As a conse-
quence of this discovery, siRNA oligonucleotides consisting
of less than 25 nucleotides are now being intensely inves-
tigated as potential therapeutic agents for various biomedical
indications.3,4 Such a scrutiny has spurred a renewed interest
in the development of rapid and efficient methods for solid-
phase RNA synthesis.
A formidable challenge in the preparation of RNA
oligonucleotides is designing a 2′-hydroxyl protecting group
that would provide ribonucleoside phosphoramidites with
coupling kinetics and coupling efficiencies comparable to
those of deoxyribonucleoside phosphoramidites. Furthermore,
† Food and Drug Administration.
‡ Lancaster Laboratories.
§ The National Institutes of Health.
(1) Fire, A.; Xu, S.; Montgomery, M. K.; Kostas, S. A.; Driver, S. E.;
Mello, C. C. Nature 1998, 391, 806-811.
(2) Elbashir, S. M.; Harborth, J.; Lendeckel, W.; Yalcin, A.; Weber, K.;
Tuschl, T. Nature 2001, 411, 494-498.
(3) Dorsett, Y.; Tuschl, T. Nat. ReV. Drug DiscoVery 2004, 3, 318-
329.
(4) Manoharan, M. Curr. Opin. Chem. Biol. 2004, 8, 570-579.
10.1021/ol0629824 CCC: $37.00
© 2007 American Chemical Society
Published on Web 01/26/2007

the 2′-OH protecting group must be stable to the reagents
and conditions used during solid-phase DNA/RNA synthesis
in addition to those required for nucleobase and phosphate
deprotection. Last, the 2′-OH protecting group must be
cleaved under conditions that will not harm the oligoribo-
nucleotide. Thus, the search for an ideal 2′-OH protecting
group in RNA synthesis has been ongoing for decades and
has been the subject of several reviews.5 One notable advance
in solid-phase RNA synthesis emerged from the implementa-
tion of the 2-nitrobenzyloxymethyl and 4-nitrobenzyloxy-
methyl (4-NBOM) groups for 2′-hydroxyl protection.6 Ri-
bonucleoside phosphoramidites functionalized with these
2′-OH protecting groups (1 and 2) produced coupling
efficiencies exceeding 98% within 2-3 min.6
ribonucleoside phosphoramidites for solid-phase RNA syn-
thesis and to develop a different method for the deprotection
of 2′-O-(4-NBOM) RNA oligonucleotides. We rationalized
that, instead of using fluoride ions for cleavage of the 2′-
O-(4-NBOM) group,6c converting its 4-nitro group to the
electron-donating 4-amino function would facilitate the
cleavage of the 2′-O-acetal through formation of an imino-
quinone methide11 intermediate and elimination of formal-
dehyde. Our investigations began with the synthesis of 2′-
O-(4-NBOM) uridine (7a) and of its phosphoramidite 2a as
depicted in Scheme 1.12
Scheme 1. Synthesis of Phosphoramidites 2a-d and 12aa
Such impressive coupling rates, relative to those of the
2′-O-tert-butyldimethylsilyl ribonucleoside phosphoramidites
(∼10 min), were presumably due to the flexibility of the
benzyloxymethyl group, which lessened the steric demand
around the activated phosphoramidite entity. These findings
were influential given that the 2′-O-substituted 1-(benzyl-
oxy)ethyl,7 2′-O-[1-(2-cyanoethoxy)]ethyl,8 2′-O-triisopro-
pylsilyloxymethyl (TIPSOM),9 and 2′-O-(2-cyanoethoxy)-
methyl (CEM)10 ribonucleoside phosphoramidites were since
reported to share structural homologies with phosphoramidite
2. More specifically, the 2′-O-TIPSOM and 2′-O-CEM
ribonucleoside phosphoramidites were claimed to exhibit
coupling reaction kinetics and coupling efficiencies compa-
rable to those of DNA phosphoramidites.9,10 These findings
prompted us to investigate further the use of 2′-O-(4-NBOM)
a
Keys: 2, 6, 7, 8, R ) 4-nitrobenzyl; 9, 10, 11, 12, R ) 4-(N-
dichloroacetyl-N-methyl)aminobenzyl; BP, U (a), CBz (b), ABz (c),
GiBu (d); TIPDSiCl2, 1,3-dichloro-1,1,3,3-tetraisopropyldisiloxane;
NIS, N-iodosuccinimide; TfOH, trifluoromethanesulfonic acid;
DCE, 1,2-dichloroethane; DMTrCl, 4,4′-dimethoxytrityl chloride;
Pyr, pyridine; CNE-DIPCP, 2-cyanoethyl N,N-diisopropylchloro-
phosphoramidite.
(5) (a) Reese, C. B. Org. Biomol. Chem. 2005, 3, 3851-3868. (b) Muller,
S.; Wolf, G.; Ivanov, S. A. Curr. Org. Synth. 2004, 1, 293-307. (c)
Marshall, W. S.; Kaiser, R. J. Curr. Opin. Chem. Biol. 2004, 8, 222-229.
(d) Reese, C. B. Tetrahedon 2002, 58, 8893-8920. (e) Reese, C. B. In
Current Protocols in Nucleic Acid Chemistry; Beaucage, S. L., Bergstrom,
D. E., Glick, G. D., Jones, R. A., Eds.; John Wiley & Sons: New York,
2000; Vol. I, pp 2.2.1-2.2.24. (f) Pitsch, S. Chimia 2001, 55, 320-324.
(g) Beaucage, S. L.; Iyer, R. P. Tetrahedron 1992, 48, 2223-2311.
(6) (a) Schwartz, M. E.; Breaker, R. R.; Asteriadis, G. T.; deBear, J. S.;
Gough, G. R. Bioorg. Med. Chem. Lett. 1992, 2, 1019-1024. (b) Miller,
T. J.; Schwartz, M. E.; Gough, G. R. In Current Protocols in Nucleic Acid
Chemistry; Beaucage, S. L., Bergstrom, D. E., Glick, G. D., Jones, R. A.,
Eds.; John Wiley & Sons: New York, 2000; Vol. I, pp 2.5.1-2.5.36 and
pp 3.7.1-3.7.8. (c) Gough, G. R.; Miller, T. J.; Mantick, N. A. Tetrahedron
Lett. 1996, 37, 981-982.
Automated solid-phase synthesis of a chimeric polyuridylic
acid (U19dT), as a model RNA oligonucleotide, was con-
ducted using commercial long-chain alkylamine controlled-
pore glass covalently linked to 5′-O-DMTr-dT through a 3′-
O-succinyl linker. Phosphoramidite 2a was dissolved in dry
MeCN to a concentration of 0.15 M and activated with 0.25
M 5-ethylthio-1H-tetrazole in MeCN. The coupling time was
set to 3 min. Upon completion of the oligonucleotide chain
assembly, the solid support was split into two fractions, one
(7) (a) Matysiak, S.; Fitznar, H.-P.; Schnell, R.; Pfleiderer, W. HelV.
Chim. Acta 1998, 81, 1545-1566. (b) Matysiak, S.; Pfleiderer, W. HelV.
Chim. Acta 2001, 84, 1066-1085.
(8) Umemoto, T.; Wada, T. Tetrahedron Lett. 2004, 45, 9529-9531.
(9) (a) Pitsch, S.; Weiss, P. A.; Jenny, L.; Stutz, A.; Wu, X. HelV. Chim.
Acta 2001, 84, 3773-3795. (b) Pitsch, S.; Weiss, P. A. In Current Protocols
in Nucleic Acid Chemistry; Beaucage, S. L., Bergstrom, D. E., Glick, G.
D., Jones, R. A., Eds.; John Wiley & Sons: New York, 2000; Vol. I, pp
3.8.1-3.8.15.
(11) Carl, P. L.; Chakravarty, P. K.; Katzenellenbogen, J. A. J. Med.
Chem. 1981, 24, 479-480.
(12) Experimental details and literature references are reported in the
Supporting Information.
(10) Ohgi, T.; Masutomi, Y.; Ishiyama, K.; Kitagawa, H.; Shiba, Y.;
Yano, J. Org. Lett. 2005, 7, 3477-3480.
672
Org. Lett., Vol. 9, No. 4, 2007

of which was treated with concentrated NH4OH for 30 min
at 25 °C to remove the phosphate protecting groups and
release the 2′-O-protected RNA oligonucleotide from the
support. The other fraction of the support was suspended in
0.1 M TiCl313 (pH 6.0) for 1 h at 25 °C to reduce the 2′-O-
(4-NBOM) groups to the corresponding 2′-O-(4-aminoben-
zyloxy)methyl (4-ABOM) groups. After washing away
residual TiCl3, removal of the phosphate protecting groups
and release of the 2′-O-(4-ABOM) RNA oligonucleotide
from the support were effected upon exposure to pressurized
NH3 gas.12 As shown in Figure 1A, the RP-HPLC profile of
tions. Encouraged by these results, the 2′-O-(4-NBOM)
phosphoramidite derivatives 2b-d were prepared as de-
scribed in Scheme 1.12 These phosphoramidites were em-
ployed in the solid-phase synthesis of an oligoribonucleotide
(20-mer) and were comparable to phosphoramidite 2a in
terms of coupling kinetics and coupling efficiencies. How-
ever, the TiCl3-mediated reduction of the 2′-O-(4-NBOM)-
protected 20-mer was not as efficient as that achieved with
[2′-O-(4-NBOM)U]19dT and resulted in a product of inferior
quality.15 Such an apparent deficiency in the reductive
capacity of TiCl3 appears related to the presence of nucleo-
bases other than uracil and thus precluded its routine use in
solid-phase RNA synthesis.
The search for an analogue of the 2′-O-(4-ABOM) group
that would permit solid-phase RNA synthesis and produce
an oligonucleotide homologous to [2′-O-(4-ABOM) U]19dT,
when using standard reagents and conditions, was initiated.
The 4-(N-methylaminobenzyloxy)methyl (4-MABOM) group
was identified as a close homologue of the 2′-O-(4-ABOM)
group. Much like nucleobases, the 4-MABOM group must
be N-protected during solid-phase oligonucleotide synthesis
but should revert to its native state under the conditions
employed for oligonucleotide deprotection. The dichloro-
acetyl group16 was found optimal for N-protection of the 2′-
O-(4-MABOM) acetal. Thus, 4-N-methylaminobenzyl alco-
hol was O-silylated upon reaction with Me3SiCl and then
N-acylated with dichloroacetic anhydride to give 4-(N-
dichloroacetyl-N-methylamino)benzyl alcohol after hydro-
lytic workup.12 The use of this alcohol in the preparation of
9a from 5a and conversion of 9a to phosphoramidite 12a
were accomplished as outlined in Scheme 1.12 Phosphor-
amidite 12a was employed in the solid-phase synthesis of
U19dT under conditions identical to those described when
using 2a. The 5′-O-dedimethoxytritylated solid-phase linked
oligoribonucleotide was exposed to concentrated NH4OH for
5 h at 55 °C to: (i) cleave the N-dichloroacetyl groups from
the 2′-O-(4-MABOM) acetals; (ii) remove the phosphate
protecting groups; and (iii) release the 2′-O-(4-MABOM)-
protected RNA oligonucleotide from the support. RP-HPLC
analysis of the RNA oligonucleotide (Figure 2A) indicates
that the phosphoramidite 12a is as efficient as 2a in solid-
Figure 1. RP-HPLC profiles of unpurified 2′-O-protected/-
deprotected U19dT. A: [2′-O-(4-NBOM) U]19dT. B: [2′-O-(4-
ABOM) U]19dT obtained from the TiCl3-mediated reduction of [2′-
O-(4-NBOM) U]19dT at pH 6.0. C: U19dT obtained from the
thermolytic deprotection of [2′-O-(4-ABOM) U]19dT in 0.1 M
AcOH at 90 °C. Conditions: see Supporting Information.
the unpurified RNA oligonucleotide protected with 2′-O-(4-
NBOM) groups is reflective of the coupling efficiency of
phosphoramidite 2a, which averaged 99%. Reduction of the
2′-O-(4-NBOM) group to its 2′-O-(4-ABOM) derivative was
efficient and clean, as illustrated in Figure 1B. The 2′-O-
(4-ABOM) group is stable under both neutral (0.1 M
triethylammonium acetate buffer, pH 7.0, 90 °C, 3 h) and
basic (concentrated NH4OH, 55 °C, 16 h) conditions. Thus,
the 2′-O-(4-ABOM) group and its homologues (vide infra)
are ideal for protecting RNA oligonucleotides against
ubiquitous ribonucleases under normal handling and storage
conditions. Complete removal of the 2′-O-(4-ABOM) group
is however achieved within 40 min upon heating the
oligonucleotide at 90 °C in 0.1 M AcOH. The RP-HPLC
profile of U19dT (Figure 1C) did not reveal substantial chain
cleavage.14
As anticipated, a peak (tR ) 11.5 min) corresponding to
4-aminobenzyl alcohol was detected. This aminoalcohol was
produced from the cleavage of the 2′-O-(4-ABOM) group,
presumably through formation of an iminoquinone methide
intermediate followed by immediate hydration.
Unpurified U19dT was completely digested to uridine and
thymidine upon incubation with snake venom phosphodi-
esterase and bacterial alkaline phosphatase. RP-HPLC analy-
sis of the digest did not indicate any nucleobase modifica-
Figure 2. RP-HPLC profiles of unpurified 2′-O-protected/-
deprotected U19dT. A: [2′-O-(4-MABOM) U]19dT. B: [2′-O-(4-
MABOM) U]19dT in 0.1 M AcOH, 90 °C, 15 min. C: Material of
profile B after multiple Et2O extractions. Conditions: see Support-
ing Information.
(13) Somei, M.; Kato, K.; Inoue, S. Chem. Pharm. Bull. 1980, 28, 2515-
2518.
Org. Lett., Vol. 9, No. 4, 2007
673

phase RNA synthesis in terms of purity. Although the 2′-
O-(4-MABOM) group is as stable as the 2′-O-(4-ABOM)
group under neutral and basic conditions, its complete
cleavage under acidic conditions is faster than that of the
2′-O-(4-ABOM) group by a factor of ∼3. The RP-HPLC
profile of U19dT shown in Figure 2B,C is comparable to that
of Figure 1C. An RP-HPLC peak corresponding to 4-(N-
methylamino)benzyl alcohol was detected, as expected, from
the cleavage of the 2′-O-(4-MABOM) group. Unpurified
U19dT was completely digested by snake venom phosphodi-
esterase and bacterial alkaline phosphatase to uridine and
thymidine without apparent nucleobase modifications as
judged by RP-HPLC analysis of the digest.12 This approach
to solid-phase RNA synthesis is attractive given its similarity
to solid-phase DNA synthesis in regard to the nucleobase
and phosphate protecting groups being used and also in
regard to the coupling rate and coupling efficiency of 12a,
which are comparable to those of deoxyribonucleoside
phosphoramidites. Moreover, the 2′-O-(4-MABOM) group
is deprotected under mild acidic conditions similar to those
reported by others17 in the production of commercial RNA
oligonucleotides.
ing 14a with the intent of evaluating the deprotection kinetics
of the 2′-O-(4-dimethylamino)benzyloxymethyl (4-DABOM)
group. Upon release of the dinucleotide from the support
and subsequent treatment with 0.1 M AcOH at 90 °C,
cleavage of the 2′-O-(4-DABOM) group occurred, unexpect-
edly, at a rate slower than that of the 2′-O-(4-MABOM)
group (15 min) but comparable to that of the 2′-O-(4-ABOM)
group (40 min). While attempts at improving the deprotection
kinetics of the 2′-O-(4-DABOM) group are underway, our
assessment of the 4-nitrogenated benzyloxymethyl groups
investigated so far favors the use of phosphoramidites
functionalized with the 4-(N-dichloroacetyl-N-methylamino)-
benzyloxymethyl group in solid-phase RNA synthesis. Given
that the coupling rate and coupling efficiency of 12a are
similar to those of 2a or 14a, it is anticipated that RNA
oligonucleotides prepared via 12a-d will be deprotected
under conditions identical to those used for DNA oligo-
nucleotides with the exception of the 2′-O-(4-MABOM)
groups, which will be removed rapidly under acidic condi-
tions essentially as described in the literature.17 An optimized
To further assess 4-nitrogenated benzyloxymethyl groups
for 2′-OH protection in solid-phase RNA synthesis, replace-
ment of the 4-N-dichloroacetyl group in phosphoramidite 12a
with a methyl group was considered. Such a modification
should functionally simplify the 2′-O-acetal protection and
accelerate its subsequent cleavage considering the strong
electron-donating ability of the 4-dimethylamino group. To
evaluate this rationale, 7a was converted to 2′-O-ABOM
uridine upon treatment with 0.1 M TiCl3 (pH 6.0) and was
then reacted with formaldehyde in the presence of
NaBH3CN and ZnCl2 in MeOH18 to give 13a. 5′-O-Di-
methoxytritylation and 3′-O-phosphinylation of 13a were
achieved as described for the preparation of 2a and 12a
affording phosphoramidite 14a in similar yields.12 The solid-
phase synthesis of dinucleotide UdT was carried out employ-
method for the solid-phase synthesis of RNA oligonucleo-
tides through the use of phosphoramidites 12a-d is currently
being developed. The details of this optimized method will
be reported in due course.
Supporting Information Available: Details on the
synthesis and characterization of the compounds prepared
1
according to Scheme 1; H and 13C NMR spectra of 7a-d,
10a, and 13a; 31P NMR spectra of 2a-d, 12a, and 14a;
expanded Figures 1 and 2; RP-HPLC profiles of the
oligonucleotides that were prepared using 2a-d; RP-HPLC
profile of the enzymatic digest of U19dT that was prepared
from 12a; PAGE analysis of a commercial oligoribonucleo-
tide that was heated in 0.1 M AcOH for up to 40 min at 90
°C. This material is available free of charge via the Internet
at http://pubs.acs.org.
(14) Heating commercial AUCCGUAGCUAAGGUCAUCGU for up to
40 min in 0.1 M AcOH at 90 °C did not result in significant chain cleavage
as estimated by polyacrylamide gel electrophoresis analysis. Data shown
in the Supporting Information.
(15) See Chart 1B,C of the Supporting Information.
(16) Goody, R. S.; Walker, R. T. Tetrahedron Lett. 1967, 8, 289-291.
(17) Scaringe, S. A. Methods 2001, 23, 206-217.
(18) Kim, S.; Oh, C. H.; Ko, J. S.; Ahn, K. H.; Kim, Y. J. J. Org. Chem.
1985, 50, 1927-1932.
OL0629824
674
Org. Lett., Vol. 9, No. 4, 2007