Rapid mass spectrometric identification of human genomic polymorphisms using multiplexed photocleavable mass-tagged probes and solid phase capture

Article abstract of DOI:10.1039/b704587e

A mass spectrometric approach for rapid and simultaneous detection of several single nucleotide polymorphisms (SNPs) is reported. Oligonucleotide single base extension (SBE) primers, labelled at the 5′-end with photocleavable, quaternised and brominated p

Full text of DOI:10.1039/b704587e

View Article Online / Journal Homepage / Table of Contents for this issue
PAPER
www.rsc.org/obc | Organic & Biomolecular Chemistry
Rapid mass spectrometric identification of human genomic polymorphisms
using multiplexed photocleavable mass-tagged probes and solid phase capture
Naomi Hammond,*a Peter Koumi,b G. John Langley,a Alex Loweb and Tom Browna
Received 27th March 2007, Accepted 19th April 2007
First published as an Advance Article on the web 10th May 2007
DOI: 10.1039/b704587e
A mass spectrometric approach for rapid and simultaneous detection of several single nucleotide
polymorphisms (SNPs) is reported. Oligonucleotide single base extension (SBE) primers, labelled at the
5ꢀ-end with photocleavable, quaternised and brominated peptidic mass tags, are extended by a mixture
of the four dideoxynucleotides of which one is biotinylated. The 3ꢀ-biotinylated extension products are
captured by streptavidin-coated solid phase magnetic beads, whilst non-biotinylated extension products
and unreacted primers are washed away. Quaternised and brominated mass tags, cleaved from captured
extension products during analysis by matrix-assisted laser desorption/ionisation-time-of-flight
(MALDI-TOF) MS, are detected at pmol levels. This method is applied to the analysis of
mitochondrial DNA polymorphisms for the purpose of human identification.
Alternatively, SBE products can be indirectly detected by
Introduction
MALDI-TOF MS by labelling them with a photocleavable
Genotyping of single nucleotide polymorphisms (SNPs), the most
mass marker, which is detected instead of the DNA products.
common human genetic variation, is widely used for identifying
Photocleavable peptide–DNA conjugates have also been used as
hybridisation probes.12 The peptides are released during photo-
cleavage induced by the nitrogen laser pulse (337 nm), greatly
simplifying detection. This provides a wide range of available mass
tags that are not restricted by the masses of unmodified DNA
strands.
In this novel approach (Fig. 1), SBE primers are labelled at the
5ꢀ-end with photocleavable, quaternised, and brominated peptidic
mass tags. These are extended by a mixture of the four dideoxynu-
cleotides of which one is biotinylated.13 The 3ꢀ-biotinylated
extension products are captured by streptavidin-coated solid phase
magnetic beads, whilst non-biotinylated extension products and
unreacted primers are washed away. Quaternised, brominated
mass tags are photocleaved from the captured extension products
during MALDI-TOF MS analysis for detection. Detection of
mass tags is automatable if cluster pattern recognition software
is used for analysis of the brominated isotope patterns.
This procedure differs from the existing SBE assays using
MALDI-TOF MS, predominantly in that the photo-released
peptide mass tags are used and not DNA based ones. Peptides are
more readily detected by MALDI-TOF MS than DNA. A wide
range of commercially available standard and isotopically labelled
amino acids can be used, eliminating the need for expensive and
time consuming chemical modification of the SBE primers. As the
ddNTPs are biotinylated and not the SBE primers, all unextended
primers are removed and no background signals, except from
matrix ions result.
disease genes, in forensic identification of individuals, and genetic
mapping.1 The search for a rapid and inexpensive technique for
determining SNP variation is ongoing.2–4
Single base extension (SBE) is commonly used for genotyping
SNPs.4,5 In this method a primer is annealed to the DNA template
and extended by a single dideoxynucleotide that is complementary
to the nucleotide at the variable site. Fluorescently-labelled
dideoxynucleotides and solid-phase capturable SBE primers,
with slab gel electrophoretic detection, have been employed for
multiplexed SNP genotyping.2 The multiplexing capabilities of this
approach are limited as spectral differentiation between large num-
bers of fluorophores is not possible. In contrast, matrix-assisted
laser desorption/ionisation-time-of-flight (MALDI-TOF) mass
spectrometry (MS) can be used to simultaneously analyse multiple
SBE products.6–9 Direct analysis of DNA is difficult due to
its negatively charged sugar–phosphate backbone which forms
adducts with alkali metal ions such as sodium and potassium.10
Stringent purification is therefore essential to obtain unambiguous
results.
The GOOD assay resolves some of the incompatibilies between
DNA and MALDI-TOF MS by chemical modifications of the
SBE primers. Primers are partially modified with up to three phos-
phorothioates, followed by extension with quaternised ddNTPs
and the unmodified segment is digested by phosphodiesterase
II. The negative charges on the remaining phosphorothioate
segment are neutralised by an alkylation reaction, leaving a single
positive charge from the quaternary ammonium ion for MALDI-
TOF MS detection.11
Results and discussion
aSchool of Chemistry, University of Southampton, Southampton, UK SO17
1BJ. E-mail: tb2@soton.ac.uk; Fax: +44 (0)2380 592991; Tel: +44 (0)23
8059 2974
The o-nitrobenzyl based photocleavable linker, similar to that of
Holmes,14 was synthesised according to Scheme 1. It was coupled
to the 5ꢀ-end of three SBE primers using standard automated
solid phase DNA synthesis methods. Mass tags were manually
bThe Forensic Science Service, Trident Court, 2920 Solihull Parkway,
Birmingham Business Park, Birmingham, UK B37 7YN
1878 | Org. Biomol. Chem., 2007, 5, 1878–1885
This journal is
The Royal Society of Chemistry 2007
©

View Article Online
Fig. 1 SBE assay. (i) The derivatised mass tagged primer anneals one base upstream of the SNP site and is extended by a ddNTP. The reaction
is carried out four times, each time replacing one of the four ddNTPs with a biotinylated version. (ii) Biotinylated extension products are captured
on streptavidin-coated beads whilst non-biotinylated extension products are washed away. (iii) Captured extension products are directly cleaved and
the peptide moiety analysed by MALDI-TOF MS. The genotype is determined by the molecular ion of the brominated mass marker. PL denotes
photocleavable linker, BrPEP denotes brominated peptide.
Scheme 1 Synthesis of the photocleavable o-nitrobenzyl photocleavable linker.
This journal is
The Royal Society of Chemistry 2007
Org. Biomol. Chem., 2007, 5, 1878–1885 | 1879
©

View Article Online
Table 1 Single base extension primer sequences and characterisation by mass spectrometry and UV melting analysis
Location of 3ꢀ
insertion
Massc m/z
(calcd/found)
Tm /◦Cd with/without
mass tag
Sequence: 5ꢀ–3ꢀ
H00073
H00247
H16129
QuataBrPheGlyGly–PLb–CCAGCGTCTCGCAATGCTATCGCGTGCA
QuataBrPhePheGly–PLb–CTGTGTGGAAAGTGGCTGTGCAGACATT
QuataBrPheGly–PLb–GTACTACAGGTGGTCAAGTATTTATGGTAC
9551/9550
9815/9812
10244/10241
74.6/75.1
73.1/72.2
67.5/67.1
a Quat denotes derivatised with a quaternary ammonium. b PL denotes photocleavable linker. c Molecular weights are reconstructed from the multiply
charged peaks. d Melting studies were performed with exact complements.
conjugated to the photocleavable linker-oligonucleotide, each
primer having its own unique mass tag (Table 1).15
the melting temperature of the primers. Photocleavage product
masses are shown in Table 3.
The mass tag was designed to have well resolved peaks (∼60 Da
apart) and to contain a single bromine atom to allow for
subsequent automated spectral analysis. The amino terminus of
the peptide was derivatised with a quaternary ammonium salt,16
to allow mass tag detection at the pmol level.
Each allele of a particular SNP requires a separate reaction,
i.e. to detect a G insertion, biotinylated ddCTP is added along
with non-biotinylated ddATP, ddGTP and ddTTP. All ddNTPs
are required to eliminate any possibility of false extension. The
method has been evaluated with just one biotinylated ddNTP
(biotin-11-ddCTP) and this adequately demonstrates its efficiency
and selectivity.
When the assay was tested with DNA source 1 (Table 2),
three mass tags were detected, as all SBE primers were extended
with biotin-11-ddCTP. With DNA source 2, just one mass tag
(corresponding to H00073) was detected (Fig. 2). Any primers not
extended by the biotinylated dideoxynucleotide are washed away
during solid phase capture providing unambiguous detection of
all C-extended nucleotides.
Single nucleotide deletions can be detected (Table 2, H00247)
by designing the 3ꢀ-end of a primer to be complementary to the
base at which the deletion is positioned. If the target sequence
has a deletion at this point, the primer does not fully hybridise
The method described has been successfully validated by prob-
ing three substitution polymorphisms from two human mitochon-
drial DNA samples, and extension with biotin-11-ddCTP. The
base compositions of each SNP investigated for both samples are
shown in Table 2. SBE primer-mass tag conjugate sequences2 and
masses are shown in Table 1 along with Tm data. The presence of
the 5ꢀ-photocleavable linker mass tags does not appreciably effect
Table 3 Cleaved mass tag
Location of 3ꢀ insertion
Mass tag m/z (calcd/found)
H00073
H00247
H16129
695.3/695.3
785.4/785.3
638.3/638.3
Table 2 SNP genotype of two DNA samples analysed at three different sites
Target sequence of template: 5ꢀ–3ꢀ
Location of 3ꢀ insertion
Source 1
Source 2
H00073
H00247
H16129
GTGCACGCGATAGCATTGCGAGACGCTGG
GAATGTCTGCACAGCCACTTTCCACACAG
GGTACCATAAATACTTGACCACCTGTAGTAC
GTGCACGCGATAGCATTGCGAGACGCTGG
GDaATGTCTGCACAGCCACTTTCCACACAG
AGTACCATAAATACTTGACCACCTGTAGTAC
a D denotes a deletion. As the primer is mismatched at the 3ꢀ-end, extension does not occur. The SNP genotype is highlighted in bold.
Fig. 2 Reflectron MALDI-TOF MS of photocleaved mass tags after SBE, demonstrating selectivity of assay. Top spectrum from DNA source 1:
expected bromine isotopic mass (M)+ 638.3, 695.3 and 785.4 m/z units. Lower spectrum from DNA source 2: expected bromine isotopic mass (M)+ 695.3
m/z units.
1880 | Org. Biomol. Chem., 2007, 5, 1878–1885
This journal is
The Royal Society of Chemistry 2007
©

View Article Online
Table 4 Quantification of the assay
and extension does not occur. If the deletion is part of a homo-
oligomer repeat region (i.e. GGGGG), the 3ꢀ-end of the primer can
be designed to be complementary to the last base in the region. A
deletion would stop full hybridisation and extension (Fig. 3).
H00073 : H00247
Source 2(%)a peak height ratiosb
Theoretical peak
height ratiosc
Source 1(%)a
100
0
25
2.4
0.5
0
100
75
97.6
99.5
1 : 1.82
1 : 0.06
1 : 0.67
1 : 0.14
1 : 0.06
n/a
1 : 0.00
1 : 0.46
1 : 0.04
1 : 0.01
a % of total DNA present in PCR sample. b Both peak heights from each
data set are obtained from the same spectra. c Theoretical values are
calculated from the 100% source 1 H00247 peak height.
were carried out under an argon atmosphere in oven-dried
glassware.
Fig. 3 Application of the assay to the detection of deletions and insertions
in a homo-oligomer repeat region (bold). The 3ꢀ-end of the primer is
designed to anneal to last base of the repeat region, assuming no deletions
or insertions. a) Primers which anneal to a template containing no deletions
or insertions are extended by a ddNTP complementary to the next base
after the repeat region. b) As primers do not fully hybridise to templates
containing a deletion, extension does not occur. c) Templates containing
an insertion are extended by a ddNTP complementary to the repeat region.
4-(4-Acetyl-2-methoxyphenoxy)butyl acetate (1). A slurry of
acetovanillone (15.36 g, 92.4 mmol), 4-bromobutyl acetate
(18.84 g, 96.6 mmol), and K2CO3 (20.00 g, 144.9 mmol) in DMF
(100 mL) was stirred at room temperature for 17 hours. Water
(50 mL) was added to the reaction mixture, dissolving the majority
of K2CO3. The mixture was poured into saturated NaCl (100 mL)
and the aqueous phase extracted with EtOAc (3 × 100 mL). The
combined organic phase was washed with H2O (2 × 50 mL) and
brine (100 mL), dried (Na2SO4), filtered and the solvent removed
in vacuo to afford the keto-ester 1 (25.35 g, 94%) as a pale yellow
crystalline solid; mp: 60–61 ◦C (ethyl acetate) (Found: C, 64.2; H,
7.2. C15H20O5 requires C, 64.3; H, 7.2%); vmax/cm−1 2961m (CH2,
Single nucleotide insertions in a homo-oligomer repeat region
can be genotyped in a similar manner, by designing the 3ꢀ-end
of a primer to anneal to the last base in the region (assuming no
insertions). If the target sequence has an insertion, the biotinylated
base added will be complementary to that of the repeat region, but
different if no insertions are present (Fig. 3).2
Typing deletions or insertions of homo-oligomer repeat regions
could prove difficult, although this has not been experimentally
determined. It may be possible for either the primer or template
to loop out and form a stable hybridised duplex for SBE, giving
false typing results.
To quantify the assay for application in forensic science, the
percentages of total DNA present in one tube from sources 1
and 2 were varied pre-PCR. Mass tag peak height ratios from
SNPs H00073 and H00247 (Table 3), of 695 and 785 m/z units
respectively, were calculated from each set of spectra obtained
(Table 4). The mass tags generated from SBE of H00073 are present
in both sample types, whilst the tags from H00247 are only present
in sample 1. Low background levels of the H00247 mass tags
are detected during analysis of 100% source 2. When total DNA
consists of ≤0.5% source 1, peaks from the tag are reduced to the
background level. As the percentage of source 2 increases, the peak
ratios increase almost proportionally (see theoretical peak height
values, Table 4). Therefore, the proportion of two different DNA
sources in a single sample can be factored into the interpretation
of a forensic result by analysing two SNPs, if the two alternative
allele types are present for one of the SNPs.
=
CH3), 1732s, 1721s, 1667s (C O), 1359s (CO-CH3) and 1255s (C–
O); dH (300 MHz, CDCl3) 2.00–1.80 (4 H, m, 2 × CH2), 2.04 (3 H, s,
CH3CO2), 2.56 (3 H, s, CH3COC), 3.92 (3 H, s, OCH3), 4.11 (2 H,
t, J 5.9, CH2), 4.15 (2 H, t, J 6.2, CH2), 6.88 (1 H, d, J 8.2, CHar),
7.55–7.52 (2 H, m, CHar); dC (75 MHz, CDCl3) 20.92 (CH3CO2),
25.28 (CH2), 25.65 (CH2), 26.17 (COCH3), 56.02 (CarOCH3), 63.96
(CH3CO2CH2), 68.36 (COCH2), 110.54 (CH), 111.19(CH), 123.16
(CH), 130.50 (C), 149.29 (C), 152.74 (C), 171.06 (CH3CO2), 196.75
(CH3COC); LRMS (ES+) m/z 303.2 (M + Na)+ (100%), HRMS
(ES+) m/z 281.1387 (M + H)+, C15H21O5 requires 281.1384.
4-[4-(1-Hydroxyiminoethyl)-2-methoxyphenoxy]butyl acetate
(2). Keto-ester 1 (25.74 g, 91.9 mmol) and H2NOH·HCl (9.57 g,
137.7 mmol) were dissolved in a 2 : 1 v/v pyridine : H2O mixture
(120 mL) forming a yellow solution which was stirred at room
temperature for 18 hours. The work-up procedure was the same as
described for compound 1. Final traces of pyridine were removed
by co-evaporating with toluene (4 × 30 mL) to afford oxime 2
(23.68 g, 87%) as a pale yellow solid (Found: C, 60.95; H, 7.2;
N, 4.6. C15H21NO5 requires C, 61.0; H, 7.2; N, 4.7%); vmax/cm−1
=
2961m (CH2, CH3), 1732s, 1721s, 1667s (C O), 1360s (CO–CH3)
and 1254s (C–O); dH (300 MHz, CDCl3) 1.71–1.91 (4 H, m, 2 ×
CH2), 1.97 (3 H, s, CH3CO2), 2.20 (3 H, s, CH3CNOH), 3.82
(3 H, s, OCH3), 3.99 (2 H, t, J 6.2, CH2), 4.07 (2 H, t, J 6.3,
CH2), 6.78 (1 H, d, J 8.4, CHar), 7.06 (1 H, dd, J 8.4 and 2.1,
CHar), 7.19 (1 H, d, J 2.2, CHar); dC (75 MHz, CDCl3) 11.98
(CH3CNOH), 20.95 (CH3CO2), 25.32 (CH2), 25.77 (CH2), 55.99
(OCH3), 64.11 (CH3CO2CH2), 68.39 (COCH2), 109.14 (CH),
112.37 (CH), 119.17 (CH), 129.42 (C), 149.34 (C), 149.57 (C),
155.67 (CH3CNOH), 171.18 (CH3CO2); LRMS (ES+) m/z 318.2
(M + Na)+ (100%), HRMS (ES+) m/z 296.1496 (M + H)+,
C15H21NO5 requires 296.1493.
Mass tag mass spectral peaks were well resolved, supporting
the capability to extend the multiplex much further, by utilising
suitable amino acids or non-natural amino acid derivatives.
Experimental
Chemical synthesis
Solvents and reagents were purchased from Aldrich or Fisher.
Derivatised peptides were purchased from Activotec. All reactions
This journal is
The Royal Society of Chemistry 2007
Org. Biomol. Chem., 2007, 5, 1878–1885 | 1881
©

View Article Online
4-[4-(1-Aminoethyl)-2-methoxyphenoxy]butyl acetate (3).
A
4-(2-Methoxy-5-nitro-4-[1-(2,2,2-trifluoroacetamido)ethyl]-
phenoxy)butyl acetate (5). Benzyl amide 4 (7.37 g, 19.5 mmol)
was slowly added to 70% HNO3 (150 mL), cooled to 0 ◦C, forming
a light yellow solution. The solution gradually turned orange in
colour and after 2 hours the reaction was quenched by pouring
into iced water (1500 mL). The resultant slurry was chilled at
4 ◦C overnight, and filtered whilst cold, resulting in a pale yellow
solid. The solid was dissolved in EtOAc and the residual aqueous
phase removed. The organic phase was dried (Na2SO4), filtered
and evaporated in vacuo to afford the nitrated amide 5 (6.57 g,
80%) as a pale yellow crystalline solid; mp: 134–135 ◦C (ethyl
acetate) (Found: C, 48.45; H, 5.1; N, 6.5. C17H21F3N2O7 requires
C, 48.3; H, 5.0; N, 6.6%); vmax/cm−1 3341m (N–H), 2951w, 2890w
suspension of oxime 2 (20.58 g, 69.7 mmol) and palladium (10%)
on activated carbon (2.0 g) was made in glacial acetic acid
(200 mL). The mixture was degassed by placing under reduced
pressure, refilled with hydrogen and placed under a pressure of
1.1 atm via a balloon. The mixture was stirred vigorously at
room temperature, refilling the balloon with further hydrogen as
required. An additional 1 g of catalyst was added after 48 hours.
After 12 hours the mixture was filtered through Celite and the
solvent reduced in vacuo to ∼10 mL. Water (100 mL) was added
and the solution acidified to pH 1 with 6 M HCl. The aqueous
phase was washed with Et2O (2 × 50 mL), basified to ∼pH 12 with
Na2CO3 and extracted with EtOAc (3 × 100 mL). The combined
organic phases were washed with H2O (50 mL) and saturated
NaCl (50 mL). The organic phase was dried (Na2SO4), filtered
and evaporated in vacuo, and purified by column chromatography
on silica gel using an eluent system of EtOAc + 8% MeOH +
1% Et3N to yield the amine 3 (8.15 g, 42%) as an orange–brown
=
=
(CH2, CH3), 1730m (C O), 1698s (C O), 1525s, 1512s (NO2),
1177s (C–F); dH (300 MHz, CDCl3) 1.62 (3 H, d, J 7.4, CH3CH),
1.78–1.98 (4 H, m), 2.05 (3 H, s, CH3CO2), 3.94 (3 H, s, OCH3), 4.08
(2 H, t, J 6.2, CH2), 4.14 (2 H, t, J 6.3, CH2), 5.52 (1 H, quin, J 7.2,
CHNH), 6.87 (1 H, s, CHar), 7.39 (1 H, d, J 7.3, NH), 7.59 (1 H, s,
CHar); dC (75 MHz, CDCl3) 20.24 (CH3CO2), 21.07 (CH3CH),
25.41 (CH2), 25.68 (CH2), 48.69 (CH3CH), 56.58 (CH3CO), 64.10
(CH2), 69.10 (CH2), 110.36 (CH), 111.34 (CH), 115.56 (q, J 276.7,
CF3), 130.95 (C), 140.74 (C), 147.93 (C), 154.20 (C), 156.31 (q,
J 38.8, COCF3), 171.33 (CH3CO2); dF (282 MHz, CDCl3) 76.21;
LRMS (ES+) m/z 445.2 (M + Na)+ (100%), HRMS (ES+) m/z
445.1199 (M + Na)+, C17H21NaF3NO7 requires 445.1193.
oil; vmax/cm−1 2956m, 2871m (CH2, CH3), 2361w, 1732s (C O),
=
=
1678w (C O), 1365m (CO–CH3), 1235s (C–O); dH (300 MHz,
CDCl3) 1.36 (3 H, d, J 6.6, CH3CH), 1.61 (2 H, s, NH2), 1.71–
1.92 (4 H, m), 2.02 (3 H, s, CH3CO2), 3.86 (3 H, s, OCH3),
3.99–4.15 (5 H, m), 6.79–6.86 (2 H, m, CHar), 6.91 (1 H,
d, J 1.5, CHar); dC (75 MHz, CDCl3) 20.94 (CH3CO2), 25.34
(CH2), 25.76 (CH3CHNH2), 25.87 (CH2), 51.02 (CHNH2), 56.00
(COCH3), 64.14 (CH3CO2CH2), 68.61 (CH2), 109.65 (CH), 113.30
(CH), 117.66 (CH), 140.78 (CCHNH2), 147.22 (COCH2), 149.57
(COCH3), 171.09 (CH3CO2); LRMS (ES+) m/z 265.2 (M − NH3 +
H)+ (100%), 304.2 (M + Na)+ (14), HRMS (ES+) m/z 304.1517
(M + Na)+, C15H23NaNO4 requires 304.1519.
4-[4-(1-Aminoethyl)-2-methoxy-5-nitrophenoxy]-1-butanol (6).
Nitro-amide 5 (6.57 g, 15.6 mmol) was dissolved in MeOH
(200 mL) and 1 M NaOH (60 mL, 60 mmol) added, forming
an orange solution which was refluxed for 6 hours. Upon
cooling to room temperature, the resultant dark red solution was
concentrated to ∼50 mL, water (200 mL) added and acidified
to pH 1 with 2 M HCl. The solution was washed with Et2O
(4 × 40 mL) and the aqueous phase basified to pH 10.5 with
saturated Na2CO3. Saturated NaCl (20 mL) was added to the
aqueous phase and extracted with DCM (3 × 60 mL, 9 × 30 mL).
The combined organic phases were dried (Na2SO4), filtered and
evaporated in vacuo to afford the nitro-amine 6 (3.96 g, 89%) as an
orange oil; vmax/cm−1 3359w, 3288w (O–H), 2922w, 2862w (CH2,
CH3), 1503s (NO2), 1263s (O–H), 1045s (C–OH); dH (400 MHz,
CDCl3) 1.43 (3 H, d, J 6.4, CH3CH), 1.72–1.81 (5 H, m, 2 ×
CH2 overlapping OH), 1.92–1.97 (2 H, m), 3.72 (2 H, t, J 6.2,
CH2OH), 3.97 (3 H, s, OCH3), 4.10 (2 H, t, J 6.2, CH2OC),
4.80 (1 H, q, J 6.4, CHNH2), 7.31 (1 H, s, CHar), 7.47 (1 H, s,
CHar); dC (100 MHz, CDCl3) 24.81 (CH3), 25.69 (CH2), 29.59
(CH2), 46.02 (CHNH2), 56.43 (CH3OC), 62.36 (CH2OH), 69.38
(CH2OC), 108.99 (2 × CHar), 137.48 (C), 140.91 (C), 146.78 (C),
153.78 (C); LRMS (ES+) m/z 268.1 (M − NH3 + H)+ (100%),
285.2 (M + H)+ (51), 307.1 (M + Na)+ (23), HRMS (ES+) m/z
285.1439 (M + H)+, C13H21N2O5 requires 285.1445.
4-(2-Methoxy-4-[1-(2,2,2-trifluoroacetamido)ethyl]phenoxy)butyl
acetate (4). Amine 3 (8.15 g, 29.0 mmol) was dissolved in
◦
pyridine (80 mL), cooled to 0 C. TFAA (12.3 mL, 56.9 mmol)
was added forming a light orange solution. The mixture was
stirred at 0 ◦C for 1.5 hours after which time the dark orange
solution was poured into saturated NaCl (200 mL, cooled to
0 ◦C) whilst stirring and the organic phase extracted with EtOAc
(3 × 100 mL). The combined organic phases were washed with
H2O (50 mL) and saturated NaCl (50 mL), dried (Na2SO4),
filtered and evaporated in vacuo. The product was purified by
column chromatography on silica gel using an eluent system
of EtOAc : hexane 2 : 1 affording amide 4 (10.02 g, 92%) as
a light yellow–off-white powder (Found: C, 54.2; H, 5.9; N,
3.7. C17H22F3NO5 requires C, 54.1; H, 5.9; N, 3.7%); vmax/cm−1
=
3296m (N–H), 2956w, 2878w (CH2, CH3), 2361w, 1736m (C O),
=
1693s (C O), 1366m (CO–CH3), 1232s (C–O) 1148s (C–F); dH
(300 MHz, CDCl3) 1.57 (3 H, d, J 7.0, CH3CH), 1.77–1.94 (4 H,
m, 2 × CH2), 2.03 (3 H, s, CH3CO2), 3.86 (3 H, s, OCH3), 4.02
(2 H, t, J 6.1, CH2), 4.13 (2 H, t, J 6.2, CH2), 5.09 (1 H, quin,
J 7.2, CHCH3), 6.83–6.85 (3 H, m, CHar), 6.49 (1 H, s, NH);
dC (75 MHz, CDCl3) 20.93 (CH3), 21.07 (CH3), 25.46 (CH2),
25.92 (CH2), 49.67 (CHCH3), 56.21 (COCH3), 64.22 (CH2), 68.69
(CH2), 110.61 (CH), 113.44 (CH), 115.56 (q, J 277.8, CF3), 118.37
(CH), 133.82 (C), 148.48 (COCH3), 149.93 (NHCO), 156.26 (q,
J 38.9, COCF3), 171.29 (CH3CO2); dF (282 MHz, CDCl3) 76.13;
LRMS (ES+) m/z 400.1 (M + Na)+ (100%), 777.4 (2M + Na)+
(13), HRMS (ES+) m/z 400.1345 (M + Na)+, C17H22NaF3NO5
requires 400.1342.
11-(4-Methoxytritylamino)undecanoic acid (9). To a solution
of 11-aminoundecanoic acid (7.15 g, 35.5 mmol) in pyridine
(100 mL), p-monomethoxytrityl chloride (10.00 g, 32.3 mmol)
was added and stirred at room temperature for 3 hours. The
solution was concentrated to ∼20 mL in vacuo, DCM (600 mL)
added and subsequently washed with saturated KCl (5 × 75 mL)
and H2O (1 × 100 mL). The organic phase was dried (Na2SO4),
filtered and evaporated in vacuo to afford a pale yellow oil. The
product was purified by column chromatography on silica using
1882 | Org. Biomol. Chem., 2007, 5, 1878–1885
This journal is
The Royal Society of Chemistry 2007
©

View Article Online
an eluent system of DCM + 8% MeOH + 1% Et3N to afford acid 9
(7.25 g, 43%) as a pale yellow oil; vmax/cm−1 3348br (O–H), 2922m,
N,N-diisopropyl chlorophosphine (0.34 mL, 1.5 mmol) and
DIPEA (0.59 mL, 3.4 mmol) were dissolved in freshly distilled
THF (10 mL) and stirred at room temperature for 2 hours under
an argon atmosphere. Degassed DCM (30 mL) and degassed
saturated KCl (8 mL) was added and the organic phase extracted,
dried (MgSO4), filtered and evaporated in vacuo to afford a yellow
oil. The product was purified by column chromatography on
silica using an eluent system of 7 : 3 EtOAc : toluene + 1% Et3N
to afford phosphoramidite 8 (0.96 g, 73%) as a yellow oil; dH
(400 MHz, DMSO) 1.16–1.22 (25 H, m, 6 × CH2, 4 × NCH3,
1 × CHNH), 1.44–1.48 (7 H, m, 2 × CH2, CH3CHNH), 1.75
(2 H, app quin, J 6.7, CH2), 1.85 (2 H, app quin, J 6.6, CH2),
2.00–2.02 (2 H, m, CH2), 2.13 (2 H, t, J 6.9, CH2), 2.79 (2 H, t, J
5.9, CH2), 3.77 (3 H, s, CH3O), 3.56–3.82 (6 H, m, 2 × CH2, 2 ×
CHNP), 3.93 (3 H, s, CH3O), 4.10 (2 H, t, J 5.5, CH2OCar), 5.43
(1 H, quin, J 7.0, CHNH), 6.89 (2 H, d, 2 × CHar), 7.20–7.24 (4
H, m, 4 × CHar), 7.29–7.35 (5 H, m, 5 × CHar), 7.44 (4 H, d, J
8.0, 4 × CHar), 7.52 (1 H, s, CHar), 8.49 (1 H, d, J 7.8, CHNH); dP
(121 MHz, DMSO) 147.76; LRMS (ES+) 940.7 (M + H)+ (100%),
HRMS (ES+) m/z 940.5362 (M + H)+, C53H75N5O8P requires
940.5354.
=
2852m (CH2, CH3), 1737w (C O), 1508s (NH), 1268s (C–O); dH
(400 MHz, CDCl3) 1.16–1.29 (13 H, m, 6 × CH2, NH), 1.40–1.49 (2
H, m, CH2), 1.57–1.64 (2 H, m, CH2), 2.12 (2 H, t, J 7.0, CH2NH),
2.23 (2 H, t, J 7.6, CH2COOH), 3.79 (3 H, s, OCH3), 6.79–6.84 (2
H, m, CHar), 7.25–7.30 (6 H, m, CHar), 7.36–7.41 (2 H, m, CHar),
7.47–7.48 (4 H, m, CHar); dC (100 MHz, CDCl3) 26.17 (CH2), 27.52
(CH2), 29.63 (CH2), 29.67 (CH2), 29.72 (2 × CH2), 29.78 (CH2),
31.02 (CH2), 36.88 (COOHCH2), 43.71 (NCH2), 55.28 (OCH3),
70.48 (NHC), 113.12 (2 × CH), 126.49 (2 × CH), 128.00 (4 × CH),
128.70 (4 × CH), 129.92 (2 × CH), 138.73 (C), 146.78 (2 × C),
157.87 (COCH3), 179.78 (COOH); LRMS (ES+) m/z 496.3 (M +
Na)+ (5%); HRMS (ES+) m/z 474.3012 (M + H)+, C31H40NO3
requires 474.3003.
11-(4-Methoxytritylamino)-N-{1-[4-(4-hydroxybutoxy)-3-meth-
oxy-6-nitrophenyl]ethyl}undecanamide (7). A solution of acid 9
(4.47 g, 9.4 mmol), nitroamine 6 (2.24 g, 7.9 mmol) and EDC·HCl
(1.81 g, 9.4 mmol) in pyridine (80 mL) was stirred at room
temperature for 3 hours. Pyridine was removed in vacuo and
final traces coevaporated with toluene. The product was purified
by column chromatography on silica using an eluent system of
EtOAc + 1% Et3N to afford the coupled amide 7 (5.00 g, 86%)
as a yellow crystalline solid; mp: 64–65 ◦C (ethyl acetate) (Found:
C, 71.32; H, 7.75; N, 5.6. C44H57N3O7 requires C, 71.4; H, 7.8; N,
5.7%); vmax/cm−1 2925s (CH2, CH3), 2851w (CH2, CH3), 1713w
6-[(N-Succinimidyl)oxy]-6-oxohexyl(trimethyl)ammonium bro-
mide (11)16. Following the procedure of Bartlet-Jones,16
trimethylamine (1.45 mL, 15.4 mmol) in anhydrous tetrahydrofu-
ran (THF) (3 mL) was added to a solution of (N-succinimidyl)oxy-
6-bromohexanoate 10 (1.48 g, 5.1 mmol) in anhydrous THF
(3 mL). The reaction mixture was stirred for 12 hours under
an atmosphere of argon (Scheme 2). The resulting white solid
was filtered and recrystallised in hot ethanol to yield ester 11
(1.14 g, 84%) as a white solid; mp: 185–186 ◦C; vmax/cm−1 2929br
=
(C O), 1508s (NO2), 1247s (O-H), 1033s (C–OH); dH (400 MHz,
CDCl3) 1.21–1.28 (13 H, m, 6 × CH2, CH2NH), 1.53 (3 H, d, J
7.0, CH3CHNH), 1.45–1.60 (4 H, m, 2 × CH2), 1.76 (2 H, app
quin, J 6.7, CH2), 1.96 (2 H, app quin, J 6.7, CH2), 2.12–2.17
(5 H, m, 2 × CH2, OH), 3.72 (2 H, t, J 6.2, CH2OH), 3.78 (3
H, s, CH3O), 3.93 (3 H, s, CH3O), 4.09 (2 H, t, J 6.2, CH2OCar),
5.49 (1 H, quin, J 7.1, CHNH), 6.32 (1 H, d, J 7.0, CHNH),
6.81 (2 H, d, J 8.8, 2 × CHar), 6.90 (1 H, s, CHar), 7.17 (2 H, t,
J 7.3, 2 × CHar), 7.27 (4 H, t, J 7.7, 4 × CHar), 7.38 (2 H, d,
J 8.8, 2 × CHar), 7.47 (4 H, d, J 7.8, 4 × CHar), 7.55 (1 H, s,
CHar); dC (100 MHz, CDCl3) 20.91 (CH3CHNH), 25.52 (CH2),
25.62 (CH2), 7.35 (CH2), 29.25 (CH2), 29.30, (CH2), 29.39 (CH2),
29.45 (CH2), 29.51 (CH2), 29.58 (CH2), 30.86 (CH2), 36.68 (CH2),
43.60 (CH2), 47.67 (CHNH), 55.17 (OCH3), 56.33 (OCH3), 60.37
(CH2), 62.25 (CH2OH), 69.29 (CH2OC), 70.41 (C), 109.85 (CH),
111.06 (CH), 113.02 (2 × CH), 126.07 (2 × CH), 127.69 (4 × CH),
128.59 (4 × CH), 129.82 (2 × CH), 133.71 (C), 140.65 (2 × C),
146.05 (C), 147.05 (C), 153.65 (C), 157.78 (C), 171.12 (C); LRMS
(ES+) 740.5 (M + H)+ (100%), HRMS (ES+) m/z 740.4261 (M +
H)+, C44H58N3O7 requires 740.4270.
=
=
=
(CH2, CH3), 1810m, 1720m (C O), 1717s (C O), 1480m (C O),
=
=
1420w (C O), 1369m (C O), 1209s, 1050s, 1003w; dH (300 MHz,
CD3OD) 1.52–1.64 (2 H, m, CH2), 1.80–1.97 (4 H, m, 2 × CH2),
2.78 (2 H, t, J 7.0, COOCH2), 2.91 (4 H, s, COCH2CH2CO), 3.21 (9
H, s, 3 × N(CH3)), 3.41–3.45 (2 H, m, CH2); dC (75 MHz, CD3OD)
23.43 (CH2), 25.04 (CH2), 26.39 (CH2), 26.54 (COCH2CH2CO),
31.24 (COOCH2), 53.60 (3 × N(CH3)), 67.63 (CH2N), 170.19
(COO), 171.92 (2 × NCO); LRMS (ES+) 270.9 (M)+ (100%),
HRMS (ES+) m/z 271.1649 (M)+, C13H23N2O4 requires 271.1652.
Synthesis of oligonucleotides
Standard DNA phosphoramidites, solid supports and additional
reagents were purchased from Link Technologies or Applied
Biosystems Ltd. All oligonucleotides were synthesised on an
Applied Biosystems 394 automated DNA/RNA synthesiser using
a 0.2 or 1.0 lmole phosphoramidite cycle of acid-catalysed
detritylation, coupling, capping and iodine oxidation. All b-
cyanoethyl phosphoramidite monomers were dissolved in anhy-
drous acetonitrile to a concentration of 0.1 M immediately prior
11-(4-Methoxytritylamino)-N-(1-{4-[4-O-(2-cyanoethoxy-diiso-
propylaminophosphinoxy)butoxy]-3-methoxy-6-nitrophenyl}ethyl)-
undecanamide (8). Amide 7 (1.00 g, 1.4 mmol), 2-cyanoethoxy-
Scheme 2 Synthesis of derivatising reagent.
The Royal Society of Chemistry 2007
This journal is
Org. Biomol. Chem., 2007, 5, 1878–1885 | 1883
©

View Article Online
to use. Monomer 8 was coupled for 300 seconds rather than
the standard 25 sec. Stepwise coupling efficiencies and overall
yields were determined by the automated trityl cation conductivity
monitoring facility and in all cases were >98.0%. Cleavage of
oligonucleotides from the solid support was achieved by exposure
to concentrated ammonia solution (30 min at room temp) followed
by heating in conc. aqueous ammonia, 55 ◦C for 5 hours in a
sealed tube. SBE primers were manually functionalised with the
appropriate peptides prior to cleavage from the solid support (see
below).
the Tm values determined from the maximum of the first order
derivative of the average of three cycles.
PCR amplification
DNA (4 ng) containing the polymorphic sites H00073, H00247
and H16129 were amplified from mitochondrial DNA in a total
volume of 20 lL, containing 10 pmol each primer (L16048,
5ꢀ-TCATGGGGAAGCAGATTTGG-3ꢀ; H00326, 5ꢀ-CAGA-
GATGTGTTTAAGTGCTGT-3ꢀ), 200 lM dNTPs (Promega,
Madison, WI), 1.5 mM MgCl2 (Promega, Madison, WI), 1.5 U
Taq DNA polymerase in storage buffer B (Promega, Madison,
WI) and 1X PCR buffer B (10 mM Tris-HCl, 50 mM KCl,
All oligonucleotides were purified by reversed phase HPLC
on a Gilson system controlled by Gilson 7.12 software using an
˚
ABI Aquapore column (C8), 8 mm × 250 mm, pore size 300 A.
R
0.1% TritonꢀX-100, pH 9.0). Using an Eppendorf Mastercycler
The following protocol was used: Run time 30 min, flow rate
4 mL min−1, binary system, gradient: time in min (% buffer B)
0 (0); 3(0); 5(20); 21 (100); 25(100); 27 (0); 30(0). Elution buffer
A: 0.1 M ammonium acetate, pH 7.0, buffer B: 0.1 M ammonium
acetate with 35% acetonitrile pH 7.0. Elution of oligonucleotides
was monitored by ultraviolet absorption at 295 nm. After HPLC
purification oligonucleotides were desalted using disposable NAP
10 Sephadex columns (Pharmacia), aliquoted into Eppendorf
tubes and stored at −20 ◦C in the dark.
gradient PCR system, the reactions were initiated with denatur-
ation at 95 ◦C for 2 min, followed by 30 cycles of 94 ◦C for 30 s,
58 ◦C for 30 s, 72 ◦C for 60 s and subsequently held at 72 ◦C for
3 min. Excess dNTPs and primers were degraded by adding 2 U
Escherichia coli exonuclease I (USB, Cleveland, Ohio) and 2 U
shrimp alkaline phosphatase (Roche Diagnostics, Indianapolis,
IN) in 1 × shrimp alkaline phosphatase buffer (50 mM Tris-HCl,
5 mM MgCl2, pH 8.5). The samples were incubated at 37 ◦C
for 45 min followed by enzyme denaturation at 95 ◦C for
15 min.
Synthesis of derivatised mass tagged SBE primers
Oligonucleotides with phosphoramidite 8 at the 5ꢀ-end were pre-
pared on a 1 lmol scale by standard solid-phase phosphoramidite
methods. The columns were removed from the synthesiser and
manually washed according to the method of Zaramella et al.15
with morpholine (1 mL, 2% in MeCN) for 1 minute, followed by
MeCN (8 × 1 mL) and DMF (3× 1 mL) prior to the addition of the
photocleavable amino linker. Solid phase coupling of derivatised
peptides to the amino-modified oligonucleotide was achieved with
peptide–HBTU–N-methylmorpholine (25 : 25 : 108) in DMF
(300 lL) overnight. The resultant yellow coupling solution was
removed and the column washed with DMF (4 × 1 mL), ether
(2 × 1 mL) and dried. The oligonucleotides were cleaved from
the solid support, deprotected and purified by HPLC as described
above.15
Single base extension
The sequence and masses of the mass tagged SBE primers used
for detecting the three SNPs are shown in Table 1. Optimised SBE
reactions contained 3 lL Exo I and SAP treated PCR product,
80 pmol each primer, 100 pmol biotin-11-ddCTP (PerkinElmer,
Boston, MA), 100 pmol each ddATP, ddGTP, ddTTP (all Roche
Diagnostics, Indianapolis, IN), 4 lL Thermo Sequenase reaction
buffer (260 mM Tris-HCl, 65 mM MgCl2, pH 9.5), 1.92 U
Thermo Sequenase (Amersham Biosciences) in a total volume
of 20 lL. Reactions were cycled 35 times at 94 ◦C for 30 s and
52 ◦C for 30 s.
The molecular masses of the conjugates were verified by ESMS
in negative mode as solutions diluted 5-fold in MeCN–H2O–TPA
(100 : 100 : 1). Molecular weights were reconstructed from the
m/z values of the multiply deprotonated molecules using the mass
deconvolution programme MassEnt (Maximum Entropy).
Solid phase purification
20 lL of Dynabeads M-270 streptavidin (Invitrogen) were pre-
washed with binding and washing (B–W) buffer (0.5 mM Tris-
HCl, 2 M NH4Cl, 1 mM EDTA, pH 7.0), and resuspended in
20 lL B–W buffer. 20 lL SBE products were added to the beads
and bound by incubating at 48 ◦C for 45 min. Captured products
were washed with B–W buffer (×3), with distilled water (×3) and
resuspended in 2 lL deionised water.
UV-melting studies
The UV absorbance vs. temperature profiles were obtained
simultaneously at 260 nm using an intra-cuvette temperature
R
probe on a ChemCary 400 UV Visible spectrometer in Hellmaꢀ
MALDI-TOF MS analysis
SUPRASIL synthetic quartz, 10 mm pathlength cuvettes. The
SBE primers, with or without conjugated mass tags, and their
exact complements were each at a concentration of 1 lM in
52 mM Tris, 13 mM MgCl2 pH 9.5 in a volume of 1.5 mL. The
samples were filtered with Kinesis regenerated cellulose 13 mm,
0.4◦5 lM syringe filters and rapidly heated from 20 ◦C to 80 ◦C at
10 C min−1 then cooled to 20 ◦C prior to analysis. The UV melting
curves were recorded for three consecutive heat and cool cycles.
The temperature was increased in increments of 0.5 ◦C min−1 and
1 lL of the suspended purified captured extension products were
directly pipetted onto a MALDI sample platen followed by 1 lL
matrix (DHB in MeCN : H2O 1 : 1, 0.1% TFA) and air dried.
Samples were analysed using a Micromass TofSpec2E MALDI-
TOF MS spectrometer. Positive ion reflectron data was acquired
at an accelerating voltage of 20 kV, a 3000 V pulse voltage, and a
39 ns delay time. Approximately 100 laser shots were averaged to
produce the final mass spectrum in each case.
1884 | Org. Biomol. Chem., 2007, 5, 1878–1885
This journal is
The Royal Society of Chemistry 2007
©

View Article Online
3 P.-Y. Kwok, Annu. Rev. Genomics Hum. Genet., 2001, 2, 235–258.
Conclusions
4 A. C. Syvanen, Nat. Rev. Genet., 2001, 2, 930–942.
5 A.-C. Syvanen, K. Aalto-Setala, L. Harju, K. Kontula and H.
Soderlund, Genomics, 1990, 8, 684–692.
A novel, indirect method to genotype SNPs, employing MALDI-
TOF MS detection, is described. The use of peptidic mass tags
avoids problems present with direct detection of DNA by MS,
whilst extension with biotinylated ddNTPs allows solid phase
capture and removal of unextended mass tag-SBE primers. The
multiplexed assay can be easily extended to genotype many more
SNPs simultaneously.
6 W. Pusch, J.-H. Wurmbach, H. Thiele and M. Kostrzewa, Pharmacoge-
nomics, 2002, 3, 537–548.
7 T. J. Griffin and L. M. Smith, Trends Biotechnol., 2000, 18, 77–84.
8 D. Lechner, G. M. Lathrop and I. G. Gut, Curr. Opin. Chem. Biol.,
2002, 6, 31–38.
9 J. Tost and I. G. Gut, Clin. Biochem., 2005, 38, 335–350.
10 S. Sauer, D. Lechner, K. Berlin, H. Lehrach, J.-L. Escary, N. Fox and
I. G. Gut, Nucleic Acids Res., 2000, 28, e13.
11 S. Sauer and I. G. Gut, Rapid Commun. Mass Spectrom., 2003, 17,
Acknowledgements
1265–1272.
12 J. Olejnik, H. C. Ludemann, E. Krzymanska-Olejnik, S. Berkenkamp,
F. Hillenkamp and K. J. Rothschild, Nucleic Acids Res., 1999, 27, 4626–
4631.
We thank the EPSRC for supporting this research.
13 X. Bai, S. Kim, Z. Li, N. J. Turro and J. Ju, Nucleic Acids Res., 2004,
32, 535–541.
References
14 C. P. Holmes, J. Org. Chem., 1997, 62, 2370–2380.
15 S. Zaramella, E. Yeheskiely and R. Stro¨mberg, J. Am. Chem. Soc., 2004,
126, 14029–14035.
16 M. Bartlet-Jones, W. Jeffery, H. Hansen and D. Pappin, Rapid Commun.
Mass Spectrom., 1994, 8, 737–742.
1 NIH/CEPH Collaborative Mapping Group, Science, 1992, 258,
67–86.
2 G. Tully, K. M. Sullivan, P. Nixon, R. E. Stones and P. Gill, Genomics,
1996, 34, 107–113.
This journal is
The Royal Society of Chemistry 2007
Org. Biomol. Chem., 2007, 5, 1878–1885 | 1885
©