Methylisoindigo and its bromo-derivatives are selective tyrosine kinase inhibitors, repressing cellular stat3 activity, and target CD133+ cancer stem cells in PDAC

Article abstract of DOI:10.3390/molecules22091546

Indirubin is an active component of the herbal ingredient 'Danggui Longhui wan', which was used for the treatment of inflammation and chronic myeloid leukemia in China. The recent study showed its derivative methylisoindigo (also known as meisoindigo) preferentially targeting cancer stem cells (CSCs) in interference with AMPK and LKB1, the cellular metabolic sensors. In this study, we screened the effect of meisoindigo on a panel of 300 protein kinases and found that it selectively inhibited Stat3-associated tyrosine kinases and further confirmed its activity in cell based assays. To gain a deeper insight into the structure-activity relationship we produced 7 bromo-derivatives exhausting the accessible positions on the bisindole backbone except for in the 4-position due to the space limitation. We compared their anti-proliferative effects on tumor cells. We found that 6-bromomeisoindigo showed improved toxicity in company with increased Stat3 inhibition. Moreover, we detected that 6-bromomeisoindigo induced apoptosis of 95% of CD133+ pancreatic cancer cells. Considering that CD133 is a common marker highly expressed in a range of CSCs, our results imply the potential application of 6-bromomeisoindigo for the treatment of CSCs in different types of cancers.

Full text of DOI:10.3390/molecules22091546

molecules
Article
Methylisoindigo and Its Bromo-Derivatives Are
Selective Tyrosine Kinase Inhibitors, Repressing
Cellular Stat3 Activity, and Target CD133+ Cancer
Stem Cells in PDAC
Jana Tegethoff 1,†, Roland Bischoff 2,†, Sawsan Saleh 1, Biljana Blagojevic 1, Karl-Heinz Merz 2
and Xinlai Cheng 1,
*
ID
1
Department of Pharmacy and Molecular Biotechnology, Division of Pharmaceutical Biology,
University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg, Germany;
jana.tegethoff@gmail.com (J.T.); sawsanalisaleh@gmail.com (S.S.); blagojevicbiljana@yahoo.com (B.B.)
Department of Chemistry, Division of Food Chemistry and Toxicology, University of Kaiserslautern,
Erwin-Schrödinger-Strasse 52, D-67663 Kaiserslautern, Germany; roland@bischoffonline.de (R.B.);
karlheinz_merz@yahoo.de (K.-H.M.)
2
*
†
Correspondence: x.cheng@uni-heidelberg.de; Tel.: +49-6221-546431; Fax: +49-6221-544884
These authors contributed equally to this work.
Received: 7 August 2017; Accepted: 11 September 2017; Published: 13 September 2017
Abstract: Indirubin is an active component of the herbal ingredient ‘Danggui Longhui wan’,
which was used for the treatment of inflammation and chronic myeloid leukemia in China. The recent
study showed its derivative methylisoindigo (also known as meisoindigo) preferentially targeting
cancer stem cells (CSCs) in interference with AMPK and LKB1, the cellular metabolic sensors.
In this study, we screened the effect of meisoindigo on a panel of 300 protein kinases and found
that it selectively inhibited Stat3-associated tyrosine kinases and further confirmed its activity in
cell based assays. To gain a deeper insight into the structure–activity relationship we produced
7 bromo-derivatives exhausting the accessible positions on the bisindole backbone except for in the
4-position due to the space limitation. We compared their anti-proliferative effects on tumor cells.
We found that 6-bromomeisoindigo showed improved toxicity in company with increased Stat3
inhibition. Moreover, we detected that 6-bromomeisoindigo induced apoptosis of 95% of CD133+
pancreatic cancer cells. Considering that CD133 is a common marker highly expressed in a range of
CSCs, our results imply the potential application of 6-bromomeisoindigo for the treatment of CSCs in
different types of cancers.
Keywords: indirubin; meisoindigo; cancer stem cells; Stat3 inhibitor; selective protein kinase inhibitor;
TCM; structure-activity-relationship
1. Introduction
Indigo, a natural 2,20-bisindole, is one of the most su0ccessful natural pigments with an annual
consumption of several thousand tons (Figure 1) [1]. Its 3,2 -isoform, also known as indirubin, is used
in China for treatment of chronic myeloid leukemia (CML). Clinical trials in the 1970s proofed the
anti-leukemic effect of indirubin with mild side-effects [ ]. However, the potential of indirubin for
clinical application is limited by its extremely low water solubility. A number of follow-up studies
2
were performed by either chemical modification [3–5] or lipid-based formulation [6–8] to improve
its bioavailability. Isoindigo is a synthetic 3,30-bisindole (Figure 1). Its N-methylated derivative
(methylisoindigo, also known as meisoindigo) showed less side-effects and better bioavailability in
animals and patients [2].
Molecules 2017, 22, 1546; doi:10.3390/molecules22091546
www.mdpi.com/journal/molecules

Molecules 2017, 22, 1546
2 of 16
Results from recent studies indicated that the anti-tumorigenic effect of indirubin and
its derivatives is majorly based on the potent inhibition of multiple protein kinases [ 10].
The identified target kinases include glycogen synthase kinase 3 (GSK-3 ), cyclin-dependent kinases
]. By contrast, little is known about the effect of meisoindigo
9,
β
β
(CDKs) [9,11,12], CK2 [13], and IGF-1R [
3
on protein kinases [14].
Recently, Hoheisel and his co-workers established a new primary pancreatic cell line, JoPaca-1,
derived from a male patient suffering from pancreatic ductal adenocarcinoma [15]. This cell line
contains a large population of cancer stem cells (CSCs) expressing stem cell markers CD133 [16,17].
Using this cell line as a model, we found that meisoindigo preferentially kills CD133 positive cells due
to the inference with cellular metabolic signaling pathways involving AMPK and LKB1 [18]. CSCs are
a sub-population of cancer cells that obtains the main features of stem cells: self-renewal, the capacity
to strongly proliferate, and to develop into multiple lineages [18]. Former results revealed that
they contribute to tumor initiation, formation of metastases, drug-resistances, and relapse in several
cancers [19], like pancreatic cancer [20] and acute myeloid leukemia [21]. Thus, drugs inhibiting CSCs
might be pioneering drugs for development of more efficient chemotherapy with expectations of
eradicating metastases and preventing relapse [22].
In vitro and in vivo studies showed that indirubin derivatives are potent Src family kinases (SFKs)
inhibitors [12
and activator of transcription 3 (Stat3) [29], indirubin derivatives remarkably inhibit cellular Stat3
activity [26 28]. Stat3 is a key mediator of proliferation, cell cycle progression, angiogenesis, survival,
,23–28]. Since SFKs are major kinases to regulate the activation of signal transducer
–
and differentiation. Persistently active Stat3 has been found in various tumor types and tissues
including leukemias [30], cervical [31], colorectal [32], and pancreatic cancer [33], which contributes to
tumor initiation, progression, invasion, migration, and formation of metastases [34,35]. In addition,
Stat3 plays an important role in the maintenance of stem cell-like properties such as self-renewal in
embryonic stem cells and pancreatic CSCs [36,37].
Figure 1. Structures of bisindoles: indigo, indirubin, isoindigo, and N-methylisoindigo (meisoindigo).
Thus, Stat3 could be a potential target of meisoindigo involved in its negative regulation of
CD133+ CSCs. In this work, we performed protein kinase profiling using a panel of 300 protein
kinases and found that meisoindigo selectively inhibited tyrosine kinases related to Stat3 activity
in vitro as well as in vivo, confirmed by cell-based assays. We investigated the structure–activity
relationship by studying the anti-proliferative effects of newly synthesized novel bromo-meisoindigos.
The results show that only 6-bromo-meisoindigo enhanced the inhibition on both Stat3 activity and

Molecules 2017, 22, 1546
3 of 16
cell proliferation, suggesting the limitation of access for chemical modification towards a protein
kinase inhibitor.
2. Results and Discussion
2.1. Chemistry
The lack of systematic evaluation of the chemical accessibility of positions on bisindole
backbone inspired us to synthesize various bromo-meisoindigos. Those novel meisoindigo
derivatives (
methyloxindoles or methylated bromoisatins with oxindoles, as showed in Scheme 1 [13
Bromo-isatins were synthesized by acidic cyclization of bromo-isonitrosoacetanilides achieved in
the reaction of bromoanilines with chloral hydrate and hydroxylamine hydrochloride [ ]. In the case
1–
7) were obtained by acidic condensation of corresponding bromoisatins with either
,
18].
3
of 3-bromoaniline, the formation of a mixture of 4- and 6-bromoisatins was observed and could be
separated by fractionated precipitation. Bromoisatins reacted further with dimethylsulfate in dried
dimethylformamide (DMF) containing NaH as base under nitrogen atmosphere to afford methylated
products. Because of the steric hindrance, we produced 40-bromo-meisoindigo in an extremely low
yield (<10%) and failed to synthesize 4-bromo-1-meisoindigo. All chemical structures of compounds
are listed in Table 1.
Scheme 1. Synthesis of bromo-meisoindigo derivatives (
) H2SO4; ( ) (CH3O)SO2, NaH, DMF; (
derivative in this position due to steric hindrance.
a
) CCl3CH(OH)2, NH2OH
·
HCl, H2O, Na2SO4;
◦
(b
c
d
) HOAc/HCl 100:1, 120–128 C, 3.5 h, X: unable to obtain the
Table 1. Chemical structures of novel-bromomeisoindigos.
Nr
Compounds
Nr.
Compounds
0
4
5
6
7
4 -bromo-meisoindigo
0
1
2
3
5-bromo-meisoindigo
6-bromo-meisoindigo
7-bromo-meisoindigo
5 -bromo-meisoindigo
0
6 -bromo-meisoindigo
0
7 -bromo-meisoindigo

Molecules 2017, 22, 1546
4 of 16
2.2. Biology
2.2.1. Meisoindigo Is a Selective Stat3-Related Tyrosine Kinase Inhibitor
Results from biological studies implied that meisoindigo might target distinct protein kinases
in comparison to indirubin [ ]. To gain a better insight in its mechanism of action we screened the
inhibitory effect of meisoindigo in a panel of 300 human protein kinases. As shown in Figure 2a and
supplementary information, meisoindigo (20 M) was a highly selective tyrosine kinase inhibitor
with a selective score of 0.07 (calculated as the number of kinases with residual activity <50%
divided by 300). Interestingly, most of them are involved in the regulation of Stat3 activity [34 38 39],
9
µ
,
,
including growth factor-related receptor tyrosine kinases, insulin-like growth factor receptor 1 (IGF-R1),
fibroblast growth factor receptor 2 (FGF-R2), vascular endothelia growth factor receptor 2 (VEGF-R2),
and FGF-R3 [39,40], as well as Trk-B, Ron, Ret, and Mertk which activate Stat3 directly or via
interleukin 6 and MAPK/Erk-associated signaling [41
–44] and Src family kinases (SFKs), such as
Lyn, Fyn, Src, Lck, Yes [29,45–47], Breast tumor kinase (BRK), Fes, and Fer [48–50].
Figure 2. (a) Kinase profiling of meisoindigo at 20 µM against 300 human kinases. Circles show
inhibited kinases, the size indicates the strength of inhibition. Kinases inhibited more than 50% are
marked red including only tyrosine kinases (TKs). The graphic was generated using KinMap beta
developed by BioMedX; (
manner. HeLa cells were incubated with meisoindigo for 30 min. The whole cell lysate was used for
immunoblot. Specific antibodies against Stat3 and phospho-Stat3 (Y705) were applied. -actin served
as loading control and 0.1% DMSO as mock; ( ) Meisoindigo inhibited Stat3 activation in HeLa cells in
a time-dependent manner. Cells were treated at 5 M as indicated and immunoblot was performed;
) Meisoindigo inhibited Stat3 activation in JoPaca-1 cells in a dose-dependent manner. JoPaca-1 cells
b) Meisoindigo inhibited Stat3 activation in HeLa cells in a dose-dependent
β
c
µ
(
d
were treated for 2 h as indicated and immunoblot was performed.
2.2.2. Meisoindigo Inhibits Cellular Stat3 Activation in Time and Concentration Dependent Manner
We investigated the influence of meisoindigo on Stat3 activity in HeLa cells by measuring the
level of phospho-Stat3. The immunoblot result confirmed that meisoindigo inhibited cellular Stat3 up
a concentration of 5
JoPaca-1 cells are more resistant and the reduction of phospho-Stat3 was observed upon treatment of
20 M for 2 h (Figure 2d). In both cell lines pan-Stat3 remained unaffected. Given that persistent Stat3
activation drives tumor initiation and progression [34] and mediates stemness in pancreatic CSCs,
µM (Figure 2b), which occurred as early as 15 min upon treatment (Figure 2c).
µ

Molecules 2017, 22, 1546
5 of 16
the anti-proliferative effect of meisoindigo and its inhibition on CSCs reported previously [18] might
partially depend on Stat3.
2.2.3. Anti-Proliferative Effect of Novel Bromo-Meisoindigos
We tested anti-proliferative effects of newly synthesized bromo-meisoindigos on HeLa, HCT116,
0
and JoPaca-1 cells. Out of seven compounds 6-, 7- and 5 -bromo-meisoindigo showed the reduction of
cellular viability with IC50 values lower than 50 µM in all three cell lines, while the introduction in
the 5- and 70-positions completely blocked the activity. It seems that the substituent in the 4-position
interrupts the planar structure of meisoindigo and results in the inactivation. Comparison to the
binding of indirubin to CDK2 in ATP-binding pocket [
9
], H-bridges might be formed between
0
1 -NH-CO of meisoindigos and target protein kinases (Figure 3), which could explain the strong impact
caused by substitution in 5- and 70-position. Moreover, we measured the toxicity of meisoindigo
and its 6-bromo-derivative in human primary fibroblasts and found that both were not toxic at the
concentration lower than 50 µM (Table 2), implying that meisoindigos preferentially target cancer
cells. Thus, 6-Bromo-meisoindigo emerged as the most active compound and was selected for
further analysis.
Figure 3. Assumed binding site and potential accesses for chemical modification of isoindigo.

Molecules 2017, 22, 1546
6 of 16
Table 2. IC50 values of compounds in HeLa, HCT116, and JoPaca-1 cells tested by MTT assay.
0
0
0
0
IC50/Cell
Line
5-Bromo-
Meisoindigo
6-Bromo-
Meisoindigo
7-Bromo-
Meisoindigo
4 -Bromo-
5 -Bromo-
6 -Bromo-
7 -Bromo-
Meisoindigo
Meisoindigo
Meisoindigo
Meisoindigo
Meisoindigo
HeLa
HCT116
JoPaca-1
HF
72 h
72 h
72 h
72 h
9.53 ± 1.09
9.09 ± 1.13
13.92 ± 1.39
>50
>100
>100
>100
n.t.
5.84 ± 0.40
7.55 ± 1.05
10.52 ± 1.67
>50
24.69 ± 6.64
26.34 ± 9.63
13.15 ± 0.99
n.t.
>50
n.t.
>50
n.t.
18.32 ± 3.22
21.96 ± 3.22
13.04 ± 1.49
n.t.
17.71 ± 1.98
16.17 ± 1.73
>100
>100
>100
>100
n.t.
n.t.
n.t.: not tested.

Molecules 2017, 22, 1546
7 of 16
2.2.4. 6-Bromo-Meisoindigo Inhibits Stat3 Activity and Induces Cell Cycle Arrest in HeLa Cells
Upon phosphorylation at tyrosine 705 (Y705), Stat3 is activated, dimerizes, and translocates
into the nucleus to promote downstream gene expression [ 38 39]. Thus, nucleic translocation of
1
, ,
cytosolic Stat3 is of importance for activation of Stat3 downstream gene expression [51]. We recruited
immunocytochemistry and clearly showed the reduction of nucleic phospho-Stat3 upon treatment
with either meisoindigo (5
further confirmed the reduction in the level of total cellular phospho-Stat3 up a concentration of
M (Figure 4b), while pan-Stat3 remained constant. Since Stat3 regulates cell cycle progression [52],
µM) or 6-bromo-meisoindigo (1 µM) in HeLa cells (Figure 4a). Immunoblot
1
µ
we determined cell cycle progression in living HeLa cells using FACS (fluorescence-activated cell
sorting) analysis. In the presence of 6-bromo-meisoindigo, cells accumulated in the G2 and M phases
instead of progressing to G1 phase (Figure 4c).
Figure 4.
treated as indicated and fixed in formaldehyde. Specific antibodies against phospho-Stat3 (Y705)
and Hoechst stain were used for immunocytochemistry assay; ( ) 6-bromo-meisoindigo reduced
(a) Meisoindigo and 6-bromo-meisoindigo reduced Stat3 activity in HeLa cells. Cells were
b
Stat3 activity in HeLa cells in a dose-dependent manner. HeLa cells were incubated with compound
for 30 min. The whole cell lysate was used for immunoblot. Specific antibodies against Stat3 and
phospho-Stat3 (Y705) were applied.
β-actin served as loading control and 0.1% DMSO as mock;
(c) 6-bromo-meisoindigo induced a G2/M cell cycle arrest in HeLa cells, determined by FACS analysis.
2.2.5. 6-Bromo-Meisoindigo Inhibits Stat3 Activity in Jopaca-1 Cells
We analyzed Stat3 activity in JoPaca-1 cells in the presence/absence of 6-bromo-meisoindigo
by immunoblot and found 10 µM was sufficient to block phospho-Stat3 (Figure 5a). qRT-PCR using
cDNA synthesized with random primers from RNA isolated from 6-bromo-meisoindigo-treated
Jopaca-1 cells exhibited a clear reduction in the level of c-Jun and MAFF expression (Figure 5b),
downstream genes of Stat3 [53], while Stat3 expression was unaffected. c-Jun is a transcription factor
that mediates progression through G2/M phase and inhibition of apoptosis [54,55], in consistence that
6-bromo-meisoindigo induced cell-cycle arrest at G2/M in HeLa cells. MAFF is a transcription factor
that regulates oxidative stress response [56], suggesting disruption of cellular homeostasis might be
involved in meisoindigo and derivatives-induced apoptosis, like we showed previously [18].
We also compared the level of four apoptosis-related genes expression (Figure 5b). c-Myc,
an oncogene that is overactive in numbers of tumors and contributes to tumor initiation and
progression [57], was slightly suppressed in presence of 6-bromo-meisoindigo or meisoindigo for
24 h. p16 and p21 are CDK inhibitors and play important roles in the regulation of cell proliferation.

Molecules 2017, 22, 1546
8 of 16
Expression of both was strongly increased by 6-bromo-meisoindigo and meisoindigo suggesting
that observed cell cycle arrest at least partially depended on their inhibition of CDKs. ATF3 is
another apoptosis related gene and inhibits the activity of p53, a key mediator of apoptosis [58].
The expression of ATF3 was reduced upon treatment with 6-bromo-meisoindigo for two hours.
Results from phosphor-protein kinase microarray analysis (Figure 5c) confirmed that the activity
of GSK3ß and FAK was not affected by meisoindigo derivatives, while reduction of phosphor-Akt
was observed probably due to the inhibition of IGF-1R (Figure 2a and supplementary information).
Thus, ATF3 may play a role in the induction of apoptosis by meisoindigos. Taken together, we showed
that 6-bromo-meisoindigo inhibited Stat3 activity in JoPaca-1 cells and altered the expression of Stat3
related genes involved in the regulation of apoptosis and cell cycle.
Figure 5.
manner. Cells were incubated with compound for 30 min. The whole cell lysate was used for
immunoblot. Specific antibodies against Stat3 and phospho-Stat3 (Y705) were applied. -actin served
as loading control and 0.1% DMSO as mock; ( ) 6-bromo-meisoindigo altered expression of Stat3 related
transcription factors and apoptosis-related genes; ( ) Protein microarray analysis of phosphorylation of
(a) 6-Bromo-meisoindigo inhibits Stat3 activation in JoPaca-1 cells in a dose-dependent
β
b
c
protein kinases in 6-bromo-meisoindigo-treated Jopaca-1 cells.
2.2.6. 6-Bromo-Meisoindigo Induces Apoptosis in CD133+ Jopaca-1 Cells
Our recent results showed that meisoindigo suppressed CD133 expression, preferentially killed
CD133+ cells, and thereby impacted on the stemness of CSCs in JoPaca-1 cells [18]. We examined the
effect of newly synthesized bromo-meisoindigos on CD133+ cells in JoPaca-1 and found the general
inhibition of CD133 expression in the presence of bromo-meisoindigos (Figure 6a). Among those,
50-bromo-meisoindigo (Figure 6a) showed the highest activity. Previous results demonstrated that
CD133+ CSCs are very resistant to chemotherapeutic agents [15]. We interestingly found that nearly
60% and 90% of CD133+ CSCs were annexin v positive in the presence of 6-bromo-meisoindigo
at 5 and 20 µM (Figure 6b), implicating the high potential of 6-bromo-meisoindigo for treatment of
CD133+ CSCs, which might depend on its Stat3 inhibition.

Molecules 2017, 22, 1546
9 of 16
Figure 6.
CD133 expression was determined by FACS analysis and the mean value was normalized to mock
treatment; ( ) Meisoindigo and 6-bromo-meisoindigo induced apoptosis in JoPaca-1 cells. Cells were
(a) Bromo-meisoindigos reduced CD133+ population in JoPaca-1 cells. The percentage of
b
treated as indicated for 24 h and FACS analysis was performed.
3. Experimental Section
3.1. Materials
pStat3Tyr705 (9145), Stat3 (9139) primary antibodies, and Alexa Flour 488 Phalloidin (8878)
were purchased from Cell Signaling Technology (Danvers, MA, USA). β-actin primary antibody and
HRP-coupled secondary anti-mouse and anti-rabbit antibodies were from Santa Cruz Biotechnology
(Santa Cruz, CA, USA). Fluorochrome-coupled Goat IgG anti-rabbit IgG Alexa Flour 594 was
bought from dianova (Hamburg, Germany). DMEM, RPMI 1640 medium, fetal bovine serum
(FBS), Penicillin/Streptomycin (Pen/Strep) and PBS were purchased from Gibco by Life Technologies
(Carlsbad, CA, USA).
3.2. Synthesis of Bromo-Meisoindigo Derivatives
A mixture of 2-bromoaniline or 3-bromoaniline (110 mmol, 18.9 g), chloral hydrate (118.8 mmol,
19.6 g), anhydrous sodium sulfate (880 mmol, 125 g), and hydroxylamine hydrochloride (347.6 mmol,
24.2 g) in water (700 mL) was heated under reflux for 25 min to form a yellow precipitate.
50 vmL of ethanol was added after that and left to boil for another 4 m◦in before filtration. The resulted
isonitrosoacetanilide was then heated with sulfuric acid (150 mL) at 70 C for about 10 min then poured
into ice water to form an orange precipitate. When using 3-bromoaniline, an extra step of separation is
required by solving the resulted mixture in 0.25 M NaOH (1 L), filtering it, then adding acetic acid
(100 mL) to afford 4-bromoistain as a precipitate. 6-Bromoistin can be then obtained when lowering
the pH of the solution to 1 by hydrochloric acid 37%.
All substituted bromo-isatins were methylated by stirring (22 mmol, 4.97 g) with sodium
hydride (2 mmol, 0.968 g) and dimethylsulfate (23.1 mmol, 2.19 mL) in dried DMF (50 mL) under
nitrogen atmosphere. The resulting mixture was poured after 2 h in ice water (100 mL) to form an
orange precipitate.
The methylated bromo-isatins (2 mmol, 0.480 g) were treated after that with oxindole (2 mmol,
0.226 g) in a 100:1 mixture of glacial acetic acid and hydrochloric acid 37% (12 mL) in reflux for
about 3 h. Then, they were poured in ice water (50 mL) to afford 5-, 6- and 7-bromomeisoindigo.

Molecules 2017, 22, 1546
10 of 16
While 40-, 50-, 60- and 70-bromomeisoindigo were obtained by reacting unmethylated bromo-isatins
(2 mmol, 0.452 g) with 1-methyloxindole (2 mmol, 0.294 g) in the same conditions. The resulted
precipitates were washed with water, ethanol (2 × 10 mL), and diethylether (2 × 10 mL) then dried.
3.2.1. 5-Bromo-1-Meisoindigo
Yield: 70%. 1H-NMR (400 MHz, DMSO, d6) ppm 3.19 (s, 3H), 6.83 (dd, 3J = 7.8 Hz, 4J = 0.5 Hz, 1H)
δ
6.96 (m, 1H), 6.97 (d, 3J = 8.4 Hz, 1H), 7.35 (td, 3J = 7.6 Hz, 4J = 1.1 Hz), 7.58 (dd, 3J = 8.4 Hz, 4J = 2.1 Hz),
9.06 (dd, 3J = 8.1 Hz, 4J = 0.5 Hz), 9.31 (d, 4J = 2.0 Hz, 1H), 10.94 (s, 1H). 13C-NMR (100 MHz, DMSO,
d6)
δ ppm 26.6, 110.2, 110.7, 114.0, 121.8, 121.9, 123.0, 130.2, 131.1, 131.5, 133.8, 134.8, 135.6, 144.4, 145.0,
167.2, 169.3. Anal. calcd. for C17H11BrN2O2: C 57.49, H 3.12, N 7.89; found: C 57.44, H 3.18, N 793.
HRMS (ESI) calculated m/z: 376.9896; found C17H11BrN2O2; m/z: 376.9896 [M + H]+.
3.2.2. 6-Bromo-1-Meisoindigo
Yield: 83%.1H-NMR (400 MHz, DMSO, d6) ppm 3.17 (s, 3H), 6.79 (dd, 3J = 7.7 Hz, 4J = 0.5 Hz,
δ
1H), 6.93 (td, 3J = 7.8 Hz, 4J = 1.1 Hz 1H), 7.17 (dd, 3J = 8.5 Hz, 4J = 2.0 Hz, 1H), 7.21 (d, 4J = 1.9 Hz, 1H),
7.32 (td, 3J = 7.6 Hz, 4J = 1.2 Hz, 1H), 8.97 (d, 3J = 8.5 Hz, 1H), 9.02 (dd, 3J = 7.6 Hz, 4J = 0.6 Hz, 1H),
10.9 (s, 1H). 13C-NMR (100 MHz, DMSO, d6)
δ ppm 26.3, 109.7, 111.5, 119.9, 121.3, 124.3, 125.6, 129.5,
130.3, 130.9, 133.1, 134.3, 144.4, 146.2, 167.1, 168.9. Anal. calcd. for C17H11BrN2O2: C 57.49, H 3.12,
N 7.89; found: C 57.43, H 3.25, N 7.87. HRMS (ESI) calculated m/z: 376.9896; found C17H11BrN2O2;
m/z: 376.9896 [M + H]+.
3.2.3. 7-Bromo-1-Meisoindigo
3
Yield: 40%. 1H-NMR (400 MHz, DMSO, d6)
δ
ppm 3.53 (s, 3H), 6.8 (d, J = 7.7 Hz, 1H),
3
3
4
3
6.92 (t, J = 8.0 Hz, 1H), 6.93 (m, 1H), 7.23 (td, J = 7.7 Hz J = 0.9 Hz, 1H), 7.52 (dd, J = 8.0 Hz,
4J = 0.7 Hz, 1H), 8.92 (d, J = 8.0 Hz, 1H), 9.07 (dd, J = 7.9 Hz, J = 0.8 Hz, 1H), 10.9 (s, 1H).
3
3
4
13C-NMR (100 MHz, DMSO, d6)
δ
ppm 29.7, 101.3, 109.7, 121.2, 121.6, 123.0, 124.0, 127.9, 129.6,
130.6, 133.4, 135.1, 137.3, 141.6, 144.5, 167.5, 168.5. Anal. calcd. for C17H11BrN2O2: C 57.49, H 3.12,
N 7.89; found: C 57.86, H 3.03, N 7.91. HRMS (ESI) calculated m/z: 376.9896; found C17H11BrN2O2;
m/z: 376.9896 [M + H]+.
3.2.4. 40-Bromo-1-Meisoindigo
1
Yield: 3.5%. H-NMR (400 MHz, DMSO, d6)
δ
ppm 3.2 (s, 3H), 6.83 (dd, 3J = 7.4 Hz, 4J = 1.1 Hz,
1H), 7.03 (d, 3J = 7.8 Hz, 1H), 7.05 (td, 3J = 8.1 Hz 4J = 1.0 Hz, 1H), 7.16 (dd, 3J = 8.1 Hz, 4J = 1.0 Hz, 1H),
7.21 (m, 1H), 7.45 (td, 3J = 7.8 Hz, 4J = 1.0 Hz, 1H), 8.62 (d, 3J = 7.6 Hz, 1H), 10.93 (s, 1H). 13C-NMR
(100 MHz, DMSO, d6)
δ ppm 26.3, 108.7, 108.8, 121.2, 121.8, 122.4, 123.4, 126.3, 129.5, 131.7, 132.7, 133.0,
133.5, 145.4, 146.2, 165.1, 168.8. HRMS (ESI) calculated m/z: 376.9896; found C17H11BrN2O2; m/z:
376.9896 [M + H]+.
3.2.5. 50-Bromo-1-Meisoindigo
3
Yield: 80%. 1H-NMR (400 MHz, DMSO, d6)
δ
ppm 3.21 (s, 3H), 6.97 (d, J = 8,3 Hz, 1H),
3
3
4
3
7.01 (d, J = 7.0 Hz, 1H), 7.03 (m, 1H), 7.44 (td, J = 7.7 Hz, J = 1.2 Hz, 1H), 7.50 (dd, J = 8.3 Hz,
4J = 2.1 Hz, 1H), 9.08 (dd, 3J = 8.0 Hz, 4J = 0.6 Hz, 1H), 9.33 (d, 4J = 2.0 Hz, 1H), 11.04 (s, 1H). 13C-NMR
(100 MHz, DMSO, d6)
δ ppm 26.6, 109.1, 111.8, 113.3, 121.0, 122.3, 123.8, 129.8, 131.9, 132.7, 133.6, 134.1,
135.2, 143.6, 145.8, 167.7, 168. Anal. calcd. for C17H11BrN2O2: C 57.49, H 3.12, N 7.89; found: C 57.34,
H 2.91, N 7.75, HRMS (ESI) calculated m/z: 376.9896; found C17H11BrN2O2; m/z: 376.9896 [M + H]+.
3.2.6. 60-Bromo-1-Meisoindigo
4
Yield: 86%. 1H-NMR (400 MHz, DMSO, d6)
δ
ppm 3.17 (s, 3H), 6.92 (d, J = 1.9 Hz, 1H),
3
3
4
3
6.95 (d, J = 7,8 Hz, 1H), 7.00 (m, 1H), 7.11 (dd, J = 8.6 Hz, J = 2.0 Hz, 1H), 7.40 (td, J = 7.7 Hz,

Molecules 2017, 22, 1546
11 of 16
4J = 0.9 Hz, 1H), 8.97 (d, 3J = 8.6 Hz, 1H), 9.03 (d, 3J = 7.7 Hz, 1H), 11.0 (s, 1H). 13C-NMR (100 MHz,
DMSO, d6) ppm 26.0, 108.5, 112.2, 120.7, 121.8, 123.8, 125.5, 129.1, 130.9, 132.3, 132.8, 132.9, 145.1,
δ
145.4, 167.1, 168.6. Anal. calcd. for C17H11BrN2O2: C 57.49, H 3.12, N 7.89; found: C 57.65, H 3.20,
N 7.91. HRMS (ESI) calculated m/z: 376.9896; found C17H11BrN2O2; m/z: 376.9896 [M + H]+.
3.2.7. 70-Bromo-1-Meisoindigo
3
Yield: 73%. 1H-NMR (400 MHz, DMSO, d6)
δ
ppm 3.21 (s, 3H), 6.94 (d, J = 8.1 Hz, 1H),
3
3
4
3
7.03 (d, J = 7.6 Hz, 1H), 7.05 (m, 1H, 7.45 (td, J = 7.6 Hz, J = 0.8 Hz, 1H), 7.55 (dd, J = 7.9 Hz,
4J = 0.5 Hz, 1H), 9.06 (d, 3J = 7.8 Hz, 1H), 9.10 (dd, 3J = 8.0 Hz, 4J = 0.6 Hz, 1H), 11.16 (s, 1H). 13C-NMR
(100 MHz, DMSO, d6)
δ ppm 26.1, 101.9, 108.6, 120.7, 121.9, 122.6, 123.3, 128.2, 129.2, 133.0, 133.2, 133.8,
135.1, 143.0, 145.3, 167.0, 168.6. Anal. calcd. for C17H11BrN2O2: C 57.49, H 3.12, N 7.89; found: C 57.68,
H 3.14, N 7.90. HRMS (ESI) calculated m/z: 376.9896; found C17H11BrN2O2; m/z: 376.9896 [M + H]+.
3.3. Cell Culture
HeLa and HCT116 were cultured in DMEM containing 10% fetal bovine serum (FBS) and
1% Penicillin/Streptomycin (Pen/Strep). JoPaca-1 cells were cultivated in RPMI 1640 medium
◦
supplemented with 10% FBS and 1% Pen/Strep. Cells were kept under 5% CO2 at 37 C in a humidified
atmosphere. Cells were treated with drugs solved in DMSO from Sigma-Aldrich (Germany) 24 h
after seeding.
Human primary fibroblasts were isolated and cultivated as described previously with positive
ethic permission [59,60].
3.4. Protein Kinase Profiling
Protein kinase profiling was performed by ProQinase (Freiburg, Germany) as previously reported [
5].
The kinase map was generated using KinMap beta developed by BioMedX (Heidelberg, Germany).
3.5. Western Blotting
As previously reported [18
,59
,60], 2
×
105 cells were seeded and treated with compounds for 30
min or 2 h. Cells were lysed in Urea-lysis buffer containing 1 mM EDTA, 0.5% Triton X-100, 5 mM
NaF, 6 M Urea, 1 mM Na3VO4, 10 mg/mL Pepstatin, 100 mM PMSF, and 3 mg/mL Aprotinin in
PBS. Protein concentrations were normalized to the smallest value and proteins were resolved on 8%
SDS-PAGE and blotted to membrane using BlueFlash Large semi-dry blotter from Serva Electrophoresis
(Heidelberg, Germany). The membrane was blocked for at least 2 h in 5% non-fat milk purchased form
Roth (Karlsruhe, Germany) in TBS-T. For immunoblotting, all antibodies were applied according to
manufacturers’ recommendations. Immunoblots were developed with ECL solution obtained from
PerkinElmar (Waltham, MA, USA) and imaged using digital imaging system LAS-3000 from Fujifilm
(Tokyo, Japan).
3.6. Cytotoxicity Assays
5
×
103 cells/well were seeded and treated in quadruplicates with compounds at concentrations
ranging from 0.4 µM to 100 µM for 24, 48 or 72 h. Cells were incubated for 2 h in medium containing
1% FBS and 0.5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) bought
from Sigma-Aldrich, washed in PBS, and incubated in DMSO from Honeywell (Morris Plains, NJ,
USA) for 10 min shaking. Absorption was measured photometrically at 595 nm using Infinite F200 pro
microplate reader from Tecan (Männedorf, Switzerland).
3.7. CD133 and Annexin V Staining
2
×
105 cells/well were seeded and treated for 24 h with compounds. Cell were trypsinized and
resuspended in 40 L blocking buffer obtained from Beckton, Dickinson and Company (Franklin Lakes,
µ

Molecules 2017, 22, 1546
12 of 16
NJ, USA) and incubated for 10 min in the dark. 10
µL staining solution containing CD133 antibody
purchased from Miltenyi Biotec (Bergisch Gladbach, Germany) and Annexin V-FITC from eBioscience
(San Diego, CA, USA) 1:10 in blocking buffer were added to each sample, which were then incubated
for 15 min in the dark at room temperature. Finally, 450 mL FACS buffer obtained from Beckton,
Dickinson and Company were added and the samples were immediately analyzed with a FACSCalibur
device from Beckton, Dickinson and Company.
3.8. Immunocytochemistry
5
×
103 cells/well were seeded and treated with compounds for 24 h. Cells were fixed in 4%
formaldehyde (formaldehyde 37% from Merck (Darmstadt, Germany) in PBS) for 12 min and blocked
for 60 min in blocking buffer (5% goat serum, 1% BSA, 0.3% Triton X-100 in PBS). For immunostaining,
all antibodies were applied according to manufacturers’ recommendations. Photos were taken with
Keyence BZ 9000 fluorescence microscope.
3.9. qRT-PCR
2
×
105 cells/well were seeded and treated with compounds for 2 or 24 h. RNA was
isolated using NucleoSpin RNA Kit obtained from Macherey-Nagel (Düren, Germany) and cDNA
synthesis was performed with ProtoScript II First Strand cDNA synthesis Kit using standard protocol
from New England Biolabs (Ipswich, MA, United States). qPCR was performed according to
manufacturers’ recommendations in LightCycler 96 from Roche (Basel, Switzerland). Actin was used
as reference gene for relative expression analysis which was performed as reported previously [61].
All primers were obtained from Eurofins Genomics (Luxembourg).The following primer pairs were
used: ATF3 (5s: TCGGAGAAGCTGGAAAGTGT, 3as: TCTGGAGTCCTCCCATTCTG), c-Myc (5s:
CCTGGCAAAAGGTCAGAGTC, 3as: GCTGCGTAGTTGTGCTGATG), IL-4 (5s: TTTGCTGCCT
CCAAGAACAC, 3as: GTCGAGCCGTTTCAGGAATC), IL-6 (5s: AGACAGCCACTCACCTCTTC, 3as:
AGTGCCTCTTTGCTGCTTTC), c-Jun (5s: TGAAACAGAGCATGACCCTG, 3as: GATTATCAGGC
GCTCCAGCTC), MAFF (5s: TCTGTGGATCCCCTATCCAG, 3as: TCTGTGGATCCCCTATCCAG),
p16 (5s: GAGCAGCATGGAGCCTTC, 3as: CATCATCATGACCTGGATCG), p21 (5s: GACACCACT
GGAGGGTGACT, 3as: CAGGTCCACATGGTCTTCCT), β-actin (5s: CTGACTACCTCATGAAGA
TCCTC, 3as; CATTGCCAATGGTGATGACCTG), Stat3 (5s: AGATGCAGCAGCTGGAACAGAT,
3as: CGTGAGAGTTTTCTGCACGT).
3.10. Protein Microarray Analysis
200,000 JoPaca-1 cells were seeded and treated for 30 min with 6-bromo-meisoindigo at the
concentration of 10
following ELISA-based microarray protocol previously described in Holenya et al. and using
microarrays based on the ArrayStrip platform (Alere Technologies GmbH, Jena, Germany) [62 63].
The quantity of phosphorylated proteins (ng/ g of total protein) in 2-treated JoPaca-1 cells was
µM and 0.1% DMSO for mock treatment. Samples were collected and measured
™
,
µ
compared to mock treatment and showed as fold change.
4. Conclusions
In this work, we identified that meisoindigo and 6-bromo-meisoindigo are potent Stat3 inhibitors
and kill CD133+ CSCs in tumors. Given that Stat3 and CD133 are of importance in the regulation of
proliferation and development of chemotherapeutic resistance [22,34], our results suggest meisoindigos
as promising anti-cancer agents. The recent results demonstrated that active Stat3 led to the expression
of immunosuppressive protein PD-L1, the major ligand of programmed death 1 (PD-1) [64]. It is very
interesting if the combination of meisoindigos with a PD-1 or PD-L1 inhibitor can elicit a synergistic
effect for immunotherapy. Moreover, our structure–activity relationship study also pinpoints that the
1- and 7-positions are available positions for further chemical modification.

Molecules 2017, 22, 1546
13 of 16
Supplementary Materials: The supplementary information is available online.
Acknowledgments: We thank Stefan Wölfl (IPMB, Heidelberg University) and Gerhard Eisenbrand (University
of Kaiserslautern) for their outstanding support. This work was supported by DFG grant (CH 1690/2-1).
We acknowledge the financial support of the Deutsche Forschungsgemeinschaft and Ruprecht-Karls-Universität
Heidelberg within the funding programme Open Access Publishing.
Author Contributions: J.T. performed biological assessments and wrote the manuscript. R.B., S.S. and K.H.-M.
synthesized compounds. B.B. performed protein microarray analysis. X.C. designed and performed experiments
and wrote the manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
Cheng, X.; Merz, K.H. The role of indirubins in inflammation and associated tumorigenesis. Adv. Exp. Med. Biol.
2016, 929, 269–290. [PubMed]
Xiao, Z.; Hao, Y.; Liu, B.; Qian, L. Indirubin and meisoindigo in the treatment of chronic myelogenous
leukemia in china. Leuk. Lymphoma 2002, 43, 1763–1768. [CrossRef] [PubMed]
Cheng, X.; Merz, K.H.; Vatter, S.; Zeller, J.; Muehlbeyer, S.; Thommet, A.; Christ, J.; Wolfl, S.; Eisenbrand, G.
Identification of a water-soluble indirubin derivative as potent inhibitor of insulin-like growth factor
1 receptor through structural modification of the parent natural molecule. J. Med. Chem. 2017, 60, 4949–4962.
[CrossRef] [PubMed]
4.
Vougogiannopoulou, K.; Ferandin, Y.; Bettayeb, K.; Myrianthopoulos, V.; Lozach, O.; Fan, Y.; Johnson, C.H.;
Magiatis, P.; Skaltsounis, A.L.; Mikros, E.; et al. Soluble 3 ,6-substituted indirubins with enhanced selectivity
0
toward glycogen synthase kinase -3 alter circadian period. J. Med. Chem. 2008, 51, 6421–6431. [CrossRef]
[PubMed]
5.
6.
Cheng, X.; Rasque, P.; Vatter, S.; Merz, K.H.; Eisenbrand, G. Synthesis and cytotoxicity of novel
indirubin-5-carboxamides. Bioorg. Med. Chem. 2010, 18, 4509–4515. [CrossRef] [PubMed]
Heshmati, N.; Cheng, X.; Dapat, E.; Sassene, P.; Eisenbrand, G.; Fricker, G.; Muellertz, A. In vitro and in vivo
evaluations of the performance of an indirubin derivative, formulated in four different self-emulsifying drug
delivery systems. J. Pharm. Pharmacol. 2014, 66, 1567–1575. [CrossRef] [PubMed]
Heshmati, N.; Cheng, X.; Eisenbrand, G.; Fricker, G. Enhancement of oral bioavailability of e804 by
self-nanoemulsifying drug delivery system (snedds) in rats. J. Pharm. Sci. 2013, 102, 3792–3799. [CrossRef]
[PubMed]
Heshmati, N.; Wagner, B.; Cheng, X.; Scholz, T.; Kansy, M.; Eisenbrand, G.; Fricker, G. Physicochemical
characterization and in vitro permeation of an indirubin derivative. Eur. J. Pharm. Sci. 2013, 50, 467–475.
[CrossRef] [PubMed]
Hoessel, R.; Leclerc, S.; Endicott, J.A.; Nobel, M.E.; Lawrie, A.; Tunnah, P.; Leost, M.; Damiens, E.;
Marie, D.; Marko, D.; et al. Indirubin, the active constituent of a chinese antileukaemia medicine, inhibits
cyclin-dependent kinases. Nat. Cell. Biol. 1999, 1, 60–67. [PubMed]
7.
8.
9.
10. Cheng, X.; Alborzinia, H.; Merz, K.H.; Steinbeisser, H.; Mrowka, R.; Scholl, C.; Kitanovic, I.;
Eisenbrand, G.; Wolfl, S. Indirubin derivatives modulate tgfbeta/bmp signaling at different levels and
trigger ubiquitin-mediated depletion of nonactivated r-smads. Chem. Biol. 2012, 19, 1423–1436. [CrossRef]
[PubMed]
11. Zuo, M.X.; Li, Y.; Zhou, J.H.; Wang, H.B.; Chen, X.G. Effect of meisoindigo on wnt signal pathway in k562
and hl-60 cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2010, 18, 579–582. [PubMed]
12. Blazevic, T.; Heiss, E.H.; Atanasov, A.G.; Breuss, J.M.; Dirsch, V.M.; Uhrin, P. Indirubin and indirubin derivatives
for counteracting proliferative diseases. Evid. Based Complement. Alternat. Med. 2015, 2015, 654098. [CrossRef]
[PubMed]
0
13. Cheng, X.; Merz, K.H.; Vatter, S.; Christ, J.; Wolfl, S.; Eisenbrand, G. 7,7 -diazaindirubin—A small molecule
inhibitor of casein kinase 2 in vitro and in cells. Bioorg. Med. Chem. 2014, 22, 247–255. [CrossRef] [PubMed]
14. Wee, X.K.; Yeo, W.K.; Zhang, B.; Tan, V.B.; Lim, K.M.; Tay, T.E.; Go, M.L. Synthesis and evaluation of
functionalized isoindigos as antiproliferative agents. Bioorg. Med. Chem. 2009, 17, 7562–7571. [CrossRef]
[PubMed]

Molecules 2017, 22, 1546
14 of 16
15. Fredebohm, J.; Boettcher, M.; Eisen, C.; Gaida, M.M.; Heller, A.; Keleg, S.; Tost, J.; Greulich-Bode, K.M.;
Hotz-Wagenblatt, A.; Lathrop, M.; et al. Establishment and characterization of a highly tumourigenic and
cancer stem cell enriched pancreatic cancer cell line as a well defined model system. PLoS ONE 2012, 7, e48503.
[CrossRef] [PubMed]
16. Yin, A.H.; Miraglia, S.; Zanjani, E.D.; Almeida-Porada, G.; Ogawa, M.; Leary, A.G.; Olweus, J.; Kearney, J.;
Buck, D.W. Ac133, a novel marker for human hematopoietic stem and progenitor cells. Blood 1997, 90, 5002–5012.
[PubMed]
17. Hermann, P.C.; Huber, S.L.; Herrler, T.; Aicher, A.; Ellwart, J.W.; Guba, M.; Bruns, C.J.; Heeschen, C. Distinct
populations of cancer stem cells determine tumor growth and metastatic activity in human pancreatic cancer.
Cell Stem Cell 2007, 1, 313–323. [CrossRef] [PubMed]
18. Cheng, X.; Kim, J.Y.; Ghafoory, S.; Duvaci, T.; Rafiee, R.; Theobald, J.; Alborzinia, H.; Holenya, P.;
Fredebohm, J.; Merz, K.H.; et al. Methylisoindigo preferentially kills cancer stem cells by interfering
cell metabolism via inhibition of lkb1 and activation of ampk in pdacs. Mol. Oncol. 2016, 10, 806–824.
[CrossRef] [PubMed]
19. Jordan, C.T.; Guzman, M.L.; Noble, M. Cancer stem cells. N. Engl. J. Med. 2006, 355, 1253–1261. [CrossRef]
[PubMed]
20. Li, C.; Heidt, D.G.; Dalerba, P.; Burant, C.F.; Zhang, L.; Adsay, V.; Wicha, M.; Clarke, M.F.; Simeone, D.M.
Identification of pancreatic cancer stem cells. Cancer Res. 2007, 67, 1030–1037. [CrossRef] [PubMed]
21. Lapidot, T.; Sirard, C.; Vormoor, J.; Murdoch, B.; Hoang, T.; Caceres-Cortes, J.; Minden, M.; Paterson, B.;
Caligiuri, M.A.; Dick, J.E. A cell initiating human acute myeloid leukaemia after transplantation into scid
mice. Nature 1994, 367, 645–648. [CrossRef] [PubMed]
22. Clevers, H. The cancer stem cell: Premises, promises and challenges. Nat. Med. 2011, 17, 313–319. [CrossRef]
[PubMed]
23. Liu, L.; Kritsanida, M.; Magiatis, P.; Gaboriaud, N.; Wang, Y.; Wu, J.; Buettner, R.; Yang, F.; Nam, S.; Skaltsounis, L.;
et al. A novel 7-bromoindirubin with potent anticancer activity suppresses survival of human melanoma cells
associated with inhibition of stat3 and akt signaling. Cancer Biol. Ther. 2012, 13, 1255–1261. [CrossRef] [PubMed]
24. Liu, L.; Nam, S.; Tian, Y.; Yang, F.; Wu, J.; Wang, Y.; Scuto, A.; Polychronopoulos, P.; Magiatis, P.;
Skaltsounis, L.; et al. 6-bromoindirubin-30-oxime inhibits JAK/STAT3 signaling and induces apoptosis
of human melanoma cells. Cancer Res. 2011, 71, 3972–3979. [CrossRef] [PubMed]
25. Meijer, L.; Skaltsounis, A.L.; Magiatis, P.; Polychronopoulos, P.; Knockaert, M.; Leost, M.; Ryan, X.P.;
Vonica, C.A.; Brivanlou, A.; Dajani, R.; et al. Gsk-3-selective inhibitors derived from tyrian purple indirubins.
Chem. Biol. 2003, 10, 1255–1266. [CrossRef] [PubMed]
26. Nam, S.; Buettner, R.; Turkson, J.; Kim, D.; Cheng, J.Q.; Muehlbeyer, S.; Hippe, F.; Vatter, S.; Merz, K.H.;
Eisenbrand, G.; et al. Indirubin derivatives inhibit stat3 signaling and induce apoptosis in human cancer
cells. Proc. Natl. Acad. Sci. USA 2005, 102, 5998–6003. [CrossRef] [PubMed]
27. Nam, S.; Scuto, A.; Yang, F.; Chen, W.; Park, S.; Yoo, H.S.; Konig, H.; Bhatia, R.; Cheng, X.; Merz, K.H.; et al.
Indirubin derivatives induce apoptosis of chronic myelogenous leukemia cells involving inhibition of stat5
signaling. Mol. Oncol. 2012, 6, 276–283. [CrossRef] [PubMed]
28. Nam, S.; Wen, W.; Schroeder, A.; Herrmann, A.; Yu, H.; Cheng, X.; Merz, K.H.; Eisenbrand, G.;
Li, H.; Yuan, Y.C.; et al. Dual inhibition of janus and src family kinases by novel indirubin derivative
blocks constitutively-activated stat3 signaling associated with apoptosis of human pancreatic cancer cells.
Mol. Oncol. 2013, 7, 369–378. [CrossRef] [PubMed]
29. Silva, C.M. Role of stats as downstream signal transducers in src family kinase-mediated tumorigenesis.
Oncogene 2004, 23, 8017–8023. [CrossRef] [PubMed]
30. Siveen, K.S.; Sikka, S.; Surana, R.; Dai, X.; Zhang, J.; Kumar, A.P.; Tan, B.K.; Sethi, G.; Bishayee, A. Targeting
the stat3 signaling pathway in cancer: Role of synthetic and natural inhibitors. Biochim. Biophys. Acta. 2014
1845, 136–154. [CrossRef] [PubMed]
,
31. Chen, C.L.; Hsieh, F.C.; Lieblein, J.C.; Brown, J.; Chan, C.; Wallace, J.A.; Cheng, G.; Hall, B.M.; Lin, J. Stat3
activation in human endometrial and cervical cancers. Br. J. Cancer 2007, 96, 591–599. [CrossRef] [PubMed]
32. Corvinus, F.M.; Orth, C.; Moriggl, R.; Tsareva, S.A.; Wagner, S.; Pfitzner, E.B.; Baus, D.; Kaufmann, R.;
Huber, L.A.; Zatloukal, K.; et al. Persistent stat3 activation in colon cancer is associated with enhanced cell
proliferation and tumor growth. Neoplasia 2005, 7, 545–555. [CrossRef] [PubMed]

Molecules 2017, 22, 1546
15 of 16
33. Wei, D.; Le, X.; Zheng, L.; Wang, L.; Frey, J.A.; Gao, A.C.; Peng, Z.; Huang, S.; Xiong, H.Q.; Abbruzzese, J.L.;
et al. Stat3 activation regulates the expression of vascular endothelial growth factor and human pancreatic
cancer angiogenesis and metastasis. Oncogene 2003, 22, 319–329. [CrossRef] [PubMed]
34. Kamran, M.Z.; Patil, P.; Gude, R.P. Role of stat3 in cancer metastasis and translational advances.
Biomed. Res. Int. 2013, 2013, 421821. [CrossRef] [PubMed]
35. Lin, L.; Jou, D.; Wang, Y.; Ma, H.; Liu, T.; Fuchs, J.; Li, P.K.; Lu, J.; Li, C.; Lin, J. Stat3 as a potential therapeutic
target in ALDH+ and CD44+/CD24+ stem cell-like pancreatic cancer cells. Int. J. Oncol. 2016, 49, 2265–2274.
[CrossRef] [PubMed]
36. Civenni, G.; Malek, A.; Albino, D.; Garcia-Escudero, R.; Napoli, S.; Di Marco, S.; Pinton, S.; Sarti, M.;
Carbone, G.M.; Catapano, C.V. Rnai-mediated silencing of myc transcription inhibits stem-like cell
maintenance and tumorigenicity in prostate cancer. Cancer Res. 2013, 73, 6816–6827. [CrossRef] [PubMed]
37. Cartwright, P.; McLean, C.; Sheppard, A.; Rivett, D.; Jones, K.; Dalton, S. Lif/stat3 controls es cell self-renewal
and pluripotency by a myc-dependent mechanism. Development 2005, 132, 885–896. [CrossRef] [PubMed]
38. Yu, H.; Lee, H.; Herrmann, A.; Buettner, R.; Jove, R. Revisiting stat3 signalling in cancer: New and unexpected
biological functions. Nat. Rev. Cancer 2014, 14, 736–746. [CrossRef] [PubMed]
39. Yu, H.; Pardoll, D.; Jove, R. Stats in cancer inflammation and immunity: A leading role for stat3. Nat. Rev. Cancer
2009, 9, 798–809. [CrossRef] [PubMed]
40. Rho, O.; Kim, D.J.; Kiguchi, K.; Digiovanni, J. Growth factor signaling pathways as targets for prevention of
epithelial carcinogenesis. Mol. Carcinog 2011, 50, 264–279. [CrossRef] [PubMed]
41. Kim, M.S.; Lee, W.S.; Jeong, J.; Kim, S.J.; Jin, W. Induction of metastatic potential by TrkB via activation
of IL6/JAK2/STAT3 and Pi3k/Akt signaling in breast cancer. Oncotarget 2015, 6, 40158–40171. [CrossRef]
[PubMed]
42. Leonis, M.A.; Thobe, M.N.; Waltz, S.E. Ron-receptor tyrosine kinase in tumorigenesis and metastasis.
Future Oncol. 2007, 3, 441–448. [CrossRef] [PubMed]
43. Schuringa, J.J.; Wojtachnio, K.; Hagens, W.; Vellenga, E.; Buys, C.H.; Hofstra, R.; Kruijer, W. Men2a-ret-
induced cellular transformation by activation of stat3. Oncogene 2001, 20, 5350–5358. [CrossRef] [PubMed]
44. Yi, Z.; Li, L.; Matsushima, G.K.; Earp, H.S.; Wang, B.; Tisch, R. A novel role for c-src and stat3 in apoptotic
cell-mediated mertk-dependent immunoregulation of dendritic cells. Blood 2009, 114, 3191–3198. [CrossRef]
[PubMed]
45. Alvarez, J.V.; Greulich, H.; Sellers, W.R.; Meyerson, M.; Frank, D.A. Signal transducer and activator of
transcription 3 is required for the oncogenic effects of non-small-cell lung cancer-associated mutations of the
epidermal growth factor receptor. Cancer Res. 2006, 66, 3162–3168. [CrossRef] [PubMed]
46. Cao, X.; Tay, A.; Guy, G.R.; Tan, Y.H. Activation and association of stat3 with src in v-src-transformed cell
lines. Mol. Cell. Biol. 1996, 16, 1595–1603. [CrossRef] [PubMed]
47. Werdich, X.Q.; Penn, J.S. Src, fyn and yes play differential roles in vegf-mediated endothelial cell events.
Angiogenesis 2005, 8, 315–326. [CrossRef] [PubMed]
48. Zoubeidi, A.; Rocha, J.; Zouanat, F.Z.; Hamel, L.; Scarlata, E.; Aprikian, A.G.; Chevalier, S. The fer tyrosine
kinase cooperates with interleukin-6 to activate signal transducer and activator of transcription 3 and
promote human prostate cancer cell growth. Mol. Cancer Res. 2009, 7, 142–155. [CrossRef] [PubMed]
49. Nelson, K.L.; Rogers, J.A.; Bowman, T.L.; Jove, R.; Smithgall, T.E. Activation of stat3 by the c-fes
protein-tyrosine kinase. J. Biol. Chem. 1998, 273, 7072–7077. [CrossRef] [PubMed]
50. Liu, L.; Gao, Y.; Qiu, H.; Miller, W.T.; Poli, V.; Reich, N.C. Identification of stat3 as a specific substrate of
breast tumor kinase. Oncogene 2006, 25, 4904–4912. [CrossRef] [PubMed]
51. Lim, C.P.; Cao, X. Structure, function, and regulation of stat proteins. Mol. Biosyst 2006, 2, 536–550. [CrossRef]
[PubMed]
52. Carpenter, R.L.; Lo, H.W. Stat3 target genes relevant to human cancers. Cancers (Basel) 2014, 6, 897–925.
[CrossRef] [PubMed]
53. Dauer, D.J.; Ferraro, B.; Song, L.; Yu, B.; Mora, L.; Buettner, R.; Enkemann, S.; Jove, R.; Haura, E.B. Stat3
regulates genes common to both wound healing and cancer. Oncogene 2005, 24, 3397–3408. [CrossRef]
[PubMed]
54. Cho, S.-D.; Li, G.; Hu, H.; Jiang, C.; Kang, K.-S.; Lee, Y.-S.; Kim, S.-H.; Lu, J. Involvement of c-jun n-terminal
kinase in g2/m arrest and caspase-mediated apoptosis induced by sulforaphane in du145 prostate cancer
cells. Nutr. Cancer 2005, 52, 213–224. [CrossRef] [PubMed]

Molecules 2017, 22, 1546
16 of 16
55. Wisdom, R.; Johnson, R.S.; Moore, C. C-jun regulates cell cycle progression and apoptosis by distinct
mechanisms. EMBO J. 1999, 18, 188–197. [CrossRef] [PubMed]
56. Kannan, M.B.; Solovieva, V.; Blank, V. The small maf transcription factors maff, mafg and mafk: Current
knowledge and perspectives. Biochim. Biophys. Acta. 2012, 1823, 1841–1846. [CrossRef] [PubMed]
57. Camarda, R.; Williams, J.; Goga, A. In vivo reprogramming of cancer metabolism by myc. Front. Cell Dev. Biol.
2017, 5, 35. [CrossRef] [PubMed]
58. Hao, Z.F.; Ao, J.H.; Zhang, J.; Su, Y.M.; Yang, R.Y. Atf3 activates stat3 phosphorylation through inhibition of
p53 expression in skin cancer cells. Asian Pac. J. Cancer Prev. 2013, 14, 7439–7444. [CrossRef] [PubMed]
59. Cheng, X.; Dimou, E.; Alborzinia, H.; Wenke, F.; Gohring, A.; Reuter, S.; Mah, N.; Fuchs, H.;
Andrade-Navarro, M.A.; Adjaye, J.; et al. Identification of 2-[4-[(4-methoxyphenyl)methoxy]-phenyl]
acetonitrile and derivatives as potent Oct3/4 inducers. J. Med. Chem. 2015, 58, 4976–4983. [CrossRef]
[PubMed]
60. Cheng, X.; Yoshida, H.; Raoofi, D.; Saleh, S.; Alborzinia, H.; Wenke, F.; Gohring, A.; Reuter, S.; Mah, N.;
Fuchs, H.; et al. Ethyl 2-((4-chlorophenyl)amino)thiazole-4-carboxylate and derivatives are potent inducers
of oct3/4. J. Med. Chem. 2015, 58, 5742–5750. [CrossRef] [PubMed]
61. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(t) method. Nat. Protoc.
2008, 3, 1101–1108. [CrossRef] [PubMed]
62. Cheng, X.; Holenya, P.; Can, S.; Alborzinia, H.; Rubbiani, R.; Ott, I.; Wolfl, S. A TrxR inhibiting gold(i) NHC
complex induces apoptosis through ASK1-p38-MAPK signaling in pancreatic cancer cells. Molecular Cancer
2014, 13, 221. [CrossRef] [PubMed]
63. Holenya, P.; Can, S.; Rubbiani, R.; Alborzinia, H.; Junger, A.; Cheng, X.; Ott, I.; Wolfl, S. Detailed analysis
of pro-apoptotic signaling and metabolic adaptation triggered by a n-heterocyclic carbene-gold(i) complex.
Metallomics 2014, 6, 1591–1601. [CrossRef] [PubMed]
64. Marzec, M.; Zhang, Q.; Goradia, A.; Raghunath, P.N.; Liu, X.; Paessler, M.; Wang, H.Y.; Wysocka, M.;
Cheng, M.; Ruggeri, B.A.; et al. Oncogenic kinase NPM/ALK induces through stat3 expression of
immunosuppressive protein CD274 (PD-l1, B7-H1). Proc. Natl. Acad. Sci. USA 2008, 105, 20852–20857.
[CrossRef] [PubMed]
Sample Availability: Samples of meisoindigo derivatives are available are available from the authors.
©
2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).