Discovery and structure-activity relationships study of thieno[2,3-b]pyridine analogues as hepatic gluconeogenesis inhibitors

Article abstract of DOI:10.1016/j.ejmech.2018.04.028

Type 2 diabetes mellitus (T2DM) is a chronic, complex and multifactorial metabolic disorder, and targeting gluconeogenesis inhibition is a promising strategy for anti-diabetic drug discovery. This study discovered a new class of thieno[2,3-b]pyridine derivatives as hepatic gluconeogenesis inhibitors. First, a hit compound (DMT: IC₅₀ = 33.8 μM) characterized by a thienopyridine core was identified in a cell-based screening of our privileged small molecule library. Structure activity relationships (SARs) study showed that replaced the CF₃ in the thienopyridine core could improve the potency and led to the discovery of 8e (IC₅₀ = 16.8 μM) and 9d (IC₅₀ = 12.3 μM) with potent inhibition of hepatic glucose production and good drug-like properties. Furthermore, the mechanism of 8e for the inhibition of hepatic glucose production was also identified, which could be effective through the reductive expression of the mRNA transcription level of gluconeogenic genes, including glucose-6-phosphatase (G6Pase) and hepatic phosphoenolpyruvate carboxykinase (PEPCK). Additionally, 8e could also reduce the fasting blood glucose and improve the oral glucose tolerance and pyruvate tolerance in db/db mice. The optimization of this class of derivatives had provided us a start point to develop new anti-hepatic gluconeogenesis agents.

Full text of DOI:10.1016/j.ejmech.2018.04.028

Accepted Manuscript
Discovery and structure-activity relationships study of thieno[2,3-b]pyridine analogues
as hepatic gluconeogenesis inhibitors
Fei Ma, Jian Liu, Tingting Zhou, Min Lei, Jing Chen, Xiachang Wang, Yinan Zhang,
Xu Shen, Lihong Hu
PII:
S0223-5234(18)30362-3
10.1016/j.ejmech.2018.04.028
EJMECH 10377
DOI:
Reference:
To appear in: European Journal of Medicinal Chemistry
Received Date: 8 February 2018
Revised Date: 31 March 2018
Accepted Date: 14 April 2018
Please cite this article as: F. Ma, J. Liu, T. Zhou, M. Lei, J. Chen, X. Wang, Y. Zhang, X. Shen,
L. Hu, Discovery and structure-activity relationships study of thieno[2,3-b]pyridine analogues as
hepatic gluconeogenesis inhibitors, European Journal of Medicinal Chemistry (2018), doi: 10.1016/
j.ejmech.2018.04.028.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
Graphical Abstract
Discovery and structure-activity relationships study of thieno[2,3-b]pyridine analogues
as hepatic gluconeogenesis inhibitors
Fei Maa,b,c,1, Jian Liua,1, Tingting Zhou b,d,1 , Min Lei b,e, Jing Chen b,e, Xu Shen*, Lihong Hu*
a Jiangsu Key Laboratory for Functional Substance of Chinese Medicine, Jiangsu Collaborative Innovation
Center of Chinese Medicinal Resources Industrialization, Stake Key Laboratory Cultivation Base for TCM
Quality and Efficacy, School of Pharmacy, Nanjing University of Chinese Medicine, Nanjing, 210023, PR
China
b
State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Chinese Academy of
Sciences, Shanghai, 201203, China
c Department of Chemistry, Kansas State University, Manhattan, Kansas 66506, United States
d School of Medicine, Jiangnan University, Wuxi 214122, China
e University of Chinese Academy of Sciences, Beijing 100049, China
1 Fei Ma and Jian Liu contributed equally.
*Corresponding author: lhhu@simm.ac.cn (L. Hu) ; xshen@mail.shcnc.ac.cn(X.Shen)
IC50: 33.9 µM
IC50: 16.8 µM

ACCEPTED MANUSCRIPT
structure-activity relationships
Discovery
and
study
of
thieno[2,3-b]pyridine analogues as hepatic gluconeogenesis inhibitors
Fei Maa,b,d,1, Jian Liua,1, Tingting Zhoub,e,1 , Min Leib,c, Jing Chenb,c, Xiachang Wanga,
Yinan Zhanga, Xu Shena,*, Lihong Hua,b,c,*
a Jiangsu Key Laboratory for Functional Substance of Chinese Medicine, Jiangsu
Collaborative Innovation Center of Chinese Medicinal Resources Industrialization,
Stake Key Laboratory Cultivation Base for TCM Quality and Efficacy, School of
Pharmacy, Nanjing University of Chinese Medicine, Nanjing, 210023, PR China
b
State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica,
Chinese Academy of Sciences, Shanghai, 201203, China
c University of Chinese Academy of Sciences, Beijing 100049, China
d
Department of Chemistry, Kansas State University, Manhattan, Kansas 66506,
United States
e School of Medicine, Jiangnan University, Wuxi 214122, China
1 Fei Ma, Jian Liu and Tingting Zhou contributed equally.
*Corresponding author: lhhu@simm.ac.cn (L. Hu) ; xshen@simm.ac.cn (X.Shen)

ACCEPTED MANUSCRIPT
Abstract: Type 2 diabetes mellitus (T2DM) is a chronic, complex and multifactorial
metabolic disorder, and targeting gluconeogenesis inhibition is a promising strategy
for anti-diabetic drug discovery. This study discovered a new class of
thieno[2,3-b]pyridine derivatives as hepatic gluconeogenesis inhibitors. First, a hit
compound (DMT: IC50= 33.8 µM) characterized by a thienopyridine core was
identified in a cell-based screening of our privileged small molecule library. Structure
activity relationships (SARs) study showed that replaced the CF3 in the thienopyridine
core could improve the potency and led to the discovery of 8e (IC50= 16.8 µM) and 9d
(IC50= 12.3 µM) with potent inhibition of hepatic glucose production and good
drug-like properties. Furthermore, the mechanism of 8e for the inhibition of hepatic
glucose production was also identified, which could be effective through the reductive
expression of the mRNA transcription level of gluconeogenic genes，including
glucose-6-phosphatase (G6Pase) and hepatic phosphoenolpyruvate carboxykinase
(PEPCK). Additionally, 8e could also reduce the fasting blood glucose and improve
the oral glucose tolerance and pyruvate tolerance in db/db mice. The optimization of
this class of derivatives had provided us a start point to develop new anti-hepatic
gluconeogenesis agents.
Keywords: Thieno[2,3-b]pyridine derivatives; Structure-activity relationships (SARs);
Hepatic gluconeogenesis; Type 2 diabetes mellitus (T2DM).

ACCEPTED MANUSCRIPT
1. Introduction
Diabetes Mellitus is a serious and increasing global health burden problem [1],
and type 2 diabetes mellitus (T2DM) accounts for 90-96% of all cases of diabetes [2].
T2DM is a chronic and multifactorial metabolic disease with complicated
pathogenesis characterized by hyperglycemia, insulin resistance and relative lack of
insulin [3]. As an important part of glucose metabolism in liver, hepatic
gluconeogenesis is responsible for the formation of glucose from non-carbohydrate
precursors, such as pyruvate, lactate, lipids, glycerol and glucogenic amino acids [4].
Meanwhile, hepatic gluconeogenesis plays a significant role in maintaining normal
plasma glucose levels to avoid hypoglycemia and provide fuels for other organs
during prolonged starvation [5]. Hepatic gluconeogenesis is regulated systemically by
hormones including insulin and glucagon in response to fasted and fed states [6].
Glucagon could bind to glucagon receptor (GCGR) and activates Gαs/cAMP/protein
kinase A (PKA)/CREB/CRTC2 signaling pathway to stimulate gluconeogenesis
[7,8,9]. On the other hand, insulin could suppress gluconeogenesis through insulin
receptor (IR)/IR substrates (IRSs)/phosphatidylinositol-4,5-bisphosphate 3-kinase
(PI3K)/protein kinase B (AKT) pathway [10] and salt-inducible kinase 2
(SIK2)/CREB/CRTC2 signaling pathway [11,12]. Two gluconeogenic enzymes,
PEPCK and G6Pase, which were highly regulated by glucagon and insulin in
correlation with gluconeogenic flux [13,14], have been thought to be rate-limiting
enzymes for gluconeogenesis in diabetes [15].
Though a number of anti-diabetic drugs are extensively used in clinic, such as
biguanides [16], glucagon-like peptide-1 (GLP-1) analogues [17], dipeptidyl
peptidase 4 (DPP4) inhibitors [18,19] and sodium-coupled glucose cotransporter 2
(SGLT2) inhibitors [20,21], many of the available anti-T2DM drugs are facing limited
efficacy and long-time tolerability by exhibiting side effects [3]. Therefore, it is urgent
to explore novel therapeutic approaches for intervention of T2DM. In patients with
T2DM, gluconeogenesis is aberrantly activated, promotes hepatic glucose production
and excessively evaluates the blood glucose level [22]. As previous reported,
metformin improves hyperglycemia mainly through the suppression of

ACCEPTED MANUSCRIPT
gluconeogenesis in liver [23]. Hence, regulation of gluconeogenesis and hepatic
glucose production could be a promising strategy to regulate blood glucose levels in
T2DM [24].
Our research group has been interested in the design, synthesis and biological
evaluation of anti-diabetic agents. In a previous cell-based screening of our privileged
small molecule library, a thienopyridine derivative (DMT, Figure1) with an IC50 of
33.8 µM in the hepatic glucose production assay was discovered. We also found that
DMT could inhibit gluconeogenic genes transcription (PEPCK and G6Pase) and
efficiently decrease fasting blood glucose and hemoglobin A1c (HbA1c) levels, and
improve glucose tolerance and pyruvate tolerance tests in db/db mice [25].
Additionally, we identified that DMT antagonized the glucagon-mediated hepatic
gluconeogenesis by regulating the Gαq/phospholipase C (PLC)/IP3R-mediated
+
Ca2 /calmodulin (CaM)/PI3K/AKT/forkhead box protein O1 (FOXO1) signaling
pathway [25]. All results have highlighted the potency of targeting gluconeogenesis
inhibition in the treatment of T2DM and the potential of DMT as an anti-T2DM drug
lead compound. To the best of our knowledge, the anti-hepatic glucose production
activity of thienopyridine derivatives was first reported. In this manuscript, detailed
SAR investigation of DMT was carried out for the purpose of developing compounds
with the aim of promoting anti-hepatic glucose production efficacy (Figure 1). As part
of ongoing research, herein we report the synthesis, the structure-activity relationship
study and preliminary biological evaluation of this new class of anti-hepatic
gluconeogenesis agents.
Figure 1
2. Results and discussions
2.1. Chemistry
In this manuscript, the compounds were synthesized (Scheme 1). Treatment of
ketone 1 with ethyl trifluoroacetate or ethyl acetate under strong basic condition in
toluene provided 1,3-diones 2 or 3, respectively. Condensation of 1 with
N,N-dimethylformamide dimethyl acetal (DMF-DMA) in DMF afforded enaminones

ACCEPTED MANUSCRIPT
4. Subsequently, the key building blocks pyridine-2-(1H)-thiones 6 were prepared by
treating 1,3-diones (for R2=CF3 and CH3), enaminones (for R2=H) and 5 (for R1=CH3)
with cyanothioacetamide in the presence of triethylamine or triethylenediamine
(DABCO). Condensation of 6 with 2-chloro-acetamid yielded the intermediate 7,
which was condensed with corresponding aldehydes through refluxing in AcOH to
yield the desired products 8. In addition, condensation of 6 with corresponding
acetamids produced the desired products 9 and 10, respectively. The compound 11
was synthesized by oxidation of DMT with 1,2-dichloro-4,5-dicyanobenzoquinone
(DDQ) in THF (Scheme 2). Finally, compound 12 was obtained via deamination of
9d with tert-butyl nitrite in DMF (Scheme 3). These compounds were assayed for
their inhibitory for the anti-hepatic glucose production in long-time fasting primary
hepatocytes with the presence of glucagon.
Scheme 1
Scheme 2
Scheme 3
2.2. Biological evaluation
2.2.1. In vitro cellular activity and structure-activity relationships
The derivatives were evaluated in the cellular assay measuring the anti-hepatic
glucose production potency in long-time fasting primary hepatocytes. Glucagon (10
nM) was used to mimic hyperglucagonemia stimulating excessive gluconeogenesis.
DMT was used as the positive control. The biological data were listed in Table 1 and
Table 2.
Table 1
The inhibition of hepatic glucose production increased significantly (Table 1)
when induced the electron-drawing group on the benzene ring compared to the lead
compound DMT (IC50: 24.8 µM for 8a, 30.2 µM for 8b and 1.7 µM for 8c,
respectively). Replaced the CF3 with H atom in the thienopyridine scaffold (IC50: 15.4
µM for 8d and 16.8 µM for 8e, respectively), the potency of anti-hepatic glucose
production was increased. The result was indicated that electron-drawing group in

ACCEPTED MANUSCRIPT
thienopyridine scaffold could reduce the potency of anti-hepatic glucose production.
When the thiophene group in 2-position of thienopyridine scaffold was replaced by
methyl (IC50>100 µM for 8f), a sharp loss of anti-hepatic glucose production was
observed, which implied that an aromatic group was vital in 2-position of
thienopyridine scaffold. Given that the chiral center of six-membered ring in DMT
could bring difficulty on the subsequent drug development, we remove the chiral
center of the six-membered ring. First, DMT was oxidized by DDQ and obtained
compound 11, which occupied poor water solubility. Therefore, we opened the
six-membered ring as the second strategy to remove the chiral center of DMT, which
led to the discovery of derivatives 9 and 10.
Table 2
As shown in Table 2, the first compound 9a in this series, containing a amide
bond, was found to be equipotent to 8e in the cell proliferation assay (IC50: 12.3 µM
for 9a vs 16.8 µM for 8e, respectively). This crucial result reinforced the rationale to
optimize the series further. The potency of anti-hepatic glucose production decreased
with the induction of electro-drawing group in the benzene ring (IC50: 33.4 µM for 9c
vs 19.1 µM for 9b, respectively). Replacing the benzene ring of 9a with heterocyclic
pyridine yielded derivatives 9d and 9e, which exhibited equivalently potent inhibition
of the hepatic glucose production (IC50: 12.3 µM for 9d vs 24.7 µM for 9e,
respectively). Introducing the halogen group to the aryl ring yielded compound 9f
(IC50: 14.6 µM), which had no significant impact compared to 9a. In order to
investigate the influence of steric hindrance, compound 9g with 5-aminobenzodioxole
was prepared (IC50>100 µM for 9g), and the result showed that steric hindrance could
decreased the potency. Comparison of the cell potency of 9h and 9i allowed one to
point out that adding hydrophilic group at this position could increase cell penetration
and potency as well (IC50: 14.2 µM for 9i vs >100 µM for 9h, respectively).
Replacing the benzene ring of 9a with a hydrophilic aryl ring yielded derivatives 9j
(IC50: 8.04 µM), which exhibited more potent inhibition of the hepatic glucose
production compared to 9a. Based on the structure of 9d, we synthesized compounds
9k and 9l to investigate the effecting of thiophene ring and CF3 in nucleus core.

ACCEPTED MANUSCRIPT
Introducing CH3 to the nucleus core yielded compound 9k (IC50>100 µM), which
showed no potency for the inhibition of hepatic glucose production. The results
indicated that increasing the electron in nucleus core could decrease the potency.
Furthermore, replacing the thiophene ring with benzene ring yielded 9l (IC50: 14.4
µM), which could maintain the potency compared to 9d.
In order to explore the appropriate length between the aryl ring and amide bond,
compounds 9m-9o with one carbon tether were synthesized. The result showed that
these derivatives maintained the potency for the inhibition of hepatic glucose
production compared to compounds 9a-9c, respectively. The result described that one
carbon tether between the aryl ring and amide bond could maintain the efficiency.
Replacing the benzene ring of 9m with pyrrole ring yielded compound 9p (IC50: 54.0
µM), which decreased the potency for the inhibition of hepatic glucose production.
Additionally, the phenylethylamine-substituted compound 9q (IC50>100 µM) with
two carbon tether between the aryl ring and amide bond showed a significant
reduction of potency, which exhibited that two carbon linear chain was negative for
the potency.
Table 3
In order to investigate the potency of the N-methyl of amide in 9-series, 10-series
was synthesized and evaluated in hepatic primary cells. 10-series with N-methyl at the
amide bond showed the similar SARs compared to the derivatives of 9-series (Table
3). However, they also exhibited weaker potency for the inhibition of hepatic glucose
production.
Among all the potent derivatives with IC50 below 20 µM, the compounds which
selected for further biological evaluation and optimization, were not only have potent
pharmacological activity, but also with favorable drug-like properties. Therefore, the
drug-like properties were taken into account, and we used the ACD-Labs 6.0 to
calculate cLog P values. The results demonstrated that the cLog P values of the
compounds 8e and 9d were lower, these two compounds might have good
physicochemical properties. Hence, the compounds 8e and 9d were chosen for more
extensive in vitro and in vivo anti-diabetic efficacy. However, 9d was not effective in

ACCEPTED MANUSCRIPT
the reducing of the key genes G6pase and PEPCK of hepatic gluconeogenesis and
was not continued in the following study.
2.2.2. 8e reduced the mRNA levels of gluconeogenic genes G6Pase, PEPCK in
hepatic primary cell
In this assay, the primary hepatocytes were obtained from 9-week-old male
C57BL/6 mice. Sodium lactate (20 mM) and sodium pyruvate (2 mM) were used as
gluconeogenic substrates, while glucagon (10 nM) was used to stimulate excessive
gluconeogenesis mimicking hyperglucagonemia. Incubation of 8e with glucagon
obviously reduced the mRNA levels of gluconeogenic genes G6Pase and PEPCK in
dose-dependent manner compared with glucagon treatment results (Figures 2A and
2B), which then inhibited hepatic glucose production in primary hepatocytes.
Figure 2
2.2.3. In vivo experiment
Given to the an-hepatic gluconeogenesis potency of 8e in vitro, we examined its
capability in ameliorating hyperglycemia against type 2 diabetic model mice.
8-week-old female mice were divided into 3 groups by fasting blood glucose and
body weight. Vehicle or 8e (25 mg/Kg) was administrated by intraperitoneal injection
daily for 5 weeks. Rosiglitazone, a PPAR-γ agonist and clinical effective anti-diabetes
drug, used as a positive control, was dosed at 10 mg/kg. Fasting blood glucose levels
from 6h fasted mice were measured weekly. The results demonstrated that 8e
treatment could reduce the fasting blood glucose (Figures. 3A) in dose-dependent
manner. Meanwhile, 8e could improve the glucose tolerance (Figures. 3B and C) and
pyruvate tolerance (Figures. 3D and E), respectively. All results indicated that 8e
ameliorated hyperglycemia in db/db mice and could be developed as a drug candidate
for the treatment of type 2 diabetes patient.
Figure 3
3. Conclusions
In conclusion, novel thieno[2,3-b]pyridine analogues were identified as inhibitors
of hepatic glucose production. Previous cell-based screening of our privileged small
molecule library led to the discovery of DMT which characterized by a

ACCEPTED MANUSCRIPT
thienopyridine core. As we previously reported, DMT antagonized the
glucagon-mediated hepatic gluconeogenesis by regulating the Gαq/phospholipase C
(PLC)/IP3R-mediated Ca2+/calmodulin (CaM)/PI3K/AKT/forkhead box protein O1
(FOXO1) signaling pathway. SARs study on four regions of the DMT was carried out
to improve its anti-hepatic glucose production potency. The detailed SARs research
showed that the eliminating of CF3 in the nucleus core could improve the potency of
anti-hepatic glucose production, and the substituents in benzene ring slightly
influenced the activity. The structure modification of DMT led to the discovery of
two derivatives 8e and 9d, which showed good anti-hepatic glucose production
potency and excellent drug-like properties. Furthermore, 8e could also reduce the
mRNA levels of gluconeogenic genes in hepatic primary cells, including G6Pase and
PEPCK. Additionally, 8e could also ameliorate hyperglycemia and improve the
glucose tolerance and pyruvate tolerance in db/db mice. These data indicated that 8e
was a promising drug candidate for the treatment of type 2 diabetes.
4. Experimental section
4.1. Chemistry
4.4.1 Genaral methods
All final compounds are >95% pure based on HPLC. The reagents (chemicals)
were purchased from Adamas-beta®, Alfa Aesar, and Shanghai Chemical Reagent Co.
and used without further purification. Nuclear magnetic resonance (NMR)
spectroscopy was performed on AMX-400 NMR (IS as TMS). Chemical shifts were
1
reported in parts per million (ppm, δ) downfield from tetramethylsilane. H NMR
multiplicity data are denoted by s (singlet), d (doublet), t (triplet), and m (multiplet).
HRESIMS were determined on a Micromass Q-Tif Global mass spectrometer and
ESI-MS were run on a Bruker Esquire 3000 Plus Spectrometer. Anhydrous solvents
were purchased from commercial suppliers.
4.1.2. General procedure for the preparation of compounds 2 and 3
To a toluene (10 mL) suspension of potassium tert-butoxide (1.35 g, 12 mmol)
and methyl ketone (10 mmol) was added dropwise ethyl trifluoroacetate (for 3) or
ethyl acetate (for 4) at 0 oC. The reaction mixture was allowed to stir for additional 12

ACCEPTED MANUSCRIPT
h until the starting materials were consumed as determined by LC-MS. Then the
solvent was removed under reduced pressure, followed by extracted with ethyl acetate
(200 mL) and water (100 mL). The combined organic layers were dried (Na2SO4),
filtered and the filtrate was concentrated under reduced pressure. The crude product
was added to DCM (20 mL) and gave a suspension liquid. The solid precipitate was
collected by filtration, washed with DCM and dried under reduced pressure to give
the products as yellow solid (63
purification in the next step.
–82%). The precipitate was used without further
4.1.3. General procedure for the preparation of compounds 4
To a mixture of aryl ketone 1 (1.1 mL) in anhydrous DMF (20 mL) at room
temperature was added N,N-dimethylformamide dimethyl acetal (5.0-10.0 equiv). The
o
resulting mixture was warmed to 80 C and stirred for 2 h. Then the solvent was
evaporated under reduced pressure until DMF-DMA was fully removed. The crude
products can be straight used for the next step without future purification. Yield:
100%.
4.1.4. General procedure for the preparation of compounds 6
A mixture of 1,3-diones (2, 3 or 5) (1 mmol) in anhydrous ethanol (2 mL) at room
temperature was added Et3N (30 µL) and cyanothioacetamide (120 mg, 1.2 mmol).
The resulting mixture was warmed to 80 oC and stirred for 2 h. Then the solvent was
evaporated under reduced pressure. The crude products 6 can be straight used for the
next step without future purification.
To a mixture of compound 4 (1 mmol) in anhydrous ethanol (2 mL) at room
temperature was added DABCO (168 mg, 1.5 mmol) and cyanothioacetamide (120
mg, 1.2 mmol). The resulting mixture was warmed to 80 oC and stirred for 2 h. Then
the solvent was evaporated under reduced pressure. The crude products 6 can be
straight used for the next step without future purification.
4.1.5. General procedure for the preparation of DMT and compounds 8
To a solution of crude products 6 from above procedure in DMF (3 mL) added
aqueous 10% KOH solution (3 mL) followed by the addition of 2-chloro-acetamid at
room temperature. The resulting mixture was stirred overnight at room temperature.

ACCEPTED MANUSCRIPT
Then H2O (3 mL) was added to the mixture so that the desire product can be
precipitated. The solid precipitate was collected by filtration, washed with MeOH (2
mL) and dried under reduced pressure to give the products 7 as yellow solid in 90%
yield. To a mixture of compound 7 (0.5 mmol) in AcOH (2 mL) at room temperature
added corresponding aldehydes (0.75 mmol). The resulting mixture was stirred and
warmed to 100 oC to reflux. Once the reaction was completed as indicated by LC-MS,
the reaction mixture was concentrated under vaccum and MeOH (2 mL) was added to
give a suspension liquid. The solid precipitate was collected by filtration, washed with
MeOH (2 mL) and dried under reduced pressure to give the desired products DMT
and 8a-8f as yellow solid.
4.1.5.1
2-(2,4-dimethoxy-3-methylphenyl)-7-(thiophen-2-yl)-9-(trifluoromethyl)-2,3-dihydrop
yrido[3',2':4,5]thieno[3,2-d]pyrimidin-4(1H)-one (DMT)
Yellow solid; Yield 85%; 1H NMR (400 MHz, DMSO-d6) δ 8.39 (d, J = 2.6 Hz, 1H),
8.31 (s, 1H), 8.23–8.20 (m, 1H), 7.86–7.83 (m, 1H), 7.25 (dd, J = 8.6, 3.6 Hz, 2H),
6.76 (d, J = 8.7 Hz, 1H), 6.15 (dd, J = 6.0, 2.7 Hz, 1H), 5.95 (d, J = 6.1 Hz, 1H), 3.77
(s, 3H), 3.76 (s, 3H), 2.08 (s, 3H); 13C NMR (151 MHz, DMSO-d6) δ 162.49, 161.10,
158.54, 156.43, 151.84, 142.12, 141.37, 132.27 and 132.05 and 131.82 and 131.60 (q,
2JCF = 33.9 Hz), 131.22, 129.09, 129.04, 124.92 (2C), 125.15 and 123.33 and 121.51
1
and 119.70 (q, JCF = 274.2 Hz), 118.91, 118.12, 112.79 and 112.76 and 112.72 and
3
112.67 (q, JCF = 5.2 Hz), 112.31, 105.98, 62.74, 61.21, 55.58, 9.07; ESI-MS m/z:
+
506.4 [M+H]+; HRMS (ESI) m/z calcd for C23H19F3N3O2S2 [M+H]+: 506.0814;
found: 506.0807.
4.1.5.2
2-phenyl-7-(thiophen-2-yl)-9-(trifluoromethyl)-2,3-dihydropyrido[3',2':4,5]thieno[3,2
1
-d]pyrimidin-4(1H)-one (8a). Yellow solid; Yield 64%; H NMR (400 MHz,
DMSO-d6) δ 8.83 (d, J = 4.1 Hz, 1H), 8.32 (s, 1H), 8.20 (dd, J = 3.8, 1.0 Hz, 1H),
7.84 (dd, J = 5.0, 1.0 Hz, 1H), 7.49 (d, J = 7.6 Hz, 2H), 7.35–7.31 (m, 2H), 7.29–7.23
(m, 2H), 6.68 (d, J = 6.2 Hz, 1H), 6.01–5.95 (dd, J = 6.2, 4.1 Hz, 1H); 13C NMR (126
MHz, DMSO-d6) δ 162.47, 160.49, 151.91, 142.14, 141.93, 140.70, 132.51 and

ACCEPTED MANUSCRIPT
2
132.25 and 131.98 and 131.71 (q, JCF = 33.6 Hz), 131.22, 129.08, 129.03, 128.17
(2C), 127.88, 125.87 (2C), 125.79 and 123.61 and 121.43 and 119.25 (q, 1JCF = 274.7
3
Hz), 118.18, 112.72 and 112.68 and 112.63 and 112.59 (q, JCF = 5.6 Hz), 112.13,
+
64.91; ESI-MS m/z: 432.6 [M+H]+; HRMS (ESI) m/z calcd for C20H13F3N3OS2
[M+H]+: 432.0447; found: 432.0441.
4.1.5.3
2-(4-hydroxy-3-methoxyphenyl)-7-(thiophen-2-yl)-9-(trifluoromethyl)-2,3-dihydropyri
1
do[3',2':4,5]thieno[3,2-d]pyrimidin-4(1H)-one (8b). Yellow solid; Yield 87%; H
NMR (400 MHz, DMSO-d6) δ 8.98 (s, 1H), 8.72 (d, J = 3.8 Hz, 1H), 8.31 (s, 1H),
8.21 (dd, J = 3.8, 0.9 Hz, 1H), 7.83 (dd, J = 5.0, 0.9 Hz, 1H), 7.25 (dd, J = 5.0, 3.8
Hz, 1H), 7.10 (d, J = 1.9 Hz, 1H), 6.86 (dd, J = 8.2, 1.9 Hz, 1H), 6.70 (d, J = 8.2 Hz,
1H), 6.50 (d, J = 6.2 Hz, 1H), 5.87 (dd, J = 6.2, 3.8 Hz, 1H), 3.69 (s, 3H); 13C NMR
(126 MHz, DMSO-d6) δ 162.42, 160.62, 151.80, 147.34, 146.36, 142.16, 140.71,
132.43 and 132.17 and 131.90 and 131.63 (q, 2JCF = 33.4 Hz), 132.40, 131.16, 129.04,
1
129.02, 125.82 and 123.64 and 121.46 and 119.28 (q, JCF = 274.6 Hz), 118.48,
3
118.30, 114.73, 112.70 and 112.65 and 112.61 and 112.56 (q, JCF = 6.1 Hz), 112.42,
110.12, 65.06, 55.31; ESI-MS m/z: 478.7 [M+H]+; HRMS (ESI) m/z calcd for
C21H15F3N3O3S2 [M+H]+: 478.0501; found: 478.0512.
+
4.1.5.4
2-(4-nitrophenyl)-7-(thiophen-2-yl)-9-(trifluoromethyl)-2,3-dihydropyrido[3',2':4,5]th
1
ieno[3,2-d]pyrimidin-4(1H)-one (8c). Yellow solid; Yield 85%; H NMR (400 MHz,
DMSO-d6) δ 8.99 (d, J = 4.4 Hz, 1H), 8.33 (s, 1H), 8.24–8.18 (m, 3H), 7.84 (dd, J =
4.9, 1.0 Hz, 1H), 7.73 (d, J = 8.7 Hz, 2H), 7.25 (dd, J = 4.9, 3.9 Hz, 1H), 6.89 (d, J =
13
6.6 Hz, 1H), 6.10 (dd, J = 6.6, 4.4 Hz, 1H); C NMR (126 MHz, DMSO-d6) δ
162.52, 160.10, 152.11, 149.72, 147.26, 142.09, 140.51, 132.62 and 132.35 and
2
132.08 and 131.81 (q, JCF = 34.0 Hz), 131.35, 129.23, 129.07, 127.22 (2C), 125.77
1
and 123.59 and 121.41 and 119.28 (q, JCF = 271.5 Hz), 123.47 (2C), 118.14, 112.84
3
and 112.80 and 112.76 and 112.72 (q, JCF = 4.9 Hz), 112.49, 64.40; ESI-MS m/z:
+
477.7 [M+H]+; HRMS (ESI) m/z calcd for C20H12F3N4O3S2 [M+H]+: 477.0297;
found: 477.0287.

ACCEPTED MANUSCRIPT
4.1.5.5
2-(2,4-dimethoxy-3-methylphenyl)-7-(thiophen-2-yl)-2,3-dihydropyrido[3',2':4,5]thien
1
o[3,2-d]pyrimidin-4(1H)-one (8d). Yellow solid; Yield 72%; H NMR (400 MHz,
DMSO-d6) δ 8.41 (d, J = 8.6 Hz, 1H), 8.00 (d, J = 8.6 Hz, 1H), 7.94 (dd, J = 3.7, 1.0
Hz, 1H), 7.89 (s, 1H), 7.84 (s, 1H), 7.74 (dd, J = 5.0, 1.0 Hz, 1H), 7.55 (d, J = 8.7 Hz,
1H), 7.21 (dd, J = 5.0, 3.7 Hz, 1H), 6.89 (d, J = 8.7 Hz, 1H), 6.16 (s, 1H), 3.81 (s, 3H),
3.74 (s, 3H), 2.11 (s, 3H); 13C NMR (126 MHz, DMSO-d6) δ 162.48, 161.31, 158.79,
156.83, 152.02, 145.55, 143.64, 132.12, 129.74, 128.73, 127.07, 126.42, 124.14,
122.80, 118.39, 115.31, 106.63, 103.01, 63.11, 61.67, 55.75, 9.07; ESI-MS m/z: 438.6
+
[M+H]+; HRMS (ESI) m/z calcd for C22H20N3O3S2 [M+H]+: 438.0941; found:
438.0945.
4.1.5.6
2-phenyl-7-(thiophen-2-yl)-2,3-dihydropyrido[3',2':4,5]thieno[3,2-d]pyrimidin-4(1H)
-one (8e). Yellow solid; Yield 61%; 1H NMR (400 MHz, DMSO-d6) δ 8.44 (d, J = 8.6
Hz, 1H), 8.21 (d, J = 10.7 Hz, 2H), 8.03 (d, J = 8.6 Hz, 1H), 7.95 (d, J = 3.2 Hz, 1H),
7.75 (d, J = 5.0 Hz, 1H), 7.60 (d, J = 10.7 Hz, 2H), 7.48–7.37 (m, 3H), 7.25–7.19 (m,
1H), 5.99 (s, 1H); 13C NMR (126 MHz, DMSO-d6) δ 161.98, 161.27, 152.07, 145.05,
143.61, 140.17, 132.01, 129.77, 128.80, 128.73, 128.39 (2C), 127.20 (2C), 127.09,
122.79, 115.37, 103.03, 68.07; ESI-MS m/z: 364.6 [M+H]+; HRMS (ESI) m/z calcd
+
for C19H14N3OS2 [M+H]+: 364.0573; found: 364.0579.
4.1.5.7
2-(2,4-dimethoxy-3-methylphenyl)-7-methyl-9-(trifluoromethyl)-2,3-dihydropyrido[3',
1
2':4,5]thieno[3,2-d]pyrimidin-4(1H)-one (8f). Yellow solid; Yield 68%; H NMR
(400 MHz, DMSO-d6) δ 8.34 (d, J = 2.6 Hz, 1H), 7.76 (s, 1H), 7.23 (d, J = 8.7 Hz,
1H), 6.74 (d, J = 8.7 Hz, 1H), 6.13 (dd, J = 5.8, 2.6 Hz, 1H), 5.91 (d, J = 5.8 Hz, 1H),
3.76 (s, 3H), 3.75 (s, 3H), 2.69 (s, 3H), 2.07 (s, 3H); 13C NMR (126 MHz, DMSO-d6)
δ 162.22, 161.21, 159.58, 158.51, 156.42, 141.24, 131.44 and 131.17 and 130.91 and
130.64 (q, 2JCF = 33.7 Hz), 125.80 and 123.62 and 121.44 and 119.27 (q, 1JCF = 274.1
Hz), 124.93, 124.89, 118.89, 117.60, 117.16 and 117.12 and 117.08 and 117.03 (q,
3JCF = 5.6 Hz), 111.78, 105.96, 62.75, 61.19, 55.57, 24.08, 9.05; ESI-MS m/z: 438.6

ACCEPTED MANUSCRIPT
[M+H]+; HRMS (ESI) m/z calcd for C20H19F3N3O3S+ [M+H]+: 438.1094; found:
438.1085.
4.1.6. General procedure for the preparation of compounds 9 and 10
To a solution of crude products 6 from above procedure in DMF (3 mL) added
aqueous 10% KOH solution (3 mL) followed by the addition of chloroacetamides (for
9 and 10, respectively) at room temperature. The resulting mixture was stirred
overnight at room temperature. Then H2O (3 mL) was added to the mixture so that the
desire product can be precipitated. The solid precipitate was collected by filtration,
washed with MeOH (2 mL) and dried under reduced pressure to obtain the products 9
and 10 as yellow solid.
4.1.6.1 3-amino-N-phenyl-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide (9a).
Yellow solid; Yield 47% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 9.45 (s, 1H),
8.52 (d, J = 8.6 Hz, 1H), 8.04 (d, J = 8.6 Hz, 1H), 7.97 (d, J = 3.6 Hz, 1H), 7.75 (d, J
= 5.0 Hz, 1H), 7.69 (d, J = 7.8 Hz, 2H), 7.40 (s, 2H), 7.33 (t, J = 7.8 Hz, 2H), 7.23
(dd, J = 5.0, 3.6 Hz, 1H), 7.08 (t, J = 7.3 Hz, 1H);
13C NMR (126 MHz, DMSO-d6) δ
163.80, 158.64, 152.54, 146.92, 143.67, 138.92, 131.68, 129.60, 128.71, 128.41 (2C),
126.99, 124.62, 123.45, 121.23 (2C), 115.14, 96.50; ESI-MS m/z: 352.6 [M+H]+;
HRMS (ESI) m/z calcd for C18H14N3OS2 [M+H]+: 352.0573; found: 352.0565.
+
4.1.6.2
3-amino-N-(4-methoxyphenyl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide
(9b). Yellow solid; Yield 49% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 9.35 (s,
1H), 8.50 (d, J = 8.6 Hz, 1H), 8.03 (d, J = 8.6 Hz, 1H), 7.96 (d, J = 3.4 Hz, 1H), 7.74
(d, J = 4.9 Hz, 1H), 7.57 (d, J = 9.0 Hz, 2H), 7.35 (s, 2H), 7.23 (dd, J = 4.9, 3.4 Hz,
1H), 6.91 (d, J = 9.0 Hz, 2H), 3.74 (s, 3H); 13C NMR (126 MHz, DMSO-d6) δ 163.60,
158.57, 155.56, 152.40, 146.53, 143.70, 131.79, 131.59, 129.53, 128.70, 126.92,
124.69, 123.07 (2C), 115.10, 113.57 (2C), 96.70, 55.16; ESI-MS m/z: 382.6 [M+H]+;
+
HRMS (ESI) m/z calcd for C19H16N3O2S2 [M+H]+: 382.0678; found: 382.0673.
4.1.6.3
3-amino-N-(4-nitrophenyl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide
(9c). Yellow solid; Yield 49% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 10.03 (s,

ACCEPTED MANUSCRIPT
1H), 8.57 (d, J = 8.6 Hz, 1H), 8.24 (d, J = 9.3 Hz, 2H), 8.06 (d, J = 8.6 Hz, 1H), 8.03
(d, J = 9.3 Hz, 2H), 7.99 (dd, J = 3.8, 1.0 Hz, 1H), 7.76 (dd, J = 5.0, 1.0 Hz, 1H), 7.62
13
(s, 2H), 7.23 (dd, J = 5.0, 3.8 Hz, 1H); C NMR (126 MHz, DMSO-d6) δ 164.08,
158.96, 153.04, 148.39, 145.74, 143.53, 142.00, 131.99, 129.84, 128.75, 127.25,
124.59 (2C), 124.26, 120.05 (2C), 115.29, 95.48; ESI-MS m/z: 397.6 [M+H]+; HRMS
+
(ESI) m/z calcd for C18H13N4O3S2 [M+H]+: 397.0424; found: 397.0412.
4.1.6.4
3-amino-N-(pyridin-4-yl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide (9d).
Yellow solid; Yield 61% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 9.78 (s, 1H),
8.56 (d, J = 8.6 Hz, 1H), 8.43 (d, J = 6.1 Hz, 2H), 8.05 (d, J = 8.6 Hz, 1H), 7.98 (d, J
= 3.8 Hz, 1H), 7.79–7.73 (m, 3H), 7.58 (s, 2H), 7.23 (dd, J = 5.0, 3.8 Hz, 1H);
13C
NMR (126 MHz, DMSO-d6) δ 164.32, 158.90, 152.99, 149.97 (2C), 148.19, 146.14,
143.54, 131.97, 129.80, 128.75, 127.22, 124.30, 115.28, 114.30 (2C), 95.50; ESI-MS
m/z: 353.6 [M+H]+; HRMS (ESI) m/z calcd for C17H13N4OS2 [M+H]+: 353.0525;
+
found: 353.0529.
4.1.6.5
3-amino-N-(pyridin-2-yl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide (9e).
Yellow solid; Yield 53% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 9.71 (s, 1H),
8.54 (d, J = 8.6 Hz, 1H), 8.36 (d, J = 3.7 Hz, 1H), 8.07 (d, J = 8.3 Hz, 1H), 8.04 (d, J
= 8.6 Hz, 1H), 7.97 (d, J = 3.1 Hz, 1H), 7.86–7.77 (m, 1H), 7.75 (d, J = 4.9 Hz, 1H),
7.48 (s, 2H), 7.23 (dd, J = 4.9, 3.7 Hz, 1H), 7.17–7.09 (m, 1H); 13C NMR (126 MHz,
DMSO-d6) δ 163.90, 158.89, 152.76, 152.01, 147.88, 147.58, 143.67, 137.92, 131.91,
129.75, 128.75, 127.11, 124.51, 119.42, 115.12, 114.81, 96.47; ESI-MS m/z: 353.6
+
[M+H]+; HRMS (ESI) m/z calcd for C17H13N4OS2 [M+H]+: 353.0525; found:
353.0528.
4.1.6.6
3-amino-N-(4-chloro-3-(trifluoromethyl)phenyl)-6-(thiophen-2-yl)thieno[2,3-b]pyridi
ne-2-carboxamide (9f). Yellow solid; Yield 63% (two steps); 1H NMR (400 MHz,
DMSO-d6) δ 9.83 (s, 1H), 8.55 (d, J = 8.6 Hz, 1H), 8.35 (d, J = 2.4 Hz, 1H), 8.08–
8.00 (m, 2H), 7.99–7.93 (m, 1H), 7.77–7.72 (m, 1H), 7.67 (d, J = 8.8 Hz, 1H), 7.54 (s,

ACCEPTED MANUSCRIPT
13
2H), 7.22 (dd, J = 5.0, 3.8 Hz, 1H); C NMR (126 MHz, DMSO-d6) δ 164.00,
158.83, 152.88, 147.95, 143.56, 138.71, 131.90, 131.71, 129.73, 128.72, 127.15,
126.78 and 126.54 and 126.30 and 126.05 (q, 2JCF = 30.5 Hz), 126.11 and 124.37 and
1
121.77 and 119.60 (q, JCF = 245.9 Hz), 125.35, 123.94, 123.79, 119.44 and 119.40
and 119.36 and 119.31 (q, 3JCF = 5.2 Hz), 115.25, 95.36; ESI-MS m/z: 454.6 [M+H]+;
+
HRMS (ESI) m/z calcd for C19H12ClF3N3OS2 [M+H]+: 454.0057; found: 454.0045.
4.1.6.7
3-amino-N-(benzo[d][1,3]dioxol-5-yl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carb
oxamide (9g). Yellow solid; Yield 59% (two steps); 1H NMR (400 MHz, DMSO-d6) δ
9.35 (s, 1H), 8.50 (d, J = 8.6 Hz, 1H), 8.02 (d, J = 8.6 Hz, 1H), 7.97–7.93 (m, 1H),
7.76–7.71 (m, 1H), 7.35 (s, 2H), 7.34 (d, J = 2.0 Hz, 1H), 7.22 (dd, J = 4.9, 3.8 Hz,
1H), 7.10 (dd, J = 8.4, 2.0 Hz, 1H), 6.88 (d, J = 8.4 Hz, 1H), 6.01(s, 2H); 13C NMR
(126 MHz, DMSO-d6) δ 163.64, 158.58, 152.46, 146.84, 146.71, 143.67, 143.21,
133.06, 131.62, 129.56, 128.70, 126.95, 124.63, 115.12, 114.37, 107.73, 103.52,
100.95, 96.47; ESI-MS m/z: 396.6 [M+H]+; HRMS (ESI) m/z calcd for
+
C19H14N3O3S2 [M+H]+: 396.0471; found: 396.0464.
4.1.6.8 3-amino-N-cyclohexyl-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide
(9h). Yellow solid; Yield 45% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 8.43 (d,
J = 8.5 Hz, 1H), 7.99 (d, J = 8.5 Hz, 1H), 7.93 (d, J = 3.6 Hz, 1H), 7.72 (d, J = 5.0
Hz, 1H), 7.41 (d, J = 8.1 Hz, 1H), 7.21 (dd, J = 5.0, 3.6 Hz, 1H), 7.16 (s, 2H), 3.81–
3.68 (m, 1H), 1.84–1.68 (m, 4H), 1.65–1.55 (m, 1H), 1.32 (tt, J = 20.5, 10.5 Hz, 4H),
1.17–1.05 (m, 1H); 13C NMR (126 MHz, DMSO-d6) δ 164.05, 158.26, 152.00,
145.25, 143.75, 131.35, 129.31, 128.64, 126.71, 124.91, 114.95, 97.52, 48.13, 32.45
(2C), 25.25, 25.16 (2C); ESI-MS m/z: 358.6 [M+H]+; HRMS (ESI) m/z calcd for
+
C18H20N3OS2 [M+H]+: 358.1042; found: 358.1048.
4.1.6.9
3-amino-N-(piperidin-4-yl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide
1
hydrochloride (9i). Yellow solid; Yield 53% (two steps); H NMR (400 MHz,
DMSO-d6) δ 9.04 (d, J = 11.9 Hz, 1H), 8.93 (d, J = 11.9 Hz, 1H), 8.48 (d, J = 8.5 Hz,
1H), 7.99 (d, J = 8.5 Hz, 1H), 7.96–7.89 (m, 1H), 7.78 (d, J = 7.2 Hz, 1H), 7.72 (d, J

ACCEPTED MANUSCRIPT
= 4.7 Hz, 1H), 7.26–7.16 (m, 1H), 5.22–3.58 (m, 3H), 3.30 (d, J = 10.9 Hz, 2H), 2.96
(q, J = 10.9 Hz, 2H), 2.00–1.76 (m, 4H); 13C NMR (126 MHz, DMSO-d6) δ 164.57,
158.43, 152.21, 145.79, 143.70, 131.54, 129.43, 128.69, 126.85, 124.75, 115.02,
96.89, 44.38, 42.38 (2C), 28.30 (2C); ESI-MS m/z: 359.6 [M-HCl+H]+; HRMS (ESI)
+
m/z calcd for C17H19N4OS2 [M-HCl+H]+: 359.0995; found: 359.0986.
4.1.6.10
3-amino-N-(4-(2-(4-methylpiperazin-1-yl)ethoxy)phenyl)-6-(thiophen-2-yl)thieno[2,3-
b]pyridine-2-carboxamide (9j). Yellow solid; Yield 59% (two steps); 1H NMR (400
MHz, DMSO-d6) δ 9.37 (s, 1H), 8.54 (d, J = 8.5 Hz, 1H), 8.03 (d, J = 8.5 Hz, 1H),
7.96 (d, J = 3.2 Hz, 1H), 7.74 (d, J = 4.9 Hz, 1H), 7.58 (d, J = 8.8 Hz, 2H), 7.36 (s,
2H), 7.28–7.18 (m, 1H), 6.93 (d, J = 8.8 Hz, 2H), 3.12–2.58 (m, 15H); 13C NMR (126
MHz, DMSO-d6) δ 163.61, 158.56, 154.59, 152.41, 146.58, 143.68, 131.65, 129.61,
129.56, 128.72, 126.96, 124.68, 123.01 (2C), 115.11, 114.26 (2C), 96.63, 65.54,
55.66, 52.43 (2C), 49.62 (2C), 45.39; ESI-MS m/z: 494.6 [M+H]+; HRMS (ESI) m/z
+
calcd for C25H28N5O2S2 [M+H]+: 494.1679; found: 494.1675.
4.1.6.11
3-amino-4-methyl-N-(pyridin-4-yl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxa
1
mide (9k). Yellow solid; Yield 53% (two steps); H NMR (400 MHz, DMSO-d6) δ
9.80 (s, 1H), 8.43 (d, J = 5.9 Hz, 2H), 7.94 (d, J = 3.5 Hz, 1H), 7.79 (s, 1H), 7.74 (m,
13
3H), 7.23 (dd, J = 5.0, 3.5 Hz, 1H), 7.15 (s, 2H), 2.84 (s, 3H); C NMR (126 MHz,
DMSO-d6) δ 164.66, 159.50, 152.34, 150.19, 150.03 (2C), 146.05, 145.89, 143.28,
129.68, 128.69, 127.04, 123.42, 117.32, 114.46 (2C), 96.62, 20.15; ESI-MS m/z:
+
367.6 [M+H]+; HRMS (ESI) m/z calcd for C18H15N4OS2 [M+H]+: 367.0682; found:
367.0686.
4.1.6.12 3-amino-6-phenyl-N-(pyridin-4-yl)thieno[2,3-b]pyridine-2-carboxamide (9l).
Yellow solid; Yield 34% (three steps); 1H NMR (400 MHz, DMSO-d6) δ 9.81 (s, 1H),
8.63 (d, J = 8.6 Hz, 1H), 8.44 (dd, J = 4.9, 1.4 Hz, 2H), 8.23–8.17 (m, 2H), 8.10 (d, J
= 8.6 Hz, 1H), 7.78 (dd, J = 4.9, 1.4 Hz, 2H), 7.61 (s, 2H), 7.58–7.48 (m, 3H);
13C
NMR (126 MHz, DMSO-d6) δ 164.40, 159.25, 157.25, 150.00 (2C), 148.10, 146.13,
137.77, 132.16, 129.82, 128.91 (2C), 127.07 (2C), 124.64, 116.54, 114.27 (2C),

ACCEPTED MANUSCRIPT
95.78; ESI-MS m/z: 347.6 [M+H]+; HRMS (ESI) m/z calcd for C19H15N4OS+ [M+H]+:
347.0961; found: 347.0956.
4.1.6.13
3-amino-N-benzyl-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide
(9m). Yellow solid; Yield 71% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 8.46 (d,
J = 8.6 Hz, 1H), 8.30 (t, J = 6.0 Hz, 1H), 8.01 (d, J = 8.6 Hz, 1H), 7.94 (dd, J = 5.0,
3.6 Hz, 1H), 7.73 (dd, J = 5.0, 3.6 Hz, 1H), 7.34–7.31 (m, 4H), 7.25–7.20 (m, 4H),
4.43 (d, J = 6.0 Hz, 2H); 13C NMR (126 MHz, DMSO-d6) δ 164.87, 158.29, 152.16,
145.60, 143.73, 140.07, 131.49, 129.41, 128.66, 128.20 (2C), 127.21 (2C), 126.79,
126.62, 124.88, 115.02, 96.88, 42.30; ESI-MS m/z: 366.6 [M+H]+; HRMS (ESI) m/z
+
calcd for C19H16N3OS2 [M+H]+: 366.0729; found: 366.0724.
4.1.6.14
3-amino-N-(4-methoxybenzyl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamid
(9n). Yellow solid; Yield 57% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 8.45 (d,
J = 8.5 Hz, 1H), 8.24 (t, J = 6.0 Hz, 1H), 8.00 (d, J = 8.5 Hz, 1H), 7.93 (d, J = 3.6 Hz,
1H), 7.72 (d, J = 5.0 Hz, 1H), 7.25 (d, J = 8.6 Hz, 2H), 7.21 (m, 3H), 6.89 (d, J = 8.6
Hz, 2H), 4.35 (d, J = 6.0 Hz, 2H), 3.72 (s, 3H);
13C NMR (126 MHz, DMSO-d6) δ
164.75, 158.27, 158.11, 152.12, 145.51, 143.73, 132.04, 131.47, 129.39, 128.66,
128.61 (2C), 126.78, 124.89, 115.01, 113.61 (2C), 97.00, 55.04, 41.73; ESI-MS m/z:
396.6 [M+H]+; HRMS (ESI) m/z calcd for C20H18N3O2S2 [M+H]+: 396.0835; found:
+
396.0841.
4.1.6.15
3-amino-N-(4-nitrobenzyl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide
(9o). Yellow solid; Yield 62% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 8.46 (m,
2H), 8.22 (d, J = 8.7 Hz, 2H), 8.02 (d, J = 8.6 Hz, 1H), 7.95 (d, J = 2.9 Hz, 1H), 7.73
(d, J = 5.0 Hz, 1H), 7.58 (d, J = 8.7 Hz, 2H), 7.25 (s, 2H), 7.21 (dd, J = 5.0, 2.9 Hz,
1H), 4.54 (d, J = 5.8 Hz, 2H) 13
; C NMR (126 MHz, DMSO-d6) δ 165.05, 158.33,
152.31, 148.20, 146.36, 145.94, 143.68, 131.59, 129.48, 128.68, 128.18 (2C), 126.87,
124.79, 123.48 (2C), 115.08, 96.36, 42.10; ESI-MS m/z: 411.6 [M+H]+; HRMS (ESI)
+
m/z calcd for C19H15N4O3S2 [M+H]+: 411.0580; found: 411.0585.
4.1.6.16

ACCEPTED MANUSCRIPT
3-amino-N-(furan-2-ylmethyl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide
(9p). Yellow solid; Yield 68% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 8.46 (d,
J = 8.6 Hz, 1H), 8.22 (t, J = 5.7 Hz, 1H), 8.00 (d, J = 8.6 Hz, 1H), 7.94 (dd, J = 3.6,
1.0 Hz, 1H), 7.73 (dd, J = 5.0, 1.0 Hz, 1H), 7.58 (d, J = 1.9 Hz, 1H), 7.28–7.17 (m,
3H), 6.40 (dd, J = 3.0, 1.9 Hz, 1H), 6.25 (d, J = 3.0 Hz, 1H), 4.41 (d, J = 5.7 Hz, 2H);
13C NMR (126 MHz, DMSO-d6) δ 164.75, 158.37, 152.83, 152.22, 145.77, 143.73,
141.83, 131.54, 129.45, 128.68, 126.83, 124.80, 115.03, 110.47, 106.76, 96.71, 35.67;
+
ESI-MS m/z: 356.6 [M+H]+; HRMS (ESI) m/z calcd for C17H14N3O2S2 [M+H]+:
356.0522; found: 356.0527.
4.1.6.17 3-amino-N-phenethyl-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide
(9q). Yellow solid; Yield 59% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 8.45 (d,
J = 8.5 Hz, 1H), 7.99 (d, J = 8.5 Hz, 1H), 7.93 (d, J = 3.2 Hz, 1H), 7.79 (t, J = 5.5 Hz,
1H), 7.71 (d, J = 4.9 Hz, 1H), 7.33–7.16 (m, 8H), 3.49–3.41 (m, 2H), 2.89–2.81 (m,
13
2H); C NMR (126 MHz, DMSO-d6) δ 164.80, 158.19, 152.07, 145.27, 143.74,
139.55, 131.44, 129.38, 128.65, 128.63 (2C), 128.35 (2C), 126.75, 126.07, 124.93,
114.99, 97.20, 40.69, 35.47; ESI-MS m/z: 380.6 [M+H]+; HRMS (ESI) m/z calcd for
+
C20H18N3OS2 [M+H]+: 380.0886; found: 380.0875.
4.1.6.18
3-amino-N,N-dimethyl-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide (10a).
Yellow solid; Yield 42% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 8.18 (d, J =
8.2 Hz, 1H), 7.97 (dd, J = 3.7, 1.0 Hz, 1H), 7.83 (dd, J = 5.0, 1.0 Hz, 1H), 7.78 (d, J =
8.2 Hz, 1H), 7.23 (dd, J = 5.0, 3.7 Hz, 1H), 4.33 (s, 2H), 3.18 (s, 3H), 2.88 (s, 3H);
13C NMR (126 MHz, DMSO-d6) δ 165.82, 158.72, 151.46, 143.86, 142.77, 131.24,
129.25, 128.61, 126.58, 124.62, 114.88, 98.58, 37.17 (2C); ESI-MS m/z: 304.6
+
[M+H]+; HRMS (ESI) m/z calcd for C14H14N3OS2 [M+H]+: 304.0573; found:
304.0576.
4.1.6.19
3-amino-N-(4-methoxyphenyl)-N-methyl-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-car
boxamide (10b). Yellow solid; Yield 64% (two steps); 1H NMR (400 MHz, DMSO-d6)
δ 8.42 (d, J = 8.6 Hz, 1H), 7.92 (d, J = 8.6 Hz, 1H), 7.88 (d, J = 3.9 Hz, 1H), 7.68 (d,

ACCEPTED MANUSCRIPT
J = 4.9 Hz, 1H), 7.48 (s, 2H), 7.30 (d, J = 8.8 Hz, 2H), 7.17 (dd, J = 4.9, 3.9 Hz, 1H),
7.02 (d, J = 8.8 Hz, 2H), 3.83 (s, 3H), 3.25 (s, 3H); 13C NMR (126 MHz, DMSO-d6) δ
165.71, 159.66, 159.06, 152.13, 147.92, 143.76, 135.81, 131.31, 130.44 (2C), 129.35,
128.60, 126.71, 123.25, 114.74 (2C), 114.66, 95.81, 55.38, 38.72; ESI-MS m/z: 396.6
+
[M+H]+; HRMS (ESI) m/z calcd for C20H18N3O2S2 [M+H]+: 396.0835; found:
396.0833.
4.1.6.20
3-amino-N-methyl-N-(4-nitrophenyl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carbo
xamide (10c). Yellow solid; Yield 52% (two steps); 1H NMR (400 MHz, DMSO-d6) δ
8.47 (d, J = 8.6 Hz, 1H), 8.27 (d, J = 9.0 Hz, 2H), 7.97 (d, J = 8.6 Hz, 1H), 7.93–7.89
(dd, J = 3.6, 1.0 Hz, 1H), 7.74–7.68 (dd, J = 4.9, 1.0 Hz, 1H), 7.61 (d, J = 9.0 Hz,
2H), 7.49 (s, 2H), 7.18 (dd, J = 4.9, 3.8 Hz, 1H), 3.38 (s, 3H); 13C NMR (126 MHz,
DMSO-d6) δ 166.17, 159.49, 152.61, 149.83, 148.34, 145.19, 143.51, 131.77, 129.68,
128.64, 128.02 (2C), 127.02, 124.74 (2C), 123.54, 114.99, 95.98, 37.97; ESI-MS m/z:
+
411.6 [M+H]+; HRMS (ESI) m/z calcd for C19H15N4O3S2 [M+H]+: 411.0580; found:
411.0583.
4.1.6.21
3-amino-N-cyclohexyl-N-methyl-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxami
de (10d). Yellow solid; Yield 68% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 8.44
(d, J = 8.6 Hz, 1H), 8.01 (d, J = 8.6 Hz, 1H), 7.93 (d, J = 3.8 Hz, 1H), 7.72 (d, J = 4.9
Hz, 1H), 7.20 (dd, J = 4.9, 3.8 Hz, 1H), 6.64 (s, 2H), 4.26–4.08 (m, 1H), 2.93 (s, 3H),
1.75 (dd, J = 26.8, 11.9 Hz, 4H), 1.66–1.50 (m, 3H), 1.39–1.22 (m, 2H), 1.18–1.03
(m, 1H); 13C NMR (126 MHz, DMSO-d6) δ 165.78, 158.56, 151.56, 143.84, 143.68,
131.20, 129.26, 128.60, 126.59, 124.68, 114.91, 98.32, 55.70, 30.02 (2C), 29.52,
25.34 (2C), 24.91; ESI-MS m/z: 372.6 [M+H]+; HRMS (ESI) m/z calcd for
+
C19H22N3OS2 [M+H]+: 372.1199; found: 372.1191.
4.1.6.22
3-amino-N-methyl-N-(piperidin-4-yl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carbo
1
xamide hydrochloride (10e). Yellow solid; Yield 58% (two steps); H NMR (400
MHz, DMSO-d6) δ 9.16–8.98 (m, 2H), 8.49 (d, J = 8.5 Hz, 1H), 8.01 (d, J = 8.5 Hz,

ACCEPTED MANUSCRIPT
1H), 7.95–7.91 (m, 1H), 7.71 (d, J = 4.9 Hz, 1H), 7.20 (dd, J = 4.9, 3.8 Hz, 1H), 5.19
(brs, 5H), 4.48–4.37 (m, 1H), 3.34 (d, J = 11.8 Hz, 2H), 3.07–2.97 (m, 2H), 2.23–2.00
(m, 2H), 1.86 (d, J = 12.6 Hz, 2H); 13C NMR (126 MHz, DMSO-d6) δ 166.14, 158.67,
151.69, 143.82, 143.40, 131.45, 129.40, 128.69, 126.74, 124.70, 114.98, 98.56, 51.06,
42.72 (2C), 30.18, 25.51 (2C); ESI-MS m/z: 373.6 [M-HCl+H]+; HRMS (ESI) m/z
+
calcd for C18H21N4OS2 [M-HCl+H]+: 373.1151; found: 373.1164.
4.1.6.23
3-amino-N-benzyl-N-methyl-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide
(10f). Yellow solid; Yield 71% (two steps); 1H NMR (400 MHz, DMSO-d6) δ 8.47 (d,
J = 8.6 Hz, 1H), 8.01 (d, J = 8.6 Hz, 1H), 7.93 (d, J = 3.5 Hz, 1H), 7.71 (d, J = 5.0
Hz, 1H), 7.42–7.35 (m, 2H), 7.32–7.27 (m, 3H), 7.20 (dd, J = 5.0, 3.5 Hz, 1H), 6.86
(s, 2H), 4.74 (s, 2H), 3.04 (s, 3H);
13C NMR (126 MHz, DMSO-d6) δ 166.34, 158.67,
151.76, 144.20, 143.79, 137.56, 131.35, 129.36, 128.62, 128.59 (2C), 127.29 (2C),
127.18, 126.68, 124.44, 114.96, 97.34, 52.47, 35.27; ESI-MS m/z: 380.6 [M+H]+;
+
HRMS (ESI) m/z calcd for C20H18N3OS2 [M+H]+: 380.0886; found: 380.0892.
4.1.7
2-(2,4-dimethoxy-3-methylphenyl)-7-(thiophen-2-yl)-9-(trifluoromethyl)pyrido[3',2':4,
5]thieno[3,2-d]pyrimidin-4(3H)-one (11).
To a mixture of DMT (50.5 mg, 0.1 mmol) in THF (2 mL) added
1,2-dichloro-4,5-dicyanobenzoquinone (DDQ, 45.4 mg, 0.2 mmol) at room
o
temperature. The resulting mixture was allowed to warm to 60 C over 1 h. Once the
reaction was completed as indicated by LC-MS, the reaction mixture was
concentrated under reduced pressure and MeOH (2 mL) was added to give a
suspension liquid. The solid precipitate was collected by filtration, washed with
MeOH (2 mL) and dried under reduced pressure to give the desired product as a
1
yellow solid (45.3 mg, 90%). Yellow solid; H NMR (400 MHz, DMSO-d6) δ 12.47
(s, 1H), 8.46 (s, 1H), 8.29 (dd, J = 3.8, 0.9 Hz, 1H), 7.89 (dd, J = 5.0, 0.9 Hz, 1H),
7.82 (d, J = 8.8 Hz, 1H), 7.29 (dd, J = 5.0, 3.8 Hz, 1H), 7.04 (d, J = 8.8 Hz, 1H), 3.90
(s, 3H), 3.65 (s, 3H), 2.16 (s, 3H); ESI-MS m/z: 504.6 [M+H]+; HRMS (ESI) m/z
+
calcd for C23H17F3N3O3S2 [M+H]+: 504.0658; found: 504,0671.

ACCEPTED MANUSCRIPT
4.1.8. N-(pyridin-4-yl)-6-(thiophen-2-yl)thieno[2,3-b]pyridine-2-carboxamide (12).
A solution of 9d (246 mg, 0.7 mmol) in DMF (3 ml) was added dropwise to a
solution of t-BuONO (2.0 equiv) in DMF (3 ml) at 60℃. After stirring for 0.5 h, the
reaction mixture was poured into hydrochloric acid (1 N, 20 mL) to give a suspension
liquid. The solid precipitate was collected by filtration. To the mixture of the solid
precipitate in EtOH (6 mL) was added Zn power (195 mg, 3 mmol) at room
temperature. The resulting mixture was allowed to warm to 100 oC. Once the reaction
was completed as indicated by LC-MS, the reaction mixture was concentrated under
reduced pressure. The appropriate compound was obtained following purification by
1
silica gel column chromatography. Yellow solid; Yield 73% (two steps); H NMR
(400 MHz, DMSO-d6) δ 10.91 (s, 1H), 8.52 (dd, J = 4.9, 1.4 Hz, 2H), 8.48 (d, J = 8.5
Hz, 1H), 8.39 (s, 1H), 8.10 (d, J = 8.5 Hz, 1H), 8.00 (dd, J = 3.8, 1.0 Hz, 1H), 7.81–
13
7.75 (m, 3H), 7.23 (dd, J = 4.9, 3.8 Hz, 1H); C NMR (126 MHz, DMSO-d6) δ
161.57, 160.85, 151.49, 150.46 (2C), 145.30, 143.59, 137.80, 134.53, 131.23, 129.86,
128.76, 127.22, 125.11, 116.60, 113.97 (2C); ESI-MS m/z: 338.6 [M+H]+; HRMS
+
(ESI) m/z calcd for C17H12N3OS2 [M+H]+: 338.0416; found: 338.0411.
4.2 Biological evaluation
4.2.1. Hepatic glucose output assay
HGP assay was conducted according to the previous study with modification
(Zhang, et al. 2013). In the assay, freshly isolated mouse hepatocytes were seeded
onto 48-well plates with standard Williams’ E medium. After 4-h attachment, cells
were changed to serum-free minimum essential medium (MEM) and incubated with
corresponding compounds and 10 nM glucagon for 16 h. After washing with PBS
twice to remove the remaining glucose, cells were incubated with compounds and
10nM glucagon in 500 µL glucose production detection buffer (glucose-free DMEM
without phenol red containing 20 mM sodium lactate and 2 mM sodium pyruvate).
After 6-h incubation, 50 µL detection buffer was collected for glucose concentration
measurement with a colorimetric glucose assay kit (Nanjing Jiancheng, Nanjing,
China) according to the manufacturer’s instruction. The results were normalized to the
total protein concentration measured by BCA protein kit (Thermo Scientific, MA,

ACCEPTED MANUSCRIPT
USA).
4.2.2. The mRNA levels of G6Pase and PEPCK Assay
Primary hepatocytes were seeded onto 6-well plates. After 4-h attachment, cells
were replaced to MEM supplemented with 10% FBS, 100 U/mL penicillin and 100
mg/mL streptomycin. Cells were incubated with corresponding compounds for 24 h
and stimulated with 10 nM glucagon together for another 2 h. Total RNA from
cultured mouse hepatocytes or mashed liver tissues was extracted using TRIzol
reagent according to the manufacturer’s protocol (Takara Bio Inc, Dalian, China).
Complementary DNAs were generated by PrimeScript™ RT reagent Kit (Takara Bio
Inc, Dalian, China) and analyzed qPCR assay using SYBR® Premix Ex Taq™
(Takara Bio Inc, Dalian, China) on a Bio-Rad CFX Connect™ Real-Time System
(Bio-Rad Company, CA, USA). The mRNA levels of specific genes were normalized
to GAPDH. The primers for qPCR were generated from Sangon Biotech (Shanghai,
China) as follows:
G6Pase (+), TAATTGGCTCTGCCAATGGCGATC;
G6Pase (-), ATCAGTCTGTGCCTTGCCCCTGT;
PEPCK (+), CTGCATAACGGTCTGGACTTC;
PEPCK (-), CAGCAACTGCCCGTACTCC;
GAPDH (+), ACAGCAACAGGGTGGTGGAC;
GAPDH (-), TTTGAGGGTGCAGCGAACTT.
4.2.3. In vivo assay
All animals were received humane care, and animal-related protocols were
approved by the Institutional Animal Care and Use Committees at Shanghai Institute
m+/+
of Materia Medica, Chinese Academy of Sciences. db/db mice (BKS.Cg-Dock7
Leprdb/J) were from Jackson Laboratory (CA, USA). 8-week-old mice were divided
into 2 groups by fasting blood glucose and body weight. Vehicle or 8e (25 mg/Kg)
was administrated by intraperitoneal injection daily for 5 weeks. Fasting blood
glucose levels from 6-h fasted mice were measured weekly. At the termination of the
assay, mice were sacrificed and liver tissues were stored at -80 °C for analysis.
Oral glucose tolerance test (OGTT) - For the glucose tolerance test, the mice were

ACCEPTED MANUSCRIPT
fasted for 16 h at the fourth week, 1.5 g/Kg glucose was administered orally with a
gavage needle. Glucose levels were measured from tail vein blood samples at 0, 15,
30, 60, 90 and 120 min by ACCU-CHEK active blood sugar system (Roche, Basel,
Switzerland).
Pyruvate tolerance test (PTT) - For the pyruvate tolerance test, the mice were
fasted for 16 h at the fifth week and then injected intraperitoneally with sodium
pyruvate (1.5 g/Kg). Blood glucose levels were measured with tail vein blood samples
at 0, 15, 30, 60, 90 and 120 min.
Acknowledgements
This work was supported by the National Natural Science Foundation of China
(grants 81473110, 81773596, 81561148011, 8170130685), Natural Science
Foundation of Jiangsu Higher Education Institutions (grant: 17KJA360004,
16KJB350003)，Natural Science Foudation of Jiangsu (grants SBK2016043296),
Program of Outstanding Scientific and Technological Innovation Team of Jiangsu
Higher Education Institutions, and the Priority Academic Program Development of
Jiangsu Higher Education Institutions.
Reference
[1] L. Guariguata, D.R. Whiting, I. Hambleton, J. Beagley, U. Linnenkamp, J.E. Shaw, Diabetes
Res. Clin. Pract. 103 (2014) 137-149.
[2] A. Dwarakanathan, J Insur Med 38 (2006) 20-30.
[3] X. Xu, G. Wang, T. Zhou, L. Chen, J. Chen, X. Shen, Expert Opinion on Drug Discovery 9
(2014) 1047-1058.
[4] G. Brown, A. Singer, V.V. Lunin, M. Proudfoot, T. Skarina, R. Flick, S. Kochinyan, R.
Sanishvili, A. Joachimiak, A.M. Edwards, A. Savchenko, A.F. Yakunin, Journal of Biological
Chemistry 284 (2009) 3784-3792.
[5] S. Jitrapakdee, The International Journal of Biochemistry & Cell Biology 44 (2012) 33-45.
[6] Y.-Y. Wang, C.-J. Chen, S.-Y. Lin, Y.-H. Chuang, W.H.-H. Sheu, K.-C. Tung, Molecular and
Cellular Endocrinology 367 (2013) 50-56.
[7] G. Jiang, B.B. Zhang, American Journal of Physiology - Endocrinology And Metabolism 284
(2003) E671-E678.
[8] Y. Liu, R. Dentin, D. Chen, S. Hedrick, K. Ravnskjaer, S. Schenk, J. Milne, D.J. Meyers, P.
Cole, J.Y. Iii, J. Olefsky, L. Guarente, M. Montminy, Nature 456 (2008) 269-273.
[9] Y. Wang, G. Li, J. Goode, J.C. Paz, K. Ouyang, R. Screaton, W.H. Fischer, J. Chen, I. Tabas,
M. Montminy, Nature 485 (2012) 128-132.
[10] L. Rui, Energy Metabolism in the Liver. In Comprehensive Physiology, John Wiley & Sons,
Inc.: 2014; Vol. 4, pp 177-197.

ACCEPTED MANUSCRIPT
[11] R. Dentin, Y. Liu, S.-H. Koo, S. Hedrick, T. Vargas, J. Heredia, J. Yates, M. Montminy,
Nature 449 (2007) 366-369.
[12] L. He, A. Sabet, S. Djedjos, R. Miller, X. Sun, M.A. Hussain, S. Radovick, F.E. Wondisford,
Cell 137 (2009) 635-646.
[13] A. Barthel, D. Schmoll, American Journal of Physiology - Endocrinology And Metabolism
285 (2003) E685-E692.
[14] D. Granner, T. Andreone, K. Sasaki, E. Beale, Nature 305 (1983) 549-551.
[15] A.K. Rines, K. Sharabi, C.D.J. Tavares, P. Puigserver, Nat Rev Drug Discov 15 (2016)
786-804.
[16] A.K. Madiraju, D.M. Erion, Y. Rahimi, X.-M. Zhang, D.T. Braddock, R.A. Albright, B.J.
Prigaro, J.L. Wood, S. Bhanot, M.J. MacDonald, M.J. Jurczak, J.-P. Camporez, H.-Y. Lee, G.W.
Cline, V.T. Samuel, R.G. Kibbey, G.I. Shulman, Nature 510 (2014) 542-546.
[17] R.A. DeFronzo, R.E. Ratner, J. Han, D.D. Kim, M.S. Fineman, A.D. Baron, Diabetes Care 28
(2005) 1092-1100.
[18] J. Rosenstock, R. Brazg, P.J. Andryuk, K. Lu, P. Stein, Clinical Therapeutics 28 (2006)
1556-1568.
[19] F.X. Pi-Sunyer, A. Schweizer, D. Mills, S. Dejager, Diabetes Res. Clin. Pract. 76 (2007)
132-138.
[20] W. Meng, B.A. Ellsworth, A.A. Nirschl, P.J. McCann, M. Patel, R.N. Girotra, G. Wu, P.M.
Sher, E.P. Morrison, S.A. Biller, R. Zahler, P.P. Deshpande, A. Pullockaran, D.L. Hagan, N.
Morgan, J.R. Taylor, M.T. Obermeier, W.G. Humphreys, A. Khanna, L. Discenza, J.G.
Robertson, A. Wang, S. Han, J.R. Wetterau, E.B. Janovitz, O.P. Flint, J.M. Whaley, W.N.
Washburn, Journal of Medicinal Chemistry 51 (2008) 1145-1149.
[21] S. Nomura, S. Sakamaki, M. Hongu, E. Kawanishi, Y. Koga, T. Sakamoto, Y. Yamamoto, K.
Ueta, H. Kimata, K. Nakayama, M. Tsuda-Tsukimoto, Journal of Medicinal Chemistry 53 (2010)
6355-6360.
[22] J.C. Yoon, P. Puigserver, G. Chen, J. Donovan, Z. Wu, J. Rhee, G. Adelmant, J. Stafford,
C.R. Kahn, D.K. Granner, C.B. Newgard, B.M. Spiegelman, Nature 413 (2001) 131-138.
[23] H. An, L. He, Journal of Endocrinology 228 (2016) R97-R106.
[24] Y.-S. Yoon, D. Ryu, M.-W. Lee, S. Hong, S.-H. Koo, Exp Mol Med 41 (2009) 577-583.
[25] T.T. Zhou, F. Ma, X.F. Shi, X. Xu, T. Du, X.D. Guo, G.H. Wang, L. Yu, V. Rukachaisirikul,
L.H. Hu, J. Chen, X. Shen, Journal of Molecular Endocrinology 59 (2017) 151-169.

ACCEPTED MANUSCRIPT
Captions:
Figure 1. The structure of DMT and the four regions SARs study focused on
Figure 2. 8e inhibited hepatic gluconeogenic genes G6Pase and PEPCK in
dose-dependent manner
Figure 3. 8e ameliorated hyperglycemia in db/db mice in dose-dependent manner
Scheme 1. Reagents and conditions
Scheme 2. Synthetic route of compound 11
Scheme 3. Synthetic route of compound 12
Table 1. Inhibition of hepatic glucose production activities with 8a-8f
Table 2. Inhibition of hepatic glucose production activities with 9a-9q and 12
Table 3. Inhibition of hepatic glucose production activities with 10a-10f

ACCEPTED MANUSCRIPT
Table 1. Inhibition of hepatic glucose production activities with 8a-8f
Compd.
DMT
R1
R2
R3
IC50 (µM)a
cLog Pb
4.714
33.9
8a
CF3
24.8
30.2
4.246
8b
CF3
CF3
3.735
8c
1.7
3.756
8d
8e
8f
H
H
15.4
16.8
NA
4.127
2.986
3.661
CH3
CF3
aIC50: 50% inhibitory concentration. The biological data are generated from at least three
independent experiments.
b: The cLog P values were calculated by ACD-Labs (Version 6.0).
NA: compound showing IC50 value > 100 µM.

ACCEPTED MANUSCRIPT
Table 2. Inhibition of hepatic glucose production activities with 9a-9q and 12
Compd.
R1
R2
R4
IC50 (µM)a
cLog Pb
4.714
33.9
DMT
H
H
H
H
H
12.3
19.1
33.4
12.3
24.7
3.661
3.744
3.800
2.858
3.066
9a
9b
9c
9d
9e
Cl
CF3
H
14.6
4.928
9f
H
H
H
NA
NA
3.266
3.931
2.715
9g
9h
9i
14.2
H
8.0
3.490
9j