Microwave-assisted synthesis of imidazo[4,5-f][1,10]phenanthroline derivatives as apoptosis inducers in chemotherapy by stabilizing Bcl-2 G-quadruplex DNA

Article abstract of DOI:10.3390/molecules22050829

Herein, a series of imidazo[4,5-f ][1,10] phenanthroline derivatives RPIP (PIP = imidazo [4,5-f ][1,10] phenanthroline, R = NO₂, 1; CF₃, 2; Cl, 3; OH, 4) have been synthesized in yields of 82.3-94.7% at 100 °C under the irradiation o

Full text of DOI:10.3390/molecules22050829

molecules
Article
Microwave-Assisted Synthesis of
Imidazo[4,5-f][1,10]phenanthroline Derivatives as
Apoptosis Inducers in Chemotherapy by Stabilizing
Bcl-2 G-quadruplex DNA
Li Li 1,2,†, Jie-Qiong Cao 3,†, Hui-Min Liu 1, Qiong Wu 3, Qiu-Hui Pan 4,*, Zhi-Ping Zeng 2,
Yu-Tao Lan 5, Yu-Mei Li 2, Wen-Jie Mei 2,*, Xi-Cheng Wang 1,* and Wen-Jie Zheng 3
1
The First Affiliation Hospital, Guangdong Pharmaceutical University, Guangzhou 510006, China;
lili7sy@163.com (L.L.); 13570250612@163.com (H.-M.L.)
School of Pharmacy, Guangdong Pharmaceutical University, Guangzhou 510006, China;
2
13086287838@163.com (Z.-P.Z.); 15975634468@163.com (Y.-M.L.)
Department of Chemistry, Jinan University, Guangzhou 510006, China; caojieqiong93@163.com (J.-Q.C.);
3
wuqiongniu.1113@163.com (Q.W.); tzhwj@jnu.edu.cn (W.-J.Z.)
Department of Laboratory Medicine, Shanghai Children’s Medical Center, Shanghai Jiao Tong University
4
School of Medicine, Shanghai 200127, China
School of Nursing, Guangdong Pharmaceutical University, Guangzhou 510006, China;
5
lanyutao@gdpu.edu.cn
*
Correspondence: panqiuhui@263.net (Q.-H.P.); wenjiemei@126.com (W.-J.M.);
13902400598@126.com (X.-C.W.); Tel.: +86-021-38625568 (Q.-H.P.); +86-020-39352122 (W.-J.M.);
+86-020-61321397 (X.-C.W.)
†
These authors contributed equally to this work.
Academic Editor: Julio A. Seijas Vázquez
Received: 23 March 2017; Accepted: 14 May 2017; Published: 20 May 2017
Abstract: Herein, a series of imidazo[4,5-f][1,10] phenanthroline derivatives RPIP (PIP = imidazo
[4,5-f][1,10] phenanthroline, R = NO2, 1; CF3, 2; Cl, 3; OH, 4) have been synthesized in yields of
82.3–94.7% at 100 ◦C under the irradiation of microwave. MTT assay has been utilized to evaluate
the inhibitory activity (IC50) of these compounds against the growth of various tumor cells, and the
results revealed that these compounds, especially
the growth of A549 cells with IC50 of 15.03 M. Moreover, it’s also confirmed that
into the membrane of tumor cells and distribute in mitochondria when observed under microscopy,
resulting apoptosis of tumor cells. The further studies showed that can bind to bcl-2 G-quadruplex
DNA, which demonstrated by the increase of melting point of bcl-2 G4 DNA in the presence of
1, exhibited excellent inhibitory activity against
µ
1
can penetrate
1
1,
as well as electronic titration and emission spectra. In a word, this kind of compound may develop
as a potential apoptosis inducer in cancer chemotherapy via binding and stabilizing to the bcl-2
G-quadruplex DNA.
Keywords: microwave-assisted synthesis; imidazo[4,5-f][1,10]phenanthroline derivatives; apoptosis
inducers; bcl-2 G-quadruplex DNA
1. Introduction
1,10-Phenanthroline derivatives with an extended
bind to duplex DNA and G-quadruplex DNA through
anti-inflammatory and antiviral activity [ ], as well as probes of DNA due to their strong fluorescence
sensory properties towards acid [ ]. Accumulated evidences show that this type of compounds
exhibit promising inhibitory activity against various tumor cells. For example, it’s reported
π
-conjugated unit of fused imidazole, which can
π-π
stacking, exhibit great antitumor,
1
2
Molecules 2017, 22, 829; doi:10.3390/molecules22050829
www.mdpi.com/journal/molecules

Molecules 2017, 22, 829
2 of 11
that imidazo[4,5-f][1,10]phenanthroline-dione derivatives might increase the chemosensitivity of
esophageal cancer patients [ ]. It’s also revealed that di-substituted phenanthroline derivatives can
induce apoptosis of tumor cells through binding to human telomeric G-quadruplexes DNA and
inhibit the telomerase activity significantly [ ]. In our previous work, it has been suggested that
3
4,5
imidazo[4,5-f][1,10]phenanthroimidazole derivatives showed excellent inbitory effect against the
growth of breast cancer cells and lung cancer cells through binding to G-quadruplex DNA and thus
blocking the replication of DNA molecules [6,7].
The bcl-2 G-quadruplex DNA, a secondary structure of G-rich sequence in promoter of Bcl-2 gene
via Hoogsteen hydrogen bond, is a key director to regulate the expression of Bcl-2, which is a crucial
member of the Bcl-2 family of proteins to inhibit the apoptosis and usually over-expressed in various
human tumor cells [8]. More recently, a number of small molecules like pyridostatin analog [9],
metal complexes [10], quindoline derivatives [11], with high affinity to bcl-2 G-quadruplex DNA
have been reported to inhibit the transcription of Bcl-2 and thus inducing apoptosis of tumor
cells. Attributed to the high ability to bind and stabilize G-qudruplex DNA, phenanthroline
derivatives exhibit effectively in inducing apoptosis of various tumor cells, and it’s possible that
this kind of compounds may also inhibit the growth of tumor cells through interacting with bcl-2
G-quatruplex DNA.
In this study, a series of imidazo[4,5-f][1,10]phenanthroline derivatives have been synthesized
under microwave irradiation (Scheme 1). The anti-tumor activity of these compounds against the
human lung adenocarcinoma A549 cells, human hepatocarcinoma SMMC7721 cells, and human
colorectal carcinoma SW620 cells were evaluated by MTT assay. The results showed these compounds,
especially
distribute in mitochondria of A549 cells, and thus inducing apoptosis of tumor cells through G1 phase
arrest. Moreover, it was found that exhibited moderate binding affinity to bcl-2 G-quadruplex DNA.
1 can effectively inhibit the growth of A549 cells. The further studies revealed that 1 could
1
Scheme 1. Microwave-assisted synthesis route for imidazo[4,5-f][1,10]phenanthroimidazole derivatives.
2. Results and Discussion
2.1. Microwave-Assisted Synthesis of the Imidazo[4,5-f][1,10]phenanthroimidazole Derivatives
Microwave-assisted synthesis technology has been widely developed in the fields of chemical
synthesis, materials science, and biotechnology [12,13]. The technique obviously shorten reaction time,
while increasing yield and product purity over traditional synthesis methods, especially in organic
synthesis which typically require long hours of heating in high-boiling solvents [14]. In this study,
the reaction temperature rapidly reached setting value less than 60 s, and kept great stabilization and
homogeneous of temperature and pressure in the whole heating process. As a result, the application
of microwave irradiation has significantly increased the yields for most of the compounds to
approximately 90% (Table 1), which was much higher than those with conventional methods [15].

Molecules 2017, 22, 829
3 of 11
Table 1. The yields of the target complexes by microwave-assisted synthesis method.
Microwave-Assisted
Comp.
◦
Temperature/ C
Time/min Yield%
1
2
3
4
100
100
100
100
20
20
20
20
91.3%
82.3%
94.7%
89.7%
2.2. Biological Activity
The synthetic imidazo[4,5-f][1,10]phenanthroimidazole derivatives can effectively inhibit the
human lung adenocarcinoma A549 cells, human hepatocarcinoma SMMC7721 cells, and human
colorectal carcinoma SW620 cells growth and proliferation, which were confirmed by MTT assay.
Cis-platin was used as a positive control, and the inhibitory activities (IC50) of these complexes were
listed in Table 2. It was observed that these compounds displayed great growth inhibition against
various tumor cells after 72 h treatment. It’s worthy to indicate that
1 exhibited excellent inhibitory
activity against A549 cells (IC50 = 15.03 M) but low toxicity in normal cells. These data suggested that
µ
imidazo[4,5-f][1,10]phenanthroimidazole derivatives exhibited promising inhibitory activity against
the growth of tumors cells.
Table 2. The inhibitory effect IC50
(
µM) of the target complexes and cis-platin on human cancer cells
and normal cells at 72 h.
IC50 (µM)
Comp.
A549
SW620
SMMC-7721
HaCaT
1
2
3
4
15.03
13.79
14.27
±
±
±
1.01 26.48
0.53 27.23
0.21 16.02
±
±
±
±
0.59 17.51
±
±
±
±
±
1.84 27.26
±
±
±
±
±
1.49
0.53 12.93
0.29 12.64
0.28 24.22
0.51 17.48
0.35 13.37
2.28 13.94
1.45 18.48
0.58
0.56
0.64
1.64
3.00 ± 0.14
16.52
cis-platin
32.01
±
4.66
6.29 ± 0.17
11.66
2.3. Apoptosis Induction
According to the results of the MTT assay, flow cytometric analysis was carried out to further
understand the underlying mechanisms of . In general, apoptosis and cell cycle arrest, or a combined
action of both can result in growth inhibition or death of cells [16]. After A549 cells were exposed
to different concentrations of (0, 5, 10, and 20 M) for 24 h, a significant increase in G1-phase was
observed, and was dosage depend (Figure 1a). At concentration of 20 M for , the ratio of G1-phase
reached about 67.37%, which was about 12% higher than that of the control (55.75%) [17 18]. These data
indicating that may inhibit the growth of A549 cells through inducing apoptosis of tumor cells since
1
1
µ
µ
1
,
1
G1 phase arrest was more related to cell apoptosis, and pro-apoptotic proteins like Bcl-2 usually plays
key roles in accelerating the apoptosis of tumor cells [19–23].

Molecules 2017, 22, 829
4 of 11
Figure 1.
(
a) G1-phase arrest of A549 cells induced by
1; (b) Change in cell cycle distribution of A549
cells induced by
1
. A549 cells were treated with (0, 5, 10, and 20 µ
1
M) for 24 h, almost 67.37% cycling
cells were in the G1-phase and the sharp peak suggested that some cells were experiencing G1-phase
delay or arrest.
2.4. Drug Distribution and Location
Cellular localization of
1 in A549 cells was further investigated, as shown in Figure 2. It was
observed that can be uptook by A549 cells and glow weak green fluorescence, a possible reason is
1
mainly due to the absence of hypochrome nitro-group. Here, the mitochondria were marked in red
by Mito-tracker, and◦the nuclei of A549 cells were stained blue by Hoechst 33,258. After incubated
1 for 6 h at 37 C, an green fluorescence was great merged with red fluorescence in the cell
with
mitochondria, but little overlay in cell nucleus. These results indicated this compound entered into
cells majorly accumulated in the mitochondria of A549 cells, which may induce the cell apoptosis
through mitochondria-mediated pathway.
◦
Figure 2. Cellular localization of
and 20 M: green,
Image Pro Plus.
1
in A549 cells. Cells were treated with the
1
for 6 h at 37 C [
1] = 0, 10
µ
1; blue, Hoechst 33258; red, Mito-Tracker. The overlay data were analyzed using

Molecules 2017, 22, 829
5 of 11
2.5. The Interaction of Bcl-2 G-quadruplex DNA with Imidazo[4,5-f][1,10]phenanthroimidazole Derivatives
2.5.1. Electronic Titrations
Electronic spectra titration experiment was carried out to monitor the interaction of 1 with bcl-2
G-quadruplex DNA. As shown in Figure 3a, the electronic spectra of 1 in Tris-HCl buffer (pH = 7.2)
solution exhibited the characteristic IL (intraligand charge transfer) absorption in the range of 250–300
nm with the maximum at about 273 nm. When the DNA was gradually added to the solution of the
complex, a hyperchromic effect and a bathochromic effect were observed. The hyperchromism value
of
the DNA exposed, when the ligand binding to DNA, induced external contact or to partial uncoiling
of the DNA structure [24 25]. Furthermore, the value of the intrinsic binding constant (Kb) for was
about 8.7
107 M−1, calculated according to the decay of IL absorption. These data implied that
1 at the IL absorption band was about 14.1% (∆λ = 2.1 nm), which may be attributed to bases of
,
1
×
1
bound to bcl-2 G-quadruplex DNA with high affinity in intercalating mode [26]. The interaction was
further confirmed by the following fluorescence quenching experiment.
（b）
（a）
120
1.0
0.8
0.6
0.4
0.2
0.0
0.15
0.10
0.05
0.00
0.6
90
60
30
0
0.00 0.05 0.10 0.15 0.20 0.25
6
0.0
0.3
0.6
0.9
M
1.2
6
[DNA]×10
M
[DNA]×10
0.4
0.2
0.0
300
400
500
600
540
570
600
630
660
690
Wavelength/nm
Wavelength/nm
Figure 3. The study of the interaction between
methods. ) The electronic spectra of in absence and in presence of bcl-2 G-quadruplex
DNA. [1] = 60 µM, [DNA] = 100 M; ( ) Emission spectra of EB and bcl-2 G-quadruplex DNA in
1 with bcl-2 G-quadruplex DNA by spectroscopic
(
a
1
µ
b
the incubation buffer in the absence and presence of 1, [EB] = 16 µM, [DNA] = 2 µM.
2.5.2. Fluorescence Quenching
Owing to the low fluorescence of
1 in the Tris-HCl KCl buffer (pH = 7.2), fluorescence quenching
of ethidium bromide (EB) and DNA was carried out. As shown in Figure 3b, when excited at 350 nm,
the EB-DNA (bcl-2 G4 DNA) emitted a strong fluorescence in the range of 500 nm to 700 nm with the
maximum at about 597 nm [27]. Upon the addition of 1, it was observed the fluorescence intensity of
the solution decreased gradually. At [1] = 20.89 µM, the relative intensity (I/I0) for solution was about
0.83. The results implied that 1 exhibited a certain interaction with bcl-2 G-quadruplex DNA.
2.5.3. FRET Melting Point Curves
To confirm the stability of the bcl-2 G4 DNA in presence of
1, FRET melting assay was carried out,
the results were shown in Figure 4a, and the melting point of the concentration–dependent melting
curves of
1
were showed in Figure 4b. Treated with 3.0
µ
M of◦1, the
∆Tm of bcl-2 G4 DNA was about
◦
2.4 C, while the
concentration 6.0
DNA [28].
∆
Tm of bcl-2 G4 DNA increased about 11 C after incubated with increasing the
µM of 1. These results indicated that 1 behaved to stabilize bcl-2 G-quadruplex

Molecules 2017, 22, 829
6 of 11
（a）
（b）
1.0
bcl-2 (0.2 μM)
1(3μM)+ bcl-2
70
70.9
1(6μM)+ bcl-2
0.8
0.6
0.4
0.2
62.3
60
59.9
40
30
20
10
0
0.0
30
Control
3
6
40
50
60
70
80
90
Temperature/
℃
Concentration/μM
Figure 4. FRET melting profiles of bcl-2 G4 DNA in the absence and in presence of
DNA] = 0.2 µM) and the melting rising trend with the increasing of 1 (b).
1 (a) ([bcl-2 G4
3. Experimental Section
3.1. Materials
All reagents were purchased from commercial suppliers and used without further purification.
Solvents were dried and purified by conventional methods prior to use. Distilled water was used
in all experiments. Bcl-2 G-quadruplex DNA (50-CGGGCGCGGGAGGAAGGGGGCGGGAGC-30)
and 50-FAM-bcl-2-TAMRA-30 were purchased from Sangon Biotech Co., Ltd. (Shanghai, China) Bcl-2
◦
G-quadruplex DNA formed a G-quadruplex conformation as literature by renaturation for 24 h at 4 C,
after denaturation for 5 min at 90 ◦C [29]. All aqueous solutions were prepared with doubly distilled
water. The Tris-HCl buffer consisting of Tris and KCl, and the pH value was adjusted to 7.2 by HCl
solution, which was applied to UV titration, Fluorescence emission titrations.
3.2. Instruments
The imidazo[4,5-f][1,10]phenanthroline derivatives were synthesized by using Anton Paar
Monowave 300 microwave reactor (Anton Paar, Graz, Austria). ESI-MS spectra were obtained
in methanol on Agilent 1100 ESI-MS system (Agilent, Palo Alto, CA, USA) operating at room
temperature. The 1H-NMR and 13C-NMR spectra were recorded on a dimethyl-d6 sulfoxide (DMSO-d6)
solution on a Bruker Avance III 500 spectrometer (Bruker, Bremen, Germany) operating at room
temperature. The HPLC spectra were recorded on a Agilent 1200 high pressure liquid chromatograph
(Agilent, Palo Alto, CA, USA). UV-vis absorption spectra were recorded on a Shimadzu UV-2550
spectrophotometer (Shimadzu, Tokyo, Japan). The steady-state emission spectra were recorded on a
RF-5301 fluorescence spectrophotometer (Shimadzu, Tokyo, Japan). Cellular localization experiment
was performed with an LSCM510 Meta Duo Scan (Carl Zeiss, Oberkochen, Germany).
3.3. Synthesis of Imidazole[4,5-f][1,10] phenantholine Derivatives
Imidazole[4,5-f][1,10]phenanthroimidazole derivatives were synthesized according to the
literature procedure with some modification [30]. All of the compounds were appropriately
characterized and the HPLC analysis showed the average purity of target compounds was about 97%
(see Supplementary Materials).
3.3.1. Synthesis of 1
A mixture of 1,10-phenanthroline-5,6-dione (315.06 mg, 1.50 mmol), 3-nitrobenzaldehyde
(339.81 mg, 2.25 mmol), ammonium acetate (4 g, 51.9 mmol) and glacial acetic acid (20 mL) was
heated at 100 ◦C for 20 min under microwave irradiation. Then, 20 mL of water was added and the

Molecules 2017, 22, 829
7 of 11
pH value was adjusted to 7.0 at room temperature. The solution was filtered and dried in vacuum to
obtain a yellow precipitate, which was collected and washed with water and small amounts of ethanol.
The crude product dissolved in ethanol was purified by filtration on silicagel column (60–100 mesh).
ESI-MS (in MeOH, m/z): 342.1 [M + H]+. Anal. Calcd. for C19H11N5O2
N, 17.45. Found: C, 61.66; H, 3.69; N, 18.72. H-NMR (500 MHz, DMSO)
·
CH3COOH: C, 62.84; H, 3.77;
9.03–9.02 (m, 1H), 9.00 (dd,
1
δ
J = 4.3, 1.7 Hz, 2H), 8.84 (dd, J = 8.1, 1.7 Hz, 2H), 8.64 (d, J = 8.0 Hz, 1H), 8.27 (dd, J = 8.1, 1.5 Hz, 1H),
7.83 (t, J = 8.0 Hz, 1H), 7.78 (dd, J = 8.1, 4.3 Hz, 2H). 13C-NMR (126 MHz, DMSO)
δ
150.38 (s), 145.70 (s),
134.14 (s), 132.63 (s), 131.70 (s), 125.58 (s), 125.29 (s), 122.30 (s), HPLC purity, 98.2% at 273 nm (method
A, tR = 4.72 min).
3.3.2. Synthesis of 2
2
was prepared using the method described above, but with 3-trifluoromethylbenzaldehyde
(391.5 mg, 2.25 mmol). ESI-MS (in MeOH, m/z): 365.5 [M + H]+. Anal. Calcd. for C20H11F3N4
·
1
H2O
DMSO)
7.84 (t, J = 3.6 Hz, 2H), 7.78 (dd, J = 8.1, 4.3 Hz, 2H). 13C-NMR (126 MHz, DMSO)
·
CH3CH2OH: C, 61.68; H, 4.47; N, 13.08. Found: C, 62.23; H, 4.26; N, 13.70. H-NMR (500 MHz,
δ
9.00 (dd, J = 4.3, 1.7 Hz, 2H), 8.84 (dd, J = 8.1, 1.6 Hz, 2H), 8.55 (s, 1H), 8.53 (d, J = 7.3 Hz, 1H),
150.88 (s), 149.99 (s),
δ
145.75 (s), 133.03 (s), 132.29 (s), 131.98 (s), 131.64 (s), 125.30 (s), HPLC purity, 99.3% at 273 nm (method
A, tR = 7.84 min).
3.3.3. Synthesis of 3
3
was prepared using the method described above, but with 3-chlorobenzaldehyde (315 mg,
2.25 mmol). ESI-MS (in MeOH, m/z): 331.3 [M + H]+. Anal. Calcd. for C19H11ClN4
·
H2O CH3COOH:
·
1
C, 61.69; H, 4.19; N, 13.70. Found: C, 61.62; H, 3.95; N, 14.13. H-NMR (500 MHz, MeOD:CDCl3 = 1:1)
δ
8.95–8.89 (m, 2H), 8.79 (s, 1H), 7.99 (t, J = 9.4 Hz, 2H), 7.62 (s, 2H), 7.57 (s, 1H), 7.29 (t, J = 8.7 Hz,
2H). 13C-NMR (126 MHz, MeOD:CDCl3 = 1:1)
δ
149.06 (s), 144.91 (s), 141.69 (s), 131.63–131.46 (m),
131.08 (s), 127.96 (s), 124.76 (s), HPLC purity, 98.8% at 273 nm (method A, tR = 6.30 min).
3.3.4. Synthesis of 4
4
was prepared using the method described above, but with 3-Hydroxybenzaldehyde (274.59 mg,
2.25 mmol). ESI-MS (in MeOH, m/z): 313.1 [M + H]+. Anal. Calcd for C19H12N4O
·
H2O
·
CH3CH2OH:
9.02 (dd,
1
C, 67.01; H, 5.36; N, 14.88. Found: C, 67.06; H, 5.20; N, 15.25. H-NMR (500 MHz, DMSO)
δ
J = 4.3, 1.7 Hz, 2H), 8.91 (dd, J = 8.1, 1.7 Hz, 2H), 7.81 (dd, J = 8.1, 4.3 Hz, 2H), 7.73 (dd, J = 6.0, 3.8 Hz,
1H), 7.72–7.69 (m, 1H), 7.39 (t, J = 7.9 Hz, 1H), 6.91 (ddd, J = 8.1, 2.4, 0.8 Hz, 1H). 13C-NMR (126 MHz,
DMSO)
δ 152.95 (s), 149.75 (s), 145.55 (s), 133.43 (s), 132.07 (s), 131.68 (s), 125.30 (s), 119.07 (s), 118.72 (s),
115.16 (s), HPLC purity, 93.2% at 273 nm (method A, tR = 4.17 min).
3.4. Cell Lines, Cell Culture and MTT Assay
Human cancer cell lines, human lung adenocarcinoma A549 cells, human hepatocarcinoma
SMMC7721 cells, human colorectal carcinoma SW620 cells and HaCaT cells were purchased from
American Type Culture Collection (ATCC, Manassas, VA, USA). All cell lines were maintained in
Dulbecco’s Modified Eagle Medium (DMEM) media supplemented with fetal bovine serum (10%),
penicillin (100 units/mL), and streptomycin (50 units/mL) at 37 ◦C in a CO2 incubator (95% relative
humidity, 5% CO2).
Cell viability was confirmed by measuring the ability of cells to transform 3-(4,
5-dimethylthia-zol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to a purple formazan dye [31].
Cells were seeded in 96-well tissue culture plates (3
incubated with the tested compounds at different concentrations for 72 h. After incubation, 20
well of MTT solution (5 mg/mL in phosphate buffered saline, PBS) was added, followed by incubation
for a further 5 h. The medium was aspirated and replaced with 150 L/well of DMSO to dissolve the
formazan salt formed. The colour intensity, which reflects the cell growth condition, was measured
×
103 cells per well) for 24 h. The cells were then
L per
µ
µ

Molecules 2017, 22, 829
8 of 11
at 570 nm using a microplate spectrophotometer (SpectroAmaxTM250, BioTek Instruments, Inc.,
Winooski, VT, USA).
3.5. Flow Cytometric Analysis
Cells were seeded in six-well tissue culture plates (1
arrest was analyzed by flow cytometry as previously described [32]. After incubating with different
×
105 cells per well), and the cell cycle
concentrations of
1
(0, 5, 10, and 20
µ
M) for 72 h, cells were trypsinized, washed with PBS, and fixed
◦
with 70% ethanol overnight at 4 C. The fixed cells were washed with PBS and stained with propidium
iodide (PI) for 15 min in the dark, then the cell cycle arrest was analyzed with an Epics XL-MCL flow
cytometer (Beckman Coulter, Miami, FL, USA).
3.6. Cellular Localization
◦
Cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) at 37 C
under 5% CO2. Cells in complete growth medium at◦5
×
104 cells per mL were incubated for 6 h at
in DMEM for 6 h at 37 C under 5% CO2. Then, cells were stained with
◦
37 C. Cells were treated with
1
Mito-tracker and Hoechst 33,258 for another 20 min, and finally, luminescence imaging was carried
out by confocal laser scanning microscope.
3.7. Electronic Absorption Measurements
Electronic absorption spectra were recorded on a Shimadzu UV-2550 spectrophotometer using
1 cm path length quartz cuvettes (3 mL). The absorption titration of the target complex in Tris-HCl
buffer was performed by using a fixed complex concentration to which increments of the DNA stock
solution were added. The concentration of the complex solution was 20 µM and bcl-2 G4 DNA was
added by degrees. Complex-DNA solutions were allowed to incubate for 3 min before the absorption
spectra were recorded.
3.8. Fluorescence Quenching Measurements
Fluorescence spectroscopy measurements were performed on a RF-5301 fluorescence
spectrophotometer using a 1 cm path length quartz cell. Fluorescence quenching of the EB + bcl-2 G4
DNA system can be used for a compound having an affinity to DNA in spite of its binding mode, and
only measures the ability of the compound to affect the EB fluorescence intensities in the EB + bcl-2 G4
DNA system. The titration processes were repeated until there was no apparent change in the spectra
for at least three titrations, indicating the achievement of the binding saturation [33].
3.9. FRET Melting Assays
The fluorescent labeled oligonucleotide, bcl-2 G-quadruplex DNA (50-FAM-CGGGCGC
GGGAGGAAGGGGGCGGGAGC-TAMRA-30, FAM: carboxyfluorescein, TAMRA: 6-carboxy
tetramethylrhodamine) used as the FRET probe was diluted in TrisHCl buffer and then annealed by
being heated to 90 ◦C for 5 min, followed by slowly cooling to room temperature [29]. Ds26 duplex
DNA (CAATCGGATCGAATTCGATCCGATTG) was competitive binders to evaluate the selective
binding ability of
Bio-RadiQ5 realtime PCR detection system (Bio-Rad, Berkeley, CA, USA), by using a total reaction
volume of 25 mL, with labeled oligonucleotide (1 M) and different concentrations of complex in
1 with bcl-2 G4 DNA. Fluorescence melting curves were determined with a
µ
Tris-HCl buffer [34]. A constant temperature was maintained for 30 s prior to each reading to ensure a
stable value. Final analysis of the data was carried out by using Origin7.5 (Origin Lab, Northampton,
MA, USA).

Molecules 2017, 22, 829
9 of 11
4. Conclusions
In summary, a series of imidazole[4,5-f][1,10]phenanthroimidazole derivatives have been
synthesized by using microwave-assisted synthesis technology, with high yields of approximately
90%, which can rapid rising to the required temperature, and kept almost no change during the whole
process. The results of MTT assay showed these complexes can block the growth of tumor cells,
especially
the cells. The further study displayed
1
, exhibited excellent antitumor activity against A549 cells through inducing apoptosis of
can distribute at mitochondria, and inhibit tumor cells at G1
1
phase then induce apoptosis. Furthermore, this compound can bind to the bcl-2 G-quadruplex DNA.
Take together, the results suggested that the target compound could act as a potential apoptosis inducer
mediated-mitochondria through binding to the bcl-2 G-quadruplex DNA in cancer chemotherapy
(Figure 5).
Figure 5. Tumor cells apoptosis induced by imidazole[4,5-f][1,10]phenanthroimidazole derivatives
related to mitochondria-mediated pathway.
Supplementary Materials: Supplementary materials are available online.
Acknowledgments: This work was supported by National Nature Science Foundation of China (81572926);
the Provincial Major Scientific Research Projects in Universities of Guangdong Province (2014KZDXM053);
the Science and Technology Project of Guangdong Province (2014A020212312); the Innovation Projects in
Universities of Guangdong Province (2015cxqx151); Tradition Chinese Medicine Bureau of Guangdong Province
(number 20151265), the Innovation Team Projects in Universities of Guangdong Province (2016KCXTD018).
Author Contributions: Li Li and Jie-Qing Cao contribute to electronic spectra titration, emission spectra, and Li Li
writes the paper. Hui-Min Liu contributes to the FRET melting assay. Yu-Mei Li contributes to the synthesis of the
target complexes; Qiu-Hui Pan, Qiong-Wu, Zhi-Ping Zeng and Yu-Tao Lan contribute to the cells experiments.
Xi-Cheng Wan, Wen-Jie Mei and Wen-Jie Zheng contributed to designed the experiments and read the manuscript.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
De Cian, A.; Delemos, E.; Mergny, J.L.; Teulade-Fichou, M.P.; Monchaud, D. Highly efficient G-quadruplex
recognition by bisquinolinium compounds. J. Am. Chem. Soc. 2007, 129, 1856–1857. [CrossRef] [PubMed]
Zhen, N.; Yang, Q.; Zheng, K.; Han, Z.; Sun, F.; Mei, W.; Yu, Y. MiroRNA-127–3p targets XRCC3 to enhance
the chemosensitivity of esophageal cancer cells to a novel phenanthroline-dione derivative. Int. J. Biochem.
Cell. B 2016, 79, 158–167. [CrossRef] [PubMed]
2.

Molecules 2017, 22, 829
10 of 11
3.
4.
5.
6.
7.
8.
9.
Peng, J.; Sun, J.; Gong, P.; Xue, P.; Zhang, Z.; Zhang, G.; Lu, R. Luminescent Nanofibers Fabricated from
Phenanthroimidazole Derivatives by Organogelation: Fluorescence Response towards Acid with High
Performance. Chem. Asian J. 2015, 10, 1717–1724. [CrossRef] [PubMed]
Wang, L.; Wen, Y.; Liu, J.; Zhou, J.; Li, C.; Wei, C. Promoting the formation and stabilization of human
telomeric G-quadruplex DNA, inhibition of telomerase and cytotoxicity by phenanthroline derivatives.
Org. Biomol. Chem. 2011, 9, 2648–2653. [CrossRef] [PubMed]
Wei, C.Y.; Wang, J.H.; Wen, Y.; Liu, J.; Wang, L.H. 4-(1H-imidazo[4,5-f]-1,10-phenanthrolin-2-yl)phenol-based
G-quadruplex DNA binding agents: Telomerase inhibition, cytotoxicity and DNA-binding studies.
Bioorg. Med. Chem. 2013, 21, 3379–3387. [CrossRef] [PubMed]
Liao, S.; Zhang, Z.; Wu, Q.; Wang, X.; Mei, W. Microwave-assisted synthesis of phenanthroimidazole
derivatives as stabilizer of c-myc G-quadruplex DNA. Bioorg. Med. Chem. 2014, 22, 6503–6508. [CrossRef]
[PubMed]
Zhen, N.; Yang, Q.; Wu, Q.; Zhu, X.; Wang, Y.; Sun, F.; Mei, W.; Yu, Y. A novelly synthesized phenanthroline
derivative is a promising DNA-damaging anticancer agent inhibiting G1/S checkpoint transition and
inducing cell apoptosis in cancer cells. Cancer Chemother. Pharmacol. 2016, 77, 169–180. [CrossRef] [PubMed]
Wang, C.; Yu, Q.; Yang, L.; Liu, Y.; Sun, D.; Huang, Y.; Zhou, Y.; Zhang, Q.; Liu, J. Ruthenium (II) polypyridyl
complexes stabilize the bcl-2 promoter quadruplex and induce apoptosis of Hela tumor cells. Biometals 2013
26, 387–402. [CrossRef] [PubMed]
,
Feng, Y.; Yang, D.; Chen, H.; Cheng, W.; Wang, L.; Sun, H.; Tang, Y. Stabilization of G-quadruplex DNA
and inhibition of Bcl-2 expression by a pyridostatin analog. Bioorg. Med. Chem. Lett. 2016, 26, 1660–1663.
[CrossRef] [PubMed]
10. Chen, Z.F.; Qin, Q.P.; Qin, J.L.; Liu, Y.C.; Huang, K.B.; Li, Y.L.; Meng, T.; Zhang, G.H.; Peng, Y.; Luo, X.J.;
et al. Stabilization of G-quadruplex DNA, inhibition of telomerase activity, and tumor cell apoptosis by
organoplatinum(II) complexes with oxoisoaporphine. J. Med. Chem. 2015, 58, 2159–2179. [CrossRef]
[PubMed]
11. Wang, X.D.; Ou, T.M.; Lu, Y.J.; Li, Z.; Xu, Z.; Xi, C.; Tan, J.H.; Huang, S.L.; An, L.K.; Li, D.; et al. Turning off
transcription of the bcl-2 gene by stabilizing the bcl-2 promoter quadruplex with quindoline derivatives.
J. Med. Chem. 2010, 53, 4390–4398. [CrossRef] [PubMed]
12. Kitchen, H.J.; Vallance, S.R.; Kennedy, J.L.; Tapia-Ruiz, N.; Carassiti, L.; Harrison, A.; Whittaker, A.G.;
Drysdale, T.D.; Kingman, S.W.; Gregory, D.H. Modern microwave methods in solid-state inorganic materials
chemistry: From fundamentals to manufacturing. Chem. Rev. 2014, 114, 1170–1206. [CrossRef] [PubMed]
13. De la Hoz, A.; Diaz-Ortiz, A.; Moreno, A. Microwaves in organic synthesis. Thermal and non-thermal
microwave effects. Chem. Soc. Rev. 2005, 34, 164–178. [CrossRef] [PubMed]
14. Beckford, F.A.; Shaloski, M.; Leblanc, G.; Thessing, J.; Lewis-Alleyne, L.C.; Holder, A.A.; Li, L.; Seeram, N.P.
Microwave synthesis of mixed ligand diimine-thiosemicarbazone complexes of ruthenium(II): Biophysical
reactivity and cytotoxicity. Dalton Trans. 2009, 48, 10757–10764. [CrossRef] [PubMed]
15. Sun, D.-D.; Wang, W.Z.; Mao, J.W.; Mei, W.J.; Liu, J. Imidazo[4,5-f][1,10]phenanthroline derivatives as
inhibitor of c-myc gene expression in A549 cells via NF-κB pathway. Bioorg. Med. Chem. Lett. 2012, 22,
102–105. [CrossRef] [PubMed]
16. Xiao, H.; Zhang, Q.; Lin, Y.; Reddy, B.S.; Yang, C.S. Combination of atorvastatin and celecoxib synergistically
induces cell cycle arrest and apoptosis in colon cancer cells. Int. J. Cancer 2008, 122, 2115–2124. [CrossRef]
[PubMed]
17. Wang, T.; Gong, X.; Jiang, R.; Li, H.; Du, W.; Kuang, G. Ferulic acid inhibits proliferation and promotes
apoptosis via blockage of PI3K/Akt pathway in osteosarcoma cell. Am. J. Transl. Res. 2016, 8, 968–980.
[PubMed]
18. Guo, Y.X.; Lin, Z.M.; Wang, M.J.; Dong, Y.W.; Niu, H.M.; Young, C.Y.; Lou, H.X.; Yuan, H.Q.
Jungermannenone A and B induce ROS- and cell cycle-dependent apoptosis in prostate cancer cells in vitro
.
Acta Pharmacol. Sin. 2016, 37, 814–824. [CrossRef] [PubMed]
19. Varshavsky, A. The N-end rule pathway and regulation by proteolysis. Protein Sci. 2011, 20, 1298–1345.
[CrossRef] [PubMed]
20. Eldeeb, M.-A.; Fahlman, R.P. Phosphorylation Impacts N-end Rule Degradation of the Proteolytically
Activated Form of BMX Kinase. J. Biol. Chem. 2016, 291, 22757–22768. [CrossRef] [PubMed]

Molecules 2017, 22, 829
11 of 11
21. Eldeeb, M.A.; Fahlman, R.P. The anti-apoptotic form of tyrosine kinase Lyn that is generated by proteolysis
is degraded by the N-end rule pathway. Oncotarget 2014, 5, 2714–2722. [CrossRef] [PubMed]
22. Song, Y.; Cao, W.; Zhu, X.; Qiu, Z.; Yang, X.; Liu, J.; Xu, R.; Yuan, W.; Quan, S. F10, a novel hydatidiform
mole-associated gene, inhibits the paclitaxel sensitivity of A549 lung cancer cells by downregulating BAX
and caspase-3. Oncol. Lett. 2017, 13, 2563–2568. [CrossRef] [PubMed]
23. Rauzan, M.; Chuah, C.T.; Ko, T.K.; Ong, S.T. The HDAC inhibitor SB939 overcomes resistance to BCR-ABL
kinase Inhibitors conferred by the BIM deletion polymorphism in chronic myeloid leukemia. PLoS ONE
2017, 12, e0174107. [CrossRef] [PubMed]
24. Bhattacharjee, S.; Chakraborty, S.; Sengupta, P.K.; Bhowmik, S. Exploring the Interactions of the Dietary Plant
Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding
Behavior: Spectroscopic and Molecular Modeling Approaches. J. Phys. Chem. B 2016, 120, 8942–8952.
[CrossRef] [PubMed]
25. Buraka, E.; Chen, C.Y.; Gavare, M.; Grube, M.; Makarenkova, G.; Nikolajeva, V.; Bisenieks, I.; Bruvere, I.;
Bisenieks, E.; Duburs, G.; et al. DNA-binding studies of AV-153, an antimutagenic and DNA
repair-stimulating derivative of 1,4-dihydropiridine. Chem. Biol. Interact. 2014, 220, 200–207. [CrossRef]
[PubMed]
26. Jager, K.; Bats, J.W.; Ihmels, H.; Granzhan, A.; Uebach, S.; Patrick, B.O. Polycyclic azoniahetarenes: Assessing
the binding parameters of complexes between unsubstituted ligands and G-quadruplex DNA. Chemistry
2012, 18, 10903–10915. [CrossRef] [PubMed]
27. Wu, Q.; Chen, T.; Zhang, Z.; Liao, S.; Wu, X.; Wu, J.; Mei, W.; Chen, Y.; Wu, W.; Zeng, L.; et al.
Microwave-assisted synthesis of arene ruthenium(II) complexes [(η
6-RC6H5)Ru(m-MOPIP)Cl]Cl (R = -H
and -CH3) as groove binder to c-myc G4 DNA. Dalton Trans. 2014, 43, 9216–9225. [CrossRef] [PubMed]
28. Peng, D.; Tan, J.H.; Chen, S.B.; Ou, T.M.; Gu, L.Q.; Huang, Z.S. Bioorg. Med. Chem. 2010, 18, 8235–8242.
[CrossRef] [PubMed]
29. Chan, D.S.-H.; Yang, H.; Kwan, M.H.-T.; Cheng, Z.; Lee, P.; Bai, L.-P.; Jiang, Z.-H.; Wong, C.-Y.; Fong, W.-F.;
Leung, C.-H.; et al. Structure-based optimization of FDA-approved drug methylene blue as a c-myc
G-quadruplex DNA stabilizer. Biochimie 2011, 93, 1055–1064. [CrossRef] [PubMed]
30. Zhang, Z.; Wang, Q.; Wu, Q.; Hu, X.Y.; Wang, C.X.; Mei, W.J.; Tao, Y.Y.; Wu, W.L.; Zheng, W. Preparation and
Characterization of Phenanthroimidazole-based Derivatives with Ether Linkage at N1-Phenyl. J. Chem. Chin.
Univ. 2014, 35, 1691–1696.
31. Chen, T.; Wong, Y.S. Selenocystine induces reactive oxygen species-mediated apoptosis in human cancer
cells. Biomed. Pharmacother. 2009, 63, 105–113. [CrossRef] [PubMed]
32. Liu, Z.-L.; Mao, J.-H.; Peng, A.-F.; Yin, Q.-S.; Zhou, Y.; Long, X.-H.; Huang, S.-H. Inhibition of fatty
acid synthase suppresses osteosarcoma cell invasion, and migration via downregulation of the PI3K/Akt
signaling pathway in vitro. Mol. Med. Rep. 2013, 7, 608–612. [CrossRef] [PubMed]
33. Lu, X.-H.; Shi, S.; Yao, J.-L.; Gao, X.; Huang, H.-L.; Yao, T.-M. Two structurally analogous ruthenium
complexes as naked-eye and reversible molecular “light switch” for G-quadruplex DNA. J. Inorg. Biochem.
2014, 140, 64–71. [CrossRef] [PubMed]
34. Kitchen, D.-B.; Decornez, H.; Furr, J.-R.; Bajorath, J. Docking and scoring in virtual screening for drug
discovery: Methods and applications. Nat. Rev. Drug Discov. 2004, 3, 935–949. [CrossRef] [PubMed]
Sample Availability: Samples of the compounds 1–4 are available from the authors.
©
2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).