In Vitro and Cellular Probes to Study PARP Enzyme Target Engagement

Resource

In Vitro and Cellular Probes to Study PARP Enzyme

Target Engagement

Graphical Abstract

Authors

Tim J. Wigle, Danielle J. Blackwell,

Laurie B. Schenkel, ...,

Melissa M. Vasbinder, Heike Keilhack,

Kevin W. Kuntz

Correspondence

twigle@ribontx.com

In Brief

Wigle et al. describe a versatile set of

+

NAD -competitive probes for PARP

enzymes that are used to build high-

throughput in vitro and cellular

biophysical assays that enable inhibitor

screening and determination of

residence time.

Highlights

d

Exploited solvent-exposed region of PARP inhibitors to

+

design NAD -competitive probes

Probes used to develop assays for PARP enzymes that are

agnostic of substrates

TR-FRET assays are sensitive and discriminate high-potency

inhibitors

NanoBRET assays conﬁrm cellular target engagement and

measure residence time in cells

Wigle et al., 2020, Cell Chemical Biology 27, 877–887

July 16, 2020 ª 2020 Elsevier Ltd.

https://doi.org/10.1016/j.chembiol.2020.06.009

ll

Resource

In Vitro and Cellular Probes

to Study PARP Enzyme Target Engagement

Tim J. Wigle,¹^,²^,* Danielle J. Blackwell, Laurie B. Schenkel, Yue Ren, W. David Church, Hetvi J. Desai,

1

Kerren K. Swinger, Andrew G. Santospago, Christina R. Majer, Alvin Z. Lu, Mario Niepel, Nicholas R. Perl,

1

Melissa M. Vasbinder, Heike Keilhack, and Kevin W. Kuntz

1

Ribon Therapeutics, 35 Cambridgepark Drive, Suite 300, Cambridge, MA 02140, USA

²Lead Contact

*Correspondence: twigle@ribontx.com

https://doi.org/10.1016/j.chembiol.2020.06.009

SUMMARY

+

Poly(ADP-ribose) polymerase (PARP) enzymes use nicotinamide adenine dinucleotide (NAD ) to modify up to

seven different amino acids with a single mono(ADP-ribose) unit (MARylation deposited by PARP monoen-

zymes) or branched poly(ADP-ribose) polymers (PARylation deposited by PARP polyenzymes). To enable the

development of tool compounds for PARP monoenzymes and polyenzymes, we have developed active site

probes for use in in vitro and cellular biophysical assays to characterize active site-directed inhibitors that

+

compete for NAD binding. These assays are agnostic of the protein substrate for each PARP, overcoming

a general lack of knowledge around the substrates for these enzymes. The in vitro assays use less enzyme

than previously described activity assays, enabling discrimination of inhibitor potencies in the single-digit

nanomolar range, and the cell-based assays can differentiate compounds with sub-nanomolar potencies

and measure inhibitor residence time in live cells.

INTRODUCTION

only limited reports of PARP monoenzyme inhibitors that are

suitable for interrogating these biological roles in cells or animal

Human poly-ADP-ribose polymerase (PARP) enzymes are models. Of the PARP monoenzyme inhibitors that have been dis-

responsible for the mono(ADP-ribosylation) (MARylation depos- closed, potencies and intra-PARP family selectivity are modest

ited by PARP monoenzymes) and poly(ADP-ribosylation) (PARy- and often the cellular target engagement is not conﬁrmed by

lation deposited by PARP polyenzymes) of serine, aspartic acid, showing direct binding to the PARP or inhibition of the PARP’s

glutamic acid, lysine, tyrosine, cysteine, and potentially arginine enzymatic activity (Carlile et al., 2016; Haikarainen et al.,

(

Leutert et al., 2016). The protein family is sub-divided such that 2014a; Johannes et al., 2015; Lindgren et al., 2013; Morgan

there are 12 enzymatically active PARP monoenzymes, 4 enzy- et al., 2019; Peng et al., 2017; Venkannagari et al., 2016; Yo-

matically active PARP polyenzymes, and 1 protein classiﬁed as neyama-Hirozane et al., 2017), with the exception of a potent

catalytically inactive (PARP13). Both PARP monoenzymes and PARP11-selective tool compound that inhibits auto-MARylation

PARP polyenzymes utilize nicotinamide adenine dinucleotide of PARP11 in 293 cells overexpressing the protein (Kirby

+

NAD ) as the source of ADP-ribose (ADPr) and share similar et al., 2018).

(

active sites, where PARP polyenzymes have a conserved H-Y-

Typically, a target-family approach to generating chemical

E motif essential for catalysis and most PARP monoenzymes, probes relies on having biochemical and cell-based target

with the exception of PARP3 and PARP4, have a conserved H- engagement assays for multiple structurally and functionally

Y motif and an isoleucine, leucine, or tyrosine in place of the related proteins. These assays enable the iterative medicinal

glutamate (Vyas et al., 2014).

chemistry design and testing cycles required to develop suitable

The biological roles of the PARP polyenzymes are character- selectivity and potency proﬁles in the inhibitors and to draw

ized to a greater extent than that of the monoenzymes. The appropriate conclusions from cellular phenotypic studies. Previ-

PARP polyenzymes have been well explored with potent, selec- ous biochemical screening for PARPs has been done using low-

tive small-molecule catalytic inhibitors (Thorsell et al., 2017) and throughput biophysical methods (Wahlberg et al., 2012), DNA-

PROTACs (Wang et al., 2019), and in the case of PARP1 and encoded library screening (Yuen et al., 2019) or small-molecule

PARP2, approved drugs exist (olaparib, niraparib, rucaparib, microarray screening (Peng et al., 2017), which require establish-

and talazoparib). PARP monoenzymes play a role in the cellular ment of complex chemistry, and enzyme assays that require high

stress response and are increasingly becoming linked to immu- amounts of enzyme to generate a robust signal but limit the lower

nology, inﬂammation, and cancer (Butepage et al., 2015; Kunze limit of potency resolution (Chen et al., 2018; Ji et al., 2018; Thor-

and Hottiger, 2019; Vyas and Chang, 2014); however, there are sell et al., 2017; Venkannagari et al., 2013; Wigle et al., 2019;

Cell Chemical Biology 27, 877–887, July 16, 2020 ª 2020 Elsevier Ltd. 877

ll

Resource

Yoneyama-Hirozane et al., 2017). The development of PARP monoenzymes and polyenzymes are differentiated by the type

monoenzyme assays is limited by a lack of understanding of residue found in that position, with hydrophobic isoleucine,

around the substrates for their MARylation activities, and at the leucine, or tyrosine residues found in most monoenzymes

time this work was initiated no antibodies capable of detecting (Leu189 and Tyr254 in PARP16), versus the polar glutamate

MARylation existed. While substrate identiﬁcation efforts for found in polyenzymes, which contain the canonical H-Y-E motif

the PARP monoenzymes have been published (Carter-O’Connell (Glu1138 in PARP5b, Figure 1B). In addition to the energetic ben-

et al., 2016; Carter-O’Connell et al., 2018; Feijs et al., 2013; Jwa eﬁts of placing a hydrophobic group on the ligand near a hydro-

and Chang, 2012; Lu et al., 2019; Yang et al., 2017), generating phobic residue in the protein, the isoindoline clashes with the

in vitro assays using the reported substrates has been chal- glutamate in overlays with H-Y-E PARP crystal structures (not

lenging (Wigle et al., 2019).

shown), further supporting the overall selectivity of this ligand

+

During our efforts to develop NAD -competitive inhibitors of for H-Y-I/L/Y PARPs over H-Y-E PARPs. It still retains binding

PARPmonoenzymes we havedeveloped an in-depthunderstand- to PARP1, PARP2 and PARP4, however on average relative to

ing of the structure-activity relationships (SAR) within the PARP other H-Y-I/L/Y PARPs it is 17-, 13-, and 15-fold selective,

+

family. We have identiﬁed regions of several NAD -competitive in- respectively. In this PARP16 crystal structure, there are three

hibitor templates that accommodate a wide range of substitutions independently solved copies of the protein-ligand complex per

without resulting in a loss of binding afﬁnity. Inspired by previous asymmetric unit, and when the three copies are superimposed,

work in the kinase ﬁeld where pan-inhibitor templates have been both the protein D loop and the piperidine moiety on the ligand

used to generate in vitro ﬂuorescent (Lebakken et al., 2007) and reveal conformational ﬂexibility. Notably, the piperidine in all

cellular NanoBRET probes (Machleidt et al., 2015), we took advan- three copies binds toward the surface of the pocket, exposing

tage of these observations and have generated a versatile set of vectors that extend toward solvent. This observation was ex-

+

NAD -competitive probes consisting of a PARP inhibitor con- ploited in the design of TR-FRET (RBN011147) and NanoBRET

nected to a ﬂuorescent group or biotin moiety via a ﬂexible linker. (RBN011198) probes (Figure 1C). Extensions off the piperidine

Here, we report the development of both in vitro and cellular probe NH with linkers connected to either biotin or ﬂuorophore Nano-

displacement assays using these compounds. These high- BRET 590SE led to probes that retained afﬁnity to the H-Y-I/L/

throughput biophysical assays do not require knowledge of the

Y

PARPs when compared with the parent molecule,

substrate for each PARP, circumventing a challenge to screening RBN010860. Based on the published crystal structure of the

these enzymes. The in vitro probe displacement assays are based literature inhibitor PJ34 bound to PARP5b (Figure 1B) (Abdel-

on time-resolved ﬂuorescence resonance energy transfer (TR- karim et al., 2001; Haikarainen et al., 2014b), a separate probe

FRET) between acceptor and donor pairs bound to a hexahistidine was designed for the H-Y-E PARPs, which includes the monoen-

(

His6) tag on the protein and the biotin group on the active site zymes, PARP3 and PARP4. Using a similar concept, and exploit-

probe. The TR-FRET assays correlate well to enzyme inhibition as- ing a solvent-exposed vector, linkers connected to the ﬂuoro-

says(Wigleetal., 2019),anduseupto50-foldlessprotein,typically phore NanoBRET 590SE were extended off the parent

improving the resolution of inhibitor potency to the single-digit molecule RBN011829, an analog of PJ34, to yield RBN012148

nanomolar range. The cellular assays are based on biolumines- (Figure 1D). The afﬁnities of the probes for all the PARP enzymes

cence resonance energy transfer (BRET) between a NanoLuc- are shown in Figure 1E and tabulated in Table S1.

tagged protein and a ﬂuorescent group on the active site probe

(

NanoBRET). The NanoBRET assays typically resolve inhibitor po- Development of TR-FRET Probe Displacement Assays

tency into the triple-digit picomolar range. A series of PARP inhib- for H-Y-I/L/Y PARPs Using RBN011147

itors was tested in both the TR-FRET and NanoBRET assays and The binding of RBN011147 to H-Y-(I/L/Y) PARPs was conﬁrmed

we observed good correlation of potencies. In addition, we show using TR-FRET where donor/acceptor pairs consisting of two

that the NanoBRET assays can be used to investigate cellular resi- conﬁgurations shown in Figure 2A were examined: (1) streptavidin

dence times of PARP inhibitors. Overall, these assays are versatile labeled with europium chelate + anti-His antibody labeled with

biophysical tools that enable PARP chemical biology.

ULight dye and (2) streptavidin labeled with ULight dye + anti-

His antibody labeled with europium chelate. The conﬁguration

that gave the best signal-to-background for each PARP was iden-

tiﬁed and selected for further assay development. An example of

the assay development process followed is shown for PARP7 in

RESULTS

Design of TR-FRET and NanoBRET Probes

RBN010860 is an inhibitor originating from a fragment screening Figures 2B–2E. First, a simultaneous titration of enzyme, active

hit against PARP16 that binds to several H-Y-I/L/Y PARPs with site probe, donor, and acceptor was performed and conditions

sub-micromolar afﬁnity as measured by surface plasmon reso- for further assay development were selected based on achieving

nance (SPR) (Figure 1E; Table S1). A crystal structure of concentrations near the apex of the hook points while minimizing

RBN010860 bound to PARP16 is depicted in Figure 1A. protein use and ensuring robust signal-to-background (Figure 2B).

PARP16 has a canonical three-dimensional structure of PARP DMSO titrations were performed to understand the sensitivity of

monoenzyme active sites, and the binding mode of the com- the binding signal to the solvent used for solubilizing the test com-

pound in PARP16 is representative of the binding mode in other pounds (Figure 2C). In many instances there was signiﬁcant

PARPs. The cis amide of the pyridazinone makes hydrogen DMSO sensitivity above 1% and we chose to use 0.25% DMSO

bonds with the backbone of Gly153, and the aromatic ring stacks in the assays to avoid major loss of signal. To search for control

with Tyr193. In addition, the observed binding mode places the compounds for each assay, a reference set of PARP inhibitors

hydrophobic isoindoline group in a region where most PARP plus the parent compound of the probe (RBN010860) was

878 Cell Chemical Biology 27, 877–887, July 16, 2020

ll

Resource

+

Figure 1. Development of NAD -Competitive Probes for PARP Enzymes

˚

A) Crystal structure of RBN010860 bound to PARP16 at 2.1 A. Three independently solved copies of the protein-ligand complex from the asymmetric unit are

(

superimposed. Protein is depicted as a gray cartoon. The protein D loop, a ﬂexible loop near the active site found in structures of all PARPs that have been

structurally characterized, is colored cyan, green, and pink in the three different chains. RBN010860 is displayed in sticks and is colored to match the protein

chain to which it is bound.

(

B) The crystal structure of PARP5b bound to PJ34 (PDB: 4BJB) is similarly depicted. The D loop and inhibitor are colored cyan. Black arrows show the solvent-

exposed vectors that were exploited for both types of probes.

C) The pan-H-Y-(I/L/Y) PARP inhibitor RBN010860 was derivatized with a linker plus biotin or NanoBRET 590SE, respectively yielding the TR-FRET probe

(

RBN011147 and the NanoBRET probe RBN011198 for H-Y-(I/L/Y) PARP assay development. The type of ADP-ribosylation deposited by each enzyme is denoted

in parentheses.

(

D) The potent PARP1 and PARP3 inhibitor RBN011829 was derivatized with a linker plus NanoBRET 590SE, yielding the NanoBRET probe RBN012148 for

PARP1 and PARP3 assay development. The type of ADP-ribosylation deposited by each enzyme is denoted in parentheses.

E) The binding afﬁnities of the parent molecules and probes were measured using SPR.

(

screened in dose-response format (Figure 2D). Finally, the assay for several H-Y-I/L/Y PARPs (an example is shown for PARP7

was transferred to automated liquid handling dispensing equip- in Figure 4), and RBN012148 was used to develop NanoBRET

ment and the uniformity of test plates containing vehicle or fully assays for PARP1 and PARP3 (an example for PARP3 is shown

blocked active site by RBN010860 were performed and the repro- in Figure 5). Transient expression of PARP enzymes fused to a

0

ducibility was judged using the Z factor (Zhang et al., 1999). This NanoLuc tag on the N or C terminus was tested in 293T cells (Fig-

process was repeated for all H-Y-I/L/Y PARP enzymes, and ﬁnal ure 4B for PARP7, Figure 5A for PARP3). Constructs that showed

assay conditions are summarized in Table S3 and correlation of a luminescence signal greater than 100-fold above the empty

TR-FRET probe displacement half-maximal inhibitory concentra- vector control were deemed sufﬁcient for assay development

tion (IC50) values to enzyme inhibition values calculated using the and were then tested for binding to the probe, and the K

d

for

self-modiﬁcation enzyme assay (Wigle et al., 2019) are shown in this interaction was calculated (Figures 4C and 5B). The

Figure 3.

construct with the best assay window was chosen for assay

development, with preference often given to full-length con-

structs to better represent the physiologically relevant form of

the enzyme, and we moved forward setting the probe concentra-

Development of NanoBRET Probe Displacement Assays

for H-Y-I/L/Y and H-Y-E PARPs Using RBN011198 and

RBN012148

d

tion to equal its K value. To search for appropriate control com-

The general scheme for the NanoBRET assays is shown in Fig- pounds, the parent of the probe as well as a reference set of

ure 4A. RBN011198 was used to develop a NanoBRET assay PARP inhibitors were screened in a dose-response format

Cell Chemical Biology 27, 877–887, July 16, 2020 879

ll

Resource

Figure 2. PARP7 Probe Displacement Assay Development Using TR-FRET

(A) Conﬁguration 1 of the TR-FRET assay with streptavidin-labeled europium (donor) and ULight-labeled anti-His6 antibody (acceptor) is shown on the left, while

conﬁguration 2 of the TR-FRET assay with europium-labeled anti-His6 antibody (donor) and ULight-labeled streptavidin (acceptor) is shown on the right.

(B) Simultaneous titration of PARP7, RBN011147, and donor/acceptor pairs was performed to select conditions leading to the most robust assay.

(C) DMSO titrations showed the assay is sensitive (IC50 = 0.9%) to the solvent used for the compounds. Data are represented as mean ± SEM.

(D) A reference set of compounds, including the active site probe parent compound (RBN010860) and literature PARP1 inhibitors screened to identify a com-

pound to be used as a positive control. Data are represented as mean ± SEM.

E) Uniformity of the fully automated assay is tested to ensure robust and reproducible performance.

(

Figures 4D and 5C). The assays were then automated using was performed by incubating 293T cells overexpressing Nano-

liquid handling equipment and the uniformity of test plates con- Luc-PARP fusion proteins with the test inhibitor at 10-fold its

taining vehicle or fully blocked active site was assessed using the measured IC50 value. Following compound treatment, the

0

Z factor (Zhang et al., 1999) (Figures 4E and 5D). Final assay excess unbound inhibitor was removed using multiple rapid

conditions and constructs used for each assay are shown in Ta- washing steps and the cells were resuspended in medium con-

d

bles S4 and S5 and correlation of TR-FRET and NanoBRET taining the NanoBRET probe at 10-fold its K value. By observing

probe displacement IC50 values are shown in Figure 6.

the NanoBRET signal increase as a function of time we inferred

the rate at which the inhibitor was dissociating from the PARP

and being replaced by the NanoBRET probe (overall scheme

for experiment shown in Figure 7A). For PARP7, RBN010860 is

Measurement of PARP7 and PARP14 Inhibitor Binding

Kinetics in Cells Using NanoBRET

We used the NanoBRET concept to assess the residence times a fast-off inhibitor in both SPR (t1/2 = 18 s) and NanoBRET (<60

of PARP7 and PARP14 inhibitors of varying degrees of potency s), while RBN012337 has a very long residence time in SPR

and compared them with residence time measurements per- (216 min) and NanoBRET (too slow to measure in this format)

formed using SPR. The NanoBRET residence time measurement (Figures 7B–7D). For PARP14, RBN010860 is a fast-off inhibitor

880 Cell Chemical Biology 27, 877–887, July 16, 2020

ll

Resource

Figure 3. Correlation of TR-FRET Probe Displacement Assay and Enzyme Inhibition Assay

Dose responses of PARP inhibitors were tested using in vitro probe displacement TR-FRET assays and in vitro enzyme inhibition assays (Wigle et al., 2019). Solid

black lines represent a 1:1 correlation and dashed green lines represent 3:1 and 1:3 correlations. The vertical blue dashed lines represent the theoretical potency

limit of the enzyme inhibition assays, equivalent to half of the enzyme concentration.

in both SPR (t1/2 = 32 s) and NanoBRET (<60 s), while

RBN013293 has a modest residence time in SPR (19 min) and ple series of NAD -competitive PARP inhibitors to design a set of

In this study we exploited our knowledge of the SAR for multi-

+

NanoBRET (12 min) (Figures 7E and 7F). The structures of derivatized small-molecule probes that bind in the NAD -binding

RBN012337 and RBN013293 are shown in Figure S1.

site of most PARP enzymes. We used these probes to develop a

series of sensitive in vitro and cellular biophysical assays that rely

upon detecting the displacement of the probes from the enzyme

using TR-FRET or NanoBRET, respectively. The pan-monoen-

DISCUSSION

The limited knowledge around the identity of PARP substrates zyme inhibitor RBN010860 served as the starting point for design

renders development of enzyme activity assays suitable for the of the monoenzyme active site probes. Functionalization of the

discovery and characterization of potent and selective small piperidine nitrogen, which provides a vector to access the sol-

molecules challenging, particularly among the PARP monoen- vent-exposed region of the protein, enabled incorporation of

zyme subfamily, which for all but PARP3 and PARP4 contain a many different substitutions while retaining potency (the full

catalytic triad of H-Y-I/L/Y residues. We have previously used SAR for this template will be described in a future publication).

a family-wide approach to developing in vitro enzyme activity as- Derivatizing RBN010860 using this vector with a linker con-

says that relies upon immobilizing the enzymes on a microplate nected to

a biotin group led to the TR-FRET probe

surface to induce molecular crowding, forcing the enzymes to (RBN011147), and when linked to the ﬂuorophore NanoBRET

self-modify (Wigle et al., 2019). We have used these assays to 590SE led to the NanoBRET probe (RBN011198). Both probe

generate SAR for a series of PARP inhibitors; however, the molecules RBN011147 and RBN011198 retained binding afﬁnity

high enzyme concentrations needed to observe robust signal to nearly all H-Y-I/L/Y PARPs similar to the parent molecule

in many cases limits the ability to discriminate between potent in- RBN010860, and enabled the development of TR-FRET assays

hibitors. In addition, there are no MAR-selective antibodies avail- for PARP6, PARP7, PARP8, PARP10, PARP11, PARP12,

able for use in cell-based assay development to understand PARP14, PARP15, and PARP16, and NanoBRET assays for

cellular target engagement, although very recently an antibody PARP7, PARP10, PARP11, PARP12, PARP14, and PARP16.

recognizing both MAR and PAR has been characterized (Lu While the TR-FRET format worked for all enzymes tested, we

et al., 2019).

note that we were unable to generate NanoBRET assays for

Cell Chemical Biology 27, 877–887, July 16, 2020 881

ll

Resource

Figure 4. PARP7 Probe Displacement Assay Development Using NanoBRET

(

A) Conﬁguration of the NanoBRET assay where a NanoLug-tagged PARP enzyme generates light from the NanoLuc substrate, which in turn excites the

NanoBRET 590SE dye in the probe, causing an emission of light with a wavelength of 610 nm.

B) The expression of catalytic domain (amino acids 456–657) or full-length PARP7 (amino acids 1–657) with N- and C-terminal NanoLuc fusions was investigated

in 293T cells. An empty vector control transfection (pcDNA) was performed to assess the background signal. Data are represented as mean ± SEM.

(

app

d

(

C) Titration of the probe RBN011198 was performed against all constructs that were expressed inside the 293T cells. K

values were as follows Nluc-PARP7

1ꢀ657

= 50 nM, and PARP7 -Nluc = 10 nM. Data are represented as mean ± SEM.

4

56ꢀ657

456ꢀ657

1ꢀ657

=

100 nM, PARP7

-Nluc = 50 nM, Nluc-PARP7

(

D) Control inhibitors were tested for the displacement of RBN011198 in 293T cells under ﬁnal assay conditions. Data are represented as mean ± SEM.

0

E) The uniformity of the ﬁnal assay was tested in 384-well format and the Z was 0.7.

PARP6, PARP8, and PARP15. Previous efforts have shown that the probe displacement assay. For these enzymes, the TR-FRET

pan-H-Y-E PARP inhibitors could be used to generate active site assay discriminates compounds over roughly 1–2 more logs of

probes for ﬂuorescence polarization (Papeo et al., 2014). We de- potency as evidenced by the ‘‘hockey stick’’ shape of those cor-

rivatized a similar parent molecule (RBN011829) with the ﬂuoro- relation plots. In addition, the lower concentration of protein

phore NanoBRET 590SE to generate the probe RBN012148, used in the TR-FRET assay combined with the reduced assay

which extends the concept of probe displacement for H-Y-E volume results in a much lower consumption of protein when

PARPs into the cellular milieu through the development of Nano- screening inhibitors. There have been reports that inhibitors of

BRET assays for PARP1 and PARP3.

To understand whether probe displacement correlated with have potency underestimated when assessed in enzyme assays

the DNA-binding PARPs (PARP1, PARP2, and PARP3) may

+

inhibition of enzymatic activity, a collection of NAD -competitive using truncated constructs (Thorsell et al., 2017). We investi-

PARP inhibitors was tested in dose-response format in both the gated if this effect occurred for PARP14, an H-Y-I/L-Y PARP,

TR-FRET assay and a previously described enzymatic assay and compared the potency of a series of inhibitors against full-

measuring self-modiﬁcation of immobilized PARP enzymes (Wi- length and truncated PARP14 comprised of only the catalytic

gle et al., 2019). The IC50 values generated in each assay typi- domain, and did not observe a shift in potency (Figure S2).

cally fall within 3-fold of each other, indicating that the TR-

We further compared IC50 data generated in the biochemical

FRET probe displacement assay is a good surrogate for enzyme assays (either TR-FRET probe displacement or self-modiﬁcation

+

inhibition when characterizing NAD -competitive inhibitors (Fig- enzyme inhibition) to the NanoBRET assays (Figure 6). While the

+

ure 3) and the IC50 for NAD was in-line with its K

M

value (data not constructs are overexpressed as NanoLuc fusions, which may

shown). In many instances, the TR-FRET assays use a much impact their subcellular localization, we note that overall the

lower concentration of enzyme compared with the self-modiﬁca- cell-based data correlate with the in vitro data. The PARP1 and

tion assay (Table S6). The high amounts of PARP protein PARP14 biochemical to NanoBRET potency correlation plots

required to observe a signal in the self-modiﬁcation assays limits did contain some outliers, with compounds being less potent

the ability to discriminate potent inhibitors since the lowest IC50 in the NanoBRET assay. In the case of PARP14, many outliers

ꢀ6

value measurable is equivalent to half the protein concentration had low permeability (Papp (A-B) <3 3 10 cm/s) in an MDCK-

used (Copeland, 2005). This is evident in the case of the PARP7 MDR1 assay, which may contribute to their shift in cellular po-

and PARP16, which use 75 and 150 nM protein, respectively, in tency. It has been established that PARP1 trapping onto DNA

the enzyme activity assay compared with 3 nM of each protein in may account for the mechanism of action of some chemotypes

882 Cell Chemical Biology 27, 877–887, July 16, 2020

ll

Resource

Figure 5. PARP3 Probe Displacement Assay Development Using NanoBRET

(A) The expression of full-length PARP3 (amino acids 1–533) with N- and C-terminal NanoLuc fusions was investigated in 293T cells. An empty vector control

transfection (pcDNA) was performed to assess the background signal. Data are represented as mean ± SEM.

1

ꢀ533

(

B) Titration of the probe RBN012148 was performed against all constructs that were expressed inside the 293T cells. The measured K values were: PARP3

d

1ꢀ533

NLuc = 176 nM and NLuc-PARP3

= 167 nM. Data are represented as mean ± SEM.

(

C) Control inhibitors were tested for the displacement of RBN012148 in 293T cells under ﬁnal assay conditions. Data are represented as mean ± SEM.

0

D) The uniformity of the ﬁnal assay was tested in 384-well format and the Z was 0.8.

of PARP1 inhibitors (Murai et al., 2012; Wang et al., 2019), and of PARP7 and PARP14 to show that cellular residence time can be

the biochemical enzyme inhibition assay used here for PARP1 measured for the PARP enzymes using NanoBRET and that, for

contains DNA to activate the enzyme. It is possible that the these enzyme-inhibitor pairs, the residence time measured by

NanoBRET assay measures the binding to the apo protein, and SPR aligns closely with the NanoBRET value. This technique

the enzyme inhibition assay is measuring the PARP1 trapping has sufﬁcient throughput to screen multiple compounds in parallel

potency of the inhibitor versus a PARP1-DNA complex. In addi- in one experiment and will be useful to inform medicinal chemistry

tion, we included a reported PARP11 cell-active tool compound design. In addition, the understanding of cellular residence time

(

Kirby et al., 2018) in this study and observed that it had IC50

=

will help build the relationship between exposure and pharmaco-

dynamic and phenotypic effects when testing PARP inhibitors

2

6

8 nM in the PARP11 enzyme inhibition assay and IC50

1 nM in the PARP11 NanoBRET assay. It had modest activity in vivo.

for PARP7, 10, and 14 in both assays but was at least 10-fold se-

lective for PARP11 over those enzymes.

It is becoming increasingly apparent that understanding an in-

SIGNIFICANCE

hibitor’s residence time on a target is important throughout the ADP-ribosylation is an important post-translational modiﬁ-

drug discovery process. Often, in the early stages of drug discov- cation involved in the cellular stress response and has

ery there is a desire to be able to screen compounds with reason- been linked to immunology, inﬂammation and cancer. The

able throughput to assess residence time to understand struc- poly(ADP-ribose) polymerase (PARP) family are the major

ture-kinetic relationships, and in the later stages to understand human enzymes responsible for the deposition of ADP-

in vivo pharmacologic outcomes (Copeland, 2016). Traditionally ribose. There are 16 enzymatically active members among

the ability to do this has mainly been limited to in vitro techniques the 17 proteins in the PARP family, and while all of them

+

(

Copeland et al., 2011; Renaud et al., 2016). Recently, NanoBRET use nicotinamide adenine dinucleotide (NAD ) to ADP-ribo-

probe displacement has been applied to other target classes to sylate their substrates, they can be further sub-divided

understand residence time in the complex cellular milieu where based on key residues in their active site and the type of

proteins may exist in complexes, have diverse post-translational modiﬁcation they perform. PARP polyenzymes typically

modiﬁcations, and are interacting with substrates whose concen- have a catalytic triad of H-Y-E in their active site and deposit

trations may be ﬂuctuating (Bouzo-Lorenzo et al., 2019; Ong et al., long, branched polymers of poly(ADP-ribose), while mono-

2

020; Robers et al., 2015). We used slow-off and fast-off inhibitors enzymes typically have a catalytic triad of H-Y-I/L/Y and

Cell Chemical Biology 27, 877–887, July 16, 2020 883

ll

Resource

Figure 6. Correlation of NanoBRET Cellular Probe Displacement and Biochemical Assays

Dose responses of PARP inhibitors were tested using NanoBRET assays and biochemical TR-FRET probe displacement or enzyme inhibition assays (Wigle et al.,

019). Solid black lines represent a 1:1 correlation and dashed green lines represent 3:1 and 1:3 correlations.

2

deposit a single mono(ADP-ribose). While the biological role on cellular target engagement for PARP inhibitors to enable

of poly(ADP-ribosylation) has been extensively studied with a family-wide approach to chemical biology.

small-molecule inhibitors, far less is known about mono(-

ADP-ribosylation). A major challenge to developing assays

STAR+METHODS

for the PARP monoenzymes is the lack of knowledge around

how they engage their substrates. To enable the discovery

Detailed methods are provided in the online version of this paper

and include the following:

and development of inhibitors for H-Y-I/L/Y PARPs, we de-

+

signed NAD -competitive probe molecules for in vitro and

cellular biophysical probe displacement assays. Using these

probes, we developed TR-FRET assays for PARP6, PARP7,

PARP8, PARP10, PARP11, PARP12, PARP14, PARP15, and

PARP16, and NanoBRET assays for PARP7, PARP10,

PARP11, PARP12, PARP14, and PARP16. In addition, we

d KEY RESOURCES TABLE

d RESOURCE AVAILABILITY

B Lead Contact

B Materials Availability

B Data Code and Availability

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

B Cell Lines

+

disclose an NAD -competitive probe for H-Y-E PARPs and

develop NanoBRET assays for PARP1 and PARP3. These

probe displacement assays are agnostic of the substrates

for the PARP enzymes, are highly sensitive and correlate

well with each other, as well as with the inhibition of enzy-

matic activity. Overall, they are high-throughput methods

that will enable hit ﬁnding, lead optimization, and inform

d METHOD DETAILS

B Recombinant Protein Production

B TR-FRET Probe Displacement Assays

B NanoBRET Probe Displacement Assays

B Cellular Binding Kinetics

884 Cell Chemical Biology 27, 877–887, July 16, 2020

ll

Resource

Figure 7. Measuring Cellular Residence Time Using NanoBRET Probe Displacement Assay

(

A) Scheme for testing residence time in cells using the NanoBRET assay.

B) SPR sensorgrams from single, discreet injections of RBN010860 against PARP7 was ﬁt using kinetic binding models and the afﬁnity and half-life are indicated.

C) Single-cycle kinetic SPR binding data for RBN012337 against PARP7 was ﬁt using kinetic binding models, and the afﬁnity and half-life are indicated.

D) RBN010860 is a fast-off inhibitor of PARP7 in cells, while RBN012337 is an extremely slow-off inhibitors for which a half-life value could not be ﬁt on the

timescale of the experiment.

E) SPR sensorgrams from single, discreet injections of RBN010860 against PARP14 was ﬁt using kinetic binding models and the afﬁnity and half-life are indicated. (F)

Single-cycle kinetic SPR binding data for RBN013293 against PARP14 was ﬁt using kinetic binding models, and the afﬁnity and half-life are indicated.

G) RBN010860 is a fast-off inhibitor of PARP14 in cells (half-life < 1 min), while RBN013293 is a modestly slow-off inhibitor (half-life = 12 min). Data were ﬁt using a

(

one-phase exponential association model.

B Self-Modiﬁcation Enzyme Assays

B Synthesis of 3-(5,5-diﬂuoro-7-(1H-pyrrol-2-yl)-5H-

4

B Surface Plasmon Resonance (SPR)

B X-Ray Crystallography

5l ,6l -dipyrrolo[1,2-c:2’,1’-f][1,3,2]diazaborinin-3-

yl)-N-(6-(methyl(3-oxo-3-((6-oxo-5,6-dihydrophenan-

thridin-2-yl)amino)propyl)amino)hexyl)propenamide

(RBN012148)

B General Chemical Synthesis

B Synthesis of 5-[5-(Piperidin-4-yloxy)-2,3-dihydro-1H-

isoindol-2-yl]-4-(triﬂuoromethyl)-2,3-dihydropyridazin-

d QUANTIFICATION AND STATISICAL ANALYSIS

B Data Analysis for In Vitro Active Site Probe Displace-

ment TR-FRET Assays

3

-one (RBN010860)

B Synthesis of 5-[(3aS,4S,6aR)-2-Oxo-hexahydro-1H-

thieno[3,4-d]imidazolidin-4-yl]-N-(6-[2-[4-([2-[6-oxo-5-

B Data Analysis for Cellular Active Site Probe Displace-

ment NanoBRET Assays

(triﬂuoromethyl)-1,6-dihydropyridazin-4-yl]-2,3-dihy-

dro-1H-isoindol-5-yl]oxy)piperidin-1-yl]acetamido]

hexyl)pentanamide (RBN011147)

B % Inhibition

B IC50 Curve Fitting

B Synthesis of 3-(5,5-diﬂuoro-7-(1H-pyrrol-2-yl)-5H-

B Pass/Fail Criteria for Screening Plates

5

l4,6l4-dipyrrolo[1,2-c:2’,1’-f][1,3,2]diazaborinin-3-yl)-

N-(6-(2-(4-((2-(6-oxo-5-(triﬂuoromethyl)-1,6-dihydro-

pyridazin-4-yl)isoindolin-5-yl)oxy)piperidin-1-yl)acet-

amido)hexyl)propanamide (RBN011198)

SUPPLEMENTAL INFORMATION

B Synthesis of 3-(dimethylamino)-N-(6-oxo-5,6-dihydro-

phenanthridin-2-yl)propenamide (RBN011829)

Supplemental Information can be found online at https://doi.org/10.1016/j.

chembiol.2020.06.009 .

Cell Chemical Biology 27, 877–887, July 16, 2020 885

ll

Resource

ACKNOWLEDGMENTS

Copeland, R.A. (2016). The drug-target residence time model: a 10-year retro-

spective. Nat. Rev. Drug Discov. 15 , 87–95.

We would like to thank Mr. Matt Robers at Promega for technical guidance

during assay development and Dr. Victoria Richon for helpful discussions in

the preparation of this manuscript. In addition, we thank Ms. Ping Wei and

her team at Viva Biotech for plasmid generation, protein production, and X-

ray crystallography, Dr. Hara Black and her team at Evotec SE for protein pro-

duction, Dr. Dennis Wegener and his team at Evotec SE for surface plasmon

resonance studies, Dr. Po-wai Yuen and Dr. Cheng Shao and their team at

Pharmaron, and Dr. Anthony Cuzzupe and his team at SYNthesis for synthesis

of the compounds and probes. We thank Mr. Chris Reik at Ribon Therapeutics

for technical assistance with the PARP3 NanoBRET experiments. This work

was funded by Ribon Therapeutics.

Copeland, R.A., Basavapathruni, A., Moyer, M., and Scott, M.P. (2011). Impact

of enzyme concentration and residence time on apparent activity recovery in

jump dilution analysis. Anal. Biochem. 416 , 206–210.

Feijs, K.L., Kleine, H., Braczynski, A., Forst, A.H., Herzog, N., Verheugd, P.,

Linzen, U., Kremmer, E., and Luscher, B. (2013). ARTD10 substrate identiﬁca-

tion on protein microarrays: regulation of GSK3beta by mono-ADP-ribosyla-

tion. Cell Commun. Signal 11 , 5.

Haikarainen, T., Krauss, S., and Lehtio, L. (2014a). Tankyrases: structure, func-

tion and therapeutic implications in cancer. Curr. Pharm. Des. 20 , 6472–6488.

Haikarainen, T., Narwal, M., Joensuu, P., and Lehtio, L. (2014b). Evaluation

and structural basis for the inhibition of tankyrases by PARP inhibitors. ACS

Med. Chem. Lett. 5 , 18–22.

AUTHOR CONTRIBUTIONS

Ji, M., Wang, L., Xue, N., Lai, F., Zhang, S., Jin, J., and Chen, X. (2018). The

development of a biotinylated NAD(+)-applied human poly(ADP-ribose) poly-

merase 3 (PARP3) enzymatic assay. SLAS Discov. 23 , 545–553.

M.M.V., L.B.S., and K.K.S. designed the active site probes. K.K.S. oversaw X-

ray crystallography and T.J.W. oversaw the surface plasmon resonance.

M.M.V., L.B.S., and N.R.P. oversaw synthesis of all compounds. T.J.W.,

W.D.C., and C.R.M. developed in vitro probe displacement assays and

D.J.B., Y.R., and H.J.D. developed the cellular probe displacement assays.

A.G.S. ran assays and plated compounds. D.J.B., Y.R., and A.Z.L. developed

the MAR ICW assays. T.J.W. conceived and designed the experiments and

T.J.W., K.W.K., H.K., and M.N. supervised the work. T.J.W. wrote the manu-

script with contributions from D.J.B., K.K.S., M.M.V., and L.B.S.

Johannes, J.W., Almeida, L., Daly, K., Ferguson, A.D., Grosskurth, S.E., Guan,

H., Howard, T., Ioannidis, S., Kazmirski, S., Lamb, M.L., et al. (2015). Discovery

of AZ0108, an orally bioavailable phthalazinone PARP inhibitor that blocks

centrosome clustering. Bioorg. Med. Chem. Lett. 25 , 5743–5747.

Jwa, M., and Chang, P. (2012). PARP16 is a tail-anchored endoplasmic retic-

ulum protein required for the PERK- and IRE1alpha-mediated unfolded protein

response. Nat. Cell. Biol. 14 , 1223–1230.

Karlberg, T., Thorsell, A.G., Kallas, A., and Schuler, H. (2012). Crystal structure

of human ADP-ribose transferase ARTD15/PARP16 reveals a novel putative

regulatory domain. J. Biol. Chem. 287 , 24077–24081.

DECLARATION OF INTERESTS

All authors are employees and shareholders of Ribon Therapeutics and a pat-

ent on this work has been granted (WO/2019/212946).

Kirby, I.T., Kojic, A., Arnold, M.R., Thorsell, A.G., Karlberg, T., Vermehren-

Schmaedick, A., Sreenivasan, R., Schultz, C., Schuler, H., and Cohen, M.S.

(2018). A potent and selective PARP11 inhibitor suggests coupling between

cellular localization and catalytic activity. Cell Chem. Biol. 25 , 1547–1553.e12.

Received: March 18, 2020

Revised: May 18, 2020

Accepted: June 15, 2020

Published: July 16, 2020

Kunze, F.A., and Hottiger, M.O. (2019). Regulating immunity via ADP-ribosyla-

tion: therapeutic implications and beyond. Trends Immunol. 40 , 159–173.

Lebakken, C.S., Hee Chol, K., and Vogel, K.W. (2007). A ﬂuorescence lifetime

REFERENCES

based binding assay to characterize kinase inhibitors. J. Biomol. Screen. 12 ,

8

28–841.

Abdelkarim, G.E., Gertz, K., Harms, C., Katchanov, J., Dirnagl, U., Szabo, C.,

and Endres, M. (2001). Protective effects of PJ34, a novel, potent inhibitor of

poly(ADP-ribose) polymerase (PARP) in in vitro and in vivo models of stroke.

Int. J. Mol. Med. 7 , 255–260 .

Leutert, M., Pedrioli, D.M.L., and Hottiger, M.O. (2016). Identiﬁcation of PARP-

speciﬁc ADP-ribosylation targets reveals a regulatory function for ADP-ribosy-

lation in transcription elongation. Mol. Cell 63 , 181–183.

Lindgren, A.E., Karlberg, T., Thorsell, A.G., Hesse, M., Spjut, S., Ekblad, T.,

Andersson, C.D., Pinto, A.F., Weigelt, J., Hottiger, M.O., et al. (2013). PARP in-

hibitor with selectivity toward ADP-ribosyltransferase ARTD3/PARP3. ACS

Chem. Biol. 8 , 1698–1703.

Bouzo-Lorenzo, M., Stoddart, L.A., Xia, L., AP, I.J., Heitman, L.H., Briddon,

S.J., and Hill, S.J. (2019). A live cell NanoBRET binding assay allows the study

of ligand-binding kinetics to the adenosine A3 receptor. Purinergic Signal. 15 ,

1

39–153 .

Lu, A.Z., Abo, R., Ren, Y., Gui, B., Mo, J.R., Blackwell, D., Wigle, T., Keilhack,

H., and Niepel, M. (2019). Enabling drug discovery for the PARP protein family

through the detection of mono-ADP-ribosylation. Biochem. Pharmacol.

167 , 97–106.

Butepage, M., Eckei, L., Verheugd, P., and Luscher, B. (2015). Intracellular

mono-ADP-ribosylation in signaling and disease. Cells 4 , 569–595 .

Carlile, G.W., Robert, R., Matthes, E., Yang, Q., Solari, R., Hatley, R., Edge,

C.M., Hanrahan, J.W., Andersen, R., Thomas, D.Y., et al. (2016). Latonduine

analogs restore F508del-cystic ﬁbrosis transmembrane conductance regu-

lator trafﬁcking through the modulation of poly-ADP ribose polymerase 3

and poly-ADP ribose polymerase 16 activity. Mol. Pharmacol. 90 , 65–79.

Machleidt, T., Woodroofe, C.C., Schwinn, M.K., Mendez, J., Robers, M.B.,

Zimmerman, K., Otto, P., Daniels, D.L., Kirkland, T.A., and Wood, K.V.

(

2015). NanoBRET—a novel BRET platform for the analysis of protein-protein

interactions. ACS Chem. Biol. 10 , 1797–1804.

Carter-O’Connell, I., Jin, H., Morgan, R.K., Zaja, R., David, L.L., Ahel, I., and

Cohen, M.S. (2016). Identifying family-member-speciﬁc targets of mono-

ARTDs by using a chemical genetics approach. Cell Rep. 14 , 621–631.

Morgan, R.K., Kirby, I.T., Vermehren-Schmaedick, A., Rodriguez, K., and

Cohen, M.S. (2019). Rational design of cell-active inhibitors of PARP10. ACS

Med. Chem. Lett. 10 , 74–79.

Carter-O’Connell, I., Vermehren-Schmaedick, A., Jin, H., Morgan, R.K., David,

L.L., and Cohen, M.S. (2018). Combining chemical genetics with proximity-

dependent labeling reveals cellular targets of poly(ADP-ribose) polymerase

Murai, J., Huang, S.Y., Das, B.B., Renaud, A., Zhang, Y., Doroshow, J.H., Ji, J.,

Takeda, S., and Pommier, Y. (2012). Trapping of PARP1 and PARP2 by clinical

PARP inhibitors. Cancer Res. 72 , 5588–5599.

1

4 (PARP14). ACS Chem. Biol. 13 , 2841–2848.

Ong, L.L., Vasta, J.D., Monereau, L., Locke, G., Ribeiro, H., Pattoli, M.A.,

Skala, S., Burke, J.R., Watterson, S.H., Tino, J.A., et al. (2020). A high-

throughput BRET cellular target engagement assay links biochemical to

cellular activity for Bruton’s tyrosine kinase. SLAS Discov. 25 , 176–185.

Chen, J., Lam, A.T., and Zhang, Y. (2018). A macrodomain-linked immunosor-

bent assay (MLISA) for mono-ADP-ribosyltransferases. Anal. Biochem. 543 ,

132–139.

Copeland, R.A. (2005). Evaluation of enzyme inhibitors in drug discovery. A

guide for medicinal chemists and pharmacologists. Methods Biochem. Anal.

Papeo, G., Avanzi, N., Bettoni, S., Leone, A., Paolucci, M., Perego, R.,

Quartieri, F., Riccardi-Sirtori, F., Thiefﬁne, S., Montagnoli, A., et al. (2014).

Insights into PARP inhibitors’ selectivity using ﬂuorescence polarization and

46 , 1–265.

886 Cell Chemical Biology 27, 877–887, July 16, 2020

ll

Resource

surface plasmon resonance binding assays. J. Biomol. Screen. 19 ,

Vyas, S., and Chang, P. (2014). New PARP targets for cancer therapy. Nat.

1212–1219.

Rev. Cancer 14 , 502–509.

Peng, B., Thorsell, A.G., Karlberg, T., Schuler, H., and Yao, S.Q. (2017). Small

molecule microarray based discovery of PARP14 inhibitors. Angew. Chem. Int.

Ed. 56 , 248–253.

Vyas, S., Matic, I., Uchima, L., Rood, J., Zaja, R., Hay, R.T., Ahel, I., and Chang,

P. (2014). Family-wide analysis of poly(ADP-ribose) polymerase activity. Nat.

Commun. 5 , 4426.

Renaud, J.P., Chung, C.W., Danielson, U.H., Egner, U., Hennig, M., Hubbard,

R.E., and Nar, H. (2016). Biophysics in drug discovery: impact, challenges and

opportunities. Nat. Rev. Drug Discov. 15 , 679–698.

Wahlberg, E., Karlberg, T., Kouznetsova, E., Markova, N., Macchiarulo, A.,

Thorsell, A.G., Pol, E., Frostell, A., Ekblad, T., Oncu, D., et al. (2012). Family-

wide chemical proﬁling and structural analysis of PARP and tankyrase inhibi-

tors. Nat. Biotechnol. 30 , 283–288.

Robers, M.B., Dart, M.L., Woodroofe, C.C., Zimprich, C.A., Kirkland, T.A.,

Machleidt, T., Kupcho, K.R., Levin, S., Hartnett, J.R., Zimmerman, K., et al.

Wang, S., Han, L., Han, J., Li, P., Ding, Q., Zhang, Q.J., Liu, Z.P., Chen, C., and

Yu, Y. (2019). Uncoupling of PARP1 trapping and inhibition using selective

PARP1 degradation. Nat. Chem. Biol. 12 , 1223–1231.

(2015). Target engagement and drug residence time can be observed in living

cells with BRET. Nat. Commun. 6 , 10091.

Schenkel, L.B., Vasbinder, M.M., Kuntz, K.W., Swinger, K.K. (2019).

Quinazolinones as PARP14 inhibitors. International Patent WO/2019/126443,

ﬁled on December 20, 2018 and granted on June 27, 2019.

Wigle, T.J., Church, W.D., Majer, C.R., Swinger, K.K., Aybar, D., Schenkel,

L.B., Vasbinder, M.M., Brendes, A., Beck, C., Prahm, M., et al. (2019).

Forced self-modiﬁcation assays as a strategy to screen MonoPARP enzymes.

SLAS Discov. 3 , 241–252.

Thorsell, A.G., Ekblad, T., Karlberg, T., Low, M., Pinto, A.F., Tresaugues, L.,

Moche, M., Cohen, M.S., and Schuler, H. (2017). Structural basis for potency

and promiscuity in poly(ADP-ribose) polymerase (PARP) and tankyrase inhib-

itors. J. Med. Chem. 60 , 1262–1271.

Yang, C.S., Jividen, K., Spencer, A., Dworak, N., Ni, L., Oostdyk, L.T.,

Chatterjee, M., Kusmider, B., Reon, B., Parlak, M., et al. (2017). Ubiquitin modi-

ﬁcation by the E3 ligase/ADP-ribosyltransferase Dtx3L/Parp9. Mol. Cell 66 ,

5

03–516 e505.

Vasbinder, M.M., Schenkel, L.B., Swinger, K.K., Kuntz, K.W. (2019).

Pyridazinones as PARP7 Inhibitors. International Patent WO/2019/212937,

ﬁled April 29, 2019 and granted July 11, 2019.

Yoneyama-Hirozane, M., Matsumoto, S.I., Toyoda, Y., Saikatendu, K.S.,

Zama, Y., Yonemori, K., Oonishi, M., Ishii, T., and Kawamoto, T. (2017).

Identiﬁcation of PARP14 inhibitors using novel methods for detecting auto-ri-

bosylation. Biochem. Biophys. Res. Commun. 486 , 626–631.

Venkannagari, H., Fallarero, A., Feijs, K.L., Luscher, B., and Lehtio, L. (2013).

Activity-based assay for human mono-ADP-ribosyltransferases ARTD7/

PARP15 and ARTD10/PARP10 aimed at screening and proﬁling inhibitors.

Eur. J. Pharm. Sci. 49 , 148–156.

Yuen, L.H., Dana, S., Liu, Y., Bloom, S.I., Thorsell, A.G., Neri, D., Donato, A.J.,

Kireev, D., Schuler, H., and Franzini, R.M. (2019). A focused DNA-encoded

chemical library for the discovery of inhibitors of NAD(+)-dependent enzymes.

J. Am. Chem. Soc. 141 , 5169–5181.

Venkannagari, H., Verheugd, P., Koivunen, J., Haikarainen, T., Obaji, E.,

Ashok, Y., Narwal, M., Pihlajaniemi, T., Luscher, B., and Lehtio, L. (2016).

Small-molecule chemical probe rescues cells from mono-ADP-ribosyltrans-

ferase ARTD10/PARP10-induced apoptosis and sensitizes cancer cells to

DNA damage. Cell Chem. Biol. 23 , 1251–1260.

Zhang, J.H., Chung, T.D., and Oldenburg, K.R. (1999). A simple statistical

parameter for use in evaluation and validation of high throughput screening as-

says. J. Biomol. Screen. 4 , 67–73.

Cell Chemical Biology 27, 877–887, July 16, 2020 887

ll

Resource

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE

Chemicals, Peptides, and Recombinant Proteins

PARP1 (full-length)

PARP2 (full-length)

PARP3 (full-length)

PARP4 (truncate)

PARP5a (truncate)

PARP6 (truncate)

PARP7 (truncate)

PARP8 (truncate)

PARP9 (full-length)

PARP10 (truncate)

PARP11 (full-length)

PARP12 (truncate)

PARP13 (full-length)

PARP14 (truncate)

PARP15 (truncate)

PARP16 (full-length)

PJ-34

SOURCE

IDENTIFIER

Wigle et al., SLAS Discovery (2019)

AdooQ Biosciences

Selleckem

N/A

Cat. # A15215

Cat. # A10111

Cat. # S2741

Cat. # S1098

Cat. # S1004

Cat. # S7048

N/A

Olaparib

Niraparib

Rucaparib

Selleckem

Veliparib

Selleckem

Talazoparib

Selleckem

RBN010860

This paper

RBN011147

This paper

N/A

RBN011198

This paper

N/A

RBN011829

This paper

N/A

RBN012148

This paper

N/A

RBN012337

This paper

N/A

RBN013283

+

NAD

This paper

N/A

Millipore Sigma

Cat. # N0632

Cat. # N012

Cat. # D3072

Cat. # J60712

Cat. # 351-036-721

Cat. # 28320

Cat. # CR84-100

Cat. # BP172-25

Cat. # GR154-1

Cat. # IBB-645

Cat. # A412-1

Cat. # D8418

Cat. # 41090036

Cat. # 11058021

Cat. # 10569010

Continued on next page)

+

Biotin-NAD

Biolog

Doxycycline

HEPES pH = 7.5

NaCl

Millipore Sigma

Alfa Aesar

Quality Biological

Tween 20

Thermo

DPTA-puriﬁed BSA

Dithiothreitol

TBS-T

Perkin Elmer

Fisher Scientiﬁc

Hoefer

PBS-T

Boston Bioproducts

Fisher Scientiﬁc

Methanol

DMSO

Millipore Sigma

MEM + Glutamax media

OptiMEM media

DMEM media

Thermo

(

e1 Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020

ll

Resource

Continued

REAGENT or RESOURCE

Fetal bovine serum

SOURCE

VWR

IDENTIFIER

Cat. # 97068-085

Cat. # E2312

FuGENE(R) HD Transfection Reagent

Critical Commercial Assays

Europium-labeled streptavidin

ULight-labeled streptavidin

Europium-labeled anti-His

Promega

Perkin Elmer

Cat. # AD0063

Cat. # AD0062

Cat. # AD0111;

RRID: AB_2811261

Ulight-labeled anti-His

Perkin Elmer

Thermo

Cat. # TRF0105

Custom

384-well nickel-NTA coated microplates

DELFIA Eu-N1 Streptavidin

Perkin Elmer

Promega

Cat. # 1244-360

Cat. # 1244-111

Cat. # 1244-105

Cat. # N2161

DELFIA Assay Buffer

DELFIA Enhancement Solution

IntracellularTE Nano-Glo(R) Substrate/Inhibitor

Deposited Data

Structure of PARP16 bound to RBN010860

Experimental Models: Cell Lines

This paper

ATCC

PDB: 6W65

293T cells

Cat. # CRL-3216;

RRID: CVCL_0063

Oligonucleotides

Activating dsDNA for PARP1 (5’ ACCCTGCTGTGGGC/

ideoxyU/GGAGAACAAGGTGAT and 3’ ATCACCTTGT

TCTCCAHGCCCACAGCAGGGT)

IDT DNA

Custom synthesis

Activating dsDNA for PARP2 (5’/phosphate/

IDT DNA

Custom synthesis

GCCTATAGGC and 3’/phosphate/GCCTATACCG)

Activating ssDNA for PARP3 (/phosphate/GCTGGCT

TCGTAAGAAGCCAGCTCGCGGTCAGCTTGCTGACCGCG)

Recombinant DNA

pcDNA3.1 plasmid

This paper

N/A

pcDNA3.1 with human PARP1 amino acids 1 1014

with C-terminal or N-terminal NanoLuc tag

pcDNA3.1 with human PARP3 amino acids 1 – 533

with C-terminal or N-terminal NanoLuc tag

This paper

N/A

pcDNA3.1 with human PARP7 amino acids

N/A

1

-657 insert with C-terminal or N-terminal NanoLuc tag

pcDNA3.1 with human PARP7 amino acids

56-657 insert with C-terminal or N-terminal NanoLuc tag

N/A

4

pcDNA3.1 with human PARP10 amino acids 808-1025

with C-terminal or N-terminal NanoLuc tag

N/A

pcDNA3.1 with human PARP10 amino acids 1-1025

with C-terminal or N-terminal NanoLuc tag

N/A

pcDNA3.1 with human PARP11 amino acids 1-338

with C-terminal or N-terminal NanoLuc tag

N/A

pcDNA3.1 with human PARP12 amino acids 1-701

with C-terminal or N-terminal NanoLuc tag

N/A

pcDNA3.1 with human PARP14 amino acids 1611-1801

with C-terminal or N-terminal NanoLuc tag

N/A

pcDNA3.1 with human PARP14 amino acids 1-1801

with C-terminal or N-terminal NanoLuc tag

N/A

pcDNA3.1 with human PARP16 amino acids

N/A

1-322 with C-terminal or N-terminal NanoLuc tag

(Continued on next page)

Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020 e2

ll

Resource

Continued

REAGENT or RESOURCE

Other

SOURCE

IDENTIFIER

Envision platereader

Biacore T200 SPR instrument

Streptavidin SPR chips

NTA SPR chips

Perkin Elmer

GE Healthcare

Licor

Cat. # 2101-0010

Cat. # 28975001

Cat. # 29104992

Cat. # 28994951

Cat. # 9140

Odyssey CLX infrared imager

RESOURCE AVAILABILITY

Lead Contact

All requests for reagents and resources should be directed to the lead contact, Tim J. Wigle (twigle@ribontx.com ).

Materials Availability

All unique/stable reagents generated in this study are available from the Lead Contact with a completed Materials Transfer Agree-

ment as long as stocks remain available.

Data Code and Availability

The coordinates for the protein structure reported in this paper have been deposited in Protein Data Bank (http://www.rcsb.org/pdb )

under ID code 6W65.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell Lines

2

mented with 10% heat inactivated fetal bovine serum (VWR) in a 5% CO

93T cells (ATCC) expressing PARP-NanoLuc fusion proteins were grown Dulbecco’s modiﬁed Eagle’s medium (DMEM) supple-

ꢁ

2

environment at 37 C.

METHOD DETAILS

Recombinant Protein Production

Recombinant PARP enzymes were expressed and puriﬁed as described previously (Wigle et al., 2019). PARP enzymes were puriﬁed

to greater than 80% purity using an N-terminal hexahistidine (His6) tag. Construct, expression, and puriﬁcation details can be found in

Table S2. The His6 tag was left on the protein following puriﬁcation in order to capture the protein on the Ni-NTA plates in the assays.

Constructs with Avi tags were biotinylated by BirA either in vitro using recombinant enzyme or in cellulo using bacterial cell lines ex-

pressing BirA and conﬁrmed to have close to 100% modiﬁcation via mass spectrometry. Protein purity was assessed on a Bio-

analyzer 2100 (Agilent; Santa Clara, CA) and only proteins with >80% purity were used in assay development.

TR-FRET Probe Displacement Assays

Displacement of RBN011147 from the NAD -binding site of PARP monoenzymes was measured in vitro using a TR-FRET assay. A

+

Mosquito (TTP Labtech) was used to add 20 nL of a dose response curve of each test compound in DMSO into black 384-well poly-

styrene Proxiplates (Perkin Elmer) and a Multidrop Combi (Thermo Scientiﬁc) was used to add the rest of the reagents. Reactions

were performed in an 8 mL volume by adding 6 mL of the PARP monoenzyme and RBN011147 in 1X TR-FRET assay buffer

(20 mM HEPES pH = 8, 100 mM NaCl, 0.1% bovine serum albumin, 2 mM DTT and 0.002% Tween20), incubating with test compound

ꢁ

at 25 C for 30 min, then adding 2 mL of ULight-anti 6xHis and LANCE Eu-W1024 labeled streptavidin (conﬁguration 1) or 2 mL of

ULight-streptavidin and LANCE Eu-W1024 Anti-6xHis (conﬁguration 2). The ﬁnal concentrations of PARP monoenzyme,

RBN011147, ULight-anti 6xHis and LANCE Eu-W1024 labeled streptavidin or ULight-streptavidin and LANCE Eu-W1024 Anti-

ꢁ

6

xHis for each assay are listed in Table S3. Binding reactions were equilibrated at 25 C for an additional 30 min, then read on an

Envision plate reader equipped with a LANCE/DELFIA top mirror using excitation = 320 nm and emission = 615 nm and 665 nM

with a 90 ms delay (Perkin Elmer). The ratio of the 665/615 nm emission was calculated for each well to determine the relative amounts

of PARP monoenzyme and RBN011147 complex formed in each well.

NanoBRET Probe Displacement Assays

Displacement of RBN011198 binding to NanoLuc-tagged PARP monoenzymes was measured in live cells using a bioluminescence

resonance energy transfer (NanoBRET) assay. Expression plasmids were created by inserting synthesized genes for each PARP

enzyme into pCDNA3.1(-) vectors coding for either N- and C-terminal NanoLuc fusions. Plasmids were prepared for transfection

7

by diluting in DMEM + 6% FuGENE HD and adding empty vector. A volume of 2.4 mL of diluted plasmid was added to 2 x 10

e3 Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020

ll

Resource

2

93T cells and incubated for 24 h under standard growth conditions then used in the NanoBRET assay. Transfected cells were re-

5

suspended in phenol red free OptiMEM to a concentration of 2.5 x 10 cells/mL and the NanoBRET probe was added. The plasmid

information and conditions for each transfection and assay are indicated in Table S4 for H-Y-(I/L-Y) PARPs and Table S5 for H-Y-E

PARPs. Next, 40 mL of cells were then added to white polystyrene 384-well non-binding surface microplate (Corning) using a Multi-

drop Combi (Thermo Scientiﬁc) and 40 nL of a dose response curve of each test compound in DMSO was added to the cell plate

ꢁ

using a Mosquito (TTP Labtech). The plate was incubated in a 5% CO

2

environment at 37 C for 2 h, then 20 mL per well of a solution

consisting of a 1:166 dilution of Nano-Glo substrate (Promega) and a 1:500 dilution of NanoLuc extracellular inhibitor (Promega) in

phenol red free OptiMEM was added to each well. Filtered luminescence was measured on an Envision plate reader equipped

app

with a dual 585 nm mirror, 460 ± 40 nm bandpass ﬁlter (donor) and 610 ± 50 nm longpass ﬁlter (acceptor) (Perkin Elmer). K

d

values

were calculated using a 4-parameter ﬁt in Graphpad Prism Version 8.

Cellular Binding Kinetics

Measurement of cellular binding kinetics was performed using the cellular probe displacement assay as previously described (Rob-

ers et al., 2015). Brieﬂy, 293T cells were transfected with either PARP7 or PARP14 fused to a NanoLuc tag as described above. Cells

ꢁ

were incubated with DMSO or test compound 10-fold above the IC50 for 1 h at 37 C. The cells were washed with PBS and resus-

pended in OptiMEM, then 40 mL of cells were plated into the white non-binding surface 384-well microplate (Corning) using a Multi-

drop Combi (Thermo). NanoGlo substrate with extracellular inhibitor was added with RBN011198 at a concentration 10-fold above

d

the K . The BRET ratio was measured on the Envision plate reader immediately and then at multiple time points for 60 min. The data

were ﬁt using a one-phase exponential association model in Graphpad Prism Version 8.

Self-Modiﬁcation Enzyme Assays

Measurement of inhibition of self-modiﬁcation enzyme activity was done as previously described (Wigle et al., 2019). Reactions were

ꢁ

performed in a 25 mL volume in 384-well white polystyrene Ni-NTA coated microplates at 25 C. Enzyme assay buffer was 20 mM

HEPES (pH = 7.5), 100 mM NaCl, 2 mM DTT, 0.1% DTPA-puriﬁed BSA and 0.002% Tween 20. Compounds were stored in 100%

DMSO and 0.5 mL were dry-spotted into the microplates. Uninhibited control wells contained DMSO (ﬁnal concentration, f.c. =

2

His-tagged PARP enzymes were added in a 20 mL volume to the microplates and incubated for 30 min before the addition of 5 mL

%) and fully inhibited control wells contained rucaparib or RBN010860 (f.c. = 200 mM), depending on the PARP being tested.

+

of biotinylated-NAD to initiate the reaction. The assays were ended while in the linear range of product versus time formation by

+

the addition of 5 mL of NAD (f.c. = 2 mM) to outcompete the incorporation of biotinylated-NAD . The details on concentrations of

+

enzyme, biotinylated-NAD and reaction time for each PARP are indicated in Table S6. Quenched reactions were washed ﬁve times

using 100 mL of Tris-buffered saline + Tween 20 (TBS-T), followed by addition of 1:1000 DELFIA Eu-N1 streptavidin diluted in DELFIA

ꢁ

assay buffer, then incubated for 30 min at 25 C to allow the streptavidin to bind to the incorporated biotin. Next, the reactions were

washed ﬁve times with 100 mL TBS-T, followed by addition of 25 mL of DELFIA enhancement solution. Microplates were incubated

3

0 minutes, then the DELFIA signal was read on an Envision plate reader (excitation = 340 nm, emission = 615 nm).

Surface Plasmon Resonance (SPR)

The binding afﬁnity of the compounds were assessed using protein constructs and SPR conditions as previously described

(

Wigle et al., 2019). PARP SPR buffer was 50 mM HEPES (pH = 7.5), 100 mM NaCl, 1 mM TCEP, 0.05% Tween 20 and assays

ꢁ

were run at 25 C. PARPs were either captured via N-terminal His6 tags on CM5 Ni-NTA sensor chips or via N-terminal biotinylated

Avi tags on streptavidin SA sensor chips (GE Healthcare Life Sciences; Marlborough, MA). The constructs used in the SPR assay are

listed in Table S2. Typically, 3000 – 6000 RU of protein were immobilized for each assay. Compounds were screened using a ﬂow rate

of 30 mL/min, using 60 s of association time, typically followed by observing dissociation for 90 s. For higher afﬁnity compounds the

dissociation window was increased and in some instances compound binding was analyzed using single-cycle kinetics. Solvent

correction was applied using a 6-point curve from 1.5 – 2.75 % DMSO injected before and after every 96 cycles. Data were ﬁt

using Biacore software to an equilibrium binding model to derive the binding constant K

were observed, data were ﬁt to a kinetic model to derive parameters for association and dissociation (k

constant K

D

, and when signiﬁcant off-rates (> 120 s)

a

and k ) and the binding

d

.

X-Ray Crystallography

Tag-cleaved, puriﬁed PARP16 (20 mg/mL, 20 mM HEPES, 200 mM NaCl, 2 mM TCEP, pH = 7.5) was incubated with a weak binding

fragment at 2 mM and crystallized via the sitting drop method of vapor diffusion using a drop size of 0.5 mL protein and 0.5 mL well

solution (100 mM sodium citrate pH = 5.5, 18% w/v PEG3350). A crystal was then transferred to a soaking solution containing 2 mM

RBN010860, 100 mM sodium citrate pH = 5.5, 18% w/v PEG3350 for 6 h. The crystal was cryoprotected in a solution containing 85%

soaking solution and 15% glycerol prior to vitriﬁcation in liquid nitrogen. Data reduction and scaling were performed using XDS.

Structure determination was performed by molecular replacement using the published PARP16 structure, PDBID 4F0D (Karlberg

et al., 2012), as a search model and REFMAC5 program in CCP4 software. After manual ligand placement, iterative cycles of reﬁne-

ment and model building were performed using REFMAC5 and COOT, respectively. The crystal structure was deposited into the Pro-

tein Data Bank with PDB code 6W65. Data collection and reﬁnement statistics are shown in Table S8. After manual ligand placement,

iterative cycles of reﬁnement and model building were performed using REFMAC5 and COOT, respectively.

Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020 e4

ll

Resource

General Chemical Synthesis

All reactions were run in standard glassware under air or nitrogen, as noted. The purity of all ﬁnal compounds was >95% as determined

by HPLC using the instrumentation and methods described below. Solvents were purchased commercially and used without additional

4

drying or puriﬁcation. 2,5-dioxopyrrolidin-1-yl 3-(5,5-diﬂuoro-7-(1H-pyrrol-2-yl)-5H-5l ,6l -dipyrrolo[1,2-c:2’,1’-f][1,3,2]diazaborinin-

-yl)propanoate (NanoBRET 590SE) was purchased from Promega. Abbreviations: ACN (acetonitrile); DCM (dichloromethane); DIPEA

diisopropylethylamine); DMF (dimethylformamide); EtOAc (ethyl acetate); h (hours); HATU ( 1-[bis(dimethylamino)methylene]-1H-1,2,3-

triazolo[4,5-b]pyridinium 3-oxide hexaﬂuorophosphate); HCl (hydrochloric acid); MeOH (methanol); NMP (N-methyl-2-pyrrolidone); rt

3

(

room temperature); SEMCl (2-(trimethylsilyl)ethoxymethyl chloride); TEA (triethyl amine); TFA (triﬂuoroacetic acid).

1

H NMR spectra were recorded at 400 MHz using a Bruker AVANCE 400 MHz spectrometer. NMR interpretation was performed

using MestReC, MestReNova or Bruker Topspin software to assign chemical shift and multiplicity. In cases where two adjacent

peaks of equal or unequal height were observed, these two peaks may be labeled as either a multiplet or as a doublet. In the

case of a doublet, a coupling constant using this software may be assigned. In any given example, one or more protons may not

be observed due to obscurity by water and/or solvent peaks. LC-MS equipment and conditions are as follows:

LC: Agilent Technologies 1290 series, Binary Pump, Diode Array Detector. Agilent Poroshell 120 EC- C18, 2.7 mm, 4.6350 mm

ꢁ

column. Mobile phase: A: 0.05% formic acid in water (v/v), B: 0.05% formic acid in ACN (v/v). Flow Rate: 1 mL/min at 25 C. Detector:

2

14 nm, 254 nm. Gradient stop time, 10 min. Timetable:

T (min)

A (%)

90

B (%)

10

0

8

1

.0

.5

90

10

.0

10

90

0.0

0

100

MS: G6120A, Quadrupole LC/MS, Ion Source: ES-API, TIC: 70ꢂ1000 m/z, Fragmentor: 60, Drying gas ﬂow: 10 L/min, Nebulizer

ꢁ

pressure: 35 psi, Drying gas temperature: 350 C, Vcap: 3000V.

LC Shimadzu LC-20AD, Binary Pump, Diode Array Detector. Column: Ascentis Express C18, 50*3.0 mm, 2.7 mm. Mobile phase: A:

ꢁ

Water/0.05%TFA, B: Acetonitrile/0.05%TFA. Flow Rate: 1.5 mL/min at 40 C. Detector: 254 nm, 220 nm. Gradient stop time, 2.9 min.

Timetable:

T (min)

A (%)

90

5

B (%)

5

0

2

.01

.10

.70

.90

95

5

90

MS: LC-MS-2020, Quadrupole LC/MS, Ion Source: ES-API, TIC: 90ꢂ900 m/z, Fragmentor: 60, Drying gas ﬂow: 15 L/min, Nebu-

ꢁ

lizing Gas Flow: 1.5 L/min, Drying gas temperature: 250 C, Vcap: 1100V.

Sample preparation: samples were dissolved in ACN or MeOH at 1ꢂ10 mg/mL, then ﬁltered through a 0.22 mm ﬁlter membrane.

Injection volume: 1ꢂ10 mL.

Synthesis of 5-[5-(Piperidin-4-yloxy)-2,3-dihydro-1H-isoindol-2-yl]-4-(triﬂuoromethyl)-2,3-dihydropyridazin-3-one

(RBN010860)

4,5-Dibromo-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihydropyridazin-3-one

To a solution of 4,5-dibromo-2,3-dihydropyridazin-3-one (3500 g, 13.78 mol, 1.00 equiv) in DMF (30 L) was added sodium hydride

ꢁ

(

[

400 g, 16.56 mol, 1.20 equiv) in batches at 0 C under nitrogen. The resulting solution was stirred for 1 hour at room temperature, then

ꢁ

2-(chloromethoxy)ethyl]trimethylsilane (2500 g, 15.2 mol, 1.10 equiv) was added dropwise at 0 C and stirred for 2 h at room temper-

e5 Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020

ll

Resource

ature. The reaction was then quenched by the addition of 30 L of water. The resulting solution was extracted with 3 x 50 L of ethyl

acetate and the organic layers combined. The organic layers were washed with 3 x 30 L of brine, dried over anhydrous sodium sulfate

+

and concentrated under reduced pressure to afford 4.2 kg of title compound. LC-MS: [M+H] 384.70.

4

To a solution of 4,5-dibromo-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihydropyridazin-3-one (2200 g, 5.73 mol, 1.00 equiv) in NMP (6

-Bromo-5-chloro-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihydropyridazin-3-one

ꢁ

L) was added chlorolithium (231 g, 5.73 mol, 1.00 equiv) and stirred for 4 hours at 95 C. The reaction was then diluted by the addition

of 10 L of water, extracted with 3 x 20 L of ethyl acetate and the organic layers combined. The organic layers were washed with 3 x

2

0 L of brine, dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was puriﬁed by column

chromatography (EtOAc:petroleum ether, 1:50, v/v) to afford 4.2 kg of 4,5-dibromo-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihydro-

pyridazin-3-one. This was repeated 2 times resulting in 2.2 kg of 4-bromo-5-chloro-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihydro-

+

pyridazin-3-one. LC-MS: [M+H] 340.90.

5-Chloro-4-(triﬂuoromethyl)-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihydropyridazin-3-one

To a solution of 4-bromo-5-chloro-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihydropyridazin-3-one (1100 g, 3.23 mol, 1.00 equiv) in

NMP (6 L) at room temperature was added CuI (56 g, 0.64 mol, 0.20 equiv) followed by dropwise addition of methyl 2,2-diﬂuoro-

ꢁ

2

-(ﬂuorosulfonyl)acetate (1865 g, 9.7 mol, 3.00 equiv). The resulting solution was stirred for 2 hours at 80 C. The reaction was

then quenched by the addition of 10 L of water and extracted with 3 x 10 L of ethyl acetate. The organic layers were combined

and washed with 3 x 10 L of brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure. The residue

was puriﬁed by column chromatography (ethyl acetate/petroleum ether, 1/100, v/v) to afford 1030 g (76%) of the title compound.

+

1

3

LC-MS: [M+H] 329.00; H NMR (300 MHz, CDCl ) d 7.82 (s, 1H), 5.50 (d, J = 27.3 Hz, 2H), 3.74 (dt, J = 12.9, 8.2 Hz, 2H), 0.97

(

td, J = 8.3, 5.0 Hz, 2H), 0.01 (d, J = 2.1 Hz, 9H).

5

-(5-Hydroxy-2,3-dihydro-1H-isoindol-2-yl)-4-(triﬂuoromethyl)-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-

dihydropyridazin-3-one

A solution of 5-chloro-4-(triﬂuoromethyl)-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihydropyridazin-3-one (2.8 g, 8.52 mmol, 1.00

equiv), 2,3-dihydro-1H-isoindol-5-ol hydrobromide (4.27 g, 19.76 mmol, 1.00 equiv), and TEA (10 mL) in ethanol (40 mL) was stirred

ꢁ

for 1 h at 60 C. The resulting solution was extracted with 2 x 100 mL of EtOAc and the organic layers combined and concentrated

+

under reduced pressure to afford 4.5 g of the title compound as a yellow oil. LC-MS: [M+H] 428.23.

Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020 e6

ll

Resource

tert-Butyl 4-([2-[6-oxo-5-(triﬂuoromethyl)-1-[[2-(trimethylsilyl)ethoxy]methyl]-1,6-dihydropyridazin-4-yl]-2,3-

dihydro-1H-isoindol-5-yl]oxy)piperidine-1-carboxylate

A solution of 5-(5-hydroxy-2,3-dihydro-1H-isoindol-2-yl)-4-(triﬂuoromethyl)-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihydropyrida-

zin-3-one (4.5 g, 10.53 mmol, 1.00 equiv), tert-butyl 4-iodopiperidine-1-carboxylate (20 g, 64.28 mmol, 8.00 equiv), potassium car-

ꢁ

bonate (15 g, 108.53 mmol, 10.00 equiv), and DMF (50 mL) was stirred for 2 days at 80 C. The resulting solution was extracted with 2 x

200 mL of EtOAc and the organic layers combined and concentrated under reduced pressure. The residue was applied onto a silica

+

gel column eluting with EtOAc/petroleum ether to afford the title compound (2 g, 31%) as a yellow oil. LC-MS: [M+H] 611.15.

5-[5-(Piperidin-4-yloxy)-2,3-dihydro-1H-isoindol-2-yl]-4-(triﬂuoromethyl)-2,3-dihydropyridazin-3-one

A solution of tert-butyl 4-([2-[6-oxo-5-(triﬂuoromethyl)-1-[[2-(trimethylsilyl)ethoxy]methyl]-1,6-dihydropyridazin-4-yl]-2,3-dihydro-

1

H-isoindol-5-yl]oxy)piperidine-1-carboxylate (150 mg, 0.25 mmol, 1.00 equiv) in HCl/dioxane (5 mL) was stirred overnight at

ꢁ

4

5 C. The resulting mixture was concentrated under reduced pressure and the crude product was puriﬁed by C18 reverse phase

+

1

2

chromatography eluting with H O/ACN to afford the title compound as a white solid LC-MS: [M+H] 381.28. H NMR (400 MHz, Meth-

4

anol-d ) d 8.05 (s, 1H), 7.27 (d, J = 8.4 Hz, 1H), 7.02 – 6.91 (m, 2H), 5.00 (d, J = 10.6 Hz, 4H), 4.61 - 4.48 (m, 1H), 3.21 - 3.10 (m, 2H), 2.89

-

2.78 (m, 2H), 2.11 - 2.08 (m, 2H), 1.82 - 1.69 (m, 2H).

Synthesis of 5-[(3aS,4S,6aR)-2-Oxo-hexahydro-1H-thieno[3,4-d]imidazolidin-4-yl]-N-(6-[2-[4-([2-[6-oxo-5-

triﬂuoromethyl)-1,6-dihydropyridazin-4-yl]-2,3-dihydro-1H-isoindol-5-yl]oxy)piperidin-1-yl]acetamido]hexyl)

(

pentanamide (RBN011147)

tert-Butyl 2-[4-([2-[6-oxo-5-(triﬂuoromethyl)-1-[[2-(trimethylsilyl)ethoxy]methyl]-1,6-dihydropyridazin-4-yl]-2,3-

dihydro-1H-isoindol-5-yl]oxy)piperidin-1-yl]acetate

A solution of 5-[5-(piperidin-4-yloxy)-2,3-dihydro-1H-isoindol-2-yl]-4-(triﬂuoromethyl)-2-[[2-(trimethylsilyl)ethoxy]methyl]-2,3-dihy-

dropyridazin-3-one (1 g, 1.96 mmol, 1.00 equiv), tert-butyl 2-chloroacetate (450 mg, 2.99 mmol, 3.00 equiv), DIPEA (5 mL), and di-

ꢁ

chloromethane (10 mL) was stirred overnight at 25 C. The residue was puriﬁed by C18 reverse phase chromatography eluting with

+

CN to afford the title compound (540 mg, 44%) as a yellow oil. LC-MS: [M+H] 625.20.

H

2

O/CH

3

2-[4-([2-[6-Oxo-5-(triﬂuoromethyl)-1,6-dihydropyridazin-4-yl]-2,3-dihydro-1H-isoindol-5-yl]oxy)piperidin-1-yl]

hydrochloride

A solution of tert-butyl 2-[4-([2-[6-oxo-5-(triﬂuoromethyl)-1-[[2-(trimethylsilyl)ethoxy]methyl]-1,6-dihydropyridazin-4-yl]-2,3-dihydro-

ꢁ

1H-isoindol-5-yl]oxy)piperidin-1-yl]acetate (540 mg, 0.86 mmol, 1.00 equiv) and dioxane/HCl (8 mL) was stirred overnight at 25 C.

The resulting mixture was concentrated under reduced pressure. The residue was puriﬁed by C18 reverse phase chromatography

e7 Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020

ll

Resource

+

2 3

eluting with H O/CH CN to afford 200 mg (53%) of title compound as a white solid. LC-MS: [M+H] 439.31.

Tert-butyl N-(6-[5-[(3aS,4S,6aR)-2-oxo-hexahydro-1H-thieno[3,4-d]imidazolidin-4-yl]pentanamido]hexyl)carbamate

A solution of 5-[(3aS,4S,6aR)-2-oxo-hexahydro-1H-thieno[3,4-d]imidazolidin-4-yl]pentanoic acid (976 mg, 3.99 mmol, 1.00 equiv),

DIPEA (1.55 g, 11.99 mmol, 3.00 equiv), HATU (1.82 g, 4.79 mmol, 1.20 equiv), tert-butyl N-(6-aminohexyl)carbamate (864 mg,

ꢁ

3

of water. The solids were collected by ﬁltration to afford 1.5 g (85%) of the title compound as a white solid. LC-MS: [M+H] 443.26.

.99 mmol, 1.00 equiv) in DMF (15 mL) was stirred overnight at 25 C. The reaction was then quenched by the addition of 50 mL

+

5

A solution of tert-butyl N-(6-[5-[(3aS,4S,6aR)-2-oxo-hexahydro-1H-thieno[3,4-d]imidazolidin-4-yl]pentanamido]hexyl)carbamate

-[(3aS,4S,6aR)-2-Oxo-hexahydro-1H-thieno[3,4-d]imidazolidin-4-yl]-N-(6-aminohexyl)pentanamide hydrochloride

ꢁ

(

concentrated under reduced pressure to afford 600 mg (88%) of the title compound as a gray crude oil. LC-MS: [M+H] 343.21.

800 mg, 1.81 mmol, 1.00 equiv) in hydrogen chloride/dioxane (20 mL) was stirred overnight at 25 C. The resulting mixture was

+

5

-[(3aS,4S,6aR)-2-Oxo-hexahydro-1H-thieno[3,4-d]imidazolidin-4-yl]-N-(6-[2-[4-([2-[6-oxo-5-(triﬂuoromethyl)-1,6-

dihydropyridazin-4-yl]-2,3-dihydro-1H-isoindol-5-yl]oxy)piperidin-1-yl]acetamido]hexyl)pentanamide

A solution of 2-[4-([2-[6-oxo-5-(triﬂuoromethyl)-1,6-dihydropyridazin-4-yl]-2,3-dihydro-1H-isoindol-5-yl]oxy)piperidin-1-yl]hydro-

chloride (175 mg, 0.40 mmol, 1.00 equiv), DIPEA (258 mg, 2.00 mmol, 5.00 equiv), HATU (228 mg, 0.60 mmol, 1.50 equiv), 5-[(3aS,4-

S,6aR)-2-oxo-hexahydro-1H-thieno[3,4-d]imidazolidin-4-yl]-N-(6-aminohexyl)pentanamide hydrochloride (228 mg, 0.60 mmol, 1.50

0

equiv) in DMF (3 mL) was stirred for 4 h at 25 C. The crude product was puriﬁed by C18 reverse phase chromatography eluting with

+

1

H

2

O/CH

2.52 (s, 1H), 7.98 (s, 1H), 7.81 – 7.68 (m, 2H), 7.26 (d, J = 8.4 Hz, 1H), 7.00 (d, J = 2.2 Hz, 1H), 6.91 (dd, J = 8.4, 2.3 Hz, 1H), 6.45 – 6.39

m, 1H), 6.36 (s, 1H), 4.91 (d, J = 6.1 Hz, 4H), 4.45 (m, 1H), 4.26 (m, 1H), 4.17 – 4.08 (m, 1H), 3.14 – 2.96 (m, 5H), 2.91 (s, 2H), 2.82 (dd,

J = 12.4, 5.1 Hz, 1H), 2.73 – 2.63 (m, 2H), 2.58 (d, J = 12.4 Hz, 1H), 2.33 (ddd, J = 11.8, 9.4, 3.1 Hz, 2H), 2.11 – 1.90 (m, 4H), 1.76 – 1.54

m, 3H), 1.57 – 1.20 (m, 13H).

3

CN to afford the title compound as a white solid (118.3 mg, 39%). LC-MS: [M+H] 763.35. H NMR (DMSO-d6, 400 MHz) d:

1

(

Synthesis of 3-(5,5-diﬂuoro-7-(1H-pyrrol-2-yl)-5H-5l4,6l4-dipyrrolo[1,2-c:2’,1’-f][1,3,2]diazaborinin-3-yl)-N-(6-(2-(4-

(2-(6-oxo-5-(triﬂuoromethyl)-1,6-dihydropyridazin-4-yl)isoindolin-5-yl)oxy)piperidin-1-yl)acetamido)hexyl)

propanamide (RBN011198)

(

Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020 e8

ll

Resource

tert-Butyl N-(6-[2-[4-([2-[6-oxo-5-(triﬂuoromethyl)-1,6-dihydropyridazin-4-yl]-2,3-dihydro-1H-isoindol-5-yl]oxy)

piperidin-1-yl]acetamido]hexyl)carbamate

A solution of 2-[4-([2-[6-oxo-5-(triﬂuoromethyl)-1,6-dihydropyridazin-4-yl]-2,3-dihydro-1H-isoindol-5-yl]oxy)piperidin-1-yl]acetic

acid (44 mg, 0.10 mmol, 1.00 equiv), DIPEA (52 mg, 0.40 mmol, 4.00 equiv), HATU (46 mg, 0.12 mmol, 1.20 equiv), and tert-butyl

ꢁ

N-(6-aminohexyl)carbamate (24 mg, 0.11 mmol, 1.10 equiv) in DMF (1 mL) was stirred overnight at 25 C. The crude product was pu-

riﬁed by C18 reverse phase chromatography eluting with H

+

LC-MS: [M+H] 637.31.

2

O/CH

3

CN to afford 38 mg (59%) of title compound as an off-white solid.

N-(6-Aminohexyl)-2-[4-([2-[6-oxo-5-(triﬂuoromethyl)-1,6-dihydropyridazin-4-yl]-2,3-dihydro-1H-isoindol-5-yl]oxy)

piperidin-1-yl]acetamide hydrochloride

A solution of tert-butyl N-(6-[2-[4-([2-[6-oxo-5-(triﬂuoromethyl)-1,6-dihydropyridazin-4-yl]-2,3-dihydro-1H-isoindol-5-yl]oxy)piperi-

din-1-yl]acetamido]hexyl)carbamate (38 mg, 0.06 mmol, 1.00 equiv) in hydrogen chloride/dioxane (10 mL) was stirred for 3 hours

ꢁ

at 25 C. The resulting mixture was concentrated under reduced pressure to afford the title compound as a gray solid (30 mg,

8

+

8%). LC-MS: [M-Cl] 537.27.

4

3

-(5,5-diﬂuoro-7-(1H-pyrrol-2-yl)-5H-5l ,6l -dipyrrolo[1,2-c:2’,1’-f][1,3,2]diazaborinin-3-yl)-N-(6-(2-(4-((2-(6-oxo-5-

triﬂuoromethyl)-1,6-dihydropyridazin-4-yl)isoindolin-5-yl)oxy)piperidin-1-yl)acetamido)hexyl)propanamide

A solution of NanoBRET 590SE (23 mg, 0.04 mmol, 2.00 equiv), DIPEA (52 mg, 0.40 mmol, 5.00 equiv), and N-(6-aminohexyl)-2-[4-

(

[2-[6-oxo-5-(triﬂuoromethyl)-1,6-dihydropyridazin-4-yl]-2,3-dihydro-1H-isoindol-5-yl]oxy)piperidin-1-yl]acetamide hydrochloride

ꢁ

10 mg, 0.02 mmol, 1.00 equiv) in DCM (2 mL) and MeOH (2 mL) was stirred for 2 h at 25 C. The resulting mixture was concentrated

under reduced pressure and the crude product was puriﬁed by C18 reverse phase chromatography eluting with H

2

O/CH

3

CN to afford

+

.9 mg of a purple solid (35%). LC-MS: [M+H] 848.38; H NMR (CD OD 400 MHz) d: 7.98 (s,1H), 7.28 – 7.14 (m, 5H), 7.02 – 6.84 (m,

1

6

4

7

4

3 ,

H), 6.37 – 6.26 (m, 2H), 4.93 (d, J = 12.0 Hz, 4H), 4.45 - 4.35 (m, 1H), 3.29 – 3.13 (m, 6H), 3.01 (s, 2H), 2.81 – 2.70 (m, 2H), 2.60 (t, J =

.7 Hz, 2H), 2.43 (td, J = 8.7, 4.6 Hz, 2H), 2.01 (dd, J = 11.8, 7.0 Hz, 2H), 1.81 (ddt, J = 15.8, 11.5, 5.5 Hz, 2H), 1.51 (q, J = 7.3, 6.8 Hz,

H), 1.38 – 1.26 (m, 4H).

e9 Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020

ll

Resource

Synthesis of 3-(dimethylamino)-N-(6-oxo-5,6-dihydrophenanthridin-2-yl)propenamide (RBN011829)

2

To a solution of 5H-phenanthridin-6-one (15 g, 77 mmol, 1 equiv) in acetic acid (300 mL) was added HNO

-Nitro-5H-phenanthridin-6-one

3

(30 mL, 77 mmol, 1 equiv).

ꢁ

The reaction was stirred at 100 C for 3 h. The mixture was cooled to room temperature and ﬁltered, and the solid was washed with

acetic acid (150 mL). Drying the solid gave the title compound (14.8 g, 61.6 mmol, 80% yield) as a white solid.

2

To a solution of 2-nitro-5H-phenanthridin-6-one (8.96 g, 37.3 mmol, 1 equiv) in water (50 mL) and ethanol (50 mL) was added iron

-Amino-5H-phenanthridin-6-one

ꢁ

(

12.5 g, 224 mmol, 6 equiv) and NH

4

Cl (11.98 g, 224 mmol, 6 equiv). The reaction was stirred at 80 C for 4 h and ﬁltered while

hot. The ﬁlter cake was wash with methanol (200 mL) and dried to give the title compound (4 g, 19 mmol, 51% yield) as a white solid.

+

LC-MS: [M+H] 211.1.

tert-Butyl N-methyl-N-[3-oxo-3-[(6-oxo-5H-phenanthridin-2-yl)amino]propyl]carbamate

To solution of 3-[tert-butoxycarbonyl(methyl)amino]propanoic acid (290 mg, 1.43 mmol, 1 equiv), HATU (814 mg, 2.14 mmol, 1.5

equiv) and diisopropylethyl amine (461 mg, 3.57 mmol, 2.5 equiv) in DMF (10 mL) was added 2-amino-5H-phenanthridin-6-one

(

300 mg, 1.43 mmol, 1 equiv), and the mixture was stirred at rt for 2 h. The mixture was quenched with water (30 mL), and extracted

with DCM (30 mL x 2). The combined organic layers were washed with water (30 mL) and brine (30 mL), dried over sodium sulfate, and

concentrated. The residue was puriﬁed by silica gel column chromatography (DCM/MeOH=50:1, v/v) to afford the title compound

Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020 e10

ll

Resource

+

410 mg, 1 mmol, 73% yield) as an off-white solid. LC-MS: [M+H-Boc] 296.1.

(

3-(Methylamino)-N-(6-oxo-5H-phenanthridin-2-yl)propanamide hydrochloride

A mixture of tert-butyl N-methyl-N-[3-oxo-3-[(6-oxo-5H-phenanthridin-2-yl)amino]propyl]carbamate (400 mg, 1.01 mmol, 1.0 equiv)

ꢁ

in HCl in EtOAc (1.01 mL, 1.01 mmol, 1 equiv) was stirred at 25 C overnight. The mixture was ﬁltered, and the cake was washed with

+

EtOAc (10 mL). The residue was dried to afford the title compound (300 mg,0.90 mmol, 89% yield) as a gray solid. LC-MS: [M+H]

2

96.1.

3-(dimethylamino)-N-(6-oxo-5H-phenanthridin-2-yl)propanamide

To a solution of 3-(methylamino)-N-(6-oxo-5H-phenanthridin-2-yl)propanamide hydrochloride (70 mg, 0.21 mmol, 1 equiv) in meth-

anol (10 mL) was added formaldehyde (0.5 mL, 0.21 mmol, 1 equiv) and the reaction was stirred at room temperature for 40 min.

Sodium cyanoborohydride (106 mg, 1.69 mmol, 8 equiv) was added, and the reaction was stirred at room temperature for another

2

h. The mixture was puriﬁed by preparative-TLC (DCM:MeOH = 15:1) to give the title compound (30 mg, 0.1 mmol, 46% yield) as a

1

white solid. H NMR (400 MHz, DMSOd

6

) d 11.63 (s, 1H), 10.23 (s, 1H), 8.63 (s, 1H), 8.31 (d, J = 7.6 Hz, 1H), 8.22 (d, J = 8.0 Hz, 1H),

7

.87 (t, J = 7.6 Hz, 1H), 7.67 – 7.57 (m, 2H), 7.29 (d, J = 8.8 Hz, 1H), 2.75 (t, J = 6.8 Hz, 2H), 2.55 (t, J = 6.8 Hz, 2H), 2.31 (s, 6H); LC-MS:

+

M+H] 310.1.

[

4

Synthesis of 3-(5,5-diﬂuoro-7-(1H-pyrrol-2-yl)-5H-5l ,6l -dipyrrolo[1,2-c:2’,1’-f][1,3,2]diazaborinin-3-yl)-N-(6-

methyl(3-oxo-3-((6-oxo-5,6-dihydrophenanthridin-2-yl)amino)propyl)amino)hexyl)propenamide (RBN012148)

(

tert-Butyl N-methyl-N-[3-oxo-3-[(6-oxo-5H-phenanthridin-2-yl)amino]propyl]carbamate

To solution of 3-[tert-butoxycarbonyl(methyl)amino]propanoic acid (290 mg, 1.43 mmol, 1 equiv), HATU (814 mg, 2.14 mmol, 1.5

equiv) and DIPEA (461 mg, 3.57 mmol, 2.5 equiv) in DMF (10 mL) was added 2-amino-5H-phenanthridin-6-one (300 mg,

ꢁ

1

.43 mmol, 1 equiv), and the mixture was stirred at 25 C for 2 h. The mixture was quenched with water (30 mL) and extracted twice

with DCM (30 mL). The combined organic layers were washed with water (30 mL) and brine (30 mL), dried with sodium sulfate, and

concentrated. The residue was puriﬁed by silica gel chromatography (DCM/MeOH=50:1, v/v) to afford the title compound (410 mg,

e11 Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020

ll

Resource

+

.0 mmol, 73% yield) as an off-white solid. LC-MS: [M+H] 396.2.

1

3

A mixture of tert-butyl N-methyl-N-[3-oxo-3-[(6-oxo-5H-phenanthridin-2-yl)amino]propyl]carbamate (400 mg, 1.01 mmol, 1.0 equiv)

-(Methylamino)-N-(6-oxo-5H-phenanthridin-2-yl)propanamide hydrochloride

ꢁ

in HCl in EtOAc (1.01 mL, 1.01 mmol, 1 equiv) was stirred at 25 C overnight. The mixture was ﬁltered, and the cake was washed with

EtOAc (10 mL). The residue was concentrated to afford the title compound (300 mg, 0.90 mmol, 89% yield) as a gray solid. LC-MS:

+

M+H] 296.1.

[

tert-Butyl N-[6-[methyl-[3-oxo-3-[(6-oxo-5H-phenanthridin-2-yl)amino]propyl]amino]hexyl]carbamate

To a stirred solution of 3-(methylamino)-N-(6-oxo-5H-phenanthridin-2-yl)propanamide hydrochloride (110 mg, 0.33 mmol, 1 equiv)

ꢁ

and tert-butyl N-(6-oxohexyl)carbamate (86 mg, 0.4 mmol, 1.2 equiv) in MeOH (3 mL) at 25 C , NaBH

3

CN (208 mg, 3.32 mmol, 10

equiv) was added batchwise. The reaction was stirred overnight. The resulting mixture was quenched with water and extracted

with EtOAc. The organic phase was washed with brine and dried over anhydrous sodium sulfate. After concentration, the crude prod-

uct was puriﬁed by preparative-TLC (EtOAc/petroleum.ether = 1/2) to afford the title compound (140 mg, 0.28 mmol, 85% yield) as a

+

white solid. LC-MS: [M+H] 495.3.

3

tert-Butyl N-[6-[methyl-[3-oxo-3-[(6-oxo-5H-phenanthridin-2-yl)amino]propyl]amino]hexyl]carbamate (110 mg, 0.22 mmol, 1 equiv)

-[6-aminohexyl(methyl)amino]-N-(6-oxo-5H-phenanthridin-2-yl)propanamide dihydrochloride

ꢁ

and HCl in EtOAc (3 mL, 4.5 mmol, 20.2 equiv) were combined and stirred overnight at 25 C. The reaction mixture was concentrated

Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020 e12

ll

Resource

+

to afford the title compound (99 mg, 0.22 mmol, 95% yield) as a light yellow solid. LC-MS: [M+H] 395.3.

4

3

-(5,5-diﬂuoro-7-(1H-pyrrol-2-yl)-5H-5l ,6l -dipyrrolo[1,2-c:2’,1’-f][1,3,2]diazaborinin-3-yl)-N-(6-(methyl(3-oxo-3-

(6-oxo-5,6-dihydrophenanthridin-2-yl)amino)propyl)amino)hexyl)propanamide

To a solution of 3-[6-aminohexyl(methyl)amino]-N-(6-oxo-5H-phenanthridin-2-yl)propenamide, 2,2,2-triﬂuoroacetic acid (12 mg,

(

0

at 25 C for 5 min, and NanoBRET 590SE (10 mg, 0.02 mmol, 1 equiv) was added. The reaction mixture was covered with foil to avoid

.02 mmol, 1 equiv) in DCM (2 mL) and MeOH (2 mL) was added DIPEA (0.08 mL, 0.47 mmol, 20 equiv). The mixture was stirred

ꢁ

exposure to light and stirred at 25 C for 1 h. The resulting mixture was concentrated under vacuum. The crude product was directly

puriﬁed by reverse-phase chromatography eluting with ACN/water (10% to 100%) and then ACN/water (20% to 100%, 0.1% TFA) to

give ꢂ10 mg crude product, which was further puriﬁed by prep-HPLC (ACN/water, 0.1% TFA) to give the title compound (5 mg,

+

1

0

3

.006 mmol, 26% yield) as a blue-purple solid. LC-MS: [M+H] 706.3. H NMR (400 MHz, CD OD) d 10.70 (s, 1H), 8.65 (d,

J =1.6 Hz, 1H), 8.41 (d, J = 8.0 Hz, 1H), 8.30 (d, J = 8.0 Hz, 1H), 7.83 (t, J = 7.6 Hz, 1H), 7.69 – 7.56 (m, 2H), 7.31 (d, J = 8.8 Hz,

1

H), 7.21 – 7.11 (m, 4H), 6.97 (d, J = 4.4 Hz, 1H), 6.89 (d, J = 4.0 Hz, 1H), 6.37 – 6.27 (m, 2H), 3.70 -3.62 (m, 1H), 3.40 - 3.35 (m,

H), 3.29 – 3.09 (m, 6H), 2.97- 2.93 (m, 2H), 2.91 (s, 3H), 2.62 (t, J = 7.6 Hz, 2H), 1.85 – 1.77 (m, 2H), 1.57 - 1.53 (m, 2H), 1.50 -

.38 (m, 4H).

RBN012337 (example 543A in (Vasbinder et al., 2019)) and RBN013293 (example 390 in (Schenkel et al., 2019)) were synthesized

as previously described.

QUANTIFICATION AND STATISICAL ANALYSIS

Data Analysis for In Vitro Active Site Probe Displacement TR-FRET Assays

The TR-FRET was calculated using the following equation:

emission 665 nM

TRF =

emission 615 nM

Data Analysis for Cellular Active Site Probe Displacement NanoBRET Assays

The BRET ratio was calculated using the following equation:

Emission at 610 nm

BRET ratio =

Luminescence

%

The % inhibition for all assays was calculated as shown below:

Inhibition

e13 Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020

ll

Resource

signalcmpd ꢀ signalmin

signalmax ꢀ signalmin

%

inhibition = 100 3

where signalcmpd is the assay signal from the compound treated well, signalmin is the assay signal from the positive control well and

signalmax is the assay signal from the DMSO-treated negative control well.

IC50 Curve Fitting

The % inhibition values were plotted as a function of compound concentration and the following 4-parameter ﬁt was applied to derive

the IC50 values:

ðTop ꢀ BottomÞ

Y = Bottom +

ꢀ

ꢁ

Hill Coefficient

X

1

+

IC50

Typically, the 4-parameters were allowed to ﬂoat, however in some cases the bottom or top of the curves were ﬁxed at 0% or 100%

respectively.

Pass/Fail Criteria for Screening Plates

Plates were failed if the Z’ (Zhang et al., 1999) was below 0.5, as well as if the IC50 value for a reference inhibitor included on each plate

did not register to within 3-fold of its historical averaged IC50

.

Cell Chemical Biology 27, 877–887.e1–e14, July 16, 2020 e14

Article Doi

In Vitro and Cellular Probes to Study PARP Enzyme Target Engagement

DOI: 10.1016/j.chembiol.2020.06.009

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.chembiol.2020.06.009

Full text of DOI:10.1016/j.chembiol.2020.06.009

Products guided by the article

R&D Labs maybe for 124072-61-3

Relevant to this article

Hot Product