PCR incorporation of dUMPs modified with aromatic hydrocarbon substituents of different hydrophilicities: Synthesis of C5-modified dUTPs and PCR studies using Taq, Tth, Vent (exo-) and Deep Vent (exo-) polymerases

Article abstract of DOI:10.1016/j.bioorg.2020.103829

Deoxyuridine triphosphate derivatives (dUTPs) modified at the C5 position of the pyrimidine ring with various aromatic hydrocarbon substituents of different hydrophilicities have been synthesized. The aromatic hydrocarbon substituents were attached to dUTPs via a CH[dbnd]CH[sbnd]CH₂[sbnd]NHCO[sbnd]CH₂ linker. The efficiency of the PCR incorporation of modified dUMPs using Taq, Tth, Vent (exo-) and Deep Vent (exo-) polymerases and a model DNA template containing one, two and three adjacent adenine nucleotides at three different sites within the sequence was investigated. For all the polymerases used, the yield of the modified PCR product was significantly increased with increasing hydrophilicity of the aromatic hydrocarbon substituent. In particular, for the above polymerases, the efficiency of the incorporation of dUMPs modified with the most hydrophilic of the studied aromatic hydrocarbon substituents, a 4-hydroxyphenyl residue, was 60–85% of the efficiency of dTMP incorporation. At the same time, the relative efficiencies of the incorporation of dUMPs modified with 2-, 4-methoxyphenyl, phenyl and 4-nitrophenyl substituents ranged from 20 to 50% and were 2–18% for the 1-naphthalene and 4-biphenyl groups, which were the most hydrophobic of the studied aromatic hydrocarbon substituents.

Full text of DOI:10.1016/j.bioorg.2020.103829

BioorganicChemistry99(2020)103829
Contents lists available at ScienceDirect
Bioorganic Chemistry
journal homepage: www.elsevier.com/locate/bioorg
PCR incorporation of dUMPs modified with aromatic hydrocarbon
substituents of different hydrophilicities: Synthesis of C5-modified dUTPs
and PCR studies using Taq, Tth, Vent (exo-) and Deep Vent (exo-)
polymerases
Olga A. Zasedateleva⁎, Sergey A. Surzhikov, Valeriy E. Shershov, Rinat A. Miftakhov,
Dmitry A. Yurasov, Viktoriya E. Kuznetsova, Alexander V. Chudinov
Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, 32 Vavilov Street, 119991 Moscow, Russia
A R T I C L E I N F O
A B S T R A C T
Keywords:
Deoxyuridine triphosphate derivatives (dUTPs) modified at the C5 position of the pyrimidine ring with various
aromatic hydrocarbon substituents of different hydrophilicities have been synthesized. The aromatic hydro-
carbon substituents were attached to dUTPs via a CH]CHeCH2eNHCOeCH2 linker. The efficiency of the PCR
incorporation of modified dUMPs using Taq, Tth, Vent (exo-) and Deep Vent (exo-) polymerases and a model
DNA template containing one, two and three adjacent adenine nucleotides at three different sites within the
sequence was investigated. For all the polymerases used, the yield of the modified PCR product was significantly
increased with increasing hydrophilicity of the aromatic hydrocarbon substituent. In particular, for the above
polymerases, the efficiency of the incorporation of dUMPs modified with the most hydrophilic of the studied
aromatic hydrocarbon substituents, a 4-hydroxyphenyl residue, was 60–85% of the efficiency of dTMP in-
corporation. At the same time, the relative efficiencies of the incorporation of dUMPs modified with 2-, 4-
methoxyphenyl, phenyl and 4-nitrophenyl substituents ranged from 20 to 50% and were 2–18% for the 1-
naphthalene and 4-biphenyl groups, which were the most hydrophobic of the studied aromatic hydrocarbon
substituents.
C5-modified dUTPs
Aromatic hydrocarbon groups
Hydrophilicity
PCR incorporation
Modified DNA
1. Introduction
However, details of the technology for creating aptamers, including
the corresponding nucleotide sequences, have not been published, and
The substrate specificities of different DNA polymerases in relation
to nucleoside triphosphates modified with different functional groups
are currently under intense investigation. Such studies are relevant, in
particular, due to the importance of technologies used for the creation
of modified aptamers. These aptamers useful for future medical appli-
cations are DNA oligonucleotides containing bases modified with dif-
ferent functional groups providing the ability for oligonucleotides to
interact with target proteins with high specificity [1,2]. To date, protein
biomarker discovery and clinical diagnostics company SomaLogic
founded by L. Gold has developed modified aptamers for more than
1000 human proteins [3–6], with one of them, Macugen, available for
purchase on the market [7]. Also, for a number of proteins, this com-
pany has developed pairs of modified aptamers whose dissociation
constants are comparable to the dissociation constants of antigen-an-
tibody complexes [6,8].
a number of laboratories are conducting independent researches aimed
at finding and developing methods for creating specific and highly af-
fine modified DNA aptamers [9–13]. A key feature of the technology for
creating a modified DNA aptamer is the effective enzymatic in-
corporation of nucleotides modified by various functional groups in the
nucleotide chain. Therefore, molecular mechanisms of enzymatic in-
corporation of modified nucleotides are also intensively investigated
[14–16].
In 2005, Jäger et al. demonstrated the possibility of the effective
enzymatic production of fully modified DNA products by B family
polymerases (both in the primer extension reaction and in PCR) using
all four nucleotides modified with basic, acid or lipophilic amino acid
residues [9]. It has also been shown in this work that the efficiency of A
family polymerases (Taq, Tth and KF (exo-)) in primer extension reac-
tions depends significantly on the template DNA sequences.
⁎ Corresponding author.
E-mail address: for_lana3@mail.ru (O.A. Zasedateleva).
https://doi.org/10.1016/j.bioorg.2020.103829
Received 24 December 2019; Received in revised form 25 March 2020; Accepted 5 April 2020
Availableonline08April2020
0045-2068/©2020ElsevierInc.Allrightsreserved.

O.A. Zasedateleva, et al.
BioorganicChemistry99(2020)103829
In the above mentioned work [9], six different types of DNA tem-
plates were used: a DNA template with an almost equal nucleotide
distribution without repeats of the same nucleotide except for one AA
motif; four templates containing long A-, Τ-, G- and C-rich regions with
two to four repetitions of the same nucleotide in adjacent positions; and
a template containing a complete set of random sequences of 40 nu-
cleotides (i.e., a complete set of sequences 40 nucleotides long, which is
typically used for in vitro aptamer selection experiments). It was shown
that Taq polymerase cannot produce a primer elongation product from
an A-rich template or a template containing a complete set of random
sequences of 40 nucleotides. At the same time, B-family polymerases
(Pwo, Tgo, Pfu (exo-) and Vent (exo-)) produced modified primer ex-
tension products using all of the listed templates with efficiencies of
more than 40% compared to the yields of primer extension products
produced using only natural dNTPs. Pwo and Vent (exo-) polymerases
produced modified DNA with efficiencies of more than 70%. In addi-
tion, Pwo polymerase can produce a fully modified PCR product using
any of the listed templates. Meanwhile, G- and C-rich matrices were
least effectively amplified by Pwo polymerase.
that mimic tyrosine and phenylalanine residues. For all the studied
polymerases, the efficiency of PCR amplification increased with the
increasing hydrophilicity of the aromatic hydrocarbon substituent. In
this study, all the polymerases most effectively (with efficiencies equal
to 60–85% of that of dTMP incorporation efficiency) incorporated
dUMP modified with 4-hydroxyphenyl group, which mimics a tyrosine
residue.
2. Materials and methods
2.1. dUTPs modified by different aromatic hydrocarbon substituents using
CH]CHeCH2eNHCOeCH2 as a linker
Homogeneity of synthesized deoxynucleoside triphosphate deriva-
tives and the reactions were monitored by TLC on TLC Silica gel 60 RP-
18 F254 and TLC Silica gel 60 F254 plates (Merck, Darmstadt,
Germany). The column chromatography was carried out using
Lichroprep RP-18 sorbent (0.040–0.063 mm, Merck, Darmstadt,
Germany). The compounds on chromatograms were detected at 280 nm
with a EM-1 Econo UV Monitor (Bio-Rad Laboratories Inc., Hercules,
CA, USA). High resolution mass spectra (HRMS) were registered on a
Bruker Daltonics microTOF-Q II instrument (Bruker, Billerica,
Germany) using electrospray ionization (ESI). The measurements were
done in a negative and positive ion mode. The 1H, 13C and 31P NMR
In 2006, Kuwahara et al. [10] also investigated the PCR amplifica-
tion of plasmid DNA sites containing AAAA and GGGG poly motifs by
polymerases from A and B families in the presence of dTTP and dCTP
modified with aliphatic hydrocarbon substituents. In this work, it was
found that polymerases from the B family (Vent (exo-), KOD Dash, and
KOD (exo-)) more effectively incorporated dTMP and dCMP modified
with a wider variety of substituents than polymerases from the A family
(Taq and Tth).
spectra were recorded using
a Bruker AMX-400 spectrometer
(400 MHz, Bruker, Billerica, Germany) in DMSO‑d6 and D2O. Chemical
shifts (δ) were expressed in ppm.
As in [9], in 2010, Vaught et al. used a template containing a
complete set of random 40 nucleotide-long sequences flanked by re-
gions with fixed sequences for primer annealing and studied the en-
zymatic incorporation of dUMPs modified with various aromatic and
aliphatic hydrocarbon substituents [3]. PCR in the presence of such
modified nucleoside triphosphates did not lead to the formation of full-
length products; however, full-length products containing modified
dUMPs were efficiently produced in primer extension reactions by B
family polymerases (KOD XL and Deep Vent (exo-)). The reverse reac-
tion of primer extension with a modified sequence was subsequently
performed in the presence of natural dNTPs followed by PCR. This
scheme was used initially for selection of the modified aptamers for a
member of the TNF receptor super family, TNFRSF9, and tumor-asso-
ciated calcium signal transducer, TACSTD2, as protein targets [3].
Further the same approach was used to create aptamers for a wide
range of proteins [4–6]. Dissociation constants for the most of protein-
aptamer complexes were estimated to be lower than 1 nM. In all of the
above studies using pyrimidine-based nucleoside triphosphates, sub-
stituents were introduced at the C5 position of the pyrimidine ring.
In the work of Kuwahara et al., pyrimidine nucleotides modified
with substituents containing an amino group that was positively
charged due to protonation were inefficiently incorporated by all the
tested polymerases during PCR [10]. Recently, we have shown that Taq
polymerase incorporates dUMPs modified by electroneutral hydrophilic
(due to the zwitterionic structure) analogues of cyanine dyes more ef-
fectively, than dUMPs containing positively or negatively charged
analogues of these dyes as substituents [17]. Based on that work, it
followed that when creating dNTPs conjugated with dyes for the ef-
fective enzymatic labelling of DNA, the physical and chemical proper-
ties of the fluorophores, which can be considered as rather large sub-
stituents, must be taken into account. The introduction of zwitterionic
groups into dyes improves their hydrophilicity, concomitantly im-
proving the aqueous solubility of fluorescently labelled dNTPs and the
enzymatic incorporation of nucleotides in DNA.
All reagents were obtained from Sigma-Aldrich or Fluka unless
otherwise stated.
The synthesis of activated aromatic acid esters and modified deox-
yuridine triphosphates was carried out according to the synthetic pro-
cedures described earlier [18]. Detailed synthetic procedures and
spectroscopic characteristics, including data on the intermediates, are
provided in the Supplementary Information.
2.2. The DNA template and primers were similar to those used in [17]
Template
5′ – TCTCTTGCCCTTTCGTCTCTAAATTGTCTTAATCTCTTCTATCC
TTCTCTCTCACCACTTACATCCGC − 3′
Primer P1-Cy3
Cy3 – NH − 5′ – GCGGATGTAAGTGGTGAG − 3′
Primer P2-Cy3
Cy3- NH − 5′ – TCTCTTGCCCTTTCGTC −3′
Primer sequences and the corresponding primer binding sites are
underlined. Also underlined are adenines that are subject to com-
plementary binding with modified deoxyuridines of the en-
zymatically synthesized DNA strand.
2.3. PCR and electrophoresis
PCR was performed following a protocol similar to one described
earlier [17]. The above 68-nucleotide template and a pair of 18- and 17-
nucleotide-long primers labelled with Cy3 dye were used. To study the
efficiency of the complementary incorporation of modified dUMPs the
template contained one, two and three adjacent adenine nucleotides at
three different sites within the sequence. We used Thermus aquaticus
(Taq) and Thermus thermophilus (Tth) DNA polymerases (Sileks, Ba-
denweiler, Germany) and forms of the native DNA polymerases from
Thermococcus litoralis (Vent (exo-)) and Pyrococcus GB-D strain (Deep
́
́
Vent (exo-)) that were genetically engineered to eliminate the 3′→5′
proofreading exonuclease activity (New England Biolabs, Ipswich, UK).
As in the work of Kuwahara et al. [10], the PCR conditions were
selected for each polymerase so that the full-length PCR products syn-
thesized using only natural dNTPs were efficiently produced by all
polymerases. Herein, the amount of PCR products was the same for all
In the present work, by using Taq, Tth, Vent (exo-) and Deep Vent
(exo-) polymerases, we investigated the efficiency of the PCR in-
corporation of dUMPs modified via a linker at the C5 position of the
pyrimidine ring with aromatic hydrocarbons. These substituents dif-
fered in hydrophilicity/hydrophobicity, and among them were those
2

O.A. Zasedateleva, et al.
BioorganicChemistry99(2020)103829
the considered polymerases within an accuracy of 20%, which allowed
the facile observation, registration and comparison of the electro-
phoregrams obtained using different polymerases.
The relative quantities of the PCR-amplified full-length DNA frag-
ments containing modified dUMPs were considered proportional to the
relative fluorescence intensities of the Cy3-labelled primers. The re-
lative Cy3 fluorescence intensities of the doublet bands that resulted
from PCR amplification of the template using the forward and reverse
primers labelled with Cy3 dye were quantified using virtual rectangular
frames surrounding the bands. The fluorescence intensities of all the
pixels within the frame were summed to obtain the total fluorescence
intensity within the frame. The fluorescence intensity of the blank gel
region within the same frame was then subtracted from the obtained
value. The obtained quantities were normalized to the fluorescence
intensity of the full-length PCR amplified DNA products obtained using
the forward and reverse primers and only natural nucleotides. The re-
lative quantities of PCR-amplified DNA containing modified dUMPs
obtained in two experiments were averaged.
The PCR conditions for each of the polymerases were as follows. All
reaction mixtures (25 μl) for PCR amplification of the 68-nucleotide
template contained each primer (10−6 M), the template (4 × 10−9 M),
each deoxynucleoside triphosphate (dATP, dCTP, dGTP, dTTP or
modified dUTP, 10−4 M), and the manufacturer's recommended buffer
(70 mM Tris HCl, 16.6 mM (NH4)2SO4, 2 mM MgCl2, pH 8.6, for Taq
and Tth polymerases, and 20 mM Tris HCl, 10 mM (NH4)2SO4, 10 mM
KCl, 2 mM MgSO4, 0.1% Triton® X-100, pH 8.8, for Vent (exo-) and
Deep Vent (exo-) polymerases). In the case of PCR amplification by
Vent (exo-) polymerase, the reaction mixture additionally contained 8%
formamide.
Tubes containing the reaction mixture without polymerase were
placed into the heating block of a Peltier thermal cycler (Dyad from Bio-
Rad, Hercules, CA, USA) and heated at 95 °C for 6 min. After that, the
temperature was decreased to 62 °C, which is the calculated melting
temperature of the P1-Cy3 and P2-Cy3 primers. The melting tempera-
tures of the primers were calculated using the DI-nucleic acid hy-
bridization and melting prediction web server [19]. Immediately after
heating for 6 min at 62 °C, the appropriate amounts of polymerase (3
units of Taq polymerase, 1 unit of Tth polymerase, 0.5 units of Vent
(exo-) polymerase or 0.08 units of Deep Vent (exo-) polymerase) were
added to the reaction mixtures, which were then stirred without re-
moving the tubes from the block. This excluded the possibility that the
activity of the polymerases decreased during the pre-denaturation
stage. Then, 20 reaction cycles of heating at 94 °C for 1 min and cooling
to 62 °C for 1.5 min were conducted.
3. Results
3.1. Properties of the aromatic hydrocarbon substituents
To study the effect of the hydrophilicity of the aromatic hydro-
carbon substituents, dUTPs modified at the C5 position of the pyr-
imidine ring by various aromatic hydrocarbon residues (R1–R7) were
synthesized. The tested substituents included the residues that mimic
natural tyrosine and phenylalanine amino acid residues as well as other
structures that could potentially interact with the target proteins
(Table 1). Following the approach developed by us in [18,21,22],
aromatic hydrocarbon residues were added at the C5 position of the
pyrimidine ring of dUTP via a CH]CHeCH2eNHCOeCH2 linker.
The hydrophilicity/hydrophobicity of substituents R1–R7 could be
approximately characterized based on the water solubility values (S
values) of the aromatic hydrocarbons, as their residues formed the
corresponding substituents. The S values were taken from the PubChem
(USA) database [23] and are presented in Table 1. These values range
from S = 4.5*10−5 M (for diphenyl) to S = 0.88 M (for phenol). In
addition, certain functional groups of some residues (R1–R7) may act as
hydrogen bond donors (in the case of R1) or acceptors (in the cases of
R1, R2, R3 and R5), which can influence the incorporation of the cor-
responding modified dUMP by each of the studied polymerases.
Thus, the selected aromatic hydrocarbon substituents presented and
characterized in Table 1 allowed the investigation of the substrate
specificity of the DNA polymerases for a wide range of hydrophilic/
hydrophobic aromatic hydrocarbons conjugated at the C5 position of
the pyrimidine ring of dUTPs via a linker.
The reactions were terminated with 450 μl of 2.5% (for the case of
amplification using Taq and Tth polymerases) or 4% (for the case of
amplification using Vent (exo-) and Deep Vent (exo-) polymerases) li-
thium perchlorate trihydrate in 95% ethanol to form 90% of the final
ethanol concentration followed by short-term mixing and 18 h of pre-
cipitation at −20 °C. After that the samples were centrifuged for 10 min
at 13,000 rpm using Biofuge pico centrifuge (Kendro Laboratory
Products GmbH, Hanau, Germany), the supernatants were removed and
the samples were washed with 40 μl of 95% ethanol with lithium
perchlorate trihydrate at the same corresponding concentrations at
20 °C for 5 min and 450 rpm using Thermomixer comfort (Eppendorf,
Hamburg, Germany). Then the samples were additionally exposed for
centrifugation for 4 min at 13,000 rpm using Biofuge pico centrifuge,
the supernatants were removed and the samples were dried at 37 °C for
10 min using Termo 24–15 thermostat (Biocom, Moscow, Russia). Each
sample was dissolved in 6 μl of water solution of 7 M Urea and 0.01%
Bromophenol blue and heated at 95 °C for 50 s before being loaded into
gel wells.
3.2. Efficiency of the PCR amplification of DNA strands by Taq, Tth, Vent
(exo-) and Deep Vent (exo-) polymerases using the C5-modified dUTPs
The PCR products were separated by electrophoresis in 18% poly-
acrylamide denaturing gels ((19:1 (w/w) acrylamide/bis-acrylamide,
7 M urea; 700 V; thermostabilized 16 × 16 cm glass sandwich with 1-
mm gel thickness; TBE buffer (89 mM Tris-borate and 2 mM ethyle-
nediaminetetraacetic acid, pH 8.3)) using PROTEAN II xi cell (Bio-Rad
Laboratories Inc., Hercules, CA, USA) and an Elf-8 power supply (DNA
Technology, Moscow, Russia). Samples of the PCR products obtained by
replacing the dTTPs with modified dUTPs were loaded in descending
order of hydrophilicity (increasing hydrophobicity) of the aromatic
hydrocarbon substituent.
Fig. 1A and B shows the electrophoretic separation of the PCR
products obtained with the Taq, Tth, Vent (exo-) and Deep Vent (exo-)
polymerases in the presence of the 68-nucleotide-long template and the
pair of 18- and 17-nucleotide-long primers labelled with Cy3 dye (see
the Materials and Methods section).
As shown in Fig. 1A and B, the full-length PCR products form two
close electrophoretic fluorescent bands in the gels, since both the direct
and reverse primers were labelled with Cy3 dye (see the Materials and
Methods section). The exception is the full-length PCR-amplified
strands in lanes 3, 12, 22 and 31, in which the PCR products of the
forward and reverse primers overlap in the gel. This coelution can be
attributed to the fact that in the presence of natural dNTPs, the “hea-
vier“ of the amplified DNA strands (the direct primer product) contains
10 dTMPs in its sequence and has a mass of 22,737 Da, and the “lighter”
(the reverse primer product) has 29 dTMPs and a mass of 21,725 Da
(lanes 2, 11, 21 and 30). Thus, the difference in the masses of these
DNA strands is 1012 Da.
After electrophoresis, images of the gels were obtained in the Cy3
abs
em
fluorescence range (λ
= 550 nm, λ
= 570 nm, as described in
max
max
the manufacturer’s instructions for Amersham CyDye mono-reactive
NHS Esters) using a gel imager for fluorescence spectroscopy with an
image field of 20 × 16 cm, as described earlier [17]. The gel imager
was equipped with an RTE/CCD-1536-K/1 CCD camera (Roper Scien-
tific, Sarasota, FL, USA), a mercury lamp, a pair of 535DF35 and
580DF27 filters (Omega Optical, Brattleboro, VT, USA) and a computer
running ImaGel Research software [17,20].
Since the primer regions of the amplified DNA strands contained
3

O.A. Zasedateleva, et al.
BioorganicChemistry99(2020)103829
Table 1
The chemical structures of the modified dUMPs, the physicochemical properties of the aromatic hydrocarbon substituents, R1–R7, and the water solubilities of the
aromatic hydrocarbon compounds forming the corresponding aromatic hydrocarbon substituents.
Substituent, R
Properties
Number of potential
Number of potential
hydrogen bond
acceptors
Water solubility, S,a at 25 °C, of aromatic hydrocarbons the residues of which form the
corresponding aromatic hydrocarbon substituents (M)
hydrogen bond donors
1
0
1
(R1)
1
(R2)
0
1
(R3)
0
0
0
2
(R4)
(R6)
(R5)
0
0
0
0
(R7)
a
Water solubilities of aromatic hydrocarbon compounds were taken from the PubChem (USA) database (23).
only natural nucleotides, it is easy to determine that in the case of PCR
in the presence of dUTPs modified with methylated linker
brightest fluorescence were those obtained in the presence of only
natural dNTPs and those that possessed dUMPs that were substituted at
the C5 position of the pyrimidine ring with a methylated linker or a
linker to which the most hydrophilic of the aromatic hydrocarbon re-
sidues was attached, namely, a 4-hydroxyphenyl residue (R1) (lanes
2–4, 11–13, 21–23 and 30–32), instead of dTMPs. With increasing hy-
drophobicity of the aromatic hydrocarbon residue, the fluorescence,
which is proportional to the amount of full-length PCR product, de-
creases.
a
(CH]CHeCH2eNHCOeCH2-Me) instead of dTTP, the product of the
forward primer contains 6 modified dUMPs, and summarizing the other
dNMPs presented in its’ sequence, it has a mass of 23,319 Da. The
product of the reverse primer contains 21 of the same dUMPs, has a
mass of 23,762 Da and is the “heavier“ of the amplified DNA strands.
However, the difference in mass between these DNA strands is only
443 Da. These PCR products overlap in the gel and emit fluorescence as
a single band (lanes 3, 12, 22 and 31).
The results of the quantitative analysis of the PCR products are
presented in Table 2 and Fig. 1C. In the cases of Taq and Tth poly-
merases, the relative amounts of PCR-amplified products containing
dUMPs modified with a 4-hydroxyphenyl residue (R1) were 80–85% of
the amounts of product obtained in the presence of only natural dNTPs
(lanes 4 and 13 in Fig. 1C). For Vent (exo-) and Deep Vent (exo-)
polymerases, these amounts were 60–70% (lanes 23 and 32 in Fig. 1C).
Thus, for Taq, Tth, Vent (exo-) and Deep Vent (exo-) polymerases the
relative efficiencies of PCR incorporation of dUMPs modified with a 4-
hydroxyphenyl residue were 60–85%. The relative efficiencies of PCR
Upon addition of an aromatic hydrocarbon residue (R1–R7) to the
linker, the DNA strand possessing 21 modified dUMPs is significantly
heavier than the DNA strand possessing 6 modified dUMPs. The mass
difference for such PCR-amplified strands is 1375 Da (for the case of
dUMPs modified via a linker with a phenyl residue (substituent R4,
Table1), lanes 7, 16, 26 and 35 in Fig. 1A and B) or more (for other
aromatic hydrocarbon residues). Therefore, in these cases, the full-
length PCR products appear as two distinct fluorescent bands.
As shown in Fig. 1A and B, the PCR products that emitted the
4

O.A. Zasedateleva, et al.
BioorganicChemistry99(2020)103829
Fig. 1. Efficiency of PCR amplification by Taq, Tth, Vent (exo-) and Deep Vent (exo-) polymerases when dTTP is replaced by dUTP modified via a
CH]CHeCH2eNHCOeCH2 linker at the C5-position of the pyrimidine ring with aromatic hydrocarbon residues of different hydrophilicities. A and B.
Electrophoretic separation of PCR products recorded in the fluorescence range of the Cy3 dye, which was used to label the primers (see Materials and Methods
section). Lanes 1 and 20: PCR mixtures in the absence of polymerase. Lanes 2, 11, 21 and 30: PCR mixtures containing dNTPs and Taq, Tth, Vent (exo-) or Deep Vent
(exo-) polymerase, respectively. Lanes 3, 12, 22 and 31: the same PCR mixtures as in lanes 2, 11, 21 and 30, respectively, but with the dTTPs replaced with dUTPs
modified with the methylated linker CH]CHeCH2eNHCOeCH2-Me. Lanes 4–10, 13–19, 23–29 and 32–38: the same PCR mixtures as in lanes 2, 11, 21 and 30,
respectively, but with dTTP replaced with dUTPs modified with residues R1-R7 using a CH]CHeCH2eNHCOeCH2 linker. C. Histogram of the fluorescence in-
tensities of the full-length PCR products normalized for each polymerase to the fluorescence intensities of the PCR products produced in the presence of only natural
dNTPs. The black columns are the fluorescent signals of the completely natural PCR products (taken as 1). The hatched columns are the normalized fluorescence
signals of the PCR products containing modified dUMPs instead of dTMPs. The experiments shown in A and B were performed twice. The average values from the two
experiments are shown. The bars indicate the absolute deviations.
incorporation of dUMPs conjugated with 2-, 4-methoxyphenyl, phenyl
and 4-nitrophenyl residues (R2-R5) were 20–50%. The relative effi-
ciencies of PCR incorporation of dUMPs modified by the most hydro-
phobic substituents, 1-naphthalene and 4-biphenyl residues (R6-R7),
were 2–18%.
substituent.
It should be mentioned that dUMPs conjugated via a linker with a 2-
methoxyphenyl residue (R2) were incorporated by Taq, Vent (exo-) and
Deep Vent (exo-) polymerases with an efficiency 1.5–2 times less than
dUMPs conjugated with a 4-methoxyphenyl residue (R3). Therefore,
the attachment of 4-methoxyphenyl residue is better for effective PCR
amplification.
Thus, for all the polymerases studied, the amounts of PCR products
that were obtained by replacing dTTP with modified dUTP decreased
with decreasing hydrophilicity of the aromatic hydrocarbon
5

O.A. Zasedateleva, et al.
BioorganicChemistry99(2020)103829
Table 2
The relative amounts of PCR products amplified by Taq, Tth, Vent (exo-) and Deep Vent (exo-) polymerases when replacing dTTP with dUTPs modified with aromatic
hydrocarbon substituents (R1–R7) via a CH]CHeCH2eNHCOeCH2 linker.
Substituent, R
Polymerase
Taq
Tth
Vent (exo-)
Deep Vent (exo-)
Polymerase averaged values
0.81
0.39
0.04
0.85
0.01
0.01
0.75
0.14
0.63
0.01
0.76
0.13
(R1)
0.01
0.03
0.49
0.53
0.18
0.02
0.01
0.26
0.01
0.33
0.16
(R2)
0.55
0.02
0.40
0.39
0.06
0.47
0.08
(R3)
0.51
0.52
0.02
0.02
0.45
0.46
0.03
0.06
0.44
0.27
0.01
0.05
0.27
0.25
0.01
0.01
0.42
0.38
0.15
0.14
(R4)
(R6)
(R5)
0.18
0.09
0.03
0.01
0.11
0.03
0.01
0.01
0.04
0.06
0.01
0.01
0.03
0.02
0.01
0.01
0.09
0.05
0.09
0.04
(R7)
3.3. Correlation between the yield of the PCR-amplified modified product
and the hydrophilicity of the aromatic hydrocarbon substituent at the C5
position of dUMP
Fig. 2 shows the plot of the relative amounts of full-length PCR
products, which were averaged over all four polymerases (Taq, Tth,
Vent (exo-) and Deep Vent (exo-), see Table 2) against the hydro-
philicity of the aromatic hydrocarbon substituents conjugated at the C5
position of the pyrimidine ring of the dUTPs. The hydrophilicities were
approximated by the water solubility values, S values, of the aromatic
hydrocarbons, the residues of which form the corresponding sub-
stituents (Table 1).
As shown in Fig. 2, the points in the obtained plot show a positive
correlation between the relative amounts of full-length PCR products
and the hydrophilicity of the aromatic hydrocarbon substituents. Thus,
it can be concluded that when PCR is performed using Taq, Tth, Vent
(exo-) or Deep Vent (exo-) polymerase, the observed efficiency of the
incorporation of dUMPs modified at the C5 position of the pyrimidine
ring increases with increasing hydrophilicity of the aromatic hydro-
carbon substituent.
Fig. 2. Plot of the relative amounts of enzymatically produced full-length
modified PCR products averaged over Taq, Tth, Vent (exo-) and Deep Vent (exo-
) polymerases as a function of the hydrophilicity of the aromatic hydrocarbon
substituents (R1–R7) conjugated at the C5 position of the dUMPs via a
CH]CHeCH2eNHCOeCH2 linker. Black circles – plot of the averaged relative
amounts of full-length PCR-amplified DNA strands (see Table 2) against the
water solubility values, S values (M) (Table 1). The bars indicate the maximum
deviations from the average. The dashed line indicates the approximation of the
“black circles” using the least squares method and the following logarithmic
equation: y = A∙log(B∙S + C) + D, where y is the averaged relative efficiency of
PCR incorporation, and A, B, C and D are the parameters. The coefficient of
determination of the logarithmic approximation, R2, was 0.91.
4. Discussion
Hydrogen bonds, electrostatic, van der Waals and hydrophobic in-
teractions form the basis of protein-protein, protein-DNA and ligand-
DNA intermolecular interactions [24–28]. The dissociation constants
for the sequence-specific complexes between transcription factors and
corresponding DNA sites are in the range of 10−6–10−9 M [29–31] and
for antigen-antibody complexes these values lie in the range
10−9–10−12 M [32]. As reported by L. Gold et al. [4,5] using SELEX
technology [33–35], it was possible to create more than 1000 DNA
oligonucleotides (or DNA aptamers) containing bases modified by
aromatic and aliphatic functional groups with a relatively high binding
affinity for target proteins (with Kd values 10−9–10−12 M for the most
aptamer-protein complexes). Therefore, it is promising to obtain mod-
ified DNA aptamers exhibiting high affinity to disease-related target
6

O.A. Zasedateleva, et al.
BioorganicChemistry99(2020)103829
proteins for the diagnostics and therapy of infectious, oncological,
neurodegenerative and cardiovascular diseases [1,2].
linker was used to modify dUTPs by seven various aromatic hydro-
carbon substutuents with rather different hydrophilicities. Using DNA
polymerases from the A (Taq and Tth) and B (Vent (exo-) and Deep Vent
(exo-)) families, we obtained quite similar efficiencies (with the dif-
ference of about 20–50% for the most of substituents) of PCR in-
corporation of dUMPs modified by one and the same aromatic hydro-
carbon substituent. Consequently, this linker structure contributes to
the effective incorporation of modified nucleotides by a broad range of
DNA polymerases.
One of the main stages of SELEX technology used in the search for
aptamers is enzymatic synthesis, i.e. primer extension or PCR [33–35].
Therefore, modified DNA template and modified dNTPs should be
compatible with the enzymatic synthesis. To meet this requirement,
various DNA polymerases were previously tested to select the most
efficient ones, depending on certain modifications of the bases of dNTPs
[3,9,12]. Another approach is based on the search for structural para-
meters characterizing as linkers and attached functional groups, which
would be more compatible with the most of DNA polymerases [10].
4.3. Complete set of random sequences of a fixed length or only those
without homonucleotide repeats longer than 3 adjacent nucleotides?
4.1. Efficiency of PCR in the presence of modified dUTPs depending on the
hydrophilicity of aromatic hydrocarbon substituents
In the present work, the incorporation of a relatively small number
(no more than three) of adjacent modified dUMPs in the PCR-amplified
strands apparently contributed to the effective PCR amplification of
full-length modified products.
Previous publications have included studies of basic, acidic, or li-
pophilic groups [3,9,10], but their hydrophilicity has not been con-
sidered separately or systematically studied.
As was expected on initial stages of SELEX development the necessary
step in aptamer production was enzymatic synthesis using a template
containing a complete set of random sequences of a fixed length including
those containing homonucleotide repeats [33–35]. Accordingly, the pre-
vious investigations were partly focused on finding combinations of poly-
merases and modified dNTPs that would contribute to enzymatic synthesis
with minimal dependence on DNA sequences [3,9,10].
In the present study, using DNA polymerases from the A (Taq and
Tth) and B (Vent (exo-) and Deep Vent (exo-)) families, similar effi-
ciencies of PCR incorporation of dUMPs modified by an aromatic hy-
drocarbon substituent were obtained. Moreover, it was shown for all
the studied polymerases, that the relative amount of full-length mod-
ified PCR product obtained was increased with increasing hydro-
philicity of the aromatic hydrocarbon substituent. This correlation,
common to the four polymerases, appears to be a consequence of the
common basic structure of DNA polymerases consisted of subdomains
referred to as fingers, palm, and thumb domains which resemble a right
hand [28,36] and also a consequence of the presence of similar parts of
the DNA template and the synthesized DNA chain in the active centers
of DNA polymerases.
However, it was shown later that the relative enzymatic in-
corporation efficiency decreases with an increase in the number of
consequently incorporated modified nucleotides of one type [10,17].
Therefore, the sequences containing homonucleotide repeats are en-
zymatically synthesized less efficiently than those without such sites. At
the same time, Taq polymerase seems to amplify an array of random
DNA sequences of a fixed length including those containing homo-
nucleotide repeats of a modified nucleotide no longer than a triplet.
Some of these oligonucleotides may with a certain probability contain
motifs capable of highly specific interactions with the target proteins.
Therefore, it can be assumed that in order to obtain aptamers, the
enzymatic synthesis of modified DNA fragments using dUTPs modified
with certain aromatic hydrocarbon substituents can be carried out by
PCR using Taq polymerase, which allows the incorporation of up to
three adjacent modified nucleotides.
It should be mentioned, that the increase of PCR efficiency de-
pending on hydrophilicity of substituent at the C5 position of dUTPs
also correlates with the previous observation that the dUMPs which are
labeled at the same position by hydrophilic zwitterionic analogs of
cyanine dyes are efficiently incorporated by Taq DNA polymerase [17].
4.2. PCR-compatibility of substituents attached at the C5 position of dUTPs,
depending on the linker structure
In the previous studies, Vaught et al. [3] and Gold et al. [4] using a
CONH-CH2 linker, demonstrated the ability to effectively incorporate
dUTPs modified with aromatic and aliphatic hydrocarbon substituents
in primer extension reactions, but not in PCR. A distinctive feature of
the approach developed by Jäger et al. [9], which is the most successful
approach in terms of the efficiency of the PCR incorporation of mod-
ified dUMPs, was the use of a C^CeCH2eNHCOeCH2 linker con-
taining a C^C bond and an “inverted” peptide group. Thus, the effec-
tive PCR incorporation of modified dUMPs is strongly influenced by the
linker structure and is facilitated by the presence of multiple bonds
between carbon atoms (in this case, a triple bond) in the linker as well
as by the presence of the “inverted” peptide group (NHCO).
5. Conclusions
When using DNA templates containing no more than three adjacent
adenine nucleotides:
(i) In general, Taq, Tth, Vent (exo-) and Deep Vent (exo-) DNA poly-
merases exhibit the same capability for PCR incorporation of
dUMPs modified via a CH]CHeCH2eNHCOeCH2 linker at the C5
position of the pyrimidine ring with an aromatic hydrocarbon
substituent;
(ii) The efficiency of incorporation by the above mentioned poly-
merases increases with increasing hydrophilicity of the aromatic
hydrocarbon substituent.
Most recently, in 2019, Lapa et al. used dUTPs modified with ali-
phatic
or
aromatic
hydrocarbon
substituents
via
a
CH]CHeCH2eNHCOeCH2 linker containing a C]C bond and an
“inverted” peptide group (NHCO) [22]. It was demonstrated that the
PCR amplification of full-length products by polymerases of both A and
B families, Taq and Vent (exo-), using the above mentioned modified
dUTPs and either a bacterial DNA or a template containing a complete
set of random 40 nucleotide-long sequences, differs in efficiency by no
more than a factor of two. Apparently, as follows from the above dis-
cussion of previous works, the presence of a carbon-carbon double bond
and an “inverted” peptide group (NHCO) in the linker structure is
crucial for the effective amplification of the modified PCR product by
Taq polymerase.
Also, it is of practical significance that Taq polymerase can be used
for the effective PCR amplification of modified DNA strands containing
no more than three adjacent dUMPs modified at the C5 position of the
pyrimidine ring with residues of aromatic hydrocarbons having hy-
drophilicities comparable to or greater than that of anisole.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influ-
ence the work reported in this paper.
In the present study, as in [22], the CH]CHeCH2eNHCOeCH2
7

O.A. Zasedateleva, et al.
BioorganicChemistry99(2020)103829
Acknowledgements
[15] K. Bergen, A.L. Steck, S. Strütt, A. Baccaro, W. Welte, K. Diederichs, A. Marx,
Structures of KlenTaq DNA polymerase caught while incorporating C5-modified
pyrimidine and C7-modified 7-deazapurine nucleoside triphosphates, J. Am. Chem.
Soc. 134 (2012) 11840–11843, https://doi.org/10.1021/ja3017889.
[16] H.M. Kropp, S.L. Dürr, C. Peter, K. Diederichs, A. Marx, Snapshots of a modified
nucleotide moving through the confines of a DNA polymerase, Proc. Natl. Acad. Sci.
U.S.A. 115 (2018) 9992–9997, https://doi.org/10.1073/pnas.1811518115.
[17] O.A. Zasedateleva, V.A. Vasiliskov, S.A. Surzhikov, V.E. Kuznetsova, V.E. Shershov,
T.O. Guseinov, I.P. Smirnov, R.A. Yurasov, M.A. Spitsyn, A.V. Chudinov, dUTPs
conjugated with zwitterionic Cy3 or Cy5 fluorophore analogues are effective sub-
strates for DNA amplification and labelling by Taq polymerase, Nucl. Acids Res. 46
(2018) e73, https://doi.org/10.1093/nar/gky247.
We thank Dr. Mikhailovich V.M. (EIMB RAS) for providing useful
advice regarding the PCR conditions. We thank American Journal
Experts (Durham, NC, USA) for providing language editing services.
Funding
This study was supported by the Russian Science Foundation [grant
number 18-29-09151].
[18] A.V. Chudinov, Y.Y. Kiseleva, V.E. Kuznetsov, V.E. Shershov, M.A. Spitsyn,
T.O. Guseinov, S.A. Lapa, E.N. Timofeev, A.I. Archakov, A.V. Lisitsa, S.P. Radko,
A.S. Zasedatelev, Structural and functional analysis of biopolymers and their
complexes: Enzymatic synthesis of high-modified DNA, Mol. Biol. (Mosk) 51 (2017)
474–482, https://doi.org/10.1134/S0026893317030025.
Appendix A. Supplementary material
[19] M. Zuker, N. Markham, http://unafold.rna.albany.edu.
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.bioorg.2020.103829.
[20] O.A. Zasedateleva, A.L. Mikheikin, A.Y. Turygin, D.V. Prokopenko, A.V. Chudinov,
E.E. Belobritskaya, V.R. Chechetkin, A.S. Zasedatelev, Gel-based oligonucleotide
microarray approach to analyze protein–ssDNA binding specificity, Nucl. Acids Res.
36 (2008) e61, , https://doi.org/10.1093/nar/gkn246.
References
[21] V.A. Vasiliskov, S.A. Lapa, V.E. Kuznetsova, S.A. Surzhikov, V.E. Shershov,
M.A. Spitsyn, T.O. Guseinov, R.A. Miftahov, O.A. Zasedateleva, A.V. Lisitsa,
S.P. Radko, A.S. Zasedatelev, E.N. Timofeev, A.V. Chudinov, Novel 5-alkylcarbox-
amide-2'-deoxyuridine-5'-triphosphates for enzymatic synthesis of highly modified
DNA, Russ. J. Bioorg. Chem. 45 (2019) 221–223, https://doi.org/10.1134/
S1068162019030063.
[1] R.B. Ladju, D. Pascut, M.N. Massi, C. Tiribelli, C.H. Sukowati, Aptamer: A potential
oligonucleotide nanomedicine in the diagnosis and treatment of hepatocellular
carcinoma, Oncotarget 9 (2017) 2951–2961, https://doi.org/10.18632/oncotarget.
23359.
[2] G. Zhu, X. Chen, Aptamer-based targeted therapy, Adv. Drug. Deliv. Rev. 134
(2018) 65–78, https://doi.org/10.1016/j.addr.2018.08.005.
[22] S.A. Lapa, A.S. Pavlov, V.E. Kuznetsova, V.E. Shershov, M.A. Spitsyn,
T.O. Guseinov, S.P. Radko, A.S. Zasedatelev, A.V. Lisitsa, A.V. Chudinov, Enzymatic
preparation of modified DNA: study of the kinetics by real-time PCR, Mol. Biol.
(Mosk) 53 (2019) 460–469, https://doi.org/10.1134/S0026893319030099.
[23] https://pubchem.ncbi.nlm.nih.gov/.
[3] J.D. Vaught, C. Bock, J. Carter, T. Fitzwater, M. Otis, D. Schneider, J. Rolando,
S. Waugh, S.K. Wilcox, B.E. Eaton, Expanding the chemistry of DNA for in vitro
selection, J. Am. Chem. Soc. 132 (2010) 4141–4151, https://doi.org/10.1021/
ja908035g.
[24] A.S. Krylov, S.L. Grokhovsky, A.S. Zasedatelev, A.L. Zhuze, G.V. Gursky,
B.P. Gottikh, Quantitative estimation of the contribution of pyrrolcarboxamide
groups of the antibiotic distamycin A into specificity of its binding to DNA AT pairs,
Nucl. Acids Res. 6 (1979) 289–304, https://doi.org/10.1093/nar/6.1.289.
[25] G.V. Gursky, A.S. Zasedatelev, A.L. Zhuze, A.A. Khorlin, S.L. Grokhovsky,
S.A. Streltsov, A.N. Surovaya, S.M. Nikitin, A.S. Krylov, V.O. Retchinsky,
M.V. Mikhailov, R.S. Beabealashvili, B.P. Gottikh, Synthetic sequence-specific li-
gands, Cold Spring Harb. Symp. Quant. Biol. 47 (1983) 367–378, https://doi.org/
10.1101/sqb.1983.047.01.043.
[4] L. Gold, D. Ayers, J. Bertino, C. Bock, A. Bock, E.N. Brody, J. Carter, A.B. Dalby,
B.E. Eaton, T. Fitzwater, D. Flather, A. Forbes, T. Foreman, C. Fowler, B. Gawande,
M. Goss, M. Gunn, S. Gupta, D. Halladay, J. Heil, J. Heilig, B. Hicke, G. Husar,
N. Janjic, T. Jarvis, S. Jennings, E. Katilius, T.R. Keeney, N. Kim, T.H. Koch,
S. Kraemer, L. Kroiss, N. Le, D. Levine, W. Lindsey, B. Lollo, W. Mayfield, M. Mehan,
R. Mehler, S.K. Nelson, M. Nelson, D. Nieuwlandt, M. Nikrad, U. Ochsner,
R.M. Ostroff, M. Otis, T. Parker, S. Pietrasiewicz, D.I. Resnicow, J. Rohloff,
G. Sanders, S. Sattin, D. Schneider, B. Singer, M. Stanton, A. Sterkel, A. Stewart,
S. Stratford, J.D. Vaught, M. Vrkljan, J.J. Walker, M. Watrobka, S. Waugh, A. Weiss,
S.K. Wilcox, A. Wolfson, S.K. Wolk, C. Zhang, D. Zichi, Aptamer-based multiplexed
proteomic technology for biomarker discovery, PLoS One 5 (2010) e15004, https://
doi.org/10.1371/journal.pone.0015004.
[26] R.S. Richard, DNA Structure and Function. Elsevier Inc., 1994. https://doi.org/10.
1016/C2009-0-02451-9.
[27] A.L. Mikheikin, A.L. Zhuze, A.S. Zasedatelev, Molecular modelling of ligand-DNA
minor groove binding: role of ligand-water interactions, J. Biomol. Struct. Dyn. 19
(2001) 175–178, https://doi.org/10.1080/07391102.2001.10506729.
[28] J.M. Walsh, P.J. Beuning, Synthetic nucleotides as probes of DNA polymerase
specificity, J. Nucl. Acids 2012 (2012), https://doi.org/10.1155/2012/530963 ID
530963.
[5] L. Gold, J.J. Walker, S.K. Wilcox, S. Williams, Advances in human proteomics at
high scale with the SOMAscan proteomics platform, N. Biotechnol. 29 (2012)
543–549, https://doi.org/10.1016/j.nbt.2011.11.016.
[6] B.N. Gawande, J.C. Rohloff, J.D. Carter, I. von Carlowitz, C. Zhang, D.J. Schneider,
N. Janjic, Selection of DNA aptamers with two modified bases, Proc. Natl. Acad. Sci.
114 (2017) 2898–2903, https://doi.org/10.1073/pnas.1615475114.
[7] D.W. Drolet, L.S. Green, L. Gold, N. Janjic, Fit for the eye: aptamers in ocular dis-
orders, Nucl. Acid Ther. 26 (2016) 127–146, https://doi.org/10.1089/nat.2015.
0573.
[29] S. Akashi, R. Osawa, Y. Nishimura, Evaluation of protein-DNA binding affinity by
electrospray ionization mass spectrometry, J. Am. Soc. Mass Spectrom. 16 (2005)
116–125, https://doi.org/10.1016/j.jasms.2004.09.021.
[30] R. Joshi, J.M. Passner, R. Rohs, R. Jain, A. Sosinsky, M.A. Crickmore, V. Jacob,
A.K. Aggarwal, B. Honig, R.S. Mann, Functional specificity of a Hox protein
mediated by the recognition of minor groove structure, Cell 131 (2007) 530–543,
https://doi.org/10.1016/j.cell.2007.09.024.
[8] U.A. Ochsner, L.S. Green, L. Gold, N. Janjic, Systematic selection of modified ap-
tamer pairs for diagnostic sandwich assays, Biotechniques 56 (2014) 125–133,
https://doi.org/10.2144/000114134.
[31] O.A. Zasedateleva, V.A. Vasiliskov, S.A. Surzhikov, A.Y. Sazykin, L.V. Putlyaeva,
A.M. Schwarz, D.V. Kuprash, A.Y. Rubina, V.E. Barsky, A.S. Zasedatelev, UV
fluorescence of tryptophan residues effectively measures protein binding to nucleic
acid fragments immobilized in gel elements of microarrays, Biotechnol. J. 9 (2014)
1074–1080, https://doi.org/10.1002/biot.201300556.
[9] S. Jäger, G. Rasched, H. Kornreich-Leshem, M. Engeser, O. Thum, M. Famulok, A
versatile toolbox for variable DNA functionalization at high density, J. Am. Chem.
Soc. 127 (2005) 15071–15082, https://doi.org/10.1021/ja051725b.
[10] M. Kuwahara, J. Nagashima, M. Hasegawa, T. Tamura, R. Kitagata, K. Hanawa,
S. Hososhima, T. Kasamatsu, H. Ozaki, H. Sawai, Systematic characterization of 2’-
deoxynucleoside-5’-triphosphate analogs as substrates for DNA polymerases by
polymerase chain reaction and kinetic studies on enzymatic production of modified
DNA, Nucl. Acids Res. 34 (2006) 5383–5394, https://doi.org/10.1093/nar/gkl637.
[11] M. Famulok, G. Mayer, Aptamers and SELEX in chemistry & biology, Chem. Biol. 21
(2014) 1055–1058, https://doi.org/10.1016/j.chembiol.2014.08.003.
[12] M. Hollenstein, C.J. Leumann, Synthesis and biochemical characterization of tri-
cyclothymidine triphosphate (tc-TTP), ChemBioChem 15 (2014) 1901–1904,
https://doi.org/10.1002/cbic.201402116.
[32] A.W. Drake, D.G. Myszka, S.L. Klakamp, Characterizing high-affinity antigen/an-
tibody complexes by kinetic- and equilibrium-based methods, Anal. Biochem. 328
(2004) 35–43, https://doi.org/10.1016/j.ab.2003.12.025.
[33] A.R. Oliphant, C.J. Brandl, K. Struhl, Defining the sequence specificity of DNA-
binding proteins by selecting binding sites from random-sequence oligonucleotides:
analysis of yeast GCN4 protein, Mol. Cell Biol. 9 (1989) 2944–2949, https://doi.
org/10.1128/mcb.9.7.2944.
[34] A.D. Ellington, J.W. Szostak, In vitro selection of RNA molecules that bind specific
ligands, Nature 346 (1990) 818–822, https://doi.org/10.1038/346818a0.
[35] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: RNA
ligands to bacteriophage T4 DNA polymerase, Science 249 (1990) 505–510,
https://doi.org/10.1126/science.2200121.
[13] M. Hocek, Synthesis of base-modified 2′-deoxyribonucleoside triphosphates and
their use in enzymatic synthesis of modified DNA for applications in bioanalysis and
chemical biology, J. Org. Chem. 79 (2014) 9914–9921, https://doi.org/10.1021/
jo5020799.
[36] P.J. Rothwell, G. Waksman, Structure and mechanism of DNA polymerases, in:
J.M. Squire, D.A.D. Parry (Eds.), Advances in protein chemistry, 71 2005, pp.
401–440, , https://doi.org/10.1016/S0065-3233(04)71011-6.
[14] S. Obeid, A. Baccaro, W. Welte, K. Diederichs, A. Marx, Structural basis for the
synthesis of nucleobase modified DNA by Thermus aquaticus DNA polymerase,
Proc. Natl. Acad. Sci. U.S.A. 107 (2010) 21327–21331, https://doi.org/10.1073/
pnas.1013804107.
8