Epo-C12 inhibits peroxiredoxin 1 peroxidase activity

Article abstract of DOI:10.1016/j.bmc.2021.116203

Epo-C12 is a synthetic derivative of epolactaene, isolated from Penicillium sp. BM 1689-P. Epo-C12 induces apoptosis in human acute lymphoblastoid leukemia BALL-1 cells. In our previous studies, seven proteins that bind to Epo-C12 were identified by a combination of pull-down experiments using biotinylated Epo-C12 (Bio-Epo-C12) and mass spectrometry. In the present study, the effect of Epo-C12 on peroxiredoxin 1 (Prx 1), one of the proteins that binds to Epo-C12, was investigated. Epo-C12 inhibited Prx 1 peroxidase activity. However, it did not suppress its chaperone activity. Binding experiments between Bio-Epo-C12 and point-mutated Prx 1s suggest that Epo-C12 binds to Cys⁵² and Cys⁸³ in Prx 1. The present study revealed that Prx 1 is one of the target proteins through which Epo-C12 exerts an apoptotic effect in BALL-1 cells.

Full text of DOI:10.1016/j.bmc.2021.116203

Bioorg. Med. Chem. 41 (2021) 116203
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Epo-C12 inhibits peroxiredoxin 1 peroxidase activity
Tomoka Yodaa, Masateru Furutaa, Tomohiko Tsutsumia, Seiki Ikedaa, Shunsuke Yukizawaa,
,
,
,
,e
Satoshi Araia, Akinori Moritaa b, Kenji Yamatoyaa c, Kazuya Nakataa d, Shusuke Tomoshigea
,
Kenji Ohganea, Yuuki Furuyamaa, Kengo Sakaguchia, Fumio Sugawaraa, Susumu Kobayashif,
,
*
Masahiko Ikekitaa, Kouji Kuramochia
a Department of Applied Biological Science, Tokyo University of Science, 2641 Yamazaki, Noda, Chiba 278-8510, Japan
b Department of Biomedical Science and Technology, Graduate School of Biomedical Sciences, Tokushima University, 3-18-15 Kuramoto-cho, Tokushima 770-8503,
Japan
c Institute for Environmental and Gender-Specific Medicine, Juntendo University Graduate School of Medicine, 2-1-1 Tomioka, Urayasu-City, Chiba, 279-0021, Japan
d Graduate School of Bio-Applications and Systems Engineering, Tokyo University of Agriculture and Technology, 2-24-16 Nakacho, Koganei, Tokyo, 184-0012, Japan
e Graduate School of Life Sciences, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai 980-8577, Japan
f Department of Pharmacy, Faculty of Pharmaceutical Sciences, Tokyo University of Science, 2641 Yamazaki, Noda, Chiba 278-8510, Japan
A R T I C L E I N F O
A B S T R A C T
Keywords:
Epo-C12 is a synthetic derivative of epolactaene, isolated from Penicillium sp. BM 1689-P. Epo-C12 induces
apoptosis in human acute lymphoblastoid leukemia BALL-1 cells. In our previous studies, seven proteins that
bind to Epo-C12 were identified by a combination of pull-down experiments using biotinylated Epo-C12 (Bio-
Epo-C12) and mass spectrometry. In the present study, the effect of Epo-C12 on peroxiredoxin 1 (Prx 1), one of
the proteins that binds to Epo-C12, was investigated. Epo-C12 inhibited Prx 1 peroxidase activity. However, it
did not suppress its chaperone activity. Binding experiments between Bio-Epo-C12 and point-mutated Prx 1s
suggest that Epo-C12 binds to Cys52 and Cys83 in Prx 1. The present study revealed that Prx 1 is one of the target
proteins through which Epo-C12 exerts an apoptotic effect in BALL-1 cells.
Peroxiredoxin 1
Reactive oxygen species
Epolactaene
Peroxidase
Chaperone
1. Introduction
experiments using Bio-Epo-C12 and mass spectrometry. Epo-C12 has an
interesting reactivity with thiols. The reaction of Epo-C12 with 2.0 equiv
Epolactaene is a natural product, isolated from Penicillium sp. BM
1689-P (Fig. 1A).1 This compound induces neurite outgrowth and ar-
rests human neuroblastoma cells SH-SY5Y in the G1 phase of the cell
cycle.1,2 Nagumo and coworkers identified heat shock protein 60
(HSP60) as a ligand for epolactaene.3,4 They reported that epolactaene
of N-acetylcysteine methyl ester (1) gave disulfide 2, dodecanoic acid
(3), and adduct 4 (Scheme 1).9 Peroxiredoxin 1 (Prx 1), one of the
candidate binding proteins, has four cysteine residues (Cys52, Cys71
,
Cys83, and Cys173) that play crucial roles in its physiological activities.
Prx 1 functions as a peroxidase reducing H2O2 mediated by the oxidation
of the N-terminal peroxidatic Cys52 (CP-SH). The resulting cysteine
sulfenic acid (CP-SOH) subsequently forms an intermolecular disulfide
bond with the C-terminal resolving Cys173 (CR-SH) in the adjacent Prx 1
monomer to form a Prx 1 homodimer (Fig. 2A).10–13 The disulfide
linkage is reduced by NADPH-dependent thioredoxin (Trx)/thioredoxin
reductase (TrxR) cycles to complete the intracellular Prx 1 catalytic
cycle.13 Besides its peroxidase activity, Prx 1 can form high molecular
weight (HMW) species, with chaperone activity (Fig. 2B).14–18 The
redox status of Cys83 influences the oligomeric structures and the
chaperone function of Prx 1.15–17 Prx 1 is involved in the control of
various physiological functions such as cell growth, differentiation,
binds Cys442 in human Hsp60 at the
α,β-unsaturated ketone moiety
inhibiting its chaperone activity.4 Our group synthesized an artificial
epolactaene derivative Epo-C12, which has a saturated n-dodecanoyl
group at the side-chain (Fig. 1B).5 Our previous study revealed that Epo-
C12 induces apoptosis in human acute lymphoblastoid leukemia BALL-1
cells more potently than epolactaene.6,7Bio-Epo-C12, a biotinylated
Epo-C12 derivative, was prepared to explore proteins that can bind Epo-
C12 from BALL-1 cell lysate (Fig. 1C).8 Fatty acid synthase, ATP citrate
lyase, elongation factor 2, HSPs 90β and 60, adenine nucleotide trans-
locator 2, and peroxiredoxin 1 (Prx 1) were identified as candidate
binding proteins for Epo-C12 through a combination of pull-down
* Corresponding author.
E-mail address: kuramoch@rs.tus.ac.jp (K. Kuramochi).
https://doi.org/10.1016/j.bmc.2021.116203
Received 31 March 2021; Received in revised form 27 April 2021; Accepted 30 April 2021
Available online 10 May 2021
0968-0896/© 2021 Elsevier Ltd. All rights reserved.

T. Yoda et al.
Bioorganic & Medicinal Chemistry 41 (2021) 116203
apoptosis, and cellular homeostasis.19–23 Based on the above, we hy-
pothesized that Epo-C12 might target the cysteine residue(s) of Prx 1
and induce apoptosis in BALL-1 cells by inhibiting Prx 1 activity. Herein,
in order to test the hypothesis, we investigated the apoptotic activity of
Epo-C12, by focusing on Prx 1.
recombinant citrate synthase (CS) (Fig. 6).16,30,31 Oxidized Prx 1, pre-
pared by treating Prx 1 with H2O2, was used in this assay. CS aggrega-
tion causes an increase in absorbance at 450 nm (blue line). An increase
in absorbance was not observed when a mixture of CS and oxidized Prx 1
was heated (pink line). These results indicate that CS aggregation was
inhibited by oxidized Prx 1 due to its chaperone activity. The chaperone
activity of oxidized Prx 1 was retained in the presence of Epo-C12 (light
green line) or conoidin A (orange line).
2. Results and discussion
2.1. Epo-C12 effect on intracellular ROS generation in BALL-1 cells
2.4. Binding of Bio-Epo-C12 to Prx 1 and its mutants
Reactive oxygen species (ROS) play an important role in apoptosis
induction. To investigate whether ROS are involved in Epo-C12-induced
apoptosis, the intracellular ROS levels in BALL-1 cells were measured by
flow cytometry using the ROS-detecting fluorescent dye 2′,7′-dichlor-
odihydrofluorescein diacetate (DCFH-DA)24 after treatment with Epo-
To determine the cysteine(s) targeted by Epo-C12, we performed
binding experiments of Bio-Epo-C12 with Prx 1 and its mutants (Fig. 7).
Wild-type (WT) Prx 1, and three alanine-scanning Prx 1 mutants (C52A,
C173A, and C52A/C173A) were transiently expressed with a N-terminal
FLAG3-tag in HEK 293 T cells. Expression of the mutant proteins was
confirmed by Western blot with anti-FLAG tag (Fig. S1A in Supple-
mentary Material). They were then tested for the ability to bind Bio-Epo-
C12. Lysates were treated with Bio-Epo-C12 and further incubated with
streptavidin resin beads. Proteins were resolved by SDS-PAGE. Endog-
enous Prx 1 and Flag-tagged WT Prx 1, C52A, C153A, and C53A/C173A
mutants that were pulled using Bio-Epo-C12 were detected by Western
blot with anti-FLAG tag and anti-Prx 1 antibodies (Fig. 7A). Next, WT
Prx 1, and five Prx 1 mutants (C71A, C83A, C52A/C71A/C173A, C52A/
C83A/C173A, and C52A/C71A/C83A/C173A) were expressed and used
in Bio-Epo-C12 binding experiments (Fig. 7B). Expression of the mutant
proteins was confirmed by Western blot with anti-FLAG tag (Fig. S1B in
Supplementary Material). Binding between Bio-Epo-C12 and C71A,
C83A, and C52A/C71A/173A mutants was confirmed by Western blot.
However, binding of Bio-Epo-C12 with C52A/C83A/C173A and C52A/
C71A/C83A/C173A mutants was not validated. Results obtained
through binding experiments suggest that Cys83 in Prx 1 is important in
Bio-Epo-C12 binding. However, C83A mutant also binds Bio-Epo-C12.
Thus, Cys83 and one or more cysteine residues in Prx 1 are involved in
Bio-Epo-C12 and Prx 1 binding. Prx 1 peroxidase activity inhibition by
Epo-C12 suggests that Bio-Epo-C12 binds to Cys52, the peroxidatic
cysteine of Prx 1. Previously, Chock and coworkers reported that glu-
tathionylation of Cys83 alone is sufficient to induce Prx 1 decamer
dissociation inhibiting its chaperone activity.16 They also reported that
glutathionylation of WT Prx 1 and its C52S/C173S mutant, greatly re-
duces their molecular chaperone activity in protecting CS from ther-
mally induced aggregation. Yang and coworkers reported that triptolide,
a diterpenoid triepoxide isolated from Tripterygium wilfordii, binds to
Cys83 and Cys173 in Prx 1.32 They showed that triptolide selectively in-
hibits Prx 1 chaperone activity through a direct interaction with these
cysteines, thereby inducing Prx HMW oligomers dissociation. Thus, the
modification of both Cys83 and Cys173 in Prx 1 by glutathione or trip-
tolide causes a decrease in chaperone activity. Taken together, it can be
speculated that Epo-C12 does not inhibit Prx 1 chaperone activity
because it does not bind to Prx 1 Cys173. It is worth noting that triptolide
did not suppress Prx 1 peroxidase activity. The effects of Epo-C12 on Prx
1 as well as its target cysteines within Prx 1 are different from those of
triptolide.
C12 (1, 5, or 10
dependent manner. ROS levels after treatment with 10
were similar to 50 M H2O2 treated cells, which were used as a posi-
tive control. Epo-C12-induced apoptosis in BALL-1 cells was inhibited by
250 M dithiothreitol (DTT), 1.5 mM glutathione (GSH), and 250 M N-
μM) (Fig. 3). Epo-C12 induced ROS in a dose-
μM Epo-C12
μ
μ
μ
acetylcysteine (NAC) (Fig. 4). These results suggest that Epo-C12
induced apoptosis by increasing intracellular ROS levels in BALL-1
cells. DTT, GSH, and NAC should suppress Epo-C12-induced apoptosis
by reducing ROS production. Generally, glutathione is present in milli-
molar concentrations (0.5–10 mM) in the cell.25 Most of the cellular
glutathione exists in the reduced form (GSH, 95%) while less than 5% is
present as oxidized glutathione disulfide (GSSG).26 Under these intra-
cellular conditions, Epo-C12 induces apoptosis in BALL-1 cells and in-
creases intracellular ROS levels even at concentrations below 5 μM.
These results rule out the possibility that Epo-C12 directly reacts with
the reducing agents to lose apoptosis-inducing activity.
2.2. Effect of Epo-C12 on peroxidase activity of peroxiredoxin 1
We first examined inhibitory activity of Epo-C12 against the perox-
idase activity of recombinant Prx 1 (Fig. 5). Peroxidase activity was
measured by the ferrous oxidation-xylenol orange (FOX) assay27 by
using H2O2 as a substrate. Epo-C12 (50 μM) decreased the peroxidase
activity of Prx 1 to 56% compared to the vehicle control (DMSO).
Conoidin A28 (50
μM), an inhibitor of Prx peroxidase activity, decreased
the activity to 33%. Epo-C12 showed cytotoxicity with a 50% inhibitory
concentration (IC50) value of 4.41 ± 2.02
exhibited cytotoxicity against BALL-1 cells with an IC50 value of 1.05 ±
0.24 M. Although Epo-C12 and conoidin A showed cytotoxicity at
μM, whereas conoidin A
μ
lower concentrations than those for the inhibition of peroxidase activity
of Prx 1, these results suggest that Epo-C12 as well as conoidin A inac-
tivate the peroxidase activity of Prx 1 in BALL-1 cells, while inducing cell
death. This possibility is supported in a previous report by Corbett and
collaborators.29 They reported that Prx 1 plays a primary role in pro-
tecting pancreatic β-cells from H2O2 and peroxynitrite.
2.3. Epo-C12 effect on peroxiredoxin 1 chaperone activity
Next, the effect of Epo-C12 on Prx 1 chaperone activity was inves-
tigated by a light scattering assay of thermally induced aggregation of
Fig. 1. Structures of epolactaene (A), Epo-C12 (B), and Bio-Epo-C12 (C).
2

T. Yoda et al.
Bioorganic & Medicinal Chemistry 41 (2021) 116203
3. Conclusion
iodide (PI) were obtained from Sigma Aldrich (St Louis, MO, USA).
Fluorescein isothiocyanate-conjugated annexin V (Annexin V-FITC) and
propidium iodide (PI) were obtained from Sigma Aldrich (St Louis, MO,
USA). Conoidin A and NADPH (sodium salt) were purchased from
Cayman Chemical (Ann Arbor, MI, USA). 2′,7′-Dichlorodihydro-
fluorescein diacetate (DCFH-DA) was purchased from Funakoshi
(Tokyo, Japan). Recombinant human Prx 1 and CS, which were fused to
His20-tag and His23-tag at N-terminus, respectively, were obtained from
Prospec-Tany Technogene (Ness Ziona, Israel). EcoR I and Hind III en-
donucleases and Tris-buffered saline with Tween 20 (TBST) were pur-
chased from Takara Bio (Kyoto, Japan). Fetal bovine serum (FBS) was
purchased from Biowest (Loire Valley, French). HRP-anti-mouse IgG and
HRP-anti-rabbit IgG antibodies were purchased from Cell Signaling
Technology (Danvers, USA). KOD-Plus polymerase was obtained from
Toyobo (Osaka, Japan). PEROXsay assay kit was purchased from G-
Biosciences (St. Louis, MO, USA). Polyvinylidene difluoride (PVDF)
membrane was obtained from Merck Millipore (Darmstadt, Germany).
The vector plasmid, pUSEamp(+), was purchased from Upstate
Biotechnology (Lake Placid, NY, USA). FuGENE 6 transfection reagent
was purchased from (Madison, WI, USA). Streptavidin Sepharose beads
and ECL Plus Western blotting detection reagents were obtained from
GE Healthcare (London, UL). Skim milk was purchased from Yukijirushi
(Tokyo, Japan).
Epo-C12 is a synthetic derivative of epolactaene, which induces
apoptosis in BALL-1 cells. The present study revealed that Epo-C12-
induced ROS production in BALL-1 cells. Epo-C12 induced apoptosis
in BALL-1 cells was suppressed by reducing reagents such as DTT and
NAC. Epo-C12 inhibited the peroxidase activity of Prx 1. Thus, we hy-
pothesized that Epo-C12 induced apoptosis could be due to an increase
in intracellular ROS concentration of BALL-1 cells. Our study demon-
strated that Epo-C12 induced ROS-mediated apoptosis by inhibiting
peroxiredoxin 1 peroxidase activity in BALL-1 cells. However, Epo-C12
induced apoptosis in BALL-1 cells at lower concentrations than those for
the inhibition of peroxidase activity of Prx 1, suggesting the possibility
that other target proteins of Epo-C12 exist. Further target validation of
Epo-C12 is necessary to understand the detail mechanism for the
apoptosis-inducing activity.
The binding experiments of Bio-Epo-C12 with the point-mutated Prx
1s suggest that Epo-C12 binds to Cys52 and Cys83 residues of Prx 1. The
inhibition of Prx 1 peroxidase activity can be explained by Epo-C12
binding Cys52. Epo-C12 did not inhibit Prx 1 chaperone activity, sug-
gesting that it does not bind to Cys173 in Prx 1.
Our present study proposes a molecular mechanism underlying the
effects of Epo-C12 on Prx 1. This study also provides a chemical tool for
the selective inhibition of the peroxidase activity of Prx 1 without
affecting its chaperone activity.
4.2. Cell lines and culturing conditions
4. Experimental methods
BALL-1 cells were purchased from Cell Resource Center for
Biomedical Research/Cell Bank (Tohoku University, Japan). BALL-1
cells were cultured at 37 ◦C with 5% CO2 in RPMI 1640 medium sup-
plemented with 10% FBS.
4.1. Materials
Epo-C12 and Bio-Epo-C12, used in the present study, were prepared
in our previous studies.5,8 Roswell Park Memorial Institute (RPMI) was
purchased from Nissui (Tokyo, Japan) or FUJIFILM Wako Pure Chemical
Corporation (Tokyo, Japan). N-Acetylcysteine (NAC), crystal violet,
glycerol, Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12
Ham (DMEM/F-12), glutathione (GSH), HEPES buffer, sodium hydrox-
ide, and 0.25% trypsin-ethylenediaminetetraacetic acid (EDTA) were
obtained by FUJIFILM Wako Pure Chemical Corporation (Tokyo,
Japan). Calcium chloride, Cell Counting Reagent SF, dimethyl sulfoxide
(DMSO), EDTA, ethylene glycol tetraacetic acid (EGTA), hydrogen
peroxide, magnesium chloride, 2-mercaptoethanol, phosphate buffered
saline (PBS), proteinase inhibitor cocktail, sodium dodecyl sulfate (SDS),
Tris(hydroxymethyl)aminomethane (Tris), Triton X-100, potassium
phosphate, sodium phosphate, and dithiothreitol (DTT) were purchased
from Nacalai Tesque (Kyoto, Japan). TRIzol reagent, MMLV reverse
transcriptase, ribonuclease inhibitor, and oligo(dT)18 were purchased
from Invitrogen (Carlsbad, CA, USA). Anti-FLAG antibody, fluorescein
isothiocyanate-conjugated annexin V (Annexin V-FITC) and propidium
4.3. Measurement of intracellular ROS generation in BALL-1 cells (Fig. 3)
BALL-1 cells (2 × 105 cells) were incubated with 10
μ
M DCFH-DA24
for 10 min. Cells were further incubated with the vehicle control
(DMSO), Epo-C12 (1, 5, or 10 μM), or H2O2 (50 μM) for 30 min. Cell
pellets were collected by centrifugation and resuspended in PBS. Sub-
sequently, cells were analyzed by a flow cytometer (FACS Calibur,
Becton Dickinson). Fluorescence was measured at 530 nm upon exci-
tation at 488 nm.
4.4. Effect of DTT, GSH, and NAC on Epo-C12 induced apoptosis in
BALL-1 cells (Fig. 4)
Percentage of apoptosis was determined by Annexin V-FITC and PI
double staining using a MEBCYTO Apoptosis kit (MBL, Nagoya, Japan).
BALL-1 cells (2 × 105 cells) were incubated with DMSO or the indicated
antioxidants (250 μM DTT, 1.5 mM GSH, or 250 μM NAC) in 12-well
Scheme 1. Reaction of Epo-C12 with N-acetylcysteine methyl ester (1).
3

T. Yoda et al.
Bioorganic & Medicinal Chemistry 41 (2021) 116203
plates at 37 ◦C for 1.5 h. Then, the cells were treated with or without
Epo-C12 (5 μM) for 24 h. Cells were collected and washed with ice-cold
PBS twice. The pellet was resuspended in 200
buffer (10 mM HEPES–NaOH, 140 mM NaCl, 2.5 mM CaCl2, pH 7.4)
containing 5 L of Annexin V-FITC. After incubation for 10 min, cells
were collected and washed with Annexin V binding buffer. The pellet
was then resuspended in 360 L Annexin V binding buffer containing 2
μL Annexin V binding
μ
μ
μ
g/mL PI. The cells were analyzed by flow cytometry (Coulter EPICS XL;
Beckman Coulter, Miami, FL, USA).
4.5. Epo-C12 and conoidin a cytotoxic activity in BALL-1 cells
Cell growth was evaluated using a cell counting kit (Cell Counting
Reagent SF) according to the manufacturer’s instructions based on the
WST-8 assay.33 For the assay, the cells were cultured in a 96-well plate,
Fig. 3. Effect of Epo-C12 on intracellular ROS production in BALL-1 cells.
with each well containing 10,000 cells in a total volume of 100 μL. The
BALL-1 cells were incubated with DCFH-DA for 10 min. The cells were then
concentration of DMSO in the cell cultures was 0.1% (v/v). As a negative
control, blank wells (0 cells/100 L) and non-treated wells (10,000
cells/100 L) were also incubated. The plates were incubated with
various concentrations of each compound for 24 h. At the end of the
incubated with vehicle control (DMSO), Epo-C12 (1, 5, or 10 μM), or H2O2 (50
μ
M) for 30 min. After the cells were washed with PBS, the fluorescence derived
μ
from the intracellular 2′,7′-dichlorofluorescein (DCF) was measured by flow
cytometry. The relative fluorescence intensity normalized to the control is
shown as the mean of two independent measurements. The error bars represent
the range from the measurements.
μ
incubation time, 10 μL of the WST-8 solution provided with the kit were
added, and the resulting mixture was further incubated for 2 h at 37 ◦C.
Absorbance values were measured at 450 nm with a 96-well plate
reader. Cell growth inhibition was evaluated as the ratio of the absor-
bance of the sample to that of the control.
oxidized Prx 1 to inhibit the thermal aggregation of recombinant
CS.16,30,31 Recombinant Prx 1 (16
μM) was preincubated with H2O2
(100 mM) in 40 mM potassium phosphate buffer (pH 7.0). CS (1 μM) in a
buffer containing 50 mM HEPS-KOH (pH 7.0) was mixed with oxidized
Prx 1 (4 M). The mixture was incubated with DMSO, Epo-C12 (25 M)
or conoidin A (25
4.6. Evaluation of Prx 1 peroxidase activity (Fig. 5)
μ
μ
μ
M). The mixture was incubated at room temperature
Reduction of H2O2 by recombinant Prx 1 was measured using the
PEROXsay assay kit, which monitors the oxidation of ferrous (Fe2+) ions
to ferric (Fe3+) ions by H2O2.27 Reactions were performed at 25 ◦C in 50
mM sodium phosphate buffer (pH 7.4) containing 0.2 mM DTT. Re-
for 20 min. Then, the cuvette was placed into a thermocontrolled holder
at 45 ◦C. The increase in the absorbance at 450 nm was monitored.
combinant Prx 1 (2
μ
M) was preincubated with DMSO, Epo-C12 (50
4.8. Plasmid construction
μ
M), or conoidin A (50
μ
M) in PBS for 30 min, then incubated with H2O2
(40
μM) for 20 min. The enzymatic reaction was quenched by the
The isolation of total RNA from BALL-1 cells was performed using the
TRIzol reagent method,34 by following the manufacturer’s protocol.
RNAs were converted to cDNAs using MMLV reverse transcriptase,
ribonuclease inhibitor, and oligo(dT)18. PRDX1 was then amplified by
polymerase chain reaction (PCR) using KOD-Plus polymerase.35 The
primer sequences were as follows: forward, 5′- GCA-
TAAGCTTTCTTCAGGAAATGCTAAAATTGGGCACCCT-3′, reverse, 5′-
ATGCGAATTCTCACTTCTGCTTGGAGAAATATTCTTTGCT-3′. After heat
denaturation for 2 min at 94 ◦C, each PCR amplification for 30 cycles
was performed as follows: 15 sec at 94 ◦C and 40 sec at 68 ◦C except that,
addition of the assay solution (D-sorbitol, xylenol orange, ferric ammo-
nium sulfate, and sulfuric acid), and incubated for 30 min. Absorbance
was measured at 560 nm on a micro plate reader. One activity unit was
defined as the amount of enzyme required to reduce 1
min.
μmol of H2O2 per
4.7. Epo-C12 effect on recombinant Prx 1 chaperone activity (Fig. 6.)
Chaperone activity was determined by assessing the ability of
Fig. 2. Oligomerization of Prx 1. (A) Formation of a
head-to-tail homodimer. Prx 1 shows peroxidase ac-
tivity that removes intracellular H2O2 through the
catalytic cycle in collaboration with the thioredoxin-
thioredoxin reductase-NADPH (Trx-TrxR-NADPH)
system. CP, peroxidatic Cys52; CR, resolving Cys172. (B)
Formation of high molecular weight (HMW) species.
Five homodimers of Prx 1 form decamers, which can
then further aggregate to form HMW species. Hyper-
oxidation induces oligomerization from low molecular
weight (LMW) to HMW species. LMW species display
the peroxidase activity, whereas HMW species display
chaperone activity.
4

T. Yoda et al.
Bioorganic & Medicinal Chemistry 41 (2021) 116203
Fig. 6. Effect of Epo-C12 on the chaperone activity of Prx 1. Light scattering
assay of thermally induced aggregation of 1 μ C
M citrate synthase (CS) at 45 ◦
was performed. The increase in the absorbance at 450 nm was observed as CS
thermally aggregated (blue line). A significant increase in the absorbance was
not observed when a solution of CS and oxidized Prx 1 (4 µM) was heated (pink
line). This chaperone activity of the oxidized Prx 1 was retained in the presence
of 25 µM Epo-C12 (light green) or 25 µM conoidin A (orange).
Fig. 4. Effect of DTT, GSH, and NAC on Epo-C12 induced-apoptosis in BALL-1
cells. BALL-1 cells were pretreated with DMSO or the indicated antioxidants
(250 μM DTT, 1.5 mM GSH, or 250 μM NAC) for 1.5 h. The cells were treated
transformed into competent Escherichia coli TOP10 and purified with the
HiSpeed Plasmid Midi Kit (Qiagen, Hilden, Germany). The sequence of
the construct was verified by DNA sequencing.
with or without Epo-C12 (5 μM) for 24 h. Apoptotic cells were detected by flow
cytometry after staining with annexin V and propidium iodide (PI). Percentages
of late apoptotic cells (annexin V positive, PI positive) are indicated. The ex-
periments were performed in octuplicate. The values represent means ± stan-
dard deviation (SD). Statistical significance was assessed by Tukey honestly
significant difference (HSD) test, and the asterisks *** indicate p < 0.001.
4.9. Construction of cysteine-to-alanine mutations
Four mutant PRDX1 genes, each encoding an alanine residue substituting
a cysteine (residues 52, 71, 83 and 173) in PRDX1 were constructed by PCR-
mediated site-directed mutagenesis.36 The plasmid containing PRDX1 was
used as a template for sequential rounds of polymerase chain reaction (PCR).
For the first round of amplification, the forward and reverse primers for
PRDX1 (5′- GCATAAGCTTTCTTCAGGAAATGCTAAAATTGGGCACCCT-3′,
and 5′- ATGCGAATTCTCACTTCTGCTTGGAGAAATATTCTTTGCT-3′) were
used together with mutagenic primers converting the cysteine codon (TGT or
TGC) to an alanine codon (GCT or GCC; underlined below).
C52A forward primer: 5′-CCTCTTGACTTCACCTTTGTGGCCCCCACGGA-
GATCATT-3′
C52A reverse primer: 5′- AATGATCTCCGTGGGGGCCACAAAGGT
GAAGTCAAGAGG-3′
C71A forward primer: 5′-GAATTTAAGAAACTCAACGCCCAAGTGA
TTGGTGCTTCT-3′
C71A reverse primer: 5′-AGAAGCACCAATCACTTGGGCGTTGAGTT
TCTTAAATTC- 3′
C83A forward primer: 5′-TCTGTGGATTCTCACTTCGCCCATCTAG-
CATGGGTCAAT-3′
C83A reverse primer: 5′-ATTGACCCATGCTAGATGGGCGAAGTGA-
GAATCCACAGA-3′
Fig. 5. Inhibition of the peroxidase activity of Prx 1 by Epo-C12 and conoidin
A. Prx 1 (2
(50
μM) was preincubated with DMSO, Epo-C12 (50 μM) or conoidin A
C173A forward primer: 5′-ACTGACAAACATGGGGAAGTGGCCC
CAGCTGGCTGGAAA-3′
μ
M) for 30 min, then incubated with H2O2 (40 μM) for 20 min. An assay
solution (D-sorbitol, xylenol orange, ferric ammonium sulfate, and sulfuric acid)
was added to the media, and the resultant mixture was incubated for 30 min.
Absorbance was measured at 560 nm on a micro plate reader. One activity unit
C173A reverse primer: 5′-TTTCCAGCCAGCTGGGGCCACTTCCC-
CATGTTTGTCAGT-3′
was defined as the amount of enzyme required to reduce 1 μmol of H2O2 per
min. The experiments were performed in triplicate. The values represent means
± SD. Statistical significance was assessed by Tukey HSD test, and the asterisks
* and ** indicates p < 0.05 and 0.01, respectively, compared with the vehicle
(DMSO) control.
After heat denaturation for 2 min at 94 ◦C, each PCR amplification
◦
for 30 cycles was performed as follows: 15 sec at 94 C and 40 sec at
68 ◦C except that, in the last cycle, extension was carried out for 3 min,
in a thermal cycler (PCR Thermal Cycler Dice, Takara, Shiga, Japan).
Overlapping PCR products were purified by agarose gel electrophoresis,
phenol–chloroform extraction and 70% ethanol precipitation. Amplified
DNAs were digested with EcoR I and Hind III restriction enzymes and
concentrated by ethanol precipitation. Purified DNA was then ligated
into pUSEamp containing a 3 × FLAG tag and digested with the same
enzymes. The constructs were transformed into competent Escherichia
coli TOP10 and purified using the HiSpeed Plasmid Midi Kit from Qia-
gen. The sequence of all constructs was verified by DNA sequencing.
in the last cycle, extension was carried out for 3 min, in a thermal cycler
(PCR Thermal Cycler Dice, Takara, Shiga, Japan). PCR products were
purified by agarose gel electrophoresis, phenol–chloroform extraction,
and 70% ethanol precipitation. Purified DNAs were digested with EcoR I
and Hind III restriction enzymes and concentrated by ethanol precipi-
tation. Concentrated DNA was then ligated into pUSEamp containing a
3 × FLAG tag, digested with the same enzymes. The construct was
5

T. Yoda et al.
Bioorganic & Medicinal Chemistry 41 (2021) 116203
Fig. 7. Binding experiments of Bio-EpoC12 with point-mutated Prx 1s. HEK 293 T cells were transfected with the indicated expression vector. Cells were lysed after
24 h and treated with 1 M Bio-Epo-C12 for 20 h; to precipitate the Bio-Epo-C12 complexes, samples were further incubated with streptavidin resin for 2 h. The
proteins were resolved by SDS-PAGE. Endogenous and exogenous Prx 1s was detected by Western blot with anti-FLAG tag and anti-Prx 1 antibodies.
μ
Double mutant (C52A/173A) was constructed by introducing the
C173A mutant to the C52A singlet. Briefly, this mutant was constructed
by employing the similar mutagenesis procedure using the following
forward and reverse mutagenic primers.
Similarly, C52A/C71A/C173A and C52A/C83A/C173A triple mu-
tants were constructed by introducing C71A and C83A to the C52A/
C173 doublet, respectively. C52A/C71A/C83A/C173A quadruple
mutant was constructed by introducing C71A to the C52A/C83A/C173
triplet.
C52A/C173A
forward
primer:
5′-ACTGACAAA-
CATGGGGAAGTGGCCCCAGCTGGCTGGAAA-3′
4.10. Transfection
C52A/C173A reverse primer: 5′- AATGATCTCCGTGGGGGCCA-
CAAAGGTGAAGTCAAGAGG-3′
HEK 293 T cells were cultured in DMEM/F-12 at 37 ◦C, 5% CO2, in
humid atmosphere. The cells were transfected in 6-well plates using
6

T. Yoda et al.
Bioorganic & Medicinal Chemistry 41 (2021) 116203
FuGENE 637 according to the manufacturer’s protocol. After incubation
at 37 ◦C for 24 h, the cells were washed with PBS. The cells were
dissociated as clumps, and a part of the solution containing cell clumps
was dissociated into single cells with 0.25% trypsin-EDTA. The cells
were collected by centrifugation and washed with PBS twice.
8 Kuramochi K, Yukizawa S, Ikeda S, et al. Syntheses and applications of fluorescent
and biotinylated epolactaene derivatives: Epolactaene and its derivative induce
disulfide formation. Bioorg. Med. Chem. 2008;16:5039–5049.
9 Kuramochi K, Sunoki T, Tsubaki K, et al. Transformation of thiols to disulfides by
epolactaene and its derivatives. Bioorg. Med. Chem. 2011;19:4162–4172.
10 Rhee SG, Woo HA, Kil IS, Bae SH. Peroxiredoxin functions as a peroxidase and a
regulator and sensor of local peroxides. J. Biol. Chem. 2012;287:4403–4410.
11 Hall A, Nelson K, Poole LB, Karplus A. Structure-based insights into the catalytic
power and conformational dexterity of peroxiredoxins. Antioxid. Redox Signal. 2011;
15:795–815.
4.11. Bio-Epo-C12 binding of point-mutated Prx 1s (Fig. 7)
12 Wood ZA, Poole LB, Hantgan RR, Karplus PA. Dimers to doughnuts: redox-sensitive
oligomerization of 2-cysteine peroxiredoxins. Biochemistry. 2002;41:5493–5504.
13 Sun CC, Dong WR, Shao T, et al. Peroxiredoxin 1 (Prx1) is a dual-function enzyme by
possessing Cys-independent catalase-like activity. Biochem. J. 2017;474:1373–1394.
Transfected HEK 293 T cells were washed three times with cold PBS
and then treated with lysis buffer (50 mM HEPES, 150 mM NaCl, 10%
glycerol, 1% Triton X-100, 1.5 mM MgCl2, 1 mM EGTA, pH 7.5). Lysed
cells were centrifuged at 20,800g for 5 min at 4 ◦C, and the supernatant
was collected as the cell lysate. The protein concentration of the lysate
was adjusted at 1 mg/mL after determination by bicinchoninic acid
(BCA) protein assay.38 The lysate (1 mL) was incubated with Bio-Epo-
´
14 Barranco-Medina S, Lazaro JJ, Dietz KJ. The oligomeric conformation of
peroxiredoxins links redox state to function. FEBS Lett. 2009;583:1809–1816.
15 Lee W, Choi KS, Riddell J, et al. Human peroxiredoxin 1 and 2 are not duplicate
proteins: the unique presence of CYS83 in Prx1 underscores the structural and
functional differences between Prx1 and Prx2. J. Biol. Chem. 2007;282:
22011–22022.
C12 (1 μ μL) were
M) at 4 ◦C for 20 h. Streptavidin agarose beads (100
16 Park JW, Piszczek G, Rhee SG, Chock PB. Glutathionylation of peroxiredoxin I
induces decamer to dimers dissociation with concomitant loss of chaperone activity.
Biochemistry. 2011;50:3204–3210.
added to the lysate, and incubated at 4 ◦C for 2 h. After the beads were
washed with lysis buffer three times, the proteins were eluted by the
17 Matsumura T, Okamoto K, Iwahara S, et al. Dimer-oligomer interconversion of wild-
type and mutant rat 2-Cys peroxiredoxin: disulfide formation at dimer-dimer
interfaces is not essential for decamerization. J. Biol. Chem. 2008;283:284–293.
18 Morais MAB, Giuseppe PO, Souza TACB, et al. How pH modulates the dimer-decamer
interconversion of 2-Cys peroxiredoxins from the Prx1 subfamily. J. Biol. Chem.
2015;290:8582–8590.
addition of 50 μL of sample buffer (62.5 mM Tris–HCl, 1% SDS, 5%
glycerol, 3% 2-mercaptoethanol, 0.05% crystal violet), followed by
boiling the samples at 90 ◦C. The beads were separated by centrifuging
at 20,800g for 10 min at 4 ◦C, and the supernatants were collected as the
eluted samples. Eluates were analyzed by SDS–PAGE and blotted onto
PDVF membranes. The membranes were blocked for 0.5 h at 4 ◦C with
5% skim milk/TBST. Proteins were detected by incubating the mem-
branes with the primary antibody at 4 ◦C overnight (anti-FLAG 1:10000
and anti-Prx 1 1:1000) followed by incubation with HRP-conjugated
secondary antibodies (anti-mouse IgG 1:2000 and anti-rabbit IgG
1:2000) at room temperature for 1 h. Chemiluminescence detection was
performed using ECL Plus Western blotting detection reagents. Chemi-
luminescent signals were captured on X-ray film (Hyperfilm Amersham,
Piscataway, NJ, USA).
19 Nicolussi A, D’inzeo S, Capalbo C, Giannini G, Coppa A. The role of peroxiredoxins in
cancer. Mol. Clin. Oncol. 2017;6:139–153.
20 Kim SY, Kim TJ, Lee KY. A novel function of peroxiredoxin 1 (Prx-1) in apoptosis
signal-regulating kinase 1 (ASK1)-mediated signaling pathway. FEBS Lett. 2008;582:
1913–1918.
21 Ishii T, Warabi E, Yanagawa T. Novel roles of peroxiredoxins in inflammation, cancer
and innate immunity. J Clin Biochem Nutr. 2012;50:91–105.
22 Neumann CA, Cao J, Manevich Y. Peroxiredoxin 1 and its role in cell signaling. Cell
Cycle. 2009;8:4072–4078.
23 Ding C, Fan X, Wu G. Peroxiredoxin 1 – an antioxidant enzyme in cancer. J. Cell. Mol.
Med. 2017;21:193–202.
24 Hempel SL, Buettner GR, O’Malley YQ, Wessels DA, Flaherty DM. Dihydrofluorescein
diacetate is superior for detecting intracellular oxidants: comparison with 2’,7’-
dichlorodihydrofluorescein diacetate, 5(and 6)-carboxy-2’,7’-
dichlorodihydrofluorescein diacetate, and dihydrorhodamine 123. Free Rad. Biol.
Med. 1999;27:146–159.
Declaration of Competing Interest
25 Montero D, Tachibana C, Winther JR, Appenzeller-Herzog C. Intracellular
glutathione pools are heterogeneously concentrated. Redox Biol. 2013;1:508–513.
26 Shankar K, Mehendale HM. Oxidative stress. In: Encyclopedia of Toxicology, third
ed. Elsevier: Amsterdam, The Netherlands; 2014; p 735–37.
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
27 Nelson KJ, Parsonage D. Measurement of peroxiredoxin activity. Curr. Protoc.
Toxicol. 2011;49(7), 10.1-7.10.28.
28 Haraldsen JD, Liu G, Botting CH, et al. Identification of conoidin A as a covalent
inhibitor of peroxiredoxin II. Org. Biomol. Chem. 2009;7:3040–3048.
29 Stancill JS, Happ JT, Broniowska KA, Hogg N, Corbett JA. Peroxiredoxin 1 plays a
primary role in protecting pancreatic β-cells from hydrogen peroxide and
peroxynitrite. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2020;318:R1004–R1013.
30 Muthuramalingam M, Seidel T, Laxa M, et al. Multiple redox and non-redox
interactions define 2-Cys peroxiredoxin as a regulatory hub in the chloroplast. Mol.
Plant. 2009;2:1273–1288.
Appendix A. Supplementary material
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.bmc.2021.116203.
References
31 Kamariah N, Eisenhaber B, Eisenhaber F, Grüber G. Molecular mechanism of the
Escherichia coli AhpC in the function of a chaperone under heat-shock conditions. Sci.
Rep. 2018;8:14151.
1 Kakeya H, Takahashi I, Okada G, Isono K, Osada H. Epolactaene, a novel
neuritogenic compound in human neuroblastoma cells, produced by a marine
fungus. J. Antibiot. 1995;48:733–735.
32 Zhao Q, Ding Y, Deng Z, et al. Natural products triptolide, celastrol, and withaferin A
inhibit the chaperone activity of peroxiredoxin I. Chem. Sci. 2015;6:4124–4130.
33 Ishiyama M, Miyazono Y, Sasamoto K, Ohkura Y, Ueno K. A highly water-soluble
disulfonated tetrazolium salt as a chromogenic indicator for NADH as well as cell
viability. Talanta. 1997;44:1299–1305.
2 Kakeya H, Onozawa C, Sato M, Arai K, Osada H. Neuritogenic effect of epolactaene
derivatives on human neuroblastoma cells which lack high-affinity nerve growth
factor receptors. J. Med. Chem. 1997;40:391–394.
3 Nagumo Y, Kakeya H, Yamaguchi J, et al. Structure-activity relationships of
epolactaene derivatives: structural requirements for inhibition of Hsp60 chaperone
activity. Bioorg. Med. Chem. Lett. 2004;14:4425–4429.
34 Simms D, Cizdziel PE, Chomczynski P. TRIzolTM: a new reagent for optimal single-
step isolation of RNA. FOCUS. 1993;15:99–102.
35 Takagi M, Nishioka M, Kakihara H, et al. Characterization of DNA polymerase from
Pyrococcus sp. strain KOD1 and its application to PCR. Appl Environ Microbiol. 1997;
63:4504–4510.
4 Nagumo Y, Kakeya H, Shoji M, Hayashi Y, Dohmae M, Osada H. Epolactaene binds
human Hsp60 Cys442 resulting in the inhibition of chaperone activity. Biochem. J.
2005;387:835–840.
36 Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed mutagenesis by
overlap extension using the polymerase chain reaction. Gene. 1989;77:51–59.
37 Jacobsen LB, Calvin SA, Colvin KE, Wright M. FuGENE 6 Transfection Reagent: the
gentle power. Methods. 2004;33:104–112.
5 Kuramochi K, Nagata S, Itaya H, et al. A convergent total synthesis of epolactaene: an
application of the bridgehead oxiranyl anion strategy. Tetrahedron. 2003;59:
9743–9758.
6 Nakai J, Kawada K, Nagata S, et al. A novel lipid compound, epolactaene, induces
apoptosis: its action is modulated by its side chain structure. Biochim. Biophys. Acta.
2002;1581:1–10.
38 Smith PK, Krohn RI, Hermanson GT, et al. Measurement of protein using
bicinchoninic acid. Anal. Biochem. 1985;150:76–85.
7 Kuramochi K, Matsui R, Matsubara Y, et al. Apoptosis-inducing effect of epolactaene
derivatives on BALL-1 cells. Bioorg. Med. Chem. 2006;14:2151–2161.
7