Amino functionalized novel cholic acid derivatives induce HIV-1 replication and syncytia formation in T cells

Article abstract of DOI:10.1021/jm051114u

Synthesis of C-11 azido/amino functionalized cholic acid derivatives has been achieved in excellent yields. Contrary to the previous prediction of analogous compounds to be HIV-1 protease inhibitors, in the present study these novel cholic acid derivatives induced host cell fusion during the progress of HIV-1 infection and produced multinucleated giant cells. This is the first report of syncytia induction and enhancement of viral replication in HIV-1 infected T cells by cholic acid derivatives.

Full text of DOI:10.1021/jm051114u

2652
J. Med. Chem. 2006, 49, 2652-2655
Brief Articles
Amino Functionalized Novel Cholic Acid Derivatives Induce HIV-1 Replication and Syncytia
Formation in T Cells
Deepak B. Salunke,†,§ Dyavar S. Ravi,‡,§ Vandana S. Pore,*,† Debashis Mitra,*,‡ and Braja G. Hazra*,†
Organic Chemistry Synthesis DiVision, National Chemical Laboratory, Pune 411 008, India, and National Centre for Cell Science,
Ganeshkhind, Pune 411 007, India
ReceiVed NoVember 4, 2005
Synthesis of C-11 azido/amino functionalized cholic acid derivatives has been achieved in excellent yields.
Contrary to the previous prediction of analogous compounds to be HIV-1 protease inhibitors, in the present
study these novel cholic acid derivatives induced host cell fusion during the progress of HIV-1 infection
and produced multinucleated giant cells. This is the first report of syncytia induction and enhancement of
viral replication in HIV-1 infected T cells by cholic acid derivatives.
Introduction
A C2-homodimer containing two aspartate residues in the
catalytic site has been reported to have therapeutic potential as
a specific inhibitor of HIV-1 protease, and numerous examples
of potent inhibitors of HIV-1 protease have been disclosed.1,2
The most active inhibitors of HIV-1 protease that are competitive
by nature contain3 the partial structure 1 or the related carbonyl
equivalent 2 (Figure 1). Other important structural features
include the incorporation of lipophilic residues and bulky
hydrophobic groups or solubility-increasing substituent at the
appropriate positions.4,5 On the basis of these important features,
Marples and co-workers6 have designed novel C-11 amino
functionalized steroidal inhibitors, namely, 11-amino-12-(oxo/
hydroxy)steroids 3 and 4 based on estra-1,3,5(10)-triens and
bile acids with the intention to mimic the transition state of
HIV-1 protease catalysis. Attempted synthesis6 of these targeted
11-amino-12-oxygenated compounds starting from d-(+)-estrone
and deoxycholic acid failed because of the decomposition of
precursor 11R-azido ketones to the steroidal enamine.7,8 Thus,
Marples et al. did not realize the synthesis of 11-amino-12-
Figure 1. Amino functionalized bile acid derivatives.
C-18 and C-19 angular methyl groups. Introduction of the C-11
R-hydroxyl functionality via microbial hydroxylation by the
Syntex group12 and via long-range chemical functionalization
by Breslow is well documented.13
oxosteroids with a specific stereogenic center at C-11. However,
this group synthesized A/B ring cis steroidal enamine 5a,
N-benzyloxycarbonyl (N-Cbz) 5b, N-pivaloyl 5c, and N-
ethoxycarbonyl 5d derivatives (Figure 1). These compounds
were predicted to be HIV-1 protease inhibitors based on their
modest activity against HIV in cell culture.
Steroids with C-11 functionality are well-known for biological
activity and are obtained in a number of naturally occurring
molecules such as cortisone, hydrocortisone, and corticoster-
one.9,10 Potent synthetic corticosteroids such as dexamethasone,
triamcinolone, and fluticasone also possess C-11 hydroxy
functionality.11 Stereoselective C-11 functionalization in the
steroids is one of the challenging targets for synthetic organic
chemists because it involves severe steric interactions due to
Human immunodeficiency virus type 1 (HIV-1) induces host
cell fusion during the progress of infection and forms multi-
nucleated giant cells called syncytia.14,15 Most of the T cell
infecting viruses are syncytium-inducing (SI), whereas monocyte
infecting viruses are non-syncytium-inducing (NSI). HIV-1
induced syncytia is the primary cause of T lymphocyte depletion
and is characterized by a high rate of cell-cell fusion between
infected and uninfected cells, eventually leading to cell death.16
Syncytia are observed in “in vitro” cell culture and “in vivo”
in the lymph nodes and brain regions of HIV-1 infected
patients.17 HIV-1 infected cells express the gp120 envelope
protein on their surfaces, which interact with CD4 receptor and
coreceptors (CXCR4 and CCR5) on uninfected bystander cells.
This interaction leads to the fusion of both of these cells to
form syncytium.14
* To whom correspondence should be addressed. For V.S.P. and
B.G.H.: phone, 91-20-25902055; fax, 91-20-25902624; e-mail, vs.pore@
ncl.res.in and bg.hazra@ncl.res.in. For D.M.: phone, 91-20-25690922; fax,
91-20-25692259; e-mail, dmitra@nccs.res.in.
† National Chemical Laboratory.
On the basis of Marples’ report and in continuation of our
§ Both the authors contributed equally to the work.
‡ National Centre for Cell Science.
work on the synthesis of various bile acid conjugates18,19 as
10.1021/jm051114u CCC: $33.50 © 2006 American Chemical Society
Published on Web 03/25/2006

Brief Articles
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 8 2653
Scheme 1a
a Reagents and conditions: (a) PTSA, MeOH, 25 °C, 12 h, 98%; (b) Ac2O, Et3N, DMAP, CH2Cl2, 25 °C, 5 h, 92%; (c) CrO3, H2SO4, H2O, acetone, 0-10
°C, 5 min, 98%; (d) Br2, BF3-OEt2, AcOH, 25 °C, 96 h, 93%; (e) NaN3, DMF, 50-100 °C, 4-48 h, 64-98%; (f) H2/Pd-C, ethyl acetate, 40 psi, 28 °C,
5 h, 95%; (g) NaBH4, CoCl2‚6H2O, cetrimide, CH2Cl2, H2O, CH3OH, 25 °C, 30 min, 86% (12) and 91% (13).
Table 1. Enhancement of Syncytia Formation Due to Treatment with
novel natural product hybrids, in the present study we have
tested the effect of cholic acid analogues 6-13 on HIV-1
Cholic Acid Derivativesa
treatment
DMSO
compound 6
compound 7
compound 8
compound 9
compound 10
no. of syncytia
treatment
no. of syncytia
replication (Figure 1 and Scheme 1). Here, we report the
synthesis of two novel steroids, namely, methyl 11R-amino-
3R,7R-diacetoxy-12R-hydroxy-5â-cholan-24-oate 12 and methyl
11â-amino-3R,7R-diacetoxy-12â-hydroxy-5â-cholan-24-oate 13.
For the first time, we report that the cholic acid analogues 6, 9,
10, 11 and novel compounds 12 and 13 induce HIV-1 mediated
syncitia formation in HIV-1 infected T cells and thereby enhance
viral replication.
85
214
69
92
136
108
compound 11
compound 12
compound 13
inophyllum B
AZT
170
173
235
2
4
a The number of syncytia was determined by flow cytometry as described
in Experimental Section.
Results and Discussion
24-well plates. Cholic acid analogues were tested for their effect
on viral replication at a similar, noncytotoxic concentration of
1 µg/mL. Visualization of the progression of infection using
GFP fluorescence observed under a fluorescence microscope
indicated an increase in syncytia formation in size and number
compared to DMSO-treated (vehicle control) infected cells.
Treatment of uninfected cells with these compounds did not
induce any change in cellular morphology or behavior.
Overnight stirring of cholic acid 7 in dry methanol using a
catalytic amount of PTSA followed by selective acetylation
provided diacetoxy methyl ester 8 in 90% overall yield in two
steps (Scheme 1). Improved yield in oxidation of compound 8
was obtained by using CrO3/H2SO4/H2O in acetone at a shorter
reaction time (98% yield, 5 min), whereas the literature
procedure used two-phase oxidation20 in diethyl ether (86%
yield,6 90 min).
The number of syncytia was quantified using forward scatter
(FSC) versus DNA content (FL-2), obtained by flow cytometry
as described previously.23 When we compared the syncytia
formation in cholic acid analogue treated HIV-1 infected CEM-
GFP cells with control cells, a further increase in the number
of syncytia was observed with 6 and 9-13, whereas 7- and
8-treated infected cells showed very little or no increase in
number of syncytia (Table 1). Maximum syncytia formation
was observed with 13-treated infected cells, the microscopic
and flow cytometric data for which is presented in parts A and
B of Figure 2 compared to DMSO- and AZT-treated infected
cells. We then analyzed the virus released in the culture
supernatants on day 5 postinfection by p24 antigen ELISA,
which is a sensitive method to quantitate HIV-1. This property
of inducing syncytia formation was proportional with an increase
in virus production in the respective treatments of cholic acid
derivatives 6 and 9-13, whereas 7 and 8 did not increase virus
replication (Figure 2C). About 1.5- to 2.5-fold increase in p24
levels was observed with syncytia-inducing compounds. Finally,
increase in viral gene expression was monitored by reverse
transcription polymerase chain reaction (RT-PCR), using RNA
isolated from infected cells treated with various compounds.
The RT-PCR data (Figure 2D) clearly correlates with syncytia
formation (Table 1) and p24 ELISA results (Figure 2C) showing
increased p24 expression in 6 and 9-13 treatments but very
little or no increase in 7 and 8 treatments.
Recently, we have reported21 the synthesis of methyl 11-
amino-3R,7R-diacetoxy-12-oxo-5â-chol-9,11-en-24-oate 6, meth-
yl 11R-azido-3R,7R-diacetoxy-12-oxo-5â-cholan-24-oate 9, meth-
yl 11â-azido-3R,7R-diacetoxy-12-oxo-5â-cholan-24-oate 10,
and methyl 11R-amino-3R,7R-diacetoxy-12-oxo-5â-cholan-24-
oate 11. Attempted catalytic hydrogenation of 11â-azido 10 to
its amine functionality was not realized (Scheme 1). Reduction
of 11R-amino-12-oxo 11 with NaBH4 produced mixture of 12-
hydroxy epimers, and we failed to isolate the desired 11R-
amino-12R-hydroxy 12. However, the desired 12 has been
synthesized in a single step from the 11R-azido-12-oxo 9 using
NaBH4/CoCl2‚6H2O22 in CH2Cl2-H2O-CH3OH and cetyltri-
methylammonium bromide (CTABr) as a phase-transfer catalyst.
This is a unique reaction in which the azide and the carbonyl
functionalities are reduced to its amino alcohol in a single step.
Use of this reagent has not been exploited earlier in steroid
chemistry. In a similar fashion, treatment of 11â-azido-12-oxo
10 with NaBH4/CoCl2‚6H2O in CH2Cl2-H2O-CH3OH and
CTABr as a phase-transfer catalyst afforded stereospecifically
the 11â-amino-12â-hydroxy 13 in excellent yield. Compounds
6-13 were subjected to biological screening against HIV-1
replication.
Enhancement of Syncytia Formation and Viral Replica-
tion. CEM-GFP cells were infected with HIV-1NL4-3 virus at
0.1 multiplicity of infection (MOI), and cells were cultured in

2654 Journal of Medicinal Chemistry, 2006, Vol. 49, No. 8
Brief Articles
to influence the induction of syncytia formation as observed
for epimers 12/13 and 9/10. Moreover, when the biological
results of 5a-d were compared with that of 6, the presence of
the C-7 acetoxy group and the free primary amino functionality
at C-11 seems to be the important features for enhancing HIV-1
replication.
Conclusion
C-11 functionalized cholic acid analogues have been syn-
thesized that are not easily accessible. Surprisingly, these
compounds were found to enhance HIV-1 replication with
induction of syncytia formation. The increase in virus production
was also found to be proportional to the increase in syncytia
formation. Because syncytium is formed by cell-cell fusion, it
will be interesting to study the molecular basis of this induction.
The syncytia-inducing property of cholic acid analogues may
also be useful for screening the efficacy of compounds that
inhibit syncytia induction and also for screening the efficacy
of the existing and novel antiretroviral drugs by artificial
enhancement of HIV-1 replication and syncytia formation.
Experimental Section
Chemistry. TLC was performed on precoated silica gel F-254
plates (0.25 mm, E. Merk), and product(s) and starting material(s)
were detected by viewing under UV light or treating with an
ethanolic solution of phosphomolybdic acid or ninhydrin followed
by heating. Column chromatography was performed on neutral
deactivated aluminum oxide. Optical rotations were obtained on
Bellingham & Stanley ADP-220 polarimeter. Specific rotations
([R]D) are reported in deg/dm, and the concentration (c) is given in
g/100 mL in the specific solvent. Infrared spectra were recorded
1
on a Schimadzu 8400 series FTIR instrument. H and 13C NMR
spectra were recorded on a Brucker AC-200 spectrophotometer at
200.13 and 50.32 MHz, respectively. The chemical shifts are given
in ppm relative to tetramethylsilane. Mass specta were recorded
on a LC-MS/MS-TOF API QSTAR PULSAR spectrometer, and
samples were introduced by the infusion method using the elec-
trospray ionization technique. Elemental analyses were performed
by use of a CHNS-O EA 1108 elemental analyzer, Carloerba
Instrument (Italy) or Elementar vario EL (Germany), and were
within (0.4% of calculated values. In the standard workup, organic
layers were dried with Na2SO4 and concentrated in a vacuum.
General Procedure. Reduction of 11-azido-12-oxo compounds
9 and 10 to 11-amino-12-hydroxy compounds 12 and 13 is indicated
below.
Methyl 11r-Amino-3r,7r-diacetoxy-12r-hydroxy-5â-cholan-
24-oate (12). Azido compound 9 (100 mg, 0.18 mmol) was
dissolved in a mixture of MeOH (2 mL) and CH2Cl2 (1 mL). To
this, CoCl2‚6H2O (4.3 mg, 0.018 mmol) in water (1 mL) and
cetyltrimethylammonium bromide (CTABr, 10 mg, 10%) were
added, and mixture was stirred for 15 min at 25 °C. Finally solid
NaBH4 (21 mg, 0.54 mmol) was added slowly in fractions for 5
min. The entire mixture was stirred for 30 min at 25 °C. Water (10
mL) was added, and the mixture was extracted with EtOAc (3 ×
25 mL) and washed with water (2 × 25 mL) and brine (1 × 20
mL). The organic extract was dried over Na2SO4 and evaporated
in a vacuum. The residue was chromatographed on the neutral
deactivated alumina column (CH2Cl2-MeOH, 20:1) to afford 82
mg (86%) of 12 as colorless foam: [R]26D + 9.76 (c 0.82, CHCl3);
IR (Nujol) 3433, 3361, and 1735 cm-1; 1H NMR (CDCl3, 200 MHz)
δ 0.67 (3H, s), 0.99 (3H, d, J ) 6 Hz), 1.08 (3H, s), 2.03 (3H, s),
2.06 (3H, s), 3.44 (1H, bs), 3.63 (1H, m), 3.67 (3H, s), 4.64 (1H,
m), 4.86 (1H, bs); 13C NMR (CDCl3, 50 MHz) δ 11.44, 17.02,
21.24, 21.43, 23.02, 23.29, 27.04, 27.37, 29.14, 29.46, 30.82, 31.42,
34.89, 35.49, 37.74, 38.53, 40.50, 42.65, 45.71, 47.39, 50.64, 51.30,
53.01, 70.91, 73.84, 77.28, 170.32, 170.41, 174.46; MS m/z (C29H47-
NO7, 521) 522.32 [30%, (M + H)+], 256.26 [100%]. Anal. Calcd
for C29H47NO7: C, 66.77; H, 9.08; N, 2.69. Found: C, 66.39; H,
9.38; N, 3.10.
Figure 2. (A) Cholic acid derivative (13) induced syncytia formation
in HIV-1 infected CEM-GFP cells as visualized by fluorescence
microscopy: bright field (BF) and fluorescence (FL) microscopic
images of uninfected (-HIV-1) and infected (+HIV-1) CEM-GFP cells
in control (+DMSO), 13 (+compound 13), and anti-HIV-1 drug AZT
(+AZT) treatments. (B) Quantification of HIV-1 induced syncytia.
Syncytia are quantified in uninfected (-HIV-1) and infected (+HIV-
1) control (+DMSO), 13 (+compound 13), and anti-HIV-1 drug AZT
(+AZT) treated CEM-GFP cells by flow cytometry as described in
Experimental Section. (C) Effect of cholic acid derivatives on HIV-1
replication in HIV-1NL4-3 infected CEM-GFP cells. HIV-1 released into
the culture supernatants of DMSO treated (C) and cholic acid derivatives
6-13 treated (6-13), and anti-HIV-1 drug azidothymidine (AZT): C,
1.00 ( 0.00; 6, 2.39 ( 0.09; 7, 1.14 ( 0.04; 8, 1.14 ( 0.16; 9, 2.16
( 0.22; 10, 1.46 ( 0.04; 11, 1.89 ( 0.1; 12, 1.76 ( 0.05; 13, 2.56 (
0.28; AZT, 0.02 ( 0.06. (D) RT-PCR analysis of viral p24 expression
in cholic acid derivative treated HIV-1 infected CEM-GFP cells. p24
transcripts were amplified by RT-PCR as described in Experimental
Section: M, marker; C, DMSO control; 6-13, cholic acid analogues;
AZT, anti-HIV-1 drug azidothymidine treatments. GAPDH is used as
the internal control.
Our primary object was to understand the relationship
between molecular structure and biological activity. From Figure
2 and Table 1, it is clear that the increase in viral count is directly
proportional to the syncytia formed in T cells. The 11â-amino-
12â-hydroxy 13 induces the maximum viral replication in T
cells followed by 11-imino-12-oxo 6, 11R-azido-12-oxo 9, 11R-
amino-12-oxo 11, 11R-amino-12R-hydroxy 12, and 11â-azido-
12-oxo 10, whereas cholic acid 7 and diacetoxymethyl cholate
8 are almost acting as control samples. From the current set of
data and from a comparison of the structural features of 6-13
with respect to the biological activity, it is clear that C-11
functionalization by amine or azide functionality is responsible
for the observed enhancement of viral replication with induction
of syncytium formation. In addition, the stereochemistry seems

Brief Articles
Journal of Medicinal Chemistry, 2006, Vol. 49, No. 8 2655
Methyl 11â-Amino-3r,7r-diacetoxy-12â-hydroxy-5â-cholan-
24-oate (13). In a similar way the crude amino alcohol was
subjected to column chromatographic purification to afford 87 mg
(91%) of pure 13 as a foamy solid: [R]26D +18.52 (c 0.54, CHCl3);
IR (Nujol) 3421, 3357, and 1733 cm-1; 1H NMR (CDCl3, 200 MHz)
δ 0.73 (3H, s), 1.05 (3H, d, J ) 6 Hz), 1.21 (3H, s), 2.04 (3H, s),
2.06 (3H, s), 3.30 (1H, m), 3.67 (3H, s), 3.75 (1H, bs), 4.62 (1H,
m), 4.99 (1H, m); 13C NMR (CDCl3, 50 MHz) δ 10.51, 20.61,
21.41, 21.55, 22.94, 23.41, 27.04, 29.42, 29.68, 30.67, 32.24, 32.44,
33.07, 34.49, 34.75, 35.09, 37.42, 43.94, 47.30, 48.69, 51.56, 53.49,
57.99, 70.92, 73.61, 77.17, 170.09, 170.57, 174.97; MS m/z (C29H47-
NO7, 521) 522.32 [6%, (M + H)+], 256.26 [100%]. Anal. Calcd
for C29H47NO7: C, 66.77; H, 9.08; N, 2.69. Found: C, 66.55; H,
9.06; N, 2.76.
edged. D.M. is thankful to Dr. G. C. Mishra, Director, NCCS,
for his encouragement, Hemangini and the NCCS FACS facility
for flow cytometric analysis, and Manish Kumar and Manoj
Kumar Tripathy for their help.
References
(1) Wlodawer, A.; Erickson, J. W. Structure-based inhibitors of HIV-1
protease. Annu. ReV. Biochem. 1993, 62, 543-585.
(2) De Clercq, E. Toward improved anti-HIV chemotherapy: therapeutic
strategies for intervention with HIV infections. J. Med. Chem. 1995,
38, 2491-2517.
(3) Norbeck, D. W.; Kempf, D. J. HIV protease inhibitors. Annu. Rep.
Med. Chem. 1991, 26, 141-150.
(4) Kempf, D. J.; Marsh, K. C.; Paul, D. A.; Knigge, M. F.; Norbeck,
D. W.; Kohlbrenner, W. E.; Codacovi, L.; Vasavanonda, S.; Bryant,
P.; Wang, X. C. Antiviral and pharmacokinetic properties of C2
symmetric inhibitors of the human immunodeficiency virus type 1
protease. Antimicrob. Agents Chemother. 1991, 35, 2209-2214.
(5) Slee, D. H.; Laslo, K. L.; Elder, J. H.; Ollman, I. R.; Gustchina, A.;
Kervinen, J.; Zdanvo, A.; Wlodwaer, A.; Wong, C. H. Selectivity in
the inhibition of HIV and FIV protease: Inhibitory and mechanistic
studies of pyrrolidine-containing R-keto amide and hydroxyethy-
lamine core structures. J. Am. Chem. Soc. 1995, 117, 11867-11878.
(6) Harburn, J. J.; Loftus, G. C.; Marples, B. A. Synthesis of novel
steroidal inhibitors of HIV-1 protease. Tetrahedron 1998, 54, 11907-
11924.
Biology. Cell Culture. CEM-GFP, a CD4+ reporter T cell line
with green fluorescent protein (GFP) under the control of the HIV-1
long terminal repeat (LTR) promoter, was obtained from the NIH
AIDS repository24 and was grown in RPMI 1640 medium (Invit-
rogen) supplemented with 2 mmol of L-glutamine, 10% fetal calf
serum, 100 U of penicillin, 100 µg of streptomycin sulfate, and
500 µg of G418 antibiotic per milliliter and was maintained at 37
°C with 5% CO2 in a water-jacketed incubator (Forma Scientific).
HIV-1 Infection of CEM-GFP Cells and Quantitation of
Virus in Culture Supernatants. The 5 × 106 CEM-GFP cells were
infected with a T cell tropic viral strain HIV-1NL4-3 at a multiplicity
of infection of 0.1 for 4 h at 37 °C in the presence of 1 µg/mL
polybrene. Cells were washed twice with serum-free RPMI and
resuspended in complete medium and seeded at 2 × 105 (cells/
mL)/well in a 24-well plate, and compounds were added to the
respective wells, keeping anti-HIV-1 drugs AZT (5µmol) and
inophyllum B (1µg/mL) as inhibitor controls. Infected cells were
maintained for 5-7 days at 37 °C in 5% CO2 and were tested for
virus released into the culture supernatant and syncytia formation
keeping DMSO-treated wells as control. Progression of infection
and syncytia formation was monitored by green fluorescence as
observed under an Olympus IX-70 fluorescence microscope using
488 nm excitation and 510 nm emission filters. Virus released into
the culture supernatants was quantitated by use of an HIV-1 p24
antigen ELISA kit (Perkin-Elmer Life Sciences, Boston, MA)
according to the manufacturer’s protocol.
Quantification of Syncytia Formation. Syncytia formation was
analyzed using GFP fluorescence and flow cytometric analysis with
propidium iodide (PI) staining using a FACS Vantage (Becton-
Dickinson). The PI emission signals, forward light scatter (FSC),
and side light scatter (SSC) signals were determined, and the
number of syncytia was analyzed using Cell Quest software as
described previously.23
Reverse Transcription Polymerase Chain Reaction. Compound-
treated HIV-1NL4-3 infected CEM-GFP cells were lysed in Trizol
(Invitrogen), and RNA was isolated according to the manufacturer’s
protocol. An amount of 5 µg of RNA was used in a reverse
transcription reaction to synthesize cDNA. Viral p24 transcripts
(692 bps) were amplified from 5 µL of cDNA in a 35-cycle PCR
reaction using the forward primer CTATAGTGCAGAATCTC-
CAAGG and the reverse primer CAACACTCTTGCTTTGTG-
GCTAGGTC with the following parameters: denaturation, 94 °C
for 1 min; annealing, 55 °C for 1 min; synthesis, 72 °C for 1 min
and a final extension at 72 °C for 10 min. GAPDH (78 bps) was
amplified using the GCCACATCGCTAAGACACCATGGG for-
ward primer and the CCTGGTGACCAGGCGCCCAAT reverse
primer, using similar PCR conditions except the annealing tem-
perature of 60 °C.
(7) Boyer, J. H.; Straw, D. Azidocarbonyl compounds. II. The pyrolysis
of R-azidocarbonyl compounds. J. Am. Chem. Soc. 1953, 75, 1642-
1644.
(8) Jones, J. G. L. I.; Marples, B. A. Steroids. Part IX. Enamines from
6R-azidocholest-4-en-3-one and 2â-azidocholest-3-one. J. Chem. Soc.
C 1970, 1188-1190.
(9) Applezweig, N. Steroid Drugs; McGraw-Hill Book Company: New
York, 1962.
(10) Zeelen, F. J. Medicinal Chemistry of Steroids; Elsevier Science B.
V: New York, 1990.
(11) Kerlo, U.; Stahnke, M.; Schulze, P.-E.; Wiechert, R. A novel entry
to corticoids. Angew. Chem., Int. Ed. Engl. 1981, 20, 88-89.
(12) Peterson, D. H.; Murray, H. C.; Eppstein, S. H.; Reineke, L. M.;
Weintraub, A.; Meister, P. D.; Leigh, H. M. Microbiological
transformations of steroids. I. Introduction of oxygen at carbon-11
of progesterone. J. Am. Chem. Soc. 1952, 74, 5933-5936.
(13) Breslow, R. Biomimetic control of chemical selectivity. Acc. Chem.
Res. 1980, 13, 170-177.
(14) Callahan, L. HIV-1 virion-cell interactions: an electrostatic model
of pathogenicity and syncytium formation. AIDS Res. Hum. Retro-
Viruses 1994, 10, 231-233.
(15) Anderson, J. M. Multinucleated giant cells. Curr. Opin. Hematol.
2000, 7, 40-47.
(16) Alimonti, J. B.; Ball, T. B.; Fowke, K. R. Mechanisms of CD4+ T
lymphocyte cell death in human immunodeficiency virus infection
and AIDS. J. Gen. Virol. 2003, 84, 1649-1661.
(17) Sodroski, J.; Goh, W. C.; Rosen, C.; Campbell, K.; Haseltine, W.
A. Role of the HTLV-III/LAV envelope in syncytium formation and
cytopathicity. Nature 1986, 322, 470-474.
(18) Salunke, D. B.; Hazra, B. G.; Pore, V. S.; Bhat, M. K.; Nahar, P. B.;
Deshpande, M. V. New steroidal dimers with antifungal and
antiproliferative activity. J. Med. Chem. 2004, 47, 1591-1594.
(19) Salunke, D. B.; Hazra, B. G.; Pore, V. S. A review on steroidal
conjugates and their pharmacological applications. Curr. Med. Chem.
2006, 13, 813-847.
(20) Brown, H. C.; Garg, C. P. A simple procedure for the chromic acid
oxidation of alcohols to ketones of high purity. J. Am. Chem. Soc.
1961, 83, 2952-2953.
(21) Salunke, D. B.; Hazra, B. G.; Gonnade, R. G.; Bhadbhade, M. M.;
Pore, V. S. An efficient method for the synthesis of methyl 11R-
amino-3R,7R-diacetoxy-12-oxo-5â-cholan-24-oate. Tetrahedron 2005,
61, 3605-3612.
(22) Fringuelli, F.; Pizzo, F.; Vaccaro, L. Cobalt(II) chloride-catalyzed
chemoselective sodium borohydride reduction of azides in water.
Synthesis 2000, 646-650.
(23) Wunschmann, S.; Stapleton, J. T. Fluorescence-based quantitative
methods for detecting human immunodeficiency virus type 1-induced
syncytia. J. Clin. Microbiol. 2000, 38, 3055-3060.
(24) Gervaix, A.; West, D.; Leoni, L. M.; Richman, D. D.; Wong-Staal,
F.; Corbeil, J. A new reporter cell line to monitor HIV infection and
drug susceptibility in vitro. Proc. Natl. Acad. Sci. U.S.A. 1997, 94,
4653-4658.
Acknowledgment. D.B.S. and D.S.R. thank Council of
Scientific and Industrial Research (CSIR) and University Grants
Commission, New Delhi, respectively, for the Senior Research
Fellowship. V.S.P. thanks NCL Research Foundation for in-
house funding. Emeritus Scientist Scheme was awarded to
B.G.H. by the CSIR, New Delhi, and is gratefully acknowl-
JM051114U