Hybridizing ability and nuclease resistance profile of backbone modified cationic phosphorothioate oligonucleotides

Article abstract of DOI:10.1016/j.bmc.2012.05.009

Various stereochemically pure cationic phosphorothioate oligonucleotides bearing aminoalkyl moieties were synthesized, and their duplex-forming ability against single-stranded DNA (ssDNA), single-stranded RNA (ssRNA) and triplex-forming ability against do

Full text of DOI:10.1016/j.bmc.2012.05.009

Bioorganic & Medicinal Chemistry 20 (2012) 4098–4102
Contents lists available at SciVerse ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Hybridizing ability and nuclease resistance profile of backbone modified
cationic phosphorothioate oligonucleotides
S.M. Abdur Rahman a, , Takeshi Baba b, Tetsuya Kodama b, Md. Ariful Islam a, Satoshi Obika b,
⇑
⇑
a Department of Clinical Pharmacy and Pharmacology, Faculty of Pharmacy, University of Dhaka, Dhaka 1000, Bangladesh
b Graduate School of Pharmaceutical Sciences, Osaka University, 1-6 Yamadaoka, Suita, Osaka 565-0871, Japan
a r t i c l e i n f o
a b s t r a c t
Article history:
Various stereochemically pure cationic phosphorothioate oligonucleotides bearing aminoalkyl moieties
were synthesized, and their duplex-forming ability against single-stranded DNA (ssDNA), single-stranded
RNA (ssRNA) and triplex-forming ability against double-stranded DNA (dsDNA) were evaluated by UV
melting experiments. The cationic Rp stereoisomers showed improved duplex-forming ability against
ssDNA, triplex-forming ability against dsDNA and nuclease stability.
Received 21 March 2012
Revised 1 May 2012
Accepted 2 May 2012
Available online 12 May 2012
Ó 2012 Elsevier Ltd. All rights reserved.
Keywords:
Phosphorothioate
Backbone modification
Aminoalkyl moiety
UV melting experiment
Nuclease resistance
1. Introduction
however, triplex-forming ability was either reduced or not deter-
mined. Alternatively, mixing of natural and synthetic polyamines
Chemically modified oligonucleotides are increasingly used in
antisense,1 antigene,2 RNA interference (RNAi)3 and other genomic
technologies such as nucleic acid nanotechnology and drug target
validation.4,5 One of the simplest chemical modifications of oligo-
nucleotides is the phosphorothioate (PS) modification in which a
non-bridging oxygen on phosphorus is replaced by a sulfur atom.6
PS oligodeoxynucleotides (ODN) showed great promises in anti-
sense technology because of their ease of synthesis and high resis-
tance to nuclease degradation.7 The first antisense drug,
Vitravene™ (Formivirsen), containing PS-ODN was approved by
the FDA in 1998 for the treatment of cytomegalovirus retinitis,8
and several others are in clinical trials.9 Derivatives of PS-ODNs
have recently been applied in sequence specific DNA cleavage10
and construction of DNA nanostructures.11 However, one of the
major problems encountered in the use of PS-ODNs is their low
hybridizing ability against complementary strands. Duplex-form-
ing ability against ssDNA or ssRNA is reduced gradually12,13 and
triplex-forming ability is greatly diminished or totally lost upon
PS modification.14,15 To overcome these problems, modifications
such as introduction of cationic residues, polyamines and stacking
enforcers on the nucleobase have been accomplished.16–21 These
strategies improved the duplex-forming ability in many cases;
of various sizes has also been investigated for improving hybrid
stability.22,23
Introduction of an additional functional moiety on the back-
bone to improve the hybridizing ability of ODNs and their nuclease
resistance was also investigated.24 Grafting of cationic functional
moieties on the backbone of natural b-ODNs was found to destabi-
lize duplexes/triplexes, whereas grafting with the non-natural
a-
ODNs was shown to improve the duplex- and triplex-forming abil-
ities.25 The stabilization of hybrids by cationic moieties lies in their
ability to neutralize the repulsive negative charges on the phos-
phate backbones and generate an electrostatic interaction with
the anionic phosphate backbone. Cationic moieties conjugated to
ODNs are also known to improve the uptake of ODNs into cells.26
Among the various modifications engineered on the backbone,
most have been performed on the usual phosphodiester linkage
and only very few attempts were undertaken to functionalize the
sulfur atom of PS-ODN.10,11,27,28 Labeling of the sulfur atom of
PS-ODN was achieved by some groups using alkylating agents con-
taining haloacetamides, aziridine sulfonamides,
c-bromo-a,b-
unsaturated carbonyl compounds27 or malemidyl derivatives.28
However, incorporation of such groups on the sulfur atom resulted
in destabilization of the duplex and no data related to triplex for-
mation has been reported.
The high nuclease resistance of PS-ODN and the lack of suffi-
cient examples of backbone modification prompted us to investi-
gate the conjugation of cationic amino groups on the backbone of
PS-ODN. Therefore, we planned to introduce several cationic amino
⇑
Corresponding authors. Tel.: +880 2 9661900 70x8166 (S.M.A.R.); tel.: +81 6
6879 8200; fax: +81 6 6879 8204 (S.O.).
E-mail addresses: rahman_du@yahoo.com (S.M.A. Rahman), obika@phs.osaka-u.
ac.jp (S. Obika).
0968-0896/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.bmc.2012.05.009

S. M. A. Rahman et al. / Bioorg. Med. Chem. 20 (2012) 4098–4102
4099
Table 1
linkers of different chain lengths to the PS-ODN based on a post-
synthetic modification protocol (Scheme 1).28 Herein, we describe
the introduction of various monoamines and diamines of variable
lengths onto the PS backbone and their effects on hybridization
and nuclease resistance profiles.
Yields of aminoalkylated phosphorothioate oligonucleotides
Oligonucleotide
Yield (%)
Rp
Sp
50-d(CCCTTTs-RTTTCCC)-30
R=
(2)
39
49
2. Results and discussion
2.1. Conjugation of aminoethyl moiety to oligonucleotide
containing purine bases
(3)
(4)
(5)
(6)
41
49
53
44
34
42
43
49
Initially, a 12 mer PS-ODN, 50-d(GCGTTTsTTTGCT)-30 (S1) con-
taining one phosphorothioate modification at the middle (labeled
as s), was used for introducing the 2-aminoethyl group on the sulfur
atom according to the reported procedure.28 The corresponding
aminoethyl PS-ODN, 50-d(GCGTTTs-RTTTGCT)-30, R = ꢀCH2CH2NH2
(S2) was obtained, together with a number of cleavage products
resulting from alkylation of the guanine residues.29 The purified dia-
stereoisomeric mixtures of aminoethyl PS-ODN were hybridized
with 12 mer complementary ssDNA and ssRNA and the
thermal stability or UV melting temperature (Tm) was determined.
The thermal stability of the duplex formed with aminoethyl PS-
ODN against ssDNA is equal, and that against ssRNA was slightly
lower, compared to the Tms obtained for non-alkylated PS-ODN.
The unmodified natural phosphodiester ODN, 50-d(GCGTTTTT
TGCT)-30 (S3) possessed higher Tm than the PS-ODN and aminoethyl
PS-ODN.30
(7)
(8)
24
28
39
41
(9)
55
33
55
53
(10)
isomers, that is introduction of 3-aminopropyl, 4-aminobutyl,
5-aminopentyl and 6-aminohexyl groups (3Sp–6Sp) destabilized
the duplex to a larger extent than that observed for the short 2-
aminoethyl chain (2Sp).
Cationization of 1Sp by acyclic and cyclic diamino moieties
(7Sp–10Sp) also destabilized the duplex and the corresponding
Rp-ODNs (7Rp–10Rp) exhibited enhanced duplex stability (Tm in-
creased by 3 °C). For most of the Rp conjugates, thermal stability
was equal to or slightly improved than that of the natural phospho-
diester ODN 11. Melting temperatures in the absence of salt (NaCl)
were also recorded for 2Sp, 2Rp and 9Sp, 9Rp and the results were
2.2. Conjugation of aminoalkyl moieties to the polypyrimidine
oligonucleotide
Because of the partial formation of cleavage products due to
guanine-alkylation and subsequent purification problems, we
decided to use a sequence without guanine residue and ultimately
selected two separate stereochemically pure Sp and Rp PS-ODNs
50-d(CCCTTTsTTTCCT)-30 (1Sp, 1Rp) bearing
a polypyrimidine
compared to those obtained for 1Sp and 1Rp. The
DTm of both 2Rp
tract.31 Stereochemistry of the PS-ODNs 1 were determined by
comparing the nuclease stability against snake venom phosphodi-
esterase which cleaves Rp isomer faster than Sp isomer.32 A num-
ber of monoamines and diamines with variable alkyl chains were
conjugated with the stereochemically pure PS-ODNs using the re-
ported protocol28 and the corresponding aminoalkyl PS derivatives
2Sp–10Sp and 2Rp–10Rp were obtained in 24–55% yields (Table
1). The aminoalkyl PS-ODNs were purified by RP-HPLC and charac-
terized by MALDI-TOF mass spectrometry (for purification, yield
and MALDI-TOF mass data see the Supplementary data).
The synthesized cationic PS-ODNs 2Sp–10Sp and 2Rp–10Rp
were then investigated for their duplex-forming ability against
complementary ssDNA and ssRNA targets and the results are com-
pared to the parent PS-ODNs 1Sp and 1Rp, respectively (Tables 2
and 3). The Tm of ODNs 1Sp and 1Rp against ssDNA under specified
conditions (Table 2) was found to be identical (42 °C). Alkylation by
the 2-aminoethyl moiety to the Sp- isomer 1Sp (ODN 2Sp) de-
creased the Tm slightly, while that of the Rp-isomer (2Rp) increased
the Tm by 3 °C. Increasing the aminoalkyl chain length of the Sp-
and 9Rp compared to 1Rp was found to be +3 °C and that for the
Sp-isomers 2Sp and 9Sp was ꢀ2 °C compared to 1Sp (data not
shown). Therefore, the increase and the decrease of Tm in the ab-
sence or presence of NaCl were similar, indicating that these
changes of Tms are related to the structure of the ODNs. The
increase of Tm against ssDNA using Rp-ODNs might be very inter-
esting for constructing recently reported protein based nanostruc-
tures11 or for designing amino modified ODN probes for DNA
microarrays.33 The difference of Tm between Sp- and Rp-isomers
is significant; for example for 7Rp and 7Sp the difference is 5 °C
by a single modification. Anionic sulfur atoms of Sp- and Rp-ODNs
are faced to the inside and the outside of the duplex, respectively.
Inward orientation is expected to cause a negative charge repul-
sion between anionic sulfur atom and negative charge present in
complementary strand.34 Aminoalkylation neutralizes negative
charge at the sulfur atom and decreases the unfavorable repulsion.
This neutralization effect stabilized duplexes formed with the Rp-
ODNs whereas the stabilization effect might be weak in case of
outward-oriented Sp-ODNs.
Against the complementary ssRNA (Table 3), all aminoalkyl
functional Sp PS-ODNs (2Sp–10Sp) showed decreased Tm com-
pared to the parent ODN 1Sp. Rp-isomers (2Rp–10Rp) also affor-
ded slightly decreased or equal Tm. These results show that
irrespective of the stereoisomers, modification of a sulfur atom
on a phosphorothioate linkage by an aminoalkyl moiety usually
is detrimental for A-form DNA/RNA duplex stability and destabili-
zation is more pronounced in duplexes formed by Sp-conformers.
This destabilization effect may result from an unfavorable steric
interaction or disturbance of the hydration pattern found in A-form
duplexes.35
Scheme 1. Conjugation of aminoalkyl groups to phosphorothioate triester.

4100
S. M. A. Rahman et al. / Bioorg. Med. Chem. 20 (2012) 4098–4102
Table 2
Thermal stability of duplexes formed by cationic Sp and Rp isomers with complementary ssDNAa,b
Oligonucleotide
Sp
Rp
c
c
Tm
D
Tm
Tm
D
Tm
50-d(CCCTTTsTTTCCC)-30
50-d(CCCTTTs-RTTTCCC)-30
(1)
42
—
42
—
R=
(2)
(3)
(4)
(5)
(6)
41
40
40
39
37
ꢀ1
ꢀ2
ꢀ2
ꢀ3
ꢀ5
45
43
44
44
42
+3
+1
+2
+2
0
(7)
(8)
40
40
ꢀ2
ꢀ2
45
45
+3
+3
(9)
40
41
ꢀ2
ꢀ1
45
45
+3
+3
(10)
a
b
c
Target ssDNA: 50-d(AGGAAAAAAGGG)-30.
Tm values of the natural oligonucleotide 50-d(CCCTTTTTTCCT)-30 (11) for ssDNA is 44 °C.
Tm condition: 10 mM sodium phosphate buffer (pH 7.2), 100 mM NaCl, 4 lM each oligonucleotide.
Table 3
Thermal stability of duplexes formed by cationic Sp and Rp isomers with complementary ssRNAa,b
Oligonucleotide
Sp
Rp
c
c
Tm
D
Tm
Tm
D
Tm
50-d(CCCTTTsTTTCCC)-30
50-d(CCCTTTs-RTTTCCC)-30
(1)
46
—
46
—
R=
(2)
(3)
(4)
(5)
(6)
43
43
43
42
41
ꢀ3
ꢀ3
ꢀ3
ꢀ4
ꢀ5
45
46
45
44
43
ꢀ1
0
ꢀ1
ꢀ2
ꢀ3
(7)
(8)
44
44
ꢀ2
ꢀ2
45
46
ꢀ1
0
(9)
44
43
ꢀ2
ꢀ3
46
45
0
(10)
ꢀ1
a
b
c
Target ssRNA: 50-r(AGGAAAAAAGGG)-30.
Tm values of the natural oligonucleotide 50-d(CCCTTTTTTCCT)-30 (11) for ssRNA is 48 °C.
Tm condition: 10 mM sodium phosphate buffer (pH 7.2), 100 mM NaCl, 4 lM each oligonucleotide.
It is possible that the cationic Rp-isomers enhanced the stability
triplex study and the results are summarized in Table 4. All the
of B-form DNA/DNA duplexes while destabilizing the A-form DNA/
RNA duplex due to the fact that in the case of the A-form duplex,
long lived hydration patterns are present in the deep major groove
and involve a sequence independent water bridge between the
proRp oxygen atom and the adjacent phosphate group,36 whereas
such interactions are absent in B-form duplexes because the corre-
sponding distance is too long.37
aminoalkyl conjugates of the Sp-isomer caused destabilization of
the triplex as shown by the
DTm values. In remarkable contrast,
all aminoalkyl Rp-conformers increased the Tm values with respect
to that obtained for 1Rp. The increase of Tm varies depending on
the size and structural features of the aminoalkyl substituents
and the highest increase of Tm (DTm = +6 °C) was noted for ODN
8Rp consisting of a 2-(3-aminopropyl)aminoethyl moiety. Another
Next, we investigated the triplex formation at pH 5.5 towards
22-bp dsDNA target bearing a homopurine–homopyrimidine tract.
The same ODNs used in duplex studies were employed for the
notable increase of Tm was found for the diamine derivative 7Rp
(D
Tm = +5 °C) bearing the 2-(2-aminoethyl)aminoethyl moiety.
The increase of Tms using 7Rp and 8Rp is also greater than that

S. M. A. Rahman et al. / Bioorg. Med. Chem. 20 (2012) 4098–4102
4101
Table 4
Thermal stability of triplexes formed by cationic Sp and Rp isomers with complementary dsDNAa,b
Oligonucleotide
Sp
Rp
c
c
Tm
D
Tm
Tm
D
Tm
50-d(CCCTTTsTTTCCC)-30
50-d(CCCTTTs-RTTTCCC)-30
(1)
26
—
25
—
R=
(2)
(3)
(4)
(5)
(6)
24
24
24
24
23
ꢀ2
ꢀ2
ꢀ2
ꢀ2
ꢀ3
29
29
27
27
27
+4
+4
+2
+2
+2
(7)
(8)
25
25
ꢀ1
ꢀ1
30
31
+5
+6
(9)
24
23
ꢀ2
ꢀ3
28
27
+3
+2
(10)
a
b
c
Target dsDNA: 50-d(GCAGCGGGAAAAAAGGAGCAGC)-30/30- d(CGTCGCCCTTTTTTCCTCGTCG)-50.
Tm values of the natural oligonucleotide 50-d(CCCTTTTTTCCT)-30 (11) for dsDNA is 29 °C.
Tm condition: 7 mM sodium phosphate buffer (pH 5.5), 140 mM KCl, 10 mM MgCl2, 1.5 lM Oligonucleotide.
2.3. Evaluation of nuclease stability of the conjugated
oligonucleotides
Conjugation of a functional moiety to the sulfur atom of PS-ODN
is effective in improving the nuclease resistance property.10 We
evaluated the nuclease stability of aminoalkylated PS-ODN using
30-exo nuclease [Crotalus Admanteus Venom Phosphodiesterase
(CAVP)]. First, we attempted to investigate the stability of ODN
8Rp, which showed the highest triplex-forming ability, and its dia-
stereomer 8Sp. However, unexpectedly, 8Rp and 8Sp were heat-la-
bile. Therefore, 8Sp, 8Rp were substituted for 2Sp, 2Rp and 6Sp,
6Rp bearing amino moieties at the same position as 8Sp, 8Rp. For
easier comparison of the nuclease stability of aminoalkylated PS-
ODNs, 12 mer ODNs were digested from the 30-position in advance
to give
7
mer ODNs, 50-d(CCCTTTsT)-30 (10Sp, 10Rp), 50-
d(CCCTTTs-RT)-30 (R = ꢀ(CH2)2NH2, 20Sp, 20Rp), (R = ꢀ(CH2)6NH2,
60Sp, 60Rp). The resulting ODNs were incubated with CAVP once
again and the ratio of the remaining ODNs at 15 min was evaluated
(Fig. 1). The Sp PS-ODN 10Sp showed slightly higher stability than Rp
PS-ODN 10Rp. The aminoalkylated Sp PS-ODNs (20Sp, 60Sp) showed
comparable or higher nuclease stability than 10Sp. In contrast, amin-
oalkylated Rp PS-ODN (20Rp, 60Rp) showed further enhanced nucle-
ase stability compared to 10Rp. Interestingly, the stability of the Rp
and Sp isomers was reversed by conjugation of an aminohexyl moi-
ety. Aminoalkylation on the sulfur atom is effective to improve the
nuclease stability of PS-ODN, notably Rp-isomers.
Figure 1. Enzymatic stability of 50-d(CCCTTTsT)-30 (10Sp, 10Rp) and 50-
d(CCCTTTs-RT)-30 (20Sp, 20Rp and 60Sp, 60Rp) against Crotalus Admanteus Venom
Phosphodiesterase (CAVP). Experiments were carried out at 37 °C for 15 min in
buffer containing 50 mM Tris–HCl (pH 7.5), 10 mM MgCl2, each ODNs and CAVP.
observed for natural unmodified phosphodiester ODN 11. The Tm
observed for 8Rp was 2 °C higher than that obtained for the natural
phosphodiester ODN 11. This increase of Tm by the Rp congeners
might arise from neutralization of the repulsive forces in the phos-
phate backbone via cationization of the third strand or via favor-
able intra or interstrand interaction between positively charged
amino groups and phosphate oxygens, similar to that obtained
using polyamines.38
3. Conclusion
Triplex formation using phosphorothioate ODN is inefficient in
most cases and usually a large decrease of Tm is observed upon
PS modification, which restricts the use of PS-ODN in antigene
technology.14,15 However, the incremental increase of Tm by 4 or
5 °C by single 3-(2-aminoethyl)aminoethyl or 2-(2-aminopro-
pyl)aminoethyl linked PS-ODN implies that cationic PS-ODNs
might be interesting candidates for antigene technology. This
property along with the increased Tm over natural unmodified
ODN might be very interesting for designing triplex-forming oligo-
nucleotides (TFO) for antigene technologies and recently reported
site specific DNA cleavage using PS-TFO.10
In conclusion, we have successfully introduced various amino-
alkyl moieties to the sulfur group of stereodefined PS-ODNs. The
aminoalkyl conjugated Rp-isomers of phosphorothioate exhibited
increased stabilization of DNA duplexes while the Sp-conformers
destabilized the duplexes. Both the cationic Rp- and Sp-isomers
showed decreased affinity towards RNA. Triplex formation was en-
hanced by all the aminoalkyl functionalized Rp-isomers. The most
significant triplex stabilization was observed with 2-(3-aminopro-
pyl)aminoethyl and 2-(2-aminoethyl)aminoethyl linked Rp-PS-
ODNs. We also revealed that the alkylation of PS-ODNs is effective
to enhance the nuclease stability and increase of nuclease stability

4102
S. M. A. Rahman et al. / Bioorg. Med. Chem. 20 (2012) 4098–4102
is more pronounced for Rp isomers. Considering all the results we
assume that cationic Rp-PS-ODNs might be an interesting candi-
date for DNA based technologies such as DNA microarray, DNA
nanostructures and antigene technologies.
(0.40 nmol) in 50 mM Tris–HCl buffer (pH 7.5) containing 10 mM
MgCl2. The reaction mixture was incubated at 37 °C for 15 min
and heated to 90 °C for 5 min to inactivate the nuclease. The
amount of intact ODN was quantified by HPLC.
4. Experimental section
4.1. General information
Acknowledgments
A part of this work was supported by the bilateral joint projects
conducted by Japan Society of Promotion of Science (JSPS) and Uni-
versity Grants Commission of Bangladesh (UGC)
Melting points are uncorrected. 1H NMR (400 MHz) and 13C NMR
(100 MHz) were recorded on a JEOL JNM-ECS-400 spectrometer.
Chemical shifts are reported in parts per million downfield from
residual solvent of D2O (4.79 ppm) for 1H NMR or methanol-d4
(49.0 ppm) for 13C NMR. Mass spectra were measured on JEOL
JMS-700 mass spectrometers. MALDI-TOF mass spectra were re-
corded on a Bruker Daltonics Autoflex II TOF/TOF mass spectrome-
ter. For high performance liquid chromatography (HPLC), Shimadzu
LC-10ATVP, SPD-10AVP and CTO-10VP were used. Thermal denatur-
ation experiments were carried out on Shimadzu UV-1650
and UV-1800 spectrophotometers equipped with a Tm analysis
accessory. Oligonucleotide 1 was purchased from GeneDesign Inc.
Aminoalkylating reagents were purchased (ethyl and propyl) or
synthesized (others except for 6-bromohexylammonium bro-
mide)39–41 as the respective ammonium bromides.
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at http://dx.doi.org/10.1016/j.bmc.2012.05.009.
References and notes
1. Crooke, S. T. Annu. Rev. Med. 2004, 55, 61.
2. Buchini, S.; Leumann, C. J. Curr. Opin. Chem. Biol. 2003, 7, 717.
3. Novina, C. D.; Sharp, P. A. Nature 2004, 430, 161.
4. Yan, H. Science 2004, 306, 2048.
5. Taylor, M. F.; Wiederholt, K.; Sverdrup, F. Drug Discovery Today 1999, 4, 562.
6. Stein, C. A.; Cheng, Y.-C. Science 1993, 261, 1004.
7. Eckstein, F. Annu. Rev. Biochem. 1985, 54, 367.
8. Marwick, C. J. Am. Med. Assoc. 1998, 280, 871.
9. Yamamoto, T.; Nakatani, M.; Narukawa, K.; Obika, S. Future Med. Chem. 2011, 3,
339.
10. Vekhoff, P.; Halby, L.; Oussedik, K.; Dallavalle, S.; Merlini, L.; Mahieu, C.;
Lansiaux, A.; Bailly, C.; Boutorine, A.; Pisano, C.; Giannini, G.; Alloatti, D.;
Arimondo, P. B. Bioconjugate Chem. 2009, 20, 666.
11. Lee, J. H.; Wong, N. Y.; Tan, L. H.; Wang, Z.; Lu, Y. J. Am. Chem. Soc. 2010, 132,
8906.
12. Stein, C. A.; Subasinghe, C.; Shinozuka, K.; Cohen, J. S. Nucleic Acids Res. 1988,
16, 3209.
13. Clark, C. L.; Cecil, P. K.; Singh, D.; Gray, D. M. Nucleic Acids Res. 1997, 25, 4098.
14. Xodo, L.; Alunni-Fabbroni, M.; Manzini, G.; Quadrifoglio, F. Nucleic Acids Res.
1994, 22, 3322.
15. Kim, S.-G.; Tsukahara, S.; Yokoyama, S.; Takaku, H. FEBS. Lett. 1992, 314, 29.
16. Haginoya, N.; Ono, A.; Nomura, Y.; Ueno, Y.; Matsuda, A. Bioconjugate Chem.
1997, 8, 271.
17. Ueno, Y.; Mikawa, M.; Matsuda, A. Bioconjugate Chem. 1998, 9, 33.
18. Matsukura, M.; Okamoto, T.; Miike, T.; Sawai, H.; Shinozuka, K. Biochem.
Biophys. Res. Commun. 2002, 293, 1341.
19. Moriguchi, T.; Sakai, H.; Suzuki, H.; Shinozuka, K. Chem. Pharm. Bull. 2008, 56,
1259.
20. Lin, K.-Y.; Jones, R. J.; Matteucci, M. J. Am. Chem. Soc. 1995, 117, 3873.
21. Lin, K.-Y.; Matteucci, M. D. J. Am. Chem. Soc. 1998, 120, 8531.
22. Venkiteswaran, S.; Vijayanathan, V.; Shirahata, A.; Thomas, T.; Thomas, T. J.
Biochemistry 2005, 44, 303.
23. Winkler, J.; Saadat, K.; Díaz-Gavilán, M.; Urban, E.; Noe, C. R. Eur. J. Med. Chem.
2009, 44, 670.
24. Morvan, F.; Debart, F.; Vasseur, J.-J. Chem. Biodivers. 2010, 7, 494.
25. Michel, T.; Debart, F.; Heitz, F.; Vasseur, J.-J. ChemBioChem 2005, 6, 1254.
26. Fraley, A. W.; Pons, B.; Dalkara, D.; Nullans, G.; Behr, J.-P.; Zuber, G. J. Am. Chem.
Soc. 2006, 128, 10763.
27. Fidanza, J. A.; Ozaki, H.; McLaughlin, L. W. J. Am. Chem. Soc. 1992, 114, 5509.
28. Chen, M.; Gothelf, K. V. Org. Biomol. Chem. 2008, 6, 908.
29. The cleavage products were characterized by MALDI-TOF mass data. The
alkylation may occur at N7 of guanine residue resulting in cleavage of sugar-
base bond.
4.2. Synthesis of 6-bromohexylammonium bromide
6-Aminohexanol (500 mg, 4.27 mmol) was slowly added to a stir-
ring 48% hydrogen bromide solution(5.1 mL) at 0 °C and the resulting
mixture was stirred at 80 °C for 20 h. The mixture was concentrated
and crystallized from toluene/ethanol = 50/1 to give 6-bromohexy-
lammonium bromide (674 mg, 2.6 mmol, 61%) as a white solid.
Mp 130–133 °C (toluene/ethanol = 50/1). 1H NMR (400 MHz,
D2O): d 1.37–1.48 (4H, m), 1.61–1.68 (2H, m), 1.82–1.87 (2H, m),
2.96 (2H, t, J = 8 Hz), 3.48 (2H, t, J = 7 Hz). 13C NMR (100 MHz,
CD3OD): d 26.6, 28.4, 28.6, 33.6, 34.2, 40.6. MS (FAB) m/z 180
(M–Br–). HRMS (FAB): Calcd for C6H15NBr (M–Br–): 180.0382.
Found: 180.0395.
4.3. Synthesis of aminoalkylated PS-ODNs
Each aminoalkylation reagent (1.0 M, 2
ODN 2–6) or H2O (for ODN 7–10) was added to a solution of ODN 1
(10 nmol) in 22 mM HEPES buffer (18 L, pH 6.5) and the reaction
mixture was incubated at 45 °C for 24 h. After completing the reac-
tion, ODN was precipitated by adding ethanol (100 L). The mix-
lL, 2 lmol) in DMF (for
l
l
ture was kept at 0 °C for 15 min, centrifuged at 13,200 rpm for
15 min at 4 °C, and the resulting supernatant solution was re-
moved. The obtained ODN was purified by RP-HPLC and character-
ized by MALDI-TOF mass spectrometry.
30. The Tm values of the ODNs were summarized in ESI.
31. The polypyrimidine ODN was selected so that it also can be used both for
duplex and triplex studies.
32. Burgers, P. M. J.; Eckstein, F. Biochemistry 1979, 18, 592.
33. Kamisetty, N. K.; Pack, S. P.; Nonogawa, M.; Devarayapalli, K. C.; Watanabe, S.;
Kodaki, T.; Makino, K. Anal. Bioanal. Chem. 2007, 387, 2027.
34. Jaroszewski, J. W.; Syi, J.-L.; Maizel, J.; Cohen, J. S. Anti-Cancer Drug Des. 1992, 7,
253.
35. Egli, M.; Portmann, S.; Usman, N. Biochemistry 1996, 35, 8489.
36. Sundaralingam, M.; Pan, B. Biophys. Chem. 2002, 95, 273.
37. Egli, M.; Tereshko, V.; Teplova, M.; Minasov, G.; Joachimiak, A.; Sanishvili, R.;
Weeks, C. M.; Miller, R.; Maier, M. A.; An, H.; Cook, D. P.; Manoharan, M.
Biopolymers 1998, 48, 234.
38. Ouameur, A. A.; Tajmir-Riahi, H-A. J. Biol. Chem. 2004, 279, 42041.
39. Hedrera, M. E.; Perillo, I. A. J. Heterocycl. Chem. 2000, 37, 1431.
40. Piper, J. R.; Stringfellow, C. R., Jr.; Elliott, R. D.; Johnston, T. P. J. Med. Chem. 1969,
12, 236.
4.4. Preparation of enzymatically digested ODNs
Crotalus Admanteus Venom Phosphodiesterase (CAVP, Pharmacia
Biotech) (1.3
l l l
g for 10 and 60Rp, 4.5 g for 20Sp, 4.1 g for 20Rp,
1.3 lM ODN (5.0 nmol
l
g for 60Sp) was added to a solution of 3.3
for 10 and 60R, 4.5 nmol for 20Sp, 4.1 nmol for 20Rp, 5.1 nmol for
60Sp) in 25 mM Tris–HCl buffer (pH 8.5 for 10, 60, pH 7.5 for 20) con-
taining 4.0 mM MgCl2. The reaction mixture was incubated at 37 °C
for 30 min and heated to 90 °C for 30 min to inactivate the nuclease.
The mixture was concentrated and purified by RP-HPLC.
4.5. Evaluation of nuclease stability
41. McElvain, S. M.; Bannister, L. W. J. Am. Chem. Soc. 1954, 76, 1126.
Crotalus Admanteus Venom Phosphodiesterase (CAVP, Pharma-
cia Biotech) (0.40 lg) was added to a solution of 3.3 lM ODN