Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic Strategy

Article abstract of DOI:10.1016/j.chembiol.2018.10.002

Clostridium difficile causes increasing numbers of life-threatening intestinal infections. Symptoms associated with C. difficile infection (CDI) are mediated by secreted protein toxins, whose virulence is modulated by intracellular auto-proteolysis following allosteric activation of their protease domains by inositol hexakisphosphate (IP6). Here, we explore the possibility of inactivating the C. difficile toxin B (TcdB) by triggering its auto-proteolysis in the gut lumen prior to cell uptake using gain-of-function small molecules. We anticipated that high calcium concentrations typically found in the gut would strongly chelate IP6, precluding it from pre-emptively inducing toxin auto-proteolysis if administered exogenously. We therefore designed IP6 analogs with reduced susceptibility to complexation by calcium, which maintained allosteric activity at physiological calcium concentrations. We found that oral administration of IP6 analogs attenuated inflammation and promoted survival in mouse models of CDI. Our data provide impetus to further develop small-molecule allosteric triggers of toxin auto-proteolysis as a therapeutic strategy. Ivarsson et al. describe a therapeutic strategy that targets the C. difficile toxin B (TcdB). They designed analogs of the natural co-factor IP6 that can induce pre-emptive toxin auto-proteolysis at physiological calcium concentrations. Oral administration of analogs attenuated inflammation and promoted survival in mouse models of CDI.

Full text of DOI:10.1016/j.chembiol.2018.10.002

Article
Small-Molecule Allosteric Triggers of Clostridium
difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy
Graphical Abstract
Authors
Mattias E. Ivarsson, Estelle Durantie,
Corina Huberli, ..., Wangxue Chen,
Jean-Christophe Leroux,
Normal TcdB
Pre-emptive TcdB
auto-proteolysis:
pathogenesis:
Bastien Castagner
Correspondence
bastien.castagner@mcgill.ca
translocation
receptor- domain cysteine
auto-proteolysis
IP6 analogs
binding
domain
protease
enzymatic
domain
In Brief
Ivarsson et al. describe a therapeutic
strategy that targets the C. difficile toxin B
(TcdB). They designed analogs of the
natural co-factor IP6 that can induce pre-
emptive toxin auto-proteolysis at
+
binding
no uptake of toxic
enzymatic domain
X
lumen
physiological calcium concentrations.
Oral administration of analogs attenuated
inflammation and promoted survival in
mouse models of CDI.
cytosol
endocytosis
translocation
auto-
proteolysis
pathogenesis
IP6
Highlights
d
d
d
Inositol hexakisphosphate (IP6) and analogs induce TcdB
auto-proteolysis in vitro
Analogs retain activity in the presence of lumenal calcium
concentration in vitro
Oral gavage of analogs promoted survival in a C. difficile
infection mouse model
Ivarsson et al., 2019, Cell Chemical Biology 26, 1–10
January 17, 2019 ª 2018 Elsevier Ltd.
https://doi.org/10.1016/j.chembiol.2018.10.002

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Cell Chemical Biology
Article
Small-Molecule Allosteric Triggers
of Clostridium difficile Toxin B
Auto-proteolysis as a Therapeutic Strategy
Mattias E. Ivarsson,1,5 Estelle Durantie,1 Corina Huberli,1 Samuel Huwiler,1 Chrismita Hegde,2 Jillian Friedman,2
Fernando Altamura,2 Jun Lu,3 Elena F. Verdu,3 Premysl Bercik,3 Susan M. Logan,4 Wangxue Chen,4
Jean-Christophe Leroux,1 and Bastien Castagner2,6,
*
1Institute of Pharmaceutical Sciences, Department of Chemistry and Applied Biosciences, ETH Zurich, Vladimir-Prelog-Weg 1-5/10, Zurich
8093, Switzerland
2Department of Pharmacology & Therapeutics, Microbiome & Disease Tolerance Centre, McGill University, 3655 Prom. Sir-William-Osler,
Montreal, QC H3G 1Y6, Canada
3Farncombe Family Digestive Health Research Institute, Department of Medicine, McMaster University, 1280 Main Street West, Hamilton,
ON L8S 4L8, Canada
4Human Health Therapeutics, National Research Council Canada, 100 Sussex Drive, Ottawa, ON K1A 0R6, Canada
5Present address: Inositec AG, Technoparkstrasse 1, 8005 Zurich, Switzerland
6Lead Contact
*Correspondence: bastien.castagner@mcgill.ca
https://doi.org/10.1016/j.chembiol.2018.10.002
SUMMARY
reduce the likelihood of further emergence of resistance (Clat-
worthy et al., 2007; Ivarsson et al., 2012; Rasko and Sperandio,
Clostridium difficile causes increasing numbers of 2010). The multidrug-resistant C. difficile is one of the most com-
mon nosocomial pathogens, causing a relentlessly growing
number of life-threatening infections in hospitalized patients
life-threatening intestinal infections. Symptoms
associated with C. difficile infection (CDI) are medi-
ated by secreted protein toxins, whose virulence is
modulated by intracellular auto-proteolysis following
allosteric activation of their protease domains by
inositol hexakisphosphate (IP6). Here, we explore
the possibility of inactivating the C. difficile toxin B
(TcdB) by triggering its auto-proteolysis in the gut
(Ananthakrishnan, 2011; He et al., 2013). Worrying reports of
community-acquired infections are also on the rise (Chitnis
et al., 2013; Jones et al., 2013). The large, monomeric, and
closely related multi-domain proteins, toxin A and B (TcdA,
TcdB) (Figure 1A), secreted by C. difficile in the colon lumen,
are responsible for pathogenesis, with TcdB being particularly
potent (Kuehne et al., 2010; Lyras et al., 2009). Indeed, targeting
TcdB alone was sufficient to reduce recurrent C. difficile infec-
tion (CDI) in phase III clinical trials, while antibodies against
lumen prior to cell uptake using gain-of-function
small molecules. We anticipated that high calcium
concentrations typically found in the gut would TcdA had no benefit (Wilcox et al., 2017). After binding to epithe-
lial cells via the receptor binding domain and endocytosis of the
toxin, a pH-dependent conformation change allows the N-termi-
strongly chelate IP6, precluding it from pre-emptively
inducing toxin auto-proteolysis if administered exog-
enously. We therefore designed IP6 analogs with
reduced susceptibility to complexation by calcium,
which maintained allosteric activity at physiological
calcium concentrations. We found that oral adminis-
tration of IP6 analogs attenuated inflammation and
promoted survival in mouse models of CDI. Our
nal glucosyltransferase domain and the adjacent cysteine prote-
ase domain (CPD) to translocate into the cytosol (Orrell et al.,
2017; Tao et al., 2016; Zhang et al., 2014). Intracellular IP6
(Figure 1B), found ubiquitously in eukaryotic cells, acts as an
allosteric activator of the CPD and triggers zinc-dependent
auto-proteolysis (Chumbler et al., 2016; Egerer et al., 2009; Pruitt
et al., 2009, 2010; Reineke et al., 2007). The freed glucosyltrans-
data provide impetus to further develop small-mole-
cule allosteric triggers of toxin auto-proteolysis as a
therapeutic strategy.
ferase domain then glucosylates small GTPases, ultimately
causing cytoskeleton disruption, cell death, inflammation, and
intestinal injury (Orrell et al., 2017).
IP6 exerts its effect by binding to a highly positively charged
binding pocket on the CPD, thus stabilizing its active conforma-
tion via a crucial b-flap (Chumbler et al., 2016; Shen et al., 2011).
IP6 has an unusually high charge density, and excellent calcium-
INTRODUCTION
As our reliance on the intensive use of antibiotics becomes chelating properties (Shears, 2001). For this reason, despite be-
increasingly precarious, alternative strategies to manage bacte- ing present at high concentrations in some food such as grains
rial infections are urgently needed. Bacterial virulence factors, (rice in particular) and nuts, IP6 is not soluble in the gut lumen
including toxins, are gaining interest as attractive drug targets where concentrations of calcium are expected to be above
to avoid putting selective pressure on bacteria and thereby 10 mM (Schlemmer et al., 2009; Van der Meer et al., 1990; Veiga
Cell Chemical Biology 26, 1–10, January 17, 2019 ª 2018 Elsevier Ltd.
1

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Figure 1. TcdB and Its Cleavage by IP6
(A) Structural organization of TcdA, TcdB, and the
recombinant TcdB constructs used in this study.
(B) Structure of IP6.
(C) TcdB autoprocessing induced by incubation of
150 ng TcdB for 3 hr at 37ꢀC with 1 mM IP6 in the
presence and absence of 10 mM Ca2+ (Rupnik
et al., 2005).
RESULTS
Synthesis of IP6 Analogs
We synthesized and assayed a series of
IP6 analogs where phosphate groups
were progressively replaced by sulfates,
ranging from three phosphates and three
et al., 2006). Although IP6 can trigger the auto-processing of sulfates (IP3S3, Scheme 1), to inositol hexasulfate (IS6). The
TcdB in vitro, the cleavage is abolished if performed in the inositol orthoformate 1 served as a starting point for the differen-
presence of luminal concentrations of calcium (Figure 1C) (Rup- tiation of the various inositol hydroxyl groups (Lee and Kishi,
nik et al., 2005). Other groups have recognized the attractive- 1985). The sulfation was initially performed on analogs with pro-
ness of the CPD as a therapeutic target, and two approaches tected phosphate groups (e.g., 6) with sulfur trioxide-triethyl-
to inhibit the protease of TcdB have recently been described, amine complex with or without trifluoromethane sulfonic acid
but both require prior binding of IP6 to the protease for full in- (Watanabe et al., 1990). However, moderate yields and unstable
hibition, limiting their therapeutic potential (Beilhartz et al., intermediates complicated the synthesis. We therefore explored
2016; Egerer and Satchell, 2010; Puri et al., 2010; Savidge the possibility of performing a direct sulfation on fully depro-
et al., 2011). Furthermore, protease inhibition does not block tected inositol phosphate analogs. We were pleased that the
uptake of the harmful enzymatic domain but merely prevents sulfur trioxide-dimethylformamide (DMF) complex promoted
its release into the cytosol. A small-molecule approach to inac- rapid and complete sulfation of inositol phosphates 3 and 4 in
tivate TcdB would be highly desirable as only passive and DMF. The final compounds were purified using reverse-phase
active immunization strategies are in use in the clinic at the solid-phase extraction columns and/or size-exclusion chroma-
moment (Beilhartz et al., 2016; Bender et al., 2015; Tam tography. The concentration of the compounds was determined
et al., 2015). Recently, a small-molecule GTD inhibitor has by 1H nuclear magnetic resonance (NMR) using an internal
been described with in vivo efficacy in a mouse model of CDI standard or by inductively coupled plasma-mass spectrometry
(Stroke et al., 2018).
(ICP-MS). For in vivo studies, the final compounds were treated
In this study, we describe a unique gain-of-function (Wolan with ion-exchange resin to obtain the sodium salt. To ensure
et al., 2009; Zorn and Wells, 2010) therapeutic approach that stability in the acidic gastric environment, IP2S4 was incubated
aims to trigger the toxin auto-proteolysis prior to its cell uptake, in D2O acidified with HCl to pH 3 at room temperature. The
thus preventing the internalization of the noxious enzymatic 31P NMR spectra revealed no major decomposition even after
domain. This approach might be superior to classical inhibition 2 days (Figure S1A).
of the protease domain as the active site is potentially occluded
and/or not formed until it reaches the cytosol and is exposed to Characterization of Binding of IP6 Analogs to Calcium
cytosolic IP6. Since the target site-of-action is the intestinal and Toxin
lumen, the trigger molecule does not need to be absorbed in We first ensured sufficient solubility by incubating 100 mM of the
order to be active. Anticipating that luminal concentrations of analogs in the presence and absence of calcium before filtering
calcium would prevent the activity of exogenously administered the solutions and measuring the filtrates’ phosphorous content
IP6, we synthesized analogs rationally designed to activate the by ICP-MS. All of the compounds except for IP6 were sufficiently
CPD in the presence of calcium. Although replacing phos- soluble in the presence of calcium (Figure 2A). The relative affin-
phates by sulfate groups provided additional solubility in cal- ity of the analogs for calcium was further investigated by deter-
cium-containing media, only IP2S4, an inositol with four mining the concentration of free calcium ions in an equimolar
sulfates and two phosphates, retained allosteric activity on mixture of analogs and calcium, using murexide as a colorimetric
TcdB in physiologically relevant extracellular concentrations calcium indicator (Figure 2B). As expected, the solution contain-
of calcium. Mice infected with C. difficile that received oral ing IP6 had the lowest concentration of free calcium, which
IP2S4 exhibited significantly less colitis than control mice. increased with analogs displaying more sulfates. This result
Furthermore, oral administration of a more stable thiophos- shows that the sulfated derivatives are not only more soluble in
phate analog, IT2S4, promoted survival in a fulminant CDI the presence of calcium, but also have weaker interactions
model compared with vehicle. Our findings provide pre-clinical with calcium.
evidence that pre-emptive toxin auto-proteolysis could be a
viable therapeutic approach.
The binding affinity of the analogs to the CPD was deter-
mined using an intrinsic fluorescence assay. We cloned and
2
Cell Chemical Biology 26, 1–10, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Scheme 1. Synthesis of Inositol Phosphate and Sulfate Hybrids
PMB, para-methoxybenzyl; DMF, dimethylformamide; DEABP, 3-(diethylamino)-1,5-dihydro-2,4,3-benzodioxa-phosphepin; DCM, dichloromethane; mCPBA,
meta-chloroperbenzoic acid; TFA, trifluoroacetic acid; TBDMS, tert-butyl-dimethylsilyl; TfOH, trifluoromethanesulfonic acid; TMS, trimethylsilyl. aPurchased
from Sigma-Aldrich. See also Figure S1.
recombinantly expressed a truncated portion of the CPD (tCPD) values obtained by others (Egerer et al., 2009; Guttenberg
(Figure 1A), lacking the cleaved N-terminal portion from et al., 2011). In contrast, IS6 had a higher Kd of 30 mM, which
C. difficile ribotype 078. The tCPD contains a single tryptophan can be rationalized by its lower negative charge. The substitution
on the b-flap that is a mobile element of the allosteric circuit, of phosphate groups by sulfates was surprisingly well tolerated
rendering the amino acid’s fluorescence sensitive to the pres- with regard to the effect on Kd. Since allosteric activation
ence of an allosteric co-factor (Shen et al., 2011). In this assay, involves stabilizing the active conformation of the enzyme, we
all hybrids containing phosphates had dissociation constants also sought to determine the conformational stability of the re-
in the low-micromolar range, indistinguishable from IP6 (Fig- sulting complex as a surrogate measure of folding. IP6 interacts
ure 2C). The Kd value obtained for IP6 is in line with reported with the TcdB CPD via cationic residues that are unlikely to form
Cell Chemical Biology 26, 1–10, January 17, 2019
3

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Figure 2. Determination of IP6 Analog Inter-
action with Calcium and Toxin
(A) Solubility of analogs in presence of calcium. The
concentration of phosphorous in filtered 100-mM
solutions of analogs with and without 10 mM CaCl2
was measured by ICP-MS, and adjusted to the
number of phosphates per molecule to obtain analog
concentrations in the filtrates. Mean SD of triplicate
measurements of one sample.
(B) Free calcium quantification: 0.5 mM of analog,
CaCl2 and murexide were mixed, incubated, and
centrifuged. Absorbance of the supernatant at 474
and 544 nm was used to determine free calcium
concentration. Mean
SD, n = 3; an asterisk in-
dicates statistical difference compared with IP6
(p < 0.05).
(C) Intrinsic fluorescence assay for Kd determination.
tCPD was titrated against increasing concentrations
of analogs. The curves of fluorescence emission at
333 nm (excitation at 295 nm) versus concentration
were fitted with a rectangular hyperbolic function
from which Kd values were determined. Mean SD,
n = 3.
See also Figure S2.
protease stabilization, and their absence
explains the large differences (roughly
three orders of magnitude) between Kd
and EC50 values as seen by us and others
(Shen et al., 2011). When rCPD cleavage
was performed in the presence of 10 mM
calcium ions, large differences in activity
a pocket in the absence of IP6 (Chumbler et al., 2016). Past were observed between the different hybrids (Figure 3B). In
studies have shown that the CPD is more flexible and thus this assay, the EC50 values reflect not only the compounds’
more susceptible to proteolysis in the absence of IP6 (Egerer allosteric activity, but also their solubility and the competition
et al., 2009; Pruitt et al., 2009). A limited digestion assay of between their binding to the protein and to calcium. As
tCPD by trypsin in the presence of the various hybrids revealed expected, the activity of IP6 decreased by 25,000-fold (from
that IS6 afforded only limited protection, but the addition of EC50 = 25 nM to 600 mM) in 10 mM calcium (Figure 3C). How-
phosphate groups gradually increased the protection up to ever, the replacement of phosphates by sulfates gradually
IP3S3, which was indistinguishable from IP6 (Figure S2). This restored the activity until EC50 reached a value of 350 nM for
result confirms that analogs with more negative charges induce IP1S5. When all phosphates were replaced by sulfates (IS6),
more rigid folding of the protease.
the EC50 increased to 780 nM. This result suggests that the
optimal balance between allosteric activity and interference
by calcium is reached by the hybrid IP1S5, although the
Induction of Toxin Auto-proteolysis
To investigate the effect of the small molecules on toxin auto- differences in EC50 for IP2S4, IP1S5, and IS6 with calcium
processing, we recombinantly expressed a fragment of TcdB are small.
encompassing the CPD and a portion of the glucosyltransfer-
We then performed a cleavage assay with TcdB isolated
ase domain (rCPD) (Figure 1A). The resulting fragment from C. difficile strain VPI 10463 in the presence and absence
undergoes cleavage when incubated with IP6, which was of calcium. In juxtaposition to IP1S5 having the strongest activ-
quantified by SDS-PAGE densitometry (Figure 3A) (Pruitt ity with rCPD, IP2S4 led to the largest extent of holotoxin cleav-
et al., 2009). We used this assay to determine the molecules’ age in the presence of calcium (Figure 3D). It is likely that a
half-maximal effective concentrations (EC50 values) Figure 3C). higher charge density is necessary to mediate the large
The mixed hybrids each had an EC50 between 25 and 93 nM, conformational change required for protease activation in the
whereas IS6 stood out from the other analogs with an EC50 holotoxin relative to rCPD due to the almost 10-fold larger mo-
of 590 nM, in a similar trend to that observed for the Kd values. lecular weight of the former. In support of this hypothesis,
The reduced activity we observed for IS6 is also in line with hybrid compounds containing fewer phosphates led to slightly
previous reports showing reduced holotoxin cleavage (Egerer lower holotoxin cleavage in absence of calcium (Figure 3E), a
et al., 2009). The tCPD lacks the substrate amino acids trend we observed to a much smaller extent with rCPD (Fig-
Ser542 and Leu543 in order to avoid proteolysis during the bind- ure 3A). A possible reason for the surprisingly low holotoxin
ing experiment. These amino acids contribute to the active cleavage observed with IP1S5 in the presence of calcium is
4
Cell Chemical Biology 26, 1–10, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Figure 3. Recombinant Toxin Fragment and Holotoxin Auto-cleavage Induced by IP6 Analogs
(A) Extent of auto-cleavage of rCPD induced by analogs in the absence of calcium and (B) in the presence of 10 mM CaCl2. rCPD was incubated with varying
concentrations of analogs for 2 hr at 37ꢀC before calculating the extent of cleavage by densitometry of Coomassie-stained SDS-PAGE gels; n = 3.
(C) EC50 values obtained from plots (A and B).
(D) TcdB cleavage in the presence of 10 mM CaCl2 on silver-stained SDS-PAGE gels determined by densitometry and normalized to the positive (IP6 is 100%) and
negative controls. Analogs (1 mM) were equilibrated with 10 mM CaCl2 for 15 min at 37ꢀC before addition of 150 ng TcdB and a 3-hr incubation at 37ꢀC. Error bars
show SD; an asterisk indicates statistical difference compared with IP2S4 (p < 0.05); n = 3.
(E) TcdB cleavage in the absence of CaCl2 on silver-stained SDS-PAGE gels determined by densitometry and normalized to positive (IP6 is 100%) and negative
controls. Analogs (1 mM) were added to 150 ng TcdB and incubated for 3 hr at 37ꢀC. Error bars show SD; an asterisk indicates statistical difference compared
with IP6 (p < 0.05); n = 3.
(F) Cell index of cells incubated under conditions described in (A), measured by real-time impedance-monitoring system at indicated incubation time. Error bars
show SD; asterisks indicate statistical difference compared with TcdB (*p % 0.1; **p % 0.01; ****p % 0.0001); duplicate measurements were repeated in triplicate.
See also Figures S3–S5.
that the kinetics of cleavage are slow compared with the rate of In Vitro Inhibition of TcdB Cytopathy
loss in activity of the protease when it is incubated in buffer at To confirm the effect of pre-emptive TcdB auto-processing on
37ꢀC. Indeed this cleavage assay is limited due to a gradual cytopathic effect, we incubated TcdB alone, with IP6 or IP2S4
inactivation of the TcdB protease over time, resulting in a in presence or absence of 10 mM CaCl2, and added the mixtures
37% decrease in cleavage when incubated at 37ꢀC for 1 hr to sub-confluent 3T3-L1 fibroblasts grown on a real-time moni-
prior to the addition of IP6 (Figure S3). The analogs with fewer toring system. The impedance (cell index) recorded reflects the
phosphates are likely to induce cleavage with slower kinetics cells’ adherence to the culture plate well, and therefore effec-
due to their weaker stabilization of the active toxin form regard- tively corresponds to the extent of cell rounding. Significant
less of calcium concentration (Figure S2). In this assay, it is un- differences in cell index were recorded between the various
clear if the incomplete holotoxin cleavage we obtained with IP6 treatments after 1.5 and 2 hr of incubation (Figures 3F and
without calcium (even after extended incubations and addition S4A), with a high cell index (low cell rounding) observed when
of DTT) is a result of cysteine protease inactivation during the TcdB was pre-treated with IP6 versus a null one (high cell round-
TcdB purification process, and how this reflects the cysteine ing) with untreated TcdB. When 10 mM CaCl2 was present in the
protease activity of TcdB produced by C. difficile in vivo. reaction mixture, the cell index was null with IP6, whereas IP2S4
Nevertheless, the clear superiority of IP2S4 over other mole- retained partial inhibitory activity. Microscopy images of the cells
cules in inducing holotoxin cleavage in high calcium conditions clearly show cell rounding and corroborate the quantitative cell
led us to select it for further study.
index results (Figure S4B). The cell indexes recorded correlated
Cell Chemical Biology 26, 1–10, January 17, 2019
5

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Figure 4. In Vivo IP2S4 Activity
(A and B) Colonic MPO activity. Germ-free NIH
Swiss mice were inoculated with 200 mL of a 1:10
dilution in saline of fecal slur from a patient with
recurrent CDI. IP6, IP2S4, or inositol (negative
control) were administered as doses of 12.3 mmol/kg
(corresponding to 10 mg/kg IP2S4). Boxes repre-
sent interquartile ranges, dividing lines in boxes
median values, and whiskers maximal and minimal
values (n(inositol) = 8, n(IP6) = 7, n(IP2S4) = 9) (A).
An aterisk indicates statistical difference compared
with inositol according to two-tailed Mann-Whitney
test (p = 0.0349). (B) Histological sections of excised
colons. Inositol-treated mice (negative control)
displayed overt colonic structural changes charac-
terized by mucosal ulceration and overlying
exudate, marked acute and chronic inflammatory
infiltrate and submucosal edema.
very closely with the extent of holotoxin cleavage induced by IP6 complicates the evaluation of potential therapeutics (Hutton
and IP2S4, leading to the conclusion that TcdB cleavage prior to et al., 2014).
cell intake does indeed reduce TcdB cytopathy significantly.
Highly charged molecules such as IP2S4 are not expected to Second-Generation Analog
be able to cross cell membranes and induce toxicity. Incubating Before moving to a different CDI animal model, we sought to
cells with concentrations of IP2S4 up to 1 mM in culture medium make a close analog of the IP2S4 that would show improved sta-
did not cause any noticeable effect on cell proliferation within bility toward inositol phosphatase (phytase) enzymes that may
24 hr, as measured by evolution of cell index (Figure S5). At be present in the gut lumen (Stentz et al., 2014). Indeed, when
the same concentration, IP6 prevented cell proliferation, most incubated with a 3-phytase for Aspergillus niger, IP2S4 showed
likely due to the visible precipitation caused by chelation of cal- sign of decomposition after 2–4 hr (Figure S1C). We synthesized
cium in the cell culture medium.
a conservative analog where the 4,6-phosphates are replaced by
thiophosphates (IT2S4, Scheme 2) (Cooke et al., 1989). The
synthesis scheme follows our optimized direct sulfation protocol
In Vivo Attenuation of Colitis
To establish a disease model resembling human CDI, germ-free of a fully deprotected thiophosphate inositol 7. We determined
mice were monocolonized with Escherichia coli JM83 to prime that the affinity of this compound for the CPD and its affinity to
the immune system and then inoculated with fecal slur from a calcium were similar to that of IP2S4 (Figures S6A and S6B).
patient suffering from recurrent infection by a TcdAÀTcdB+ As expected, the thiophosphate analog was as active as IP2S4
C. difficile strain (NAP1) 3 weeks later. Within 5 days of inocu- in the holotoxin cleavage assay, and even slightly more active
lation with patient fecal slur, the mice developed moderate to in the presence of calcium (Figure 5A). As hypothesized, the
severe colitis with elevated activity of the inflammation marker compound was also stable in the presence of phytase for at least
myeloperoxidase (MPO) and histological features that are the 30 hr (Figure S1D).
hallmark of CDI. The MPO activity measured after inoculating
mice with fecal slur from a healthy donor in this model is low Survival Mouse CDI Model
(less than 1 unit/mg of tissue). Animals were randomly assigned We then investigated the activity of IT2S4 in an acute CDI model,
to receive IP6, IP2S4 (from two synthetic batches), or myo- where female C57BL/6J mice are treated by an antibiotic cock-
inositol as a negative control, administered twice daily at tail followed by inoculation with C. difficile spores from strain
12.3 mmol/kg (corresponding to 10 mg/kg IP2S4) for 4.5 days VPI10463 (toxin A and B positive) (Chen et al., 2008). The
starting 6 hr post-inoculation. Colonic MPO activity measure- 4-day treatment was started 5 hr after inoculation, and the study
ments were obtained from two series of blinded experiments collaborators and technicians were blinded to the test groups.
with three to five mice per group in each series. Oral adminis- Animals were monitored daily (2–3 times daily on days 2 and 3)
tration of IP2S4 but not IP6 significantly reduced the acute in- for clinical signs and euthanized if they reached irreversible
flammatory component of colitis compared with administration morbidity. Mice administered vehicle succumbed to the infection
of myo-inositol (Figure 4A). Histologically, mice treated with within 3 days, whereas animals treated with vancomycin sur-
myo-inositol had abnormal architecture of the mucosa, with vived passed 8 days, showing that morbidity comes from the
focal epithelial necrosis, ulceration and overlying fibrin-rich infection (Figure 5B). The mortality seen after this time for the
exudate containing neutrophils (Figure 4C). IP2S4- and IP6- vancomycin-treated group is due to recurrence of the disease,
treated mice had decreased mucosal damage and inflamma- and interestingly was not observed for the other treatment
tory infiltrate, but blinded histological scoring of sections was groups (Chen et al., 2008). Animals treated with IT2S4 by oral
not statistically different from inositol control (data not shown). gavage thrice daily showed significantly improved survival at
As evident from the MPO activity of the myo-inositol control doses of 6, 12, and 60 mg/kg (Figures 5B and S7B). The 33%
group, a significant degree of variability in disease outcome survival at 300 mg/kg was not significantly different to vehicle
following inoculation exists, as also reported by others, which treatment, perhaps due to a lower number of animals in that
6
Cell Chemical Biology 26, 1–10, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Scheme 2. Thiophosphate Analog
See also Figures S1 and S6.
The partial replacement of phosphates
by sulfates and thiophosphates results in
analogs capable of inducing TcdB cleav-
age at micromolar concentrations in the
group. However, we cannot rule out that, at this dose, the com- presence of calcium (Figure 5A). In the first series of analogs,
pound might exert toxicity in infected mice that is not seen in IP2S4 strikes the optimal balance between allosteric activity
healthy animals (vide infra). Interestingly, we could not show su- on TcdB and competition by calcium. It is safe to assume that
periority of our compounds to treatment with IP6 that was signif- all phosphate groups do not play an equal role in the allosteric
icant at 6 and 300 mg/kg, but not 60 mg/kg (Figure S7A). This activation depending on their position in the CPD’s binding
could be due to lower calcium concentrations in the diseased pocket. Therefore, a more in-depth structure-activity relation-
mouse gut or the inherent variability of the disease model, which ship study is warranted to probe the impact of the substitution
makes subtle differences in efficacy difficult to observe. The position on the activity of the analog.
lethality observed in the treatment groups could be the result
Furthermore, we show that TcdB auto-proteolysis by IP2S4
of slow or incomplete toxin cleavage leaving enough intact reduces TcdB cytopathy in cultured cells, as expected given
toxin to induce mortality. Indeed this model is particularly that intracellular delivery of the glucosyltransferase domain in
virulent and results in rapid death of the animals compared the cytosol is known to be necessary for full toxin cytopathy
with the human disease. Furthermore, the colon pH of mice is re- (Donald et al., 2013; Egerer et al., 2007; Kreimeyer et al., 2011;
ported to be lower than that of human, which would negatively Lanis et al., 2012; Pfeifer et al., 2003; Rupnik et al., 2005).
impact the auto-processing in mice since it is inhibited by acid TcdB produced by hypervirulent strains of C. difficile are re-
(McConnell et al., 2008; Rupnik et al., 2005). Different models ported to auto-cleave more efficiently in vitro than historical
and the impact of calcium in the diet could be investigated to strains, suggesting that glucosyltransferase domain uptake after
resolve this point.
exposure to IP2S4 would be even more limited with these strains
We evaluated the acute oral toxicity of IT2S4 in female (Lanis et al., 2012). The extent to which auto-proteolytic release
C57BL/6J mice. Daily gavage at doses up to 2,000 mg/kg failed of the glucosyltransferase domain after holotoxin uptake plays a
to produce any observable sign of toxicity or weight loss (Ta- role in the context of an infection has recently come under scru-
ble S1).
tiny but is of lesser relevance to the situation where the glucosyl-
transferase is not taken up in the first place due to its separation
from the remainder of the toxin in the lumen (Chumbler et al.,
2012; Farrow et al., 2013). It is well established that TcdB is a
mediator of strong immune responses and that reduction in
DISCUSSION
Previously published efforts to develop non-antibiotic therapies inflammation markers such as MPO activity is associated with
against CDI include antibodies (Lowy et al., 2010), vaccines (Fo- attenuated pathology (Madan and Petri, 2012; Ng et al., 2010).
glia et al., 2012), fecal microbiota transplantation (van Nood To investigate the effect of toxin-induced inflammation, we
et al., 2013), polymeric binders (Weiss, 2009), inhibitors of spore used a mouse model of CDI where monocolonized mice were
germination (Howerton et al., 2013), and non-toxigenic C. difficile challenged with fecal slur from a patient suffering from recurrent
(Natarajan et al., 2013). The most clinically advanced of these are CDI. We show that IP2S4 attenuates colitis by quantitative
all aimed at preventing infection recurrence. A strong unmet measure of MPO activity after oral dosing. Furthermore, IT2S4
need for effective and safe first-line, combination or prophylactic treatment could rescue mice in a fulminant CDI model. These
agents therefore persists.
observations support the hypothesis that the TcdB glucosyl-
The present study describes the synthesis, characterization, transferase domain plays an important role in pathogenesis
and in vitro and in vivo testing of allosteric triggers capable of and that preventing its uptake influences CDI symptoms. A
inducing TcdB cleavage in calcium concentrations mimicking superiority of the analogs compared with IP6 itself could not
those in the colon lumen. To achieve this, we modified IP6 to be conclusively demonstrated in the mouse models used in
tune its affinity to calcium while maintaining the uniquely high this study. However, the in vivo data clearly show survival and
charge density that mediates its interaction with TcdB, as well recovery of C. difficile-infected animals with 4-day treatments
as TcdA and numerous other proteins such as Vibrio cholerae of small molecules post-infection in a harsh infection model.
MARTX (Lupardus et al., 2008) and hemoglobin (Arnone and Pe-
rutz, 1974). We synthesized a series of IP6 analogs where phos- SIGNIFICANCE
phate groups are progressively replaced by sulfate groups. We
favored the positioning of sulfates in positions 2 and 3 on the Clostridium difficile infection continues to cause significant
inositol ring, which are less buried in the binding pocket, and morbidity and mortality despite efforts to develop novel
therefore less likely to be crucial for ionic cohesion (Figure S1) therapies. The TcdB toxin secreted by the bacterium has
(Pruitt et al., 2009; Puri et al., 2010). Vicinal phosphates were emerged as an interesting target for therapeutic antibody,
also avoided to disfavor chelation with calcium.
but, as of yet, no small molecule has reached clinical trials.
Cell Chemical Biology 26, 1–10, January 17, 2019
7

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Figure 5. In Vitro and In Vivo IT2S4 Activity
(A) TcdB cleavage in presence of 10 mM CaCl2 on
silver-stained SDS-PAGE gels determined by
densitometry and normalized to the positive (IP6
is 100%) and negative controls. Analogs (1 mM)
were equilibrated with 10 mM CaCl2 for 15 min at
37ꢀC before addition of 150 ng TcdB and a 3-hr
incubation at 37ꢀC. Error bars show SD; an
asterisk indicates statistical difference (p < 0.05);
n = 3.
(B) Mouse CDI survival model after oral IT2S4
treatment. IT2S4 and vehicle were administered
twice a day on day 0 and three times a day on
days 1–3. Vancomycin was administered every
day on days 0–4. Survival curves from three pooled experiments. Survival curve difference to vehicle treatment were analyzed by Gehan-Breslow-
Wilcoxon test. ns, p > 0.05; **p % 0.01; ****p % 0.0001.
See also Figure S7.
SUPPLEMENTAL INFORMATION
Here, we report a rational approach designed to irreversibly
inactivate the bacterial toxin by prematurely triggering its
Supplemental Information includes seven figures, one table, and one data file
auto-proteolysis. We modulated the physico-chemical prop-
and can be found with this article online at https://doi.org/10.1016/j.chembiol.
erties of an essential co-factor in the pathogenesis of TcdB
2018.10.002.
in order to obtain oral small-molecule drug candidates.
We demonstrated the potential of this approach in two
ACKNOWLEDGMENTS
animal infection models. Our findings are highly relevant
We gratefully acknowledge funding by the Swiss National Science Foundation
to the ongoing pursuit of novel anti-infective strategies
(grant 205321_141263), the Canadian Institutes of Health Research (CIHR),
that are not based on antibiotics and provide impetus for
and the Natural Sciences and Engineering Research Council of Canada
further investigating toxin auto-processing as a therapeutic
(NSERC) (discovery grant RGPIN-2015-05364). B.C. holds a tier II Canada
approach.
Research Chair (CRC) in Therapeutic Chemistry. E.F.V. holds a CRC and is
funded by a Crohn’s and Colitis Canada grant. We thank the NMR spectros-
€
copy service from Institut fur Pharmazeutische Wissenschaften at ETH Zurich,
STAR+METHODS
and the Chemistry Department at McGill University, as well as the Mass Spec-
€
trometry service from the Laboratorium fur Organische Chemie at ETH Zurich
Detailed methods are provided in the online version of this paper
and include the following:
for their helpful support. We wish to thank Annie Aubry for preparation of the
C. difficile spore stock and for the confirmation of the challenge doses, Greg
Harris for performing the mouse CDI experiments, and Amalia Ponce for con-
ducting the toxicity study.
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Cell Lines
AUTHOR CONTRIBUTIONS
M.E.I. designed and carried out the biological and biochemical experiments.
E.D. designed and carried out the chemical synthesis. C. Huberli, C. Hegde,
and F.A. performed the biochemical experiments. C. Hegde, J.F., and S.H.
performed the chemical synthesis. J.L., E.F.V., P.B., S.M.L., and W.C. de-
signed and performed the in vivo experiments. M.E.I., J.-C.L., and B.C.
analyzed the data and designed the experiments. B.C. initiated and directed
the project. M.E.I. and B.C. wrote the manuscript. All authors discussed the re-
sults and commented on the manuscript.
B Mice
d METHOD DETAILS
B General Synthesis Information
B Synthesis of IP3S3
B Synthesis of IP1S5
B Synthesis of IP2S4
B Synthesis of IT2S4
B Analogue Solubility Measurements by ICP-MS
B Free Calcium Ion Quantification
B Compound Phytase Stability Assay
B Plasmid Construction
DECLARATION OF INTERESTS
M.I.E., J.-C.L., and B.C. are co-founders and shareholders of Inositec AG
(M.I.E. is CEO), which has licensed our patent no. WO2013045107-A1.
B Recombinant Protein Expression and Purification
B Intrinsic Tryptophan Fluorescence Assay
B Trypsin Digestion Assay
Received: December 29, 2017
Revised: June 27, 2018
Accepted: September 28, 2018
Published: October 25, 2018
B Cleavage Assays with Recombinant Toxin
B Cleavage Assays with Holotoxin
B Inhibition of TcdB Toxicity in Cell Assays
B Bacterial Culture for Monocolonisation
B Testing of IP2S4 in Mouse Model
B Testing of IT2S4 in Survival Mouse Model
B Acute Oral Toxicity
REFERENCES
Aubry, A., Hussack, G., Chen, W., KuoLee, R., Twine, S.M., Fulton, K.M., Foote,
S., Carrillo, C.D., Tanha, J., and Logan, S.M. (2012). Modulation of toxin produc-
tion bytheflagellar regulon inClostridiumdifficile. Infect.Immun.80, 3521–3532.
Ananthakrishnan, A.N. (2011). Clostridium difficile infection: epidemiology, risk
factors and management. Nat. Rev. Gastroenterol. Hepatol. 8, 17–26.
d QUANTIFICATION AND STATISTICAL ANALYSIS
8
Cell Chemical Biology 26, 1–10, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Angyal, S.J. (2000). myo-Inositol 4,6-carbonate: an easily prepared small
Jones, A.M., Kuijper, E.J., and Wilcox, M.H. (2013). Clostridium difficile: a
European perspective. J. Infect. 66, 115–128.
molecule with three syn-axial hydroxyl groups. Carbohydr. Res. 325, 313–320.
Arnone, A., and Perutz, M.F. (1974). Structure of inositol hexaphosphate–
Kreimeyer, I., Euler, F., Marckscheffel, A., Tatge, H., Pich, A., Olling, A.,
Schwarz, J., Just, I., and Gerhard, R. (2011). Autoproteolytic cleavage medi-
ates cytotoxicity of Clostridium difficile toxin A. Naunyn Schmiedebergs
Arch. Pharmacol. 383, 253–262.
human deoxyhaemoglobin complex. Nature 249, 34–36.
Beilhartz, G.L., Tam, J., Zhang, Z., and Melnyk, R.A. (2016). Comment on "A
small-molecule antivirulence agent for treating Clostridium difficile infection".
Sci. Transl Med. 8, 370tc2.
Kuehne, S.A., Cartman, S.T., Heap, J.T., Kelly, M.L., Cockayne, A., and
Minton, N.P. (2010). The role of toxin A and toxin B in Clostridium difficile infec-
tion. Nature 467, 711–713.
Bender, K.O., Garland, M., Ferreyra, J.A., Hryckowian, A.J., Child, M.A., Puri,
A.W., Solow-Cordero, D.E., Higginbottom, S.K., Segal, E., Banaei, N., et al.
(2015). A small-molecule antivirulence agent for treating Clostridium difficile
infection. Sci. Transl Med. 7, 306ra148.
Lampe, D., Liu, C., and Potter, B.V. (1994). Synthesis of selective non-Ca(2+)-
mobilizing inhibitors of D-myo-inositol 1,4,5-trisphosphate 5-phosphatase.
J. Med. Chem. 37, 907–912.
Chen, X., Katchar, K., Goldsmith, J.D., Nanthakumar, N., Cheknis, A., Gerding,
D.N., and Kelly, C.P. (2008). A mouse model of Clostridium difficile-associated
disease. Gastroenterology 135, 1984–1992.
Lanis, J.M., Hightower, L.D., Shen, A., and Ballard, J.D. (2012). TcdB from
hypervirulent Clostridium difficile exhibits increased efficiency of autoprocess-
ing. Mol. Microbiol. 84, 66–76.
Chitnis, A.S., Holzbauer, S.M., Belflower, R.M., Winston, L.G., Bamberg,
W.M., Lyons, C., Farley, M.M., Dumyati, G.K., Wilson, L.E., Beldavs, Z.G.,
et al. (2013). Epidemiology of community-associated Clostridium difficile
infection, 2009 through 2011. JAMA Intern. Med. 173, 1359–1367.
Lee, H.W., and Kishi, Y. (1985). Synthesis of mono and unsymmetrical bis
ortho-esters of scyllo-inositol. J. Org. Chem. 50, 4402–4404.
Lowy, I., Molrine, D.C., Leav, B.A., Blair, B.M., Baxter, R., Gerding, D.N.,
Nichol, G., Thomas, W.D., Jr., Leney, M., Sloan, S., et al. (2010). Treatment
with monoclonal antibodies against Clostridium difficile toxins. N. Engl. J.
Med. 362, 197–205.
Chumbler, N.M., Farrow, M.A., Lapierre, L.A., Franklin, J.L., Haslam, D.,
Goldenring, J.R., and Lacy, D.B. (2012). Clostridium difficile toxin B causes
epithelial cell necrosis through an autoprocessing-independent mechanism.
PLoS Pathog. 8, e1003072.
Lupardus, P.J., Shen, A., Bogyo, M., and Garcia, K.C. (2008). Small molecule-
induced allosteric activation of the Vibrio cholerae RTX cysteine protease
domain. Science 322, 265–268.
Chumbler, N.M., Rutherford, S.A., Zhang, Z., Farrow, M.A., Lisher, J.P.,
Farquhar, E., Giedroc, D.P., Spiller, B.W., Melnyk, R.A., and Lacy, D.B.
(2016). Crystal structure of Clostridium difficile toxin A. Nat. Microbiol.
1, 15002.
Lyras, D., O’Connor, J.R., Howarth, P.M., Sambol, S.P., Carter, G.P.,
Phumoonna, T., Poon, R., Adams, V., Vedantam, G., Johnson, S., et al.
(2009). Toxin B is essential for virulence of Clostridium difficile. Nature 458,
1176–1179.
Clatworthy, A.E., Pierson, E., and Hung, D.T. (2007). Targeting virulence: a new
paradigm for antimicrobial therapy. Nat. Chem. Biol. 3, 541–548.
Cooke, A.M., Nahorski, S.R., and Potter, B.V. (1989). myo-Inositol 1,4,5-
trisphosphorothioate is a potent competitive inhibitor of human erythrocyte
5-phosphatase. FEBS Lett. 242, 373–377.
Madan, R., and Petri, W.A., Jr. (2012). Immune responses to Clostridium diffi-
cile infection. Trends Mol. Med. 18, 658–666.
McConnell, E.L., Basit, A.W., and Murdan, S. (2008). Measurements of rat and
mouse gastrointestinal pH, fluid and lymphoid tissue, and implications for in-
vivo experiments. J. Pharm. Pharmacol. 60, 63–70.
Donald, R.G., Flint, M., Kalyan, N., Johnson, E., Witko, S.E., Kotash, C., Zhao,
P., Megati, S., Yurgelonis, I., Lee, P.K., et al. (2013). A novel approach to
generate
a recombinant toxoid vaccine against Clostridium difficile.
Mortz, E., Krogh, T.N., Vorum, H., and Gorg, A. (2001). Improved silver staining
protocols for high sensitivity protein identification using matrix-assisted laser
desorption/ionization-time of flight analysis. Proteomics 1, 1359–1363.
Microbiology 159, 1254–1266.
Egerer, M., Giesemann, T., Herrmann, C., and Aktories, K. (2009).
Autocatalytic processing of Clostridium difficile toxin B. Binding of inositol hex-
akisphosphate. J. Biol. Chem. 284, 3389–3395.
Natarajan, M., Walk, S.T., Young, V.B., and Aronoff, D.M. (2013). A clinical and
epidemiological review of non-toxigenic Clostridium difficile. Anaerobe
22, 1–5.
Egerer, M., Giesemann, T., Jank, T., Satchell, K.J., and Aktories, K. (2007).
Auto-catalytic cleavage of Clostridium difficile toxins A and B depends on
cysteine protease activity. J. Biol. Chem. 282, 25314–25321.
Natividad, J.M., Hayes, C.L., Motta, J.P., Jury, J., Galipeau, H.J., Philip, V.,
Garcia-Rodenas, C.L., Kiyama, H., Bercik, P., and Verdu, E.F. (2013).
Differential induction of antimicrobial REGIII by the intestinal microbiota and
Bifidobacterium breve NCC2950. Appl. Environ. Microbiol. 79, 7745–7754.
Egerer, M., and Satchell, K.J. (2010). Inositol hexakisphosphate-induced auto-
processing of large bacterial protein toxins. PLoS Pathog. 6, e1000942.
Farrow, M.A., Chumbler, N.M., Lapierre, L.A., Franklin, J.L., Rutherford, S.A.,
Goldenring, J.R., and Lacy, D.B. (2013). Clostridium difficile toxin B-induced
necrosis is mediated by the host epithelial cell NADPH oxidase complex.
Proc. Natl. Acad. Sci. U S A 110, 18674–18679.
Natividad, J.M., Petit, V., Huang, X., de Palma, G., Jury, J., Sanz, Y., Philpott,
D., Garcia Rodenas, C.L., McCoy, K.D., and Verdu, E.F. (2012). Commensal
and probiotic bacteria influence intestinal barrier function and susceptibility
to colitis in Nod1À/À; Nod2À/À mice. Inflamm. Bowel Dis. 18, 1434–1446.
Ng, J., Hirota, S.A., Gross, O., Li, Y., Ulke-Lemee, A., Potentier, M.S., Schenck,
L.P., Vilaysane, A., Seamone, M.E., Feng, H., et al. (2010). Clostridium difficile
toxin-induced inflammation and intestinal injury are mediated by the inflamma-
some. Gastroenterology 139, 542–552, 552.e1-3.
Foglia, G., Shah, S., Luxemburger, C., and Pietrobon, P.J. (2012). Clostridium
difficile: development of a novel candidate vaccine. Vaccine 30, 4307–4309.
Guttenberg, G., Papatheodorou, P., Genisyuerek, S., Lu, W., Jank, T., Einsle,
O., and Aktories, K. (2011). Inositol hexakisphosphate-dependent processing
of Clostridium sordellii lethal toxin and Clostridium novyi alpha-toxin. J. Biol.
Chem. 286, 14779–14786.
Oakley, A.J. (2010). The structure of Aspergillus niger phytase PhyA in complex
with a phytate mimetic. Biochem. Biophys. Res. Commun. 397, 745–749.
He, M., Miyajima, F., Roberts, P., Ellison, L., Pickard, D.J., Martin, M.J.,
Connor, T.R., Harris, S.R., Fairley, D., Bamford, K.B., et al. (2013).
Emergence and global spread of epidemic healthcare-associated
Clostridium difficile. Nat. Genet. 45, 109–113.
Ohnishi, S.T. (1978). Characterization of the murexide method: dual-wave-
length spectrophotometry of cations under physiological conditions. Anal.
Biochem. 85, 165–179.
Howerton, A., Patra, M., and Abel-Santos, E. (2013). A new strategy for the
Orrell, K.E., Zhang, Z., Sugiman-Marangos, S.N., and Melnyk, R.A. (2017).
Clostridium difficile toxins A and B: receptors, pores, and translocation into
cells. Crit. Rev. Biochem. Mol. Biol. 52, 1–13.
prevention of Clostridium difficile infection. J. Infect. Dis. 207, 1498–1504.
Hutton, M.L., Mackin, K.E., Chakravorty, A., and Lyras, D. (2014). Small animal
models for the study of Clostridium difficile disease pathogenesis. FEMS
Microbiol. Lett. 352, 140–149.
Pfeifer, G., Schirmer, J., Leemhuis, J., Busch, C., Meyer, D.K., Aktories, K., and
Barth, H. (2003). Cellular uptake of Clostridium difficile toxin B. Translocation of
the N-terminal catalytic domain into the cytosol of eukaryotic cells. J. Biol.
Chem. 278, 44535–44541.
Ivarsson, M.E., Leroux, J.C., and Castagner, B. (2012). Targeting bacterial
toxins. Angew. Chem. Int. Ed. 51, 4024–4045.
Cell Chemical Biology 26, 1–10, January 17, 2019
9

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Pruitt, R.N., Chagot, B., Cover, M., Chazin, W.J., Spiller, B., and Lacy, D.B.
(2009). Structure-function analysis of inositol hexakisphosphate-induced
autoprocessing in Clostridium difficile toxin A. J. Biol. Chem. 284,
21934–21940.
Stroke, I.L., Letourneau, J.J., Miller, T.E., Xu, Y., Pechik, I., Savoly, D.R., Ma, L.,
Sturzenbecker, L.J., Sabalski, J., Stein, P.D., et al. (2018). Treatment of
Clostridium difficile infection with a small-molecule inhibitor of toxin UDP-
glucose hydrolysis activity. Antimicrob Agents Chemother 62, e00107–
e00118.
Pruitt, R.N., Chambers, M.G., Ng, K.K.S., Ohi, M.D., and Lacy, D.B. (2010).
Structural organization of the functional domains of Clostridium difficile toxins
A and B. Proc. Natl. Acad. Sci. U S A 107, 13467–13472.
Tam, J., Beilhartz, G.L., Auger, A., Gupta, P., Therien, A.G., and Melnyk, R.A.
(2015). Small molecule inhibitors of Clostridium difficile toxin B-induced
cellular damage. Chem. Biol. 22, 175–185.
Puri, A.W., Lupardus, P.J., Deu, E., Albrow, V.E., Garcia, K.C., Bogyo, M., and
Shen, A. (2010). Rational design of inhibitors and activity-based probes
targeting Clostridium difficile virulence factor TcdB. Chem. Biol. 17,
1201–1211.
Tao, L., Zhang, J., Meraner, P., Tovaglieri, A., Wu, X., Gerhard, R., Zhang, X.,
Stallcup, W.B., Miao, J., He, X., et al. (2016). Frizzled proteins are colonic
epithelial receptors for C. difficile toxin B. Nature 538, 350–355.
Rasko, D.A., and Sperandio, V. (2010). Anti-virulence strategies to combat
Van der Meer, R., Welberg, J.W., Kuipers, F., Kleibeuker, J.H., Mulder, N.H.,
Termont, D.S., Vonk, R.J., De Vries, H.T., and De Vries, E.G. (1990). Effects
of supplemental dietary calcium on the intestinal association of calcium, phos-
phate, and bile acids. Gastroenterology 99, 1653–1659.
bacteria-mediated disease. Nat. Rev. Drug Discov. 9, 117–128.
Reineke, J., Tenzer, S., Rupnik, M., Koschinski, A., Hasselmayer, O.,
Schrattenholz, A., Schild, H., and von Eichel-Streiber, C. (2007).
Autocatalytic cleavage of Clostridium difficile toxin B. Nature 446, 415–419.
van Nood, E., Vrieze, A., Nieuwdorp, M., Fuentes, S., Zoetendal, E.G., de Vos,
W.M., Visser, C.E., Kuijper, E.J., Bartelsman, J.F., Tijssen, J.G., et al. (2013).
Duodenal infusion of donor feces for recurrent Clostridium difficile. N. Engl.
J. Med. 368, 407–415.
Rupnik, M., Pabst, S., von Eichel-Streiber, C., Urlaub, H., and Soling, H.D.
(2005). Characterization of the cleavage site and function of resulting cleavage
fragments after limited proteolysis of Clostridium difficile toxin B (TcdB) by host
cells. Microbiology 151, 199–208.
Veiga, N., Torres, J., Dominguez, S., Mederos, A., Irvine, R.F., Diaz, A., and
Kremer, C. (2006). The behaviour of myo-inositol hexakisphosphate in the
presence of magnesium(II) and calcium(II): protein-free soluble InsP6 is limited
to 49 microM under cytosolic/nuclear conditions. J. Inorg. Biochem. 100,
1800–1810.
Savidge, T.C., Urvil, P., Oezguen, N., Ali, K., Choudhury, A., Acharya, V.,
Pinchuk, I., Torres, A.G., English, R.D., Wiktorowicz, J.E., et al. (2011). Host
S-nitrosylation inhibits clostridial small molecule-activated glucosylating
toxins. Nat. Med. 17, 1136–1141.
Watanabe, Y., Komoda, Y., Ebisuya, K., and Ozaki, S. (1990). An efficient
phosphorylation method using a new phosphitylating agent, 2-diethylamino-
1,3,2-benzodioxaphosphepane. Tetrahedron Lett. 31, 255–256.
Schlemmer, U., Frolich, W., Prieto, R.M., and Grases, F. (2009). Phytate in
foods and significance for humans: food sources, intake, processing, bioavail-
ability, protective role and analysis. Mol. Nutr. Food Res. 53 (Suppl 2),
S330–S375.
Weiss, K. (2009). Toxin-binding treatment for Clostridium difficile: a review
including reports of studies with tolevamer. Int. J. Antimicrob. Agents 33, 4–7.
Shears, S.B. (2001). Assessing the omnipotence of inositol hexakisphosphate.
Cell Signal. 13, 151–158.
Wilcox, M.H., Gerding, D.N., Poxton, I.R., Kelly, C., Nathan, R., Birch, T.,
Cornely, O.A., Rahav, G., Bouza, E., Lee, C., et al. (2017). Bezlotoxumab for
prevention of recurrent Clostridium difficile Infection. N. Engl. J. Med. 376,
305–317.
Shen, A., Lupardus, P.J., Gersch, M.M., Puri, A.W., Albrow, V.E., Garcia, K.C.,
and Bogyo, M. (2011). Defining an allosteric circuit in the cysteine protease
domain of Clostridium difficile toxins. Nat. Struct. Mol. Biol. 18, 364–371.
Wolan, D.W., Zorn, J.A., Gray, D.C., and Wells, J.A. (2009). Small-molecule
Slack, E., Hapfelmeier, S., Stecher, B., Velykoredko, Y., Stoel, M., Lawson,
M.A., Geuking, M.B., Beutler, B., Tedder, T.F., Hardt, W.D., et al. (2009).
Innate and adaptive immunity cooperate flexibly to maintain host-microbiota
mutualism. Science 325, 617–620.
activators of a proenzyme. Science 326, 853–858.
Zhang, Z., Park, M., Tam, J., Auger, A., Beilhartz, G.L., Lacy, D.B., and Melnyk,
R.A. (2014). Translocation domain mutations affecting cellular toxicity
identify the Clostridium difficile toxin B pore. Proc. Natl. Acad. Sci. U S A
111, 3721–3726.
Stentz, R., Osborne, S., Horn, N., Li, A.W.H., Hautefort, I., Bongaerts, R.,
Rouyer, M., Bailey, P., Shears, S.B., Hemmings, A.M., et al. (2014). A bacterial
homolog of a eukaryotic inositol phosphate signaling enzyme mediates cross-
kingdom dialog in the mammalian gut. Cell Rep. 6, 646–656.
Zorn, J.A., and Wells, J.A. (2010). Turning enzymes ON with small molecules.
Nat. Chem. Biol. 6, 179–188.
10 Cell Chemical Biology 26, 1–10, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE
SOURCE
ATCC
IDENTIFIER
Bacterial and Virus Strains
Escherichia coli: JM83
ATCC 35607
N/A
€
Dr. Donald Hilvert, ETH Zurich,
Escherichia coli: chemically competent BL21 (DE3)
Zurich, Switzerland
Clostridium difficile: strain VPI 10463, Toxin A/B
Dr. Susan Logan
N/A
(positive), spores
(Aubry et al., 2012)
Biological Samples
C. difficile: ribotype 078, Genomic DNA
Dr Roger Stephan, University
€
of Zurich, Switzerland
stephanr@fsafety.uzh.ch
N/A
Human: Faecal slurry containing C. difficile strain NAP1
TcdA-TcdB+
Dr. Elena Verdu, Dr. Premsyl Bercik
Chemicals, Peptides, and Recombinant Proteins
Plasmid: pET28a
Novagen
Cat# 69864
Plasmid: pET47b
Novagen
Cat# 71461
Murexide
Merck
CAS No: 3051-09-0
CAS No: 10035-04-8
CAS No: 824-94-2
CAS No: 68-12-2
Cas No: 82372-35-8
Cas No: 288-94-8
Cas No: 74-09-2
Cas No: 7646-69-7
Cas No: 76-05-1
Cas No: 2857-97-8
Cas No: 29584-42-7
Cas No: 67-56-1
PubChem Substance ID 57652600
Cas No: 18162-48-6
Cas No: 108-48-5
Cas No: 109-99-9
Cas No: 108-98-5
Cas No: 108-39-4
Cas No: 937-14-4
Cas No: 12650-88-3
Cas No: 9025-65-4
Cat# TGC-T101
Calcium Chloride dihydrate
4-methoxybenzyl chloride
Dimethylformamide
Fisher Scientific
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
Sigma-Aldrich
TgcBiomics
3-(Diethylamino)-1,5-dihydro-2,4,3-benzodioxaphosphepine
1H-tetrazole (solution)
Dichloromethane
Sodium hydride
Trifluoroacetic acid
Bromotrimethylsilane
Sulfur trioxide.DMF complex
Methanol
Palladium 10% on Activated Charcoal (Pd/C)
tert-Butyl-dimethylsilyl chloride
2,6-Lutidine
Tetrahydrofuran
Thiophenol
m-Cresol
3-Chloroperbenzoic acid
Chicken egg white lysozyme
Benzonase
Clostridium difficile: strain VPI 10463, Toxin B (TcdB)
Clostridium difficile: ribotype 078, truncated
TcdB-CPD (tCPD)
This paper
N/A
Clostridium difficile: ribotype 078, recombinant fragments
ofTcdB- cysteine protease domain + glucosyltransferase
domain (rCPD)
This paper
N/A
N/A
Aspergillus niger: 3-Phytase (purified from Natuphosꢀ)
BASF; purified from formulation
according to Oakley (2010).
Vancomycin
Clindamycin
Sigma-Aldrich
Sandoz
Cas No: 1404-90-6
Cas No: 18323-44-9
(Continued on next page)
Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019 e1

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Continued
REAGENT or RESOURCE
SOURCE
IDENTIFIER
15 well 8% acrylamide Preciseꢁ Tris-Glycine gels
50% Ni-NTA resin
ThermoScientific
Qiagen
Cat# XP00085BOX
Cat# 30210
PD Midi Trap G-25 columns
Critical Commercial Assays
Serological Testing
GE Healthcare Life Sciences
Cat# 28918008
Charles River Laboratories
https://www.criver.com/
Experimental Models: Cell Lines
Mouse: 3T3-L1 Fibroblasts
Dr Michael Detmar, ETH
€
Zurich, Switzerland
CVCL_0123; michael.detmar@pharma.
ethz.ch
Experimental Models: Organisms/Strains
Mouse: NIH Swiss outbred
Germ-free NIH Swiss mice
rederived at the McMaster
N/A
University Axenic Gnotobiotic Unit
Mouse: C57BL/6J, female, 8-10wk old
Oligonucleotides
The Jackson Laboratory
Jax: 000064
Primer - CPD 511-843, TcdB ribotype 078 (rCPD)
MicroSynth
MicroSynth
MicroSynth
MicroSynth
N/A
N/A
N/A
N/A
Forward: GGCTAGCTGGACATTTGACGATGCAAG
Primer - CPD 511-843 TcdB ribotype 078 (rCPD)
Reverse:CGAAGCTTTCAGGCTTCTTCAATCCTTTCCTCAA
Primer - CPD 545-797 TcdB ribotype 078 (tCPD)
Forward: GCCGCGGCTGAAGATGATAATCTTGATTT
Primer - CPD 545-797 TcdB ribotype 078 (tCPD)
Reverse: CGAAGCTTTCACAGCTCAGGTAAATTTTT
Recombinant DNA
Plasmid: pET28a - rCPD
Plasmid: pET47b - tCPD
Software and Algorithms
OriginPro
This paper
This paper
N/A
N/A
OriginLab
https://www.originlab.com/
Prism 7
GraphPad Software
https://www.graphpad.com/scientific-
software/prism/
Image J
NIH
https://imagej.nih.gov/ij/
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Bastien
Castagner (bastien.castagner@mcgill.ca).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Cell Lines
Murine 3T3-L1 fibroblast cells (male) were kindly gifted by Dr. Michael Detmar. based on a Material Transfer Agreement (MTA) with
ETH Zurich, Zurich, Switzerland These cells were maintained in DMEM with 10 % bovine serum. Cell lines are regularly assayed for
mycoplasma contamination in our laboratory. For experiments, cells were seeded at a density of 2 x 103 cells per well in 90 mL on an
E-plate View 16 and the cell index monitored using an xCelligence RTCA DP (ACEA Biosciences) impedance monitoring system.
Mice
NIH Swiss Mouse Model
Germ-free NIH Swiss mice were rederived at the McMaster University Axenic Gnotobiotic Unit (AGU) by an axenic two-cell embryo
transfer technique previously described.(Slack et al., 2009) Germ-free mouse colonies were maintained in flexible film isolators at the
axenic gnotobiotic unit (AGU) at McMaster University, and axenic status of the mice was routinely confirmed by a combination of
culture- and non-culture-based techniques in faecal and caecal contents (Natividad et al., 2013). Periodic serological testing was
e2 Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019

Please cite this article in press as: Ivarsson et al.
also performed for viruses, parasites, and known pathogens (Charles Rivers Laboratories). All mice had unlimited access to auto-
claved food and water. Both male and female mice were used at the age of 8 to 12 weeks. All experiments were carried out in accor-
dance with the McMaster University animal utilization protocols.
C57BL/6J Mouse Model
8 – 10 week-old C57BL/6J female mice were purchased from the Jackson Laboratories, Bar Harbor, ME and used. The animals were
maintained and used in accordance with the recommendations of the Canadian Council on Animal Care Guide to the Care and Use of
Experimental Animals. All experimental procedures were approved by the institutional animal care committee.
METHOD DETAILS
General Synthesis Information
Reactions requiring dry conditions were performed under an atmosphere of dry nitrogen in dried glassware. All chemicals were re-
agent grade and used as supplied unless stated otherwise. Solvents for reactions (diethylether, N,N-dimethylformamide, methylene
chloride, methanol) were purchased of analytical grade from commercial suppliers and used without further purification unless stated
otherwise. Solvents for extractions and chromatography were technical grade and distilled prior to use. Ultrapure water was pre-
pared by a Barnstead Nanopure system (Thermo Fischer Scientific, Reinach, Switzerland). Analytical thin layer chromatography
(TLC) was performed on pre-coated Merck silica gel 60 F254 plates and visualized with UV light or cerium molybdate stain. Flash
column chromatography was carried out on Fluka silica gel 60 (230-400 mesh). For reverse phase column chromatography, Sep-
Pakꢀ Vac 6cc (1 g) C18 cartridges (Waters, Ireland) were used. Size exclusion column chromatography was performed on PD-10
Desalting Columns containing Sephadex G-25 (GE Healthcare Life Sciences, Buckinghamshire, UK) or on Sephadex G-10 (Pharma-
cia Fine Chemicals AB, Uppsala, Sweden). Ion exchange column chromatograph was performed on Dowexꢀ 50WX8-400 (Sigma-
Aldrich, St. Louis, USA) or on HiTrapTM QHP pre-packed columns (1 or 5 mL) (GE Healthcare Bio-Sciences AB, Uppsala Sweden).
Concentration in vacuo was performed at ꢁ 10 mbar and 40ꢀC unless stated otherwise, drying at ꢁ10-2 mbar at room temperature (rt).
Lyophilizations were performed on a Christ Freeze Dryer Alpha 2-4 LSC (Birsfelden, Switzerland) 1H, 13C and 31P NMR spectra were
recorded on a Bruker AV 400 MHz spectrometer or a Bruker AV 500 MHz spectrometer. NMR data are reported as follows: chemical
shifts (d, ppm, relative to residual solvent peaks), integration, multiplicity (s = singlet, br = broad, d = doublet, t = triplet, q = quartet,
m = multiplet), coupling constant (J, Hz). High-resolution mass spectra (HR ESI) were performed by the MS service at the Laboratory
for Organic Chemistry, ETH Zurich. The MS of IP1S5, IP2S4, and IP3S3 were performed on an aliquot that was passed through a
Dowex 50X8 400 (NH4+ form obtained by washing with NH4OH followed by water) column in order to obtain the ammonium salt.
Synthesis of IP3S3
Synthesis of 2,4,6-tri-O-(4-methoxybenzyl)-myo-inositol 2
2,4,6-tri-O-(4-methoxybenzyl)-myo-inositol 2 was synthesized as described in the literature from commercially available orthofor-
mate 1 (Lampe et al., 1994). Purification by flash chromatography (SiO2, EtOAc/hexane 50%) afforded 2 as white solid (600 mg,
1
1.11 mmol, 55 %). H NMR (400 MHz, CDCl3) d (ppm) 7.30 (4H, d, J 8.7 Hz, Ph), 7.26 (2H, d, J 8.4 Hz, Ph), 6.91 (2H, d, J 8.4 Hz,
Ph), 6.89 (4H, d, J 8.7 Hz, Ph), 4.78 (4H, s, CH2-Ph), 4.75 (2H, s, CH2-Ph), 3.98 (1H, t, J 2.7 Hz, H-C2), 3.83 (3H, s, OCH3), 3.81
(6H, s, OCH3), 3.62 (2H, t, J 9.3 Hz, H-C4/6), 3.46-3.56 (3H, m, H-C1/3, H-C5), 2.44 (1H, bd, OH), 2.32 (2H, bd, OH). In accordance
with literature (Lampe et al., 1994).
Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019 e3

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Synthesis of 2,4,6-tri-O-(4-methoxybenzyl)-1,3,5-tri-O-(o-xylylenephospho)myo-inositol 8
A solution of 2,4,6-tri-O-(4-methoxybenzyl)-myo-inositol 2 (0.541 g, 1 mmol, 1 eq.) in dry CH2Cl2 (20 mL, 0.05 M) under an atmo-
sphere of nitrogen was treated with tetrazole in acetonitrile 0.45 M (20.0 mL, 9.0 mmol, 9 eq.) and o-xylylene-N,N-diethylphosphor-
amidite (6 mmol, 1.44 g, 6 eq.). The reaction mixture was stirred at rt for 2 days. A solution of mCPBA (75 % w/w, 9 mmol, 2.07 g, 9 eq.)
in about 10 mL CH2Cl2 was dried over Na2SO4, added at -10ꢀC to the reaction mixture and stirred at rt for an additional 45 min. The
mixture was then diluted in EtOAc, washed with a saturated solution of aqueous NaHCO3 and with brine. The organic phase was
dried over Na2SO4, filtered and concentrated in vacuo. Purification by flash chromatography (SiO2, CH2Cl2/MeOH gradually from
0 to 4 %, three times) afforded 2,4,6-tri-O-(4-methoxybenzyl)-1,3,5-tri-O-(o-xylylenephospho)-myo-inositol 8 as a white solid
(0.901 g, 0.98 mmol, 98 %). 1H NMR (400 MHz, CDCl3) d (ppm) 7.38-7.35 (6H, m, Ph), 7.30-7.33 (6H, m, Ph), 7.22-7.24
3
2
(2H, m, Ph), 7.14-7.19 (4H, m, Ph), 6.89 (2H, d, J 8.5 Hz, Ph), 6.73 (4H, d, J 8.5 Hz, Ph), 5.26 (1H, t, JHP 13.6, JHH 13.6 Hz,
3
2
CHaHb-Ph), 5.21 (2H, dd, JHP 16.6, JHH 13.7 Hz, CHaHb-Ph), 5.18 (1H, d, J 13.7 Hz, CH2-Ph), 5.13 (1H, d, J 13.7 Hz, CH2-Ph),
4.93-5.10 (8H, m, CH2-Ph), 4.88-4.91 (4H, m, CH2-Ph), 4.65-4.69 (3H, m, CH2-Ph, H-C2), 4.59 (1H, q, J 9.2 Hz, H-C5), 4.40 (2H,
ddd, J 2.4, 8.1, 9.5 Hz, H-C1/3), 4.12 (2H, t, J 9.5 Hz, H-C4/6), 3.81 (3H, s, CH3), 3.74 (6H, s, CH3); 13C NMR (125 MHz,
CDCl3) d (ppm) 159.3 (iPh), 159.1 (2xiPh), 135.4 (2xiPh), 135.3 (2xiPh), 135.2 (2xiPh), 130.8 (iPh), 130.3 (2xiPh), 129.7 (4xPh), 129.6
(2xPh), 129.2 (2xPh), 129.13 (2xPh), 129.12 (2xPh), 129.0 (2xPh), 128.9 (2xPh), 128.6 (2xPh), 113.74 (2xPh), 113.57 (4xPh), 80.6
2
3
(d, JCP 6.0 Hz, C5), 78.1 (2C, dd, JCP 6.9, 3.2 Hz, C4/6), 77.6 (C2), 77.1 (2C, C1/3, under chloroform peak), 76.0 (CH2-Ph),
74.9 (2xCH2-Ph), 68.74 (d, 2JCP 6.3 Hz, 2xCH2-Ph), 68.65 (d, 2JCP 6.6 Hz, 2xCH2-Ph), 68.3 (d, 2JCP 5.6 Hz, 2xCH2-Ph), 55.4 (CH3),
55.3 (2xCH3); 31P NMR (160 MHz, 1H-decoupled, CDCl3) d (ppm) 1.10 (P-C5), -1.32 (P-C1/3); [m/z (ESI) (M+H)+ C54H58O18P3 calcu-
lated 1087.2831, found 1087.2821].
Synthesis of 1,3,5-tri-O-(o-xylylenephospho)-myo-inositol 3
To a solution of 2,4,6-tri-O-(4-methoxybenzyl)-1,3,5-tri-O-(o-xylylenephospho)-myo-inositol 8 (97 mg, 89 mmol) in CH2Cl2 (1 mL) was
slowly added premixed trifluoroacetic acid and H2O (ratio TFA/H2O 5:1, 6mL). The reaction turned dark pink and was stirred for
25 min. The reaction mixture was diluted with toluene and co-evaporated in vacuo 3 times. The residue was triturated in a mixture
hexane-dichloromethane, dried under high vacuum to afford product 3 as a white solid that was used immediately without further
purification in the next step to avoid compound decomposition. 1H NMR (400 MHz, MeOD) d (ppm) 7.44 (8H, s, Ph), 7.42
2
3
2
3
2
(4H, s, Ph), 5.71 (2H, dd, JHH 13.5, JHP 8.9 Hz, CHaHb-Ph), 5.62 (2H, dd, JHH 13.5, JHP 9.8 Hz, CHaHb-Ph), 5.58 (2H, dd, JHH
3
3
2
3
2
13.3, JHP 9.3 Hz, CHaHb-Ph), 5.13 (2H, dd, JHP 22.7, JHH 13.4 Hz, CHaHb-Ph), 5.11 (2H, dd, JHP 22.4, JHH 13.5 Hz, CHaHb-
3
2
3
Ph), 5.07 (2H, dd, JHP 23.4, JHH 13.4 Hz, CHaHb-Ph), 4.66 (1H, t, J 2.6 Hz, H-C2), 4.44 (2H, ddd, J 2.6 Hz, JHP 7.6, J 10.5 Hz,
H-C1/3), 4.35 (1H, q, J 9.4, 3JHP 7.6 Hz, H-C5), 4.22 (2H, t, J 9.4 Hz, H-C4/6).
Synthesis of 1,3,5-tri-O-(o-xylylenephospho)-myo-inositol 2,4,6-tri-O-sulfate 9
A solution of 1,3,6-tri-O-(o-xylylenephospho)-myo-inositol 3 (54 mmol, 1 eq.) in dry DMF (3 mL, 0.02 M) was treated with sulfur trioxide
triethylamine complex (195 mg, 1070 mmol, 20 eq.). The reaction mixture was stirred at 50ꢀC for 20 h and concentrated to dryness.
Purification by reverse phase column chromatography (Sep-Pak, C18, methanol/water gradually from 0 % to 40 %) afforded the
product 9 as white solid (32 mg, 33 mmol, 61 %). 1H NMR (400 MHz, MeOD) d (ppm) 7.40-7.45 (4H, m, Ph), 7.33-7.39 (4H, m, Ph),
2
3
2
3
7.24-7.28 (2H, m, Ph), 7.19-7.21 (2H, m, Ph), 5.66 (2H, dd, JHH 13.4, JHP 8.0 Hz, CHaHb-Ph), 5.63 (2H, dd, JHH 13.6, JHP
e4 Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
9.7 Hz, CHaHb-Ph), 5.47 (2H, dd, 2JHH 13.2, 3JHP 10.2 Hz, CHaHb-Ph), 5.41 (2H, t, J 2.8 Hz, H-C4/6), 5.34-5.39 (2H, m, H-C1/3), 5.18
(1H, dt, 3JHP 10.9, J 2.7 Hz, H-C5), 5.06-5.11 (1H, m, H-C2), 5.07 (2H, dd, 3JHP 22.2, 2JHH 13.7 Hz, CHaHb-Ph), 5.02 (2H, dd, 3JHP 24.1,
2JHH 13.4 Hz, CHaHb-Ph), 4.81-4.90 (2H, CHaHb-Ph, under water peak but visible in COSY spectrum), 3.24 (17H, q, J 7.3 Hz,
CH3CH2NH), 1.32 (25H, t, J 7.3 Hz, CH3CH2NH); 13C NMR (125 MHz, MeOD) d (ppm) 137.5 (2xiPh), 137.4 (2xiPh), 137.1 (2xiPh),
3
2
2
130.6 (4xPh), 130.5 (2xPh), 130.33 (2xPh), 130.30 (4xPh), 75.8 (d, JCP 4.3 Hz, C4/6), 75.6 (d, JCP 6.0 Hz, C1/3), 73.7 (d, JCP
2
2
2
6.0 Hz, C5), 70.6 (d, JCP 7.3 Hz, 2xCHaHb-Ph), 70.5 (d, JCP 6.5 Hz, 2xCHaHb-Ph), 70.3 (d, JCP 7.4 Hz, 2xCHaHb-Ph), 70.0-70.2
(C2 determined by HSQC, not apparent on 13C NMR spectra); 31P NMR (162 MHz, 1H-decoupled, MeOD/CDCl3) d (ppm) -3.7
(P-C1/3), -4.8 (P-C5).
Synthesis of 1,3,5-tri-(O-phosphate)-myo-inositol 2,4,6-tri-O-sulfate IP3S3
To a solution of trisulfate 9 (32 mg, 33 mmol, 1 eq.) in water (3 mL, 11 mM) under nitrogen atmosphere was added Pd on acti-
vated carbon 10 % (w/w) (small scoop). The reaction mixture was evacuated and flushed with hydrogen gas, the operation was
repeated 3 times and the reaction mixture was vigorously stirred at rt for 4 h. The reaction mixture was flushed with nitrogen,
neutralized with concentrated NH4OH (few drops) to basic pH, filtered through a pad of celite and concentrated to dryness.
Purification by reverse phase column chromatography (Sep-Pak, C18, water) afforded the product IP3S3 as white solid (ammo-
+
nium salt, 16 mg, as PSPSPS$2Et3NH+$6NH4 (by 1H NMR) MW 963.84, 17 mmol, 50 %). 1H NMR (400 MHz, D2O) d (ppm) 4.98
(1H, bd, H-C2), 4.90 (2H, bd, H-C4/6), 4.47-4.60 (3H, m, H-C5 and H-C1/3), 3.22 (14H, q, J 7.3 Hz, CH3CH2NH), 1.30 (21H, t,
2
J 7.3 Hz, CH3CH2NH); 13C NMR (125 MHz, D2O) d (ppm) 76.9-77.2 (m, C4/6), 71.3 (d, JCP 5.1 Hz, C1/3), 46.7 (CH3CH2NH),
8.2 (CH3CH2NH); 31P NMR (162 MHz, 1H-decoupled, D2O) d (ppm) -0.39 (2P, s, P-C1/3), -0.81 (1P, s, P-C5); [m/z (ESI)
[IP3S39-$7H+$3NH4+]- C6H25N3O24P3S3 calculated 711.9197, found 711.9199]. C2 and C5 were neither visible on the 13C NMR
nor on the HSQC spectra.
Synthesis of IP1S5
Synthesis of 1,2,3,4,6-penta-O-(4-methoxybenzyl)-myo-inositol 5
To a solution of 2,4,6-tri-O-(4-methoxybenzyl)-myo-inositol 2 (530 mg, 0.98 mmol, 1 eq.) in DMF (10 ml, 0.1 M) at 0ꢀC was added
portionwise NaH (60 % in oil w/w; 86 mg, 2.16 mmol, 2.2 eq.). The reaction mixture was then treated with PMBCl (0.29 mL,
2.16 mmol, 2.2 eq.) and heated at 50ꢀC for 3h. The mixture was quenched with MeOH and concentrated in vacuo. The crude was
diluted with EtOAc and washed with H2O and then brine. The organic phase was dried over Na2SO4, filtered and concentrated in
vacuo. Purification by flash column chromatography (SiO2, EtOAc/hexane 30 -> 40 %) gave a mixture of the two monohydroxylated
isomers. The mixture was separated by a second flash column chromatography (SiO2, EtOAc/hexane 30 %) to afford 5 as a white
solid (170 mg, 0.22 mmol, 22 %). 1H NMR (400 MHz, CDCl3) d (ppm) 7.32 (2H, d, J 8.7 Hz, Ph), 7.27 (4H, d, J 8.3 Hz, Ph), 7.24
(4H, d, J 8.7 Hz, Ph), 6.83-6.89 (10H, m, Ph), 4.84 (2H, d, J 10.8 Hz, CH2-Ph), 4.79 (2H, s, CH2-Ph), 4.70 (2H, d, J 10.8 Hz, CH2-
Ph), 4.56 (2H, d, J 11.3 Hz, CH2-Ph), 4.52 (2H, d, J 11.3 Hz, CH2-Ph), 3.99 (1H, t, J 2.2 Hz, H-C2), 3.87 (2H, t, J 9.5 Hz, H-C4/6),
3.82 (6H, s, CH3), 3.81 (3H, s, CH3), 3.80 (6H, s, CH3), 3.45 (1H, t, J 9.2 Hz, H-C5), 3.28 (1H, dd, J 9.7, 2.2 Hz, H-C1/3), 2.40 (1H,
br, OH); 13C NMR (125 MHz, CDCl3) d (ppm) 159.33 (2xiPh), 159.31 (2xiPh), 159.2 (iPh), 131.33 (iPh), 131.30 (2xiPh), 130.7
Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019 e5

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
(2xiPh), 129.8 (4xPh), 129.5 (2xPh), 129.3 (4xPh), 113.97 (4xPh), 113.91 (4xPh), 113.7 (2xPh), 81.0 (C4/6), 80.7 (C1/3), 75.3 (C5), 75.1
(2xCH2-Ph), 74.3 (C2), 73.9 (CH2-Ph), 72.4 (2xCH2-Ph), 55.43 (2xCH3), 55.42 (3xCH3); [m/z (ESI) (M+Na)+ C46H52NaO11 calculated
803.3402, found 803.3387].
Synthesis of 1,2,3,4,6-penta-O-(4-methoxybenzyl)-5-O-(o-xylylenephospho)-myo-inositol 10
A solution of 1,2,3,4,6-penta-O-(4-methoxybenzyl)-myo-inositol 5 (127 mg, 0.16 mmol, 1 eq.) in dry CH2Cl2 (1.45 mL) under an
atmosphere of nitrogen was treated with tetrazole in acetonitrile 0.45 M (1.45 mL, 0.65 mmol, 4 eq.) and o-xylylene-N,N-diethyl-
phosphoramidite (78 mg, 0.32 mmol, 2 eq.). The reaction mixture was stirred at rt for 20 h. A solution of mCPBA (75 % w/w,
225 mg, 0.98 mmol, 6 eq.) in about 3 mL CH2Cl2 was dried over Na2SO4, added at -10ꢀC to the reaction mixture, and stirred
at rt for an additional 30 min. The mixture was then diluted in EtOAc, washed with a saturated solution of aqueous NaHCO3
and with brine. The organic phase was dried over Na2SO4, filtered and evaporated to dryness. Purification by flash chromatog-
raphy (SiO2, EtOAc/hexane gradually from 30% -> 40 %) gave a mixture of product 10 and phosphate a reagent by-product.
Trituration in Et2O afforded the pure product 10 as a white solid (110 mg, 0.11 mmol, 71 %). 1H NMR (400 MHz, CDCl3)
d (ppm) 7.31-7.37 (6H, m, Ph), 7.29 (2H, dd, J 5.6, 3.3 Hz, Ph), 7.19 (4H, d, J 8.6 Hz Ph), 7.13 (2H, dd, J 5.6, 3.3 Hz, Ph),
3
2
3
2
6.81-6.87 (10H, m, Ph), 5.22 (2H, dd, JHP 14.9, JHH 13.9 Hz, CHaHb-Ph), 5.01 (2H, dd, JHP 17.5, JHH 13.9 Hz, CHaHb-Ph),
4.79 (2H, s, CH2-Ph), 4.78 (4H, s, CH2-Ph), 4.47-4.55 (1H, m, H-C5), 4.52 (2H, d, J 11.3 Hz, CH2-Ph), 4.47 (2H, d, J 11.3 Hz,
CH2-Ph), 4.01 (2H, t, J 9.6 Hz, H-C4/6), 3.93 (1H, t, J 1.9 Hz, H-C2), 3.81 (6H, s, CH3), 3.80 (3H, s, CH3), 3.80 (6H, s, CH3),
3.30 (2H, dd, J 9.8, 1.9 Hz, H-C1/3); 13C NMR (125 MHz, CDCl3) d (ppm) 159.2 (2xiPh), 159.1 (iPh), 159.0 (2xiPh), 135.3
(2xiPh), 131.01 (iPh), 131.00 (2xiPh), 130.3 (2xiPh), 129.6 (4xPh), 129.5 (2xPh), 129.2 (4xPh), 128.6 (2xPh), 128.4 (2xPh), 113.8
2
3
(4xPh), 113.6 (2xPh), 113.5 (4xPh), 82.0 (d, JCP 7.1 Hz, C5), 80.0 (C1/3), 79.3 (2C, d, JCP 3.1 Hz, C4/6), 74.9 (2xCH2-Ph),
2
74.0 (C2), 73.9 (CH2-Ph), 72.5 (2xCH2-Ph), 68.0 (CH2-Ph), 68.0 (d, JCP 5.6 Hz, CHaHb-Ph), 55.3 (5xCH3); 31P NMR (160 MHz,
1H-decoupled, CDCl3) d (ppm) 1.07 (P-C5). [m/z (ESI) (M+Na)+ C54H59NaO14P calculated 985.3535, found 985.3534].
Synthesis of 5-O-(o-xylylenephospho)-myo-inositol 6
To a solution of 1,2,3,4,6-penta-O-(4-methoxybenzyl)-5-O-(o-xylylenephospho)-myo-inositol 10 (45 mg, 47 mmol) in CH2Cl2 (1 mL)
was slowly added premixed trifluoroacetic acid and H2O (ratio TFA/H2O 5:1, 6 mL). The reaction turned dark pink and was stirred
for 25 min. The reaction mixture was diluted with toluene and co-evaporated 3 times. The crude was suspended in diethylether
and dried under high vacuum to afford product 6 as a white solid that was used without further purification in the next step to avoid
compound decomposition. 1H NMR (400 MHz, MeOD) d (ppm) 7.42 (4H, s, Ph), 5.63 (2H, dd, 2JHH 13.5, 3JHP 9.3 Hz, CHaHb-Ph), 5.07
(2H, dd, 3JHP 22.8, 2JHH 13.5 Hz, CHaHb-Ph), 4.11 (1H, td, J 9.5, 3JHP 7.6 Hz, H-C5), 3.99 (1H, t, J 2.8 Hz, H-C2), 3.88 (2H, t, J 9.5 Hz,
H-C4/6), 3.44 (2H, dd, J 9.7, 2.8 Hz, H-C1/3); 31P NMR (160 MHz, 1H-decoupled, MeOD) d (ppm) -2.04 (P-C5); [m/z (ESI) (M+Na)+
C14H19NaO9P calculated 385.0659, found 385.0665].
e6 Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Synthesis of 5-O-(o-xylylenephospho)-myo-inositol 1,2,3,4,6-penta-O-sulfate 11
A solution of 5-O-(o-xylylenephospho)-myo-inositol 6 (47 mmol, 1 eq.) in dry DMF (1.6 mL, 0.03 M) was treated with sulfur trioxide
triethylamine complex (213 mg, 1175 mmol, 25 eq.). After 10 min, the reaction mixture was cooled at -10ꢀC, treated with trifluorome-
thanesulfonic acid (20.8 mL, 235 mmol, 4 eq.) and stirred to 4ꢀC for 16 h. The reaction mixture was neutralized by the addition of Et3N
and concentrated to dryness at rt in vacuo and then under high vacuum. The mixture was used without further purification in the next
1
2
step to avoid compound decomposition. H NMR (400 MHz, MeOD) d (ppm) 7.42 (4H, s, Ph), 5.95 (2H, d, JHH 13.6, 3JHP 6.1 Hz,
3
2
CHaHb-Ph), 5.54 (2H, br, H-C4/6), 5.26 (1H, d, J 10.7 Hz, H-C2), 5.13 (2H, br, H-C1/3), 4.95 (2H, dd, JHP 25.4, JHH 13.6 Hz,
CHaHb-Ph), 4.87 (1H, t, J 3.7 Hz, H-C5); 13C NMR 500 MHz (125 MHz, MeOD) d (ppm) 137.0 (2xiPh), 129.4 (2xPh), 129.1(2xPh),
74.2-74.3 (4C, m, C1/3-C4/6), 72.1 (C2), 69.9 (2C, d, JCP 8.2 Hz, CHaHb-Ph), 69.1 (2C, d, JCP 8.2 Hz, C5); 31P NMR (160 MHz,
2
2
1H-decoupled, MeOD) d (ppm) -6.23 (P-C5).
Synthesis of 5-O-phosphate-myo-inositol 1,2,3,4,6-penta-O-sulfate IP1S5
To a solution of pentasulfate 11 (26 mmol, 1 eq.) in MeOH/H2O (1:3, 8 mL, 4 mM) under nitrogen atmosphere was added Pd on
activated carbon 10 % (w/w) (10 mg, 9 mmol, 0.3 eq.). The reaction mixture was evacuated and flushed with hydrogen gas, the oper-
ation was repeated 3 times and the reaction mixture was stirred vigorously at rt for 4 h. The reaction mixture was flushed with
nitrogen, neutralized with concentrated NH4OH (few drops) to basic pH, filtered through a pad of celite and concentrated to dryness.
Purification by size exclusion chromatography (Sephadex G10) afforded clean product IP1S5 as a white solid (ammonium salt,
10.29 mmol, 40 % over 2 steps, the concentration of the final product was determined by 1H NMR with dioxane as internal reference).
1H NMR (400 MHz, D2O) d (ppm) 5.31 (1H, br, H-C2), 4.85 (2H, br), 4.68 (2H, br), 4.42-4.50 (1H, m, H-C5), 3.22 (42H, q, J 7.3 Hz,
CH3CH2NH), 1.30 (63H, t, J 7.3 Hz, CH3CH2NH); 13C NMR 500 MHz (125 MHz, D2O) d (ppm) 76.0 (br, C4/6), 73.7 (s, C1/3),
+ +
46.7 (CH3CH2NH), 8.3 (CH3CH2NH); 31P NMR (162 MHz, 1H-decoupled, D2O) d (ppm) -0.60 (P-C5); [m/z (ESI) [IP1S57-$3H+$5NH4
]
C6H29N5O24P1S5 calculated 745.9538, found 745.9541]. C2 and C5 were neither visible on the 13C NMR nor on the HSQC spectra.
Synthesis of IP2S4
Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019 e7

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Synthesis of 2-O-(tert-butyldimethylsilyl)-1,3,5-orthoformate-myo-inositol 12
2-O-tert-butyldimethylsilyl compound 12 was synthesized as described in the literature (Angyal, 2000). Purification by flash
chromatography (SiO2, EtOAc/hexane 30%) afforded 12 as white crystals (332 mg, 1.09 mmol, 50 %). 1H NMR (400 MHz, CDCl3)
d (ppm) 5.51 (1H, d, 5J 1.4 Hz, H-C7), 4.59 (2H, dt, J 7.6, 3.9 Hz, H-C4/6), 4.25-4.29 (2H, m, H-C2, H-C5), 4.16 (2H, dt, J 4.6,
1.7 Hz, H-C1/3), 3.17 (2H, d, J 7.6 Hz, OH), 0.95 (9H, s, (CH3)3C-Si), 0.16 (6H, s, CH3-Si). In accordance with the literature (Angyal,
2000).
Synthesis of 2-O-(tert-butyldimethylsilyl)-4,6-di-O-(o-xylylenephospho)-1,3,5-orthoformate myo-inositol 13
A solution of 2-O-tert-butyldimethylsilyl compound 12 (50 mg, 0.16 mmol, 1 eq.) in dry CH2Cl2 (3 mL) under an atmosphere of nitrogen
was treated with tetrazole in acetonitrile 0.45 M (3 mL, 1.31 mmol, 8 eq.) and o-xylylene-N,N-diethylphosphoramidite (174 mg,
0.66 mmol, 4 eq.). The reaction mixture was stirred at rt for 20 h. A solution of mCPBA (75 % w/w, 453 mg, 1.97 mmol, 12 eq.) in
about 6 mL CH2Cl2 was dried over Na2SO4, added at -10ꢀC to the reaction mixture and stirred at rt for an additional 30 min. The
mixture was then diluted in EtOAc, washed with a saturated solution of aqueous NaHCO3 and with brine. The organic phase was
dried over Na2SO4, filtered and evaporated to dryness. Purification by flash chromatography (SiO2, MeOH/ CH2Cl2 gradually
from 0 -> 1 -> 2 %) gave a mixture of product 12 and reagent by-product. Trituration in Et2O afforded the pure product 13 as a white
solid (103 mg, 0.15 mmol, 93 %). 1H NMR (400 MHz, CDCl3) d (ppm) 7.34-7.39 (4H, m, H-Ph), 7.23-7.26 (2H, m, H-Ph), 7.21-7.18 (2H,
3
m, H-Ph), 5.52 (1H, d, 5J 1.3 Hz, H-C7), 5.24 (2H, dt, JHP 8.3, J 3.8 Hz, H-C4/6), 5.06-5.24 (8H, m, CHaHb-Ph), 4.59-4.62 (1H, m,
H-C5), 4.32-4.34 (2H, m, H-C1/3), 4.29-4.30 (1H, m, H-C2), 0.94 (9H, s, (CH3)3C-Si), 0.15 (6H, s, CH3-Si); 13C NMR (125 MHz,
3
CDCl3) d (ppm) 135.3 (2xiPh), 135.2 (2xiPh), 129.59 (2xPh), 129.55 (2xPh), 129.3 (4xPh), 102.8 (C7), 72.7 (2C, d, JCP 4.4 Hz,
2
2
2
3
C1/3), 71.5 (2C, d, JCP 5.3 Hz, C4/6), 68.9 (2C, d, JCP 6.4 Hz, 2xCH2-Ph), 68.8 (2C, d, JCP 6.3 Hz, 2xCH2-Ph), 68.0 (t, JCP
5.6 Hz, C5), 60.2 (C2), 26.0 (3x(CH3)3C-Si), 18.5 ((CH3)3C-Si), -4.6 (2xCH3-Si); 31P NMR (162 MHz, 1H-decoupled, CDCl3)
d (ppm) -1.81 (P-C4/6); [m/z (ESI) (M+H)+ C19H39O12P2Si calculated 669.1681, found 669.1682].
Synthesis of 4,6-di-O-phosphate-myo-inositol 4
Protected inositol phosphate 12 (1 eq.) in MeOH/DCM 30% (0.05 M) was treated with TMSBr (56 eq.) and stirred for 5 h. The reaction
mixture was degased with N2 and the HBr was neutralized with 1 M NaOH solution. After 1-2 h it was concentrated to dryness. The
crude was triturated with acetone and then with ACN to afford clean bisphosphate 4 as a white solid (539 mg, 95%). 1H NMR
(500 MHz; D2O): d 4.19 (q, J = 9.1 Hz, 2H), 4.02 (t, J = 2.8 Hz, 1H), 3.65 (dd, J = 9.7, 2.8 Hz, 2H), 3.55 (t, J = 9.3 Hz, 1H); 31P NMR
NMR (203 MHz; D2O): d 0.6; 13C NMR (126 MHz; D2O): d 79.0 (d, 1JCP=5.51 Hz), 75.9 (t, 2JCP=3.81), 74.0, 73.7; [m/z (ESI) (M+H)+
C6H15O12P2 required 341.0033, found 341.0037].
e8 Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Synthesis of 4,6-di-O-phosphate-myo-inositol 1,2,3,5-tetra-O-sulfate IP2S4
Myo-inositol diphosphate 4 (30 mg, 0.077 mmol) was suspended in anhydrous DMF. To this, SO3$DMF complex (142 mg,
0.925 mmol) was added. The mixture was allowed to stir at r.t. for 1h. The reaction was neutralized with ca. 0.3mL dilute NaOH
and the salts were precipitated by adding 1 mL ethanol. The solid was dissolved in 1 mL water and loaded onto an LH-20 column
(1.6 cm diameter x 5 cm) and eluted with water. Fractions containing product were lyophilized to yield 8 mg IP2S4 (0.012mmol,
15% yield) as determined by 1H NMR with trioxane as an internal standard. 1H NMR (400 MHz; D2O): d 5.15 (s, trioxane), 4.99
(t, J = 3.6 Hz, 1H), 4.92-4.89 (m, 2H), 4.87-4.82 (m, 2H), 4.66-4.63 (m, 1H); 13C NMR (126 MHz; D2O): d 93.5 (trioxane), 75.8, 74.2,
2
+ +
71.01 (d, JCP = 4.38 Hz), 68.9; 31P NMR (203 MHz; D2O): d 3.6. [m/z (ESI) [IP2S48-$6H+$3NH4
] C6H24N3O24P2S4 calculated
711.9102, found 711.9100.]
Synthesis of IT2S4
Synthesis of 2-O-(tert-butyldimethylsilyl)-4,6- di-(o-xylylenethiophospho)-1,3,5-orthoformate myo-inositol 14
A solution of 2-O-tert-butyldimethylsilyl compound 12 (48.8 mg, 0.16 mmol, 1 eq.) in dry CH2Cl2 (2.9 mL) under an atmosphere of
nitrogen was treated with tetrazole in acetonitrile 0.45 M (2.9 mL, 1.28 mmol, 8 eq.) and o-xylylene-N,N-diethylphosphoramidite
(153 mg, 0.641 mmol, 4 eq.). The reaction mixture was stirred at rt overnight. Pyridine (6 mL) and sulfur (102.4 mg, 3.2 mmol,
20 eq.) were then added and the mixture was stirred overnight before concentration under reduced vacuum. The residue was dis-
solved in CH2Cl2 and washed with a saturated solution of aqueous NaHCO3. The organic phase was dried over Na2SO4, filtered and
evaporated to dryness. Purification by flash chromatography (SiO2, CH2Cl2/toluene gradually from 0 to 100%) gave product 14
(62.7 mg, 0.089 mmol, 56%). 1H-NMR (400 MHz; CDCl3): d 7.35-7.29 (m, 4H), 7.15 (dd, J = 6.6, 2.1 Hz, 2H), 7.07-7.04 (m, 2H),
5.54 (d, J = 1.1 Hz, 1H), 5.45-5.41 (m, 2H), 5.30-4.97 (m, 8H), 4.51-4.49 (m, 1H), 4.33-4.32 (m, 2H), 4.27 (d, J = 1.3 Hz, 1H), 0.93
(s, 9H), 0.13 (s, 6H); 31P-NMR (162 MHz; CDCl3): d 70.1; 13C NMR (101 MHz; CDCl3): d 135.1, 129.04, 129.00, 128.96, 102.7,
72.59, 72.55, 71.84, 71.79, 68.95, 68.88, 68.81, 68.74, 68.20, 68.13, 68.07, 60.4, 25.9, 18.3, -4.7.
Synthesis of 4,6-(di- O-thiophosphate)-myo-inositol 7
Protected inositol thiophosphate 14 (89 mg, 0.127 mmol) was stirred in 1mL TFA. To this, 0.3 mL each of thiophenol and m-cresol
were added followed by dropwise addition of TMSBr (0.3 mL, 1.69 mmol). The mixture was allowed to stir at r.t. for 3h. Toluene was
then added and the solution was co-evaporated 3 times with toluene in vacuo. The residue was then neutralized with 1M NaOH and
the aqueous layer was washed with dichloromethane. The aqueous layer was then loaded on a PD-10 column (GE Healthcare) and
the product was eluted with water and lyophilized to yield 43.6 mg, 0.118 mmol, 93% yield) as determined by 1H NMR with
trioxane as an internal standard. 1H NMR (500 MHz; D2O): d 5.24 (s, trioxane), 4.46 (q, J = 9.7 Hz, 2H), 4.10 (t, J = 2.4 Hz, 1H),
3.73 (dd, J = 9.7, 2.8 Hz, 2H), 3.60 (t, J = 9.3 Hz, 1H); 31P NMR (203 MHz; D2O): d 46.1; 13C NMR (126 MHz; D2O): d 93.46 (trioxane)
76.94 (d, 2JCP = 6.45 Hz), 73.1, 71.21, 71.12.
Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019 e9

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
Synthesis of 4,6-di-(O-thiophosphate)-myo-inositol 1,2,3,5-tetra-O-sulfate IT2S4
Sulphur trioxide (43 mg, 0.283 mmol, 12 eq.) was added to a suspension of inositol phosphate 7 (9.8 mg, 0.023 mmol, 1 eq.) in
DMF and stirred for 35 min. The reaction was quenched by adding ca. 0.6mL 1N NaOH, until pH 8. 3mL of MeOH was added to
precipitate salts. The filtered solid was purified by size exclusion using Sephadex LH-20 resin (2.5g dry resin, equilibrated and eluted
with water) to obtain 6.1mg of product (0.0077 mmol, 33% yield). 1H NMR (500 MHz; D2O): d 5.06-5.03 (m, 3H), 5.01 (b, 1H), 4.99
2
(t, J = 3.3 Hz, 1H), 4.74-4.72 (m, 1H); 13C NMR (126 MHz; D2O): d 75.6, 74.3, 71.39 (d, JCP = 4.4 Hz), 69.1; 31P NMR (203 MHz;
D2O): d 44.0.
Analogue Solubility Measurements by ICP-MS
100 mM solutions of inositol hexakisphosphate (IP6) analogues with or without 10 mM CaCl2 were prepared in 10 mM Tris pH 7.4 and
incubated with agitation for 2 h at 37ꢀC. The solutions were immediately filtered through 0.2 mm nylon filters equilibrated to 37ꢀC. The
phosphorous content in each filtrate was determined by inductively coupled plasma-mass spectrometry (ICP-MS). The values
obtained were divided by the number of phosphates in each IP6 analogue to determine the concentration of the compound in the
solutions.
Free Calcium Ion Quantification
A fresh 1 mM solution of murexide (Merck, Germany) was prepared in 10 mM tris pH 7.4. For each IP6 analogue, samples containing
0.5 mM analogue, murexide and CaCl2 in 50 mL 10 mM tris were prepared in triplicate. After 5 min incubation at room temperature, the
samples were centrifuged at 20,000 X G for 2 min and the upper 40 mL of the supernatant transferred to a 384-well plate. Samples
without IP6 analogue containing CaCl2 from 1 mM to 20 mM, and 20 mM were also prepared and used for calibrating each
experiment. The absorbance was measured at 474 nm and 544 nm and the data analyzed as reported by Ohnishi (Ohnishi, 1978)
The experiment was repeated in triplicate.
Compound Phytase Stability Assay
3 mg of IP2S4 or IT2S4 was dissolved in D2O (600 mL) and 100 mM tris pH 7.4 buffer (70 mL) was added. If needed the pH was
adjusted 7.4. A 31P NMR was recorded (t=0). 30 mL of 3-phytase from Aspergillus niger (Natuphos, BASF, purified from the formu-
lation according to (Oakley, 2010)) at 4.64 mg/mL was added to each tube. The 31P NMR was recorded at various time points.
Plasmid Construction
To generate recombinant cysteine protease domain from TcdB (rCPD, His6-TcdB511843), the nucleotide sequence coding for amino
acids 520—843 of TcdB from ribotype 078 C. difficile was amplified from genomic DNA (kindly donated by Prof. Roger Stephan,
University of Zurich, Switzerland) by PCR with the forward primer GGCTAGCTGGACATTTGACGATGCAAG (NheI restriction site
underlined) and the reverse primer CGAAGCTTTCAGGCTTCTTCAATCCTTTCCTCAA (HindIII restriction site underlined, STOP
codon in italic). The DNA was subsequently cloned into pET28a plasmid (Novagen, Germany) using standard techniques and the
resulting plasmid transformed into BL21(DE3). To generate truncated recombinant cysteine protease domain from TcdB (tCPD,
His6-TcdB545-797), the nucleotide sequence coding for amino acids 545—797 was amplified by PCR using the forward primer
GCCGCGGCTGAAGATGATAATCTTGATTT (SacII restriction site underlined) and the reverse primer CGAAGCTTTCACAGCTCAG
GTAAATTTTT (HindIII restriction site underlined, STOP codon in italic). The DNA was cloned into pET47b (Novagen, Germany)
and the resulting plasmid also transformed into BL21(DE3). All primers were purchased from Microsynth (Switzerland).
Recombinant Protein Expression and Purification
rCPD and tCPD were both expressed and purified according to the following protocol. Overnight cultures of transformed BL21(DE3)
were diluted 1:100 in 1 L Terrific Broth (Sigma-Aldrich, USA) and grown at 37ꢀC until an OD600 of 0.6—0.8 was reached. IPTG was
added to a final concentration of 0.5 mM and the cultures grown for 3 h at 30ꢀC. The cultures were pelleted by centrifugation at
4,000 X G for 15 min at 4ꢀC and resuspended in sonication buffer (20 mM NaH2PO4, 100 mM NaCl, 1 mM MgCl2) with 1 mg/mL
lysozyme from chicken egg white (Sigma-Aldrich, USA) and 10 U/mL benzonase (Sigma-Aldrich, USA). The lysates were incubated
for 30 min on ice and then sonicated with a probe sonicator before centrifugation at 10,000 x G for 20 min. Recombinant proteins were
purified from the cleared lysate by immobilized metal-ion affinity chromatography using 50 % Ni-NTA resin (Qiagen, Germany)
according to the manufacturer’s instructions for batch purification. Eluted fractions containing protein were buffer exchanged into
e10 Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
20 mM Tris, 60 mM NaCl, 250 mM sucrose pH 7.4 using PD Midi Trap G-25 columns (GE Healthcare Life Sciences, UK) and
supplemented with 10 % glycerol before storage at -80ꢀC.
Intrinsic Tryptophan Fluorescence Assay
The intrinsic fluorescence of the lone tryptophan residue in tCPD was exploited to determine the Kd of the interaction between IP6
analogues and the toxin fragment using an assay based on that described by Shen et al.(Shen et al., 2011) 200 mL of 20 mM tCPD in
20 mM tris, 60 mM NaCl, 250 mM sucrose pH 7.4 were added to three wells per IP6 analogue in a 96-well plate. Small aliquots of IP6
analogue stock solutions were added up to a maximal concentration of 200 mM. At each step, the samples were excited at 295 nm
and the emission recorded between 325 nm and 360 nm on a plate reader (Tecan infinite M200, Tecan, Switzerland). All measure-
ments were made at 25ꢀC. The maximum responses (obtained at an emission wavelength of 333 nm) were plotted against analogue
concentration and the data fitted with a rectangular hyperbolic function. The data were normalized and the Kd determined for each
IP6 analogue using OriginPro (OriginLab, MA, USA).
For the IT2S4 Kd measurement, tCPD was both expressed and purified according to the following protocol. 5ml of overnight cul-
tures of transformed BL21(DE3) were diluted 1:200 in 1 L Kan+ Terrific Broth and grown at 37ꢀC until an OD600 of 0.6—0.8 was
reached. IPTG was added to a final concentration of 0.5 mM and the cultures grown for 3 h at 30ꢀC. The cultures were pelleted
by centrifugation at 4,000 X G for 15 min at 4ꢀC and resuspended in sonication buffer (20 mM NaH2PO4, 100 mM NaCl, 1 mM
MgCl2) with 1 mg/mL lysozyme from chicken egg white and 10 U/mL benzonase. The lysates were incubated for 30 min on ice
and then sonicated with a probe sonicator before centrifugation at 10,000 x G for 20 min. Recombinant proteins were purified
from the cleared lysate by immobilized metal-ion affinity chromatography using 50 % Ni-NTA resin packed into a gravity flow column.
Eluted fractions containing protein were buffer exchanged and repurified into LEW Buffer (50 mM Na2HPO4, 300 mM NaCl, pH 8.0)
using a Superdex 75 HiLoad Prep column and supplemented with 10 % glycerol before storage at -80ꢀC.
200 mL of 20 mM tCPD in LEW Buffer (50 mM Na2HPO4, 300 mM NaCl, pH 8.0) were added to three wells per IP6 analogue in a
96-well plate. Small aliquots of IP6 analogue stock solutions were added up to a maximal concentration of 200 mM. At each step,
the samples were excited at 295 nm and the emission scan spectra recorded between 325 nm and 360 nm on a plate reader (EnSpire,
Perkin Elmer). All measurements were made at room temperature. The maximum responses (obtained at an emission wavelength of
330 nm) were plotted against analogue concentration and the data fitted with a rectangular hyperbolic function. The data were
normalized and the Kd determined for each IP6 analogue using Prism 7 (GraphPad).
Trypsin Digestion Assay
tCPD (0.2 mg/mL) was added to 1 mM IP6 analogue in 10 mL 100 mM tris pH 7.4 and incubated at 37ꢀC for 30 min. Trypsin (1 mL) was
added to a final concentration of 0.3 ng/mL and incubated at 37ꢀC for 10 min. Laemmli sample buffer (5X) was added to each reaction
before heating for 3 min at 95ꢀC to stop the reactions. Controls with and without trypsin (both without IP6 analogues) were included in
every experiment. The cleavage products were visualized by SDS-PAGE followed by Coomassie staining. The gels were imaged and
band intensities were quantified using ImageJ (http://rsbweb.nih.gov/ij/). The extent of digestion as normalized to the controls.
Cleavage Assays with Recombinant Toxin
Serial dilutions of the IP6 analogues were prepared in 100 mM pH 7.4 Tris buffer to which 0.85 mM rCPD was added with or without
10 mM CaCl2 in a total volume of 13.3 mL. After a 2 h incubation at 37ꢀC, the reactions were put on ice and 10 mM EDTA added to the
samples containing calcium. Laemmli sample buffer (5X) was added before heating the samples at 95ꢀC for 3 minutes. The cleavage
products were visualized by SDS-PAGE followed by Coomassie staining. The gels were imaged and band intensities were quantified
using ImageJ. Every gel included a negative control (no IP6) and a positive control (maximum cleavage, induced by 1 mM IP6 in the
absence of calcium), which were used as internal references for minimal and maximal cleavage, respectively. All experiments were
made in triplicate. Molar extent of cleavage (EoC) was first calculated for each lane according to the following formula, which takes
into account the difference in molecular weight of the uncleaved and cleaved protein fragments: EoC = (I34/34)/(I34/34 + I40/40), where
I
34 and I40 correspond to the intensity of the cleaved and uncleaved bands, respectively (rCPD has a molecular weight of 40 kDa,
which decreases to 34 kDa after release of the N-terminus). The EoC values obtained were then normalized to the internal references
for minimal and maximal cleavage according to the following formula:
EoCnorm = (EoC – EoCmin)/(EoCmax - EoCmin).
Half-maximal effective concentrations (EC50) values were calculated for each analogue in presence and absence of 10 mM CaCl2
from logistic fitting of plots of EoCnorm values versus concentration using OriginPro.
Cleavage Assays with Holotoxin
1 mM IP6 analogues were equilibrated with 10 mM CaCl2 in 100 mM tris pH 7.4 for 15 min at 37ꢀC before addition of 150 ng TcdB
(TgcBiomics, Germany) in a total volume of 20 mL. A negative control (no IP6, 10 mM CaCl2) and a positive control (1 mM IP6)
were also included on every gel. The reaction mixtures were incubated for 3 h at 37ꢀC and then placed on ice. Laemmli sample buffer
(5X) was added to stop the reactions and 10 mM EDTA was added to the samples containing CaCl2 before heating at 95ꢀC for
3 minutes. The cleavage products were visualized by SDS-PAGE (using 15-well 8 % acrylamide Precise Tris-Glycine gels,
Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019 e11

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
ThermoScientific, USA) followed by silver staining according to a modified Vorum protocol (Mortz et al., 2001) with the thiosulphate
sensitization step extended to 10 min. The linearity of the staining protocol was verified with serial dilutions of TcdB starting at
160 ng/lane down to 20 ng/lane. The band intensities were quantified as described for the cleavage assays with recombinant toxin.
The experiment was done in triplicate.
Inhibition of TcdB Toxicity in Cell Assays
3T3-L1 fibroblasts (gift from Prof. Michael Detmar) were maintained in DMEM with 10 % bovine serum. Cell lines are regularly
assayed for mycoplasma contamination in our laboratory. For experiments, cells were seeded at a density of 2 x 103 cells per
well in 90 mL on an E-plate View 16 and the cell index monitored using an xCelligence RTCA DP (ACEA Biosciences) impedance
monitoring system. 100 ng TcdB was incubated alone, with 1 mM IP6 or with 1 mM IP2S4 in 10 mL 100 mM tris buffer pH 7.4 for
1 h at 37ꢀC before dilution by 1:100 in culture medium. Ten mL of the diluted reaction mixtures were added to cells grown to
sub-confluence for 24 h. The cell index of all wells was normalized to 1.0 immediately after addition of the toxin. Two wells were
used for each reaction mixture per experiment, and the experiment was repeated on three different days.
Bacterial Culture for Monocolonisation
LB broth was aseptically inoculated from single colonies of Escherichia coli JM83 and incubated with shaking at 160 rpm at 37ꢀC for
12 hours. Bacteria were harvested by centrifugation (15 min, 3,500 X g) in a 400 mL sterile flask, washed in sterile PBS and concen-
trated to a density of about 109 CFU/ml in PBS, all performed aseptically under a sterile laminar flow hood. Bacterial suspensions
were sealed in sterile tubes, with the outside surface kept sterile, and imported into gnotobiotic isolators.
Testing of IP2S4 in Mouse Model
Germ-free NIH Swiss mice were rederived at the McMaster University Axenic Gnotobiotic Unit (AGU) by an axenic two-cell embryo
transfer technique previously described (Slack et al., 2009). Germ-free mouse colonies were maintained in flexible film isolators at the
axenic gnotobiotic unit (AGU) at McMaster University, and axenic status of the mice was routinely confirmed by a combination of
culture- and non-culture-based techniques in faecal and caecal contents (Natividad et al., 2013). Periodic serological testing was
also performed for viruses, parasites, and known pathogens (Charles Rivers Laboratories). All mice had unlimited access to auto-
claved food and water. Both male and female mice were used at the age of 8 to 12 weeks. All experiments were carried out in
accordance with the McMaster University animal utilization protocols. In order to prime the immune system, but limit colonization
resistance provided by a complex microbiota, germ-free NIH Swiss mice were monocolonised with E. coli JM83 by intragastric
gavage using 109 CFU in 200 mL of PBS per mouse. Three weeks post mono-colonization, mice were gavaged with faecal content
from a patient with recurrent CDI (C. difficile NAP1, 200 mL of a 1:10 dilution in saline per mouse). Mice then received IP6, IP2S4 or
myo-inositol in drinking water (12.3 mmol/kg in 5 mL of water/ mouse) starting 6 hours after C. difficile inoculation (n = 7 – 9). In addi-
tion, all mice received one dose of IP6, IP2S4 or myo-inositol by intragastric gavage (12.3 mmol/kg) at noon on days 2, 3, 4 and 5. On
the afternoon of day 5, the mice were sacrificed and the colon excised for histological evaluation and myeloperoxidase activity as
described before (Natividad et al., 2012).
Testing of IT2S4 in Survival Mouse Model
Groups (n = 5 -17) of female, 8 – 10 week-old C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME) were used. The animals were
maintained and used in accordance with the recommendations of the Canadian Council on Animal Care Guide to the Care and Use of
Experimental Animals. All experimental procedures were approved by the institutional animal care committee. At -3 to -6 days, the
regular drinking water of the mice was replaced with antibiotic cocktail-supplemented drinking water as described by Chen et al.
(Chen et al., 2008). At day -3, mice were provided with regular water (acidified Milli-Q), which was then replaced by tap water at
-1 day when the animals were also treated i.p. with clindamycin (20 mg/kg body weight, Sandoz, Boucherville, QC). With the excep-
tion of the uninfected control group, all the mice were orally inoculated with 5 x 105 C. difficile VPI10463 spores at day 0 and the actual
inocula were confirmed in each experiment by quantitative bacterial culture (Aubry et al., 2012). Five hours after the spore inoculation,
the mice were treated p.o. with varying doses of IT2S4 b.d. for day 1 and t.i.d. for day 1-3, vancomycin (Sigma, 50 mg/kg) q.d. for
5 days (treatment control), or diluent (placebo control). Mice were monitored daily (twice or thrice for day 2 and 3) and their clinical
signs and body weight from day -1 to day 10 were recorded and analysed. The researchers involved in the mouse studies were
blinded to the treatment group assignment during the experimental period.
Acute Oral Toxicity
The experimental design follows the protocol from the Organisation for Economic Co-operation and Development (OECD) Test
Guideline 425. Individual female 6-10 week-old C57BL/6J mice (Jackson Laboratories) were dosed by oral gavage once daily in
sequence, starting at 175 mg/kg. When the animal did not show signs of toxicity, the next animal received a higher dose until the
upper boundary of 2000 mg/kg was reached. The animals were monitored daily for food consumption, diarrhea, ruffled fur, hunched
posture and activity. Body weight was measured daily.
e12 Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019

Please cite this article in press as: Ivarsson et al., Small-Molecule Allosteric Triggers of Clostridium difficile Toxin B Auto-proteolysis as a Therapeutic
Strategy, Cell Chemical Biology (2018), https://doi.org/10.1016/j.chembiol.2018.10.002
QUANTIFICATION AND STATISTICAL ANALYSIS
For in vitro assays, data were assumed to be normally distributed and Tukey’s two-tailed test in conjunction with one-way analysis of
variance was used to determine statistically significant differences (P < 0.05). For the MPO assay, the distributions were skewed and
therefore a two-tailed Mann-Whitney U test on ranks was used for evaluating statistically significant differences (P < 0.05).
Cell Chemical Biology 26, 1–10.e1–e13, January 17, 2019 e13