Berberrubine attenuates mucosal lesions and inflammation in dextran sodium sulfate-induced colitis in mice

Article abstract of DOI:10.1371/journal.pone.0194069

Ulcerative colitis (UC) is a chronic relapsing disease without satisfactory treatments, in which intestinal inflammation and disrupted intestinal epithelial barrier are two main pathogeneses triggering UC. Berberrubine (BB) is deemed as one of the major active metabolite of berberine (BBR), a naturally-occurring isoquinoline alkaloid with appreciable anti-UC effect. This study aimed to comparatively investigate the therapeutic effects of BB and BBR on dextran sodium sulfate (DSS)-induced mouse colitis model, and explore the potential underlying mechanism. Results revealed that BB (20 mg/kg) produced a comparable therapeutic effect as BBR (50 mg/kg) and positive control sulfasalazine (200 mg/kg) by significantly reducing the disease activity index (DAI) with prolonged colon length and increased bodyweight as compared with the DSS group. BB treatment was shown to significantly ameliorate the DSS-induced colonic pathological alternations and decreased histological scores. In addition, BB markedly attenuated colonic inflammation by alleviating inflammatory cell infiltration and inhibiting myeloperoxidase (MPO) and cytokines (TNF-α, IFN-γ, IL-1β, IL-6, IL-4 and IL-10) productions in DSS mice. Furthermore, BB treatment substantially upregulated the expression of tight junction (TJ) proteins (zonula occludens-1, zonula occludens-2, claudin-1, occludin) and mRNA expression of mucins (mucin-1 and mucin-2), and decreased the Bax/Bcl-2 ratio. In summary, BB exerted similar effect to its analogue BBR and positive control in attenuating DSS-induced UC with much lower dosage and similar mechanism. The protective effect observed may be intimately associated with maintaining the integrity of the intestinal mucosal barrier and mitigating intestinal inflammation, which were mediated at least partially, via favorable modulation of TJ proteins and mucins and inhibition of inflammatory mediators productions in the colonic tissue. This is the first report to demonstrate that BB possesses pronounced anti-UC effect similar to BBR and sulfasalazine with much smaller dosage. BB might have the potential to be further developed into a promising therapeutic option in the treatment of UC.

Full text of DOI:10.1371/journal.pone.0194069

RESEARCH ARTICLE
Berberrubine attenuates mucosal lesions and
inflammation in dextran sodium sulfate-
induced colitis in mice
Xiu-Ting Yu1☯, Yi-Fei Xu2☯, Yan-Feng Huang3, Chang Qu3, Lie-Qiang Xu3, Zi-Ren Su3,4
Hui-Fang Zeng1, Lin Zheng5, Tie-Gang Yi5, Hui-Lin Li5, Jian-Ping Chen5*, Xiao-
Jun Zhang2*
,
1 The First Affiliated Hospital of Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou,
Guangdong, PR China, 2 School of Chinese Materia Medica, Guangzhou University of Chinese Medicine,
Guangzhou, Guangdong, PR China, 3 Guangdong Provincial Key Laboratory of New Chinese Medicinal
Development and Research, Mathematical Engineering Academy of Chinese Medicine, Guangzhou
University of Chinese Medicine, Guangzhou, Guangdong, PR China, 4 Dongguan Mathematical Engineering
Academy of Chinese Medicine, Guangzhou University of Chinese Medicine, Dongguan, Guangdong, PR
China, 5 Shenzhen Key Laboratory of Hospital Chinese Medicine Preparation, Shenzhen Traditional Chinese
Medicine Hospital, Guangzhou University of Chinese Medicine, Shenzhen, PR China
a1111111111
a1111111111
a1111111111
a1111111111
a1111111111
☯ These authors contributed equally to this work.
* zhangxj@gzucm.edu.cn (Xiao-Jun Zhang); lycjp@126.com (Jian-Ping Chen)
OPEN ACCESS
Citation: Yu X-T, Xu Y-F, Huang Y-F, Qu C, Xu L-Q,
Su Z-R, et al. (2018) Berberrubine attenuates
mucosal lesions and inflammation in dextran
sodium sulfate-induced colitis in mice. PLoS ONE
13(3): e0194069. https://doi.org/10.1371/journal.
pone.0194069
Abstract
Ulcerative colitis (UC) is a chronic relapsing disease without satisfactory treatments, in
which intestinal inflammation and disrupted intestinal epithelial barrier are two main patho-
geneses triggering UC. Berberrubine (BB) is deemed as one of the major active metabolite
of berberine (BBR), a naturally-occurring isoquinoline alkaloid with appreciable anti-UC
effect. This study aimed to comparatively investigate the therapeutic effects of BB and BBR
on dextran sodium sulfate (DSS)-induced mouse colitis model, and explore the potential
underlying mechanism. Results revealed that BB (20 mg/kg) produced a comparable thera-
peutic effect as BBR (50 mg/kg) and positive control sulfasalazine (200 mg/kg) by signifi-
cantly reducing the disease activity index (DAI) with prolonged colon length and increased
bodyweight as compared with the DSS group. BB treatment was shown to significantly ame-
liorate the DSS-induced colonic pathological alternations and decreased histological scores.
In addition, BB markedly attenuated colonic inflammation by alleviating inflammatory cell
infiltration and inhibiting myeloperoxidase (MPO) and cytokines (TNF-α, IFN-γ, IL-1β, IL-6,
IL-4 and IL-10) productions in DSS mice. Furthermore, BB treatment substantially upregu-
lated the expression of tight junction (TJ) proteins (zonula occludens-1, zonula occludens-2,
claudin-1, occludin) and mRNA expression of mucins (mucin-1 and mucin-2), and
decreased the Bax/Bcl-2 ratio. In summary, BB exerted similar effect to its analogue BBR
and positive control in attenuating DSS-induced UC with much lower dosage and similar
mechanism. The protective effect observed may be intimately associated with maintaining
the integrity of the intestinal mucosal barrier and mitigating intestinal inflammation, which
were mediated at least partially, via favorable modulation of TJ proteins and mucins and
inhibition of inflammatory mediators productions in the colonic tissue. This is the first
report to demonstrate that BB possesses pronounced anti-UC effect similar to BBR and
Editor: Hiroyasu Nakano, Toho Daigaku, JAPAN
Received: July 1, 2017
Accepted: February 25, 2018
Published: March 14, 2018
Copyright: © 2018 Yu et al. This is an open access
article distributed under the terms of the Creative
Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in
any medium, provided the original author and
source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information
files.
Funding: This work was supported by: 1.
Hongkong, Macao and Taiwan Science &
Technology Cooperation Program of China
(2014DFH30010), http://www.most.gov.cn/, (Zi-
Ren Su: study design); 2. Science and
Technology Planning Project of Guangdong
Province, China (2013B090600007), http://www.
gdstc.gov.cn/, (Zi-Ren Su: study design); 3.
Science and Technology Planning Project of
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
1 / 15

Berberrubine and DSS-induced ulcerative colitis
Guangdong Province, China (2013B090600026),
http://www.gdstc.gov.cn/, (Hui-Fang Zeng: study
design); 4. Guangdong International Cooperation
Project (2013508102016), http://www.gdstc.gov.
cn/, (Zi-Ren Su: study design); 5. Shenzhen
Science and Technology Plan Project
sulfasalazine with much smaller dosage. BB might have the potential to be further devel-
oped into a promising therapeutic option in the treatment of UC.
(ZDSYS201606081515458), http://www.szsti.
gov.cn/, (Jian-Ping Chen: study design); 6.
Shenzhen Science and Technology Plan Project
(JCYJ20140408153331810), http://www.szsti.
gov.cn/, (Jian-Ping Chen: study design); 7.
Natural Science Foundation of Guangdong
Province (2015A030310247), http://www.gdstc.
gov.cn/, (Jian-Ping Chen: study design).
Introduction
Ulcerative colitis (UC), a subtype of inflammatory bowel disease (IBD), is clinically character-
ized by acute abdominal pain, weight loss, diarrhea, even hematochezia which severely lower
the quality of life [1]. Nowadays, there are different drugs for UC treatment, including 5-ami-
nosalicylic acid, steroid hormone, immunosuppressive agents and anti-tumor necrosis factor-
α (anti-TNF-α) agent. However, the frequency and severity of side effects, inconvenient dosing
regimen, and partially prohibitive price limit their clinical application [2]. Therefore, it is of
great significance to seek effective alternative for the treatment of UC.
Competing interests: The authors have declared
that no competing interests exist.
Inflammation responses are one of the most crucial factors causing UC [3]. The increased
pro-inflammatory cytokines such as TNF-α, IFN-γ, and IL-1β, extend the inflammatory cas-
cade and eventually lead to intestinal/colonic tissue damage in UC induced by DSS [4]. More-
over, the onset of UC is accompanied by obvious diffused intestinal inflammation which is
closely associated with the increased permeability of intestinal epithelial barrier [5, 6].
The intestinal epithelial barrier, physically protecting the intestine from luminal bacteria
and toxins, is composed of the mucous layer, epithelial cells and intercellular junctions. Com-
ponents of the mucous layer are mucins, including mucin-1 and mucin-2, which are secreted
by intestinal epithelium goblet cells and markedly decreased in colitis subjects [5, 7]. Tight
junctions (TJs) are the most apical structure of the junction complex, which is intercellular
structure in epithelial cells and play crucial roles in cell-cell recognition and paracellular
motion of substances. TJs regulate the mucosal barrier capability [8], which comprised of vari-
ous transmembrane proteins including occluding and claudins, coupling each other with
zonaoccludens (ZO, cytoplasmic peripheral membrane proteins including ZO-1 and ZO-2)
within cells [9, 10]. Once the barrier is impaired, bacteria and toxins may easily penetrate and
aggravate the release of multiple cytokines, thus evoking the occurrence and development of
UC. Therefore, maintaining the integrity of the gut barrier structure and function provide an
invaluable contribution to the treatment of UC, and strategies based on this are now essential
lines of treatment for UC [11].
Traditional Chinese medicines (TCMs) remain a fundamental therapeutic solution in the
treatment of various diseases due to their long history of clinical practice and reliable therapeu-
tic efficacy. Rhizoma Coptidis (the rhizoma of Coptischinensis Franch., Huanglian in Chinese),
officially listed in the Chinese Pharmacopoeia, has been used in China for a long history to treat
gastroenteritis including abdominal pain, diarrhea and IBD [12]. Berberine (BBR), the most
abundant and major active isoquinoline alkaloid of Rhizoma Coptidis [13], has been reported
to exert therapeutic effect on colitis and inhibits inflammatory responses in colonic macro-
phages and epithelial cells in DSS-treated mice [14]. Indeed, BBR is a safe and effective agent
commonly used for the treatment of gastrointestinal disorders like diarrhea in China. How-
ever, there are some limitations of BBR due to its low bioavailability and poor intestinal
absorption [15]. BBR undergoes extensive metabolism in vivo after oral administration which
results in its extremely low plasma exposure [16]. Hence, increasing researchers have focused
their attention on the metabolites of BBR, which were also believed to contribute a lot to its
pharmacological effects [17].
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
2 / 15

Berberrubine and DSS-induced ulcerative colitis
Fig 1. Chemical structures of berberine and berberrubine.
https://doi.org/10.1371/journal.pone.0194069.g001
Berberrubine (BB), one of the main metabolites of BBR in vivo [18] (Fig 1), is more lipo-
philic than BBR and has higher plasma concentration after BBR oral administration owing to
its more efficient intestinal absorption. Previous study has suggested that it is potentially more
pharmacologically active than BBR [19]. Indeed, BBR and BB are both found in the medicinal
plant Berberis vulgaris, which has been shown to possess anti-UC effect [20, 21]. Increasing evi-
dences have shown that BB exerted multiple activities, such as anti-inflammation [13], anti-
microbial [22], anti-tumor [23], lipid-lowering [24], and anti-oxidation [25]. In this study, we
made pioneering endeavor to assess the potential protective effects and underlying mechanism
of BB in comparison with BBR in DSS-induced colitis by measuring macroscopic score, histo-
logical alternations, inflammation markers such as MPO and pro-inflammatory cytokines pro-
ductions. In addition, we further detected the expression of colonic TJs and apoptosis-related
proteins, and the mRNA expression of colonic mucins. Results indicated that BB effectively
prevented DSS-induced colitis in mice, and the protective effect might be intimately associated
with attenuating intestinal inflammation and maintaining the integrity of the intestinal muco-
sal barrier.
Materials and methods
Chemicals and reagents
Berberine hydrochloride (purity > 98% by HPLC) was provided by Xi’an Realin Biotechnol-
ogy Co. Ltd. (Xi’an, China). Dextran sulfate sodium (DSS) was obtained from MP Biomedicals
(LLC, France). Sulfasalazine (SASP) was supplied by Sunve Pharmaceutical Co. Ltd. (Shanghai,
China). MPO detection kit was purchased from Nanjing Jiancheng Bioenginerring Institute
(Nanjing, China). ELISA kits (TNF-α, IFN-γ, IL-6, IL-1β, IL-4 and IL-10) were purchased
from eBioscience (MA, USA). BCA protein assay kit was purchased from Thermo Scientific
Pierce (Rockford, USA). Sodium carboxymethyl cellulose (CMC-Na) was purchased from
Guangzhou Chemical Reagent Factory (Guangzhou, China). All other reagents and chemicals
used in the study were of analytical grade.
Synthesis of berberrubine
Berberrubine was synthesized according to the previous study with some modifications [26].
Briefly, berberine hydrochloride (3 g) was microwaved at 180 ˚C for 30 min under vacuum
condition, then dissolved in deionized water (300 ml), extracted by chloroform extraction
(300 ml once for 3 times) and dried using the rotary evaporation apparatus to get the crude
product, which was purified and concentrated using silica gel column chromatography
(CH2Cl2: MeOH = 10:1, v/v) to obtain the red compound (berberrubine). Its structural
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
3 / 15

Berberrubine and DSS-induced ulcerative colitis
identity was confirmed by comparing its spectral data (MS, 1H- and 13C-NMR) with those
published previously [27]. Its purity was determined to exceed 95.58% by HPLC analysis.
Experimental design and sample collection
Six-week-old male Balb/c mice were obtained from the Laboratory Animal Center of Guang-
zhou University of Chinese Medicine (Guangzhou, China). Mice were housed under standard
conditions at controlled temperature (22 2 ˚C), humidity (50 10%), and light (12 h light/
dark cycle) and fed with standard diets and tap water ad libitum. Animal experiments were
approved by the Institutional Animal Care and Welfare Committee of Guangzhou University
of Chinese Medicine and performed in accordance with institutional protocols (2016047).
After acclimatization for 7 days, mice were divided into 6 groups based on the average body
weight (n = 12 per group), control group, DSS group, BBL (berberrubine, 10 mg/kg) group,
BBH (berberrubine, 20 mg/kg) group, BBR (berberine, 50 mg/kg, control drug) and sulfasala-
zine (SASP, 200 mg/kg, positive drug). BB, BBR and SASP were also dissolved in 0.5%
CMC-Na. Except the control group, colitis was induced by oral intake of 3% DSS (w/v, dis-
solved in drinking water) for 7 days in the other 5 groups. During the experimental period,
normal control was given distilled water and DSS group was given 0.5% CMC-Na by gavage.
Other groups were orally administered with the corresponding tested articles at the doses
mentioned above (0.1 ml/10 g body weight) once daily for 7 consecutive days. The dosage of
BBR was selected based on Lee’s study [28], and the dose of BB was adopted according to pre-
vious investigation [23] and our preliminary experiment.
Animals were euthanized by an overdose of inhalational diethyl ether on day 8 and colons
were collected. The colon length, an indicator of colitis, was gauged from proximal rectum to
the ileocecal junction [3]. Whereafter, colon was divided into 4 different pieces. One piece was
placed in 4% paraformaldehyde for histological observation. The other piece was homogenized
for MPO and cytokines measurements. The remaining two parts were stored at −80˚C for fur-
ther Western blotting and RT-PCR analyses. The colonic samples are all taken from the same
position in the colons for every application.
Assessment of disease activity
During the experiment, body weight, stool character, and fecal occult blood were recorded
daily. The disease activity index (DAI) was calculated by scoring weight loss, stool character
and fecal occult blood based on the scoring system as shown in Table 1 as previously described
[29].
Histopathological examination
After 4% paraformaldehyde fixation for 24 h, colon tissues were then dehydrated, embedded
in paraffin, sliced to 5 μm-thickness sections, and stained with H&E following routine proto-
col. Finally, slides were observed under a microscope. For each sample, six horizons were
Table 1. Scoring of disease activity index (DAI).
Score
Bodyweight loss
0
Stool character
Fecal occult blood
0
1
2
3
4
Normal formed
Negative
= 1–5%
= 5–10%
= 10–20%
>20%
Loose stool
Diarrhea
Positive
Gross bleeding
https://doi.org/10.1371/journal.pone.0194069.t001
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
4 / 15

Berberrubine and DSS-induced ulcerative colitis
selected to assess the colonic inflammation and lesions degree, which were denoted as histo-
logical scores, according to the previous criterion [30].
Measurement of MPO activity and cytokines concentrations
The activity of MPO in the colonic tissue was measured using a MPO detection kit and the lev-
els of cytokines (TNF-α, IFN-γ, IL-6, IL-1β, IL-4 and IL-10) were quantified by ELISA accord-
ing to the instruction of manufacturers. To determine the MPO activity and the levels of these
cytokines, tissues were homogenized with lysis buffer for 1 min and centrifuged at 14000 g,
4 ˚C for 15 min. Supernatants were collected for subsequent measurements. The amount of
total protein was determined by BCA protein assay kit.
Mucin mRNA analysis by Real-time PCR
Total RNA was extracted from colonic samples using Trizol reagent (15596–026, Invitrogen,
USA) according to the operating manual. Total RNA (2 μg) was retrotranscribed into cDNA
using the GoScript™ reverse transcription system (Promega, Shanghai, China). The reaction
condition was as follows: 70 ˚C incubation for 10 min, then at 42 ˚C for 60 min, and termi-
nated at 75 ˚C for 15 min. And 5 μl cDNA was used in a Real-time PCR reaction which was
performed with ABI 7500 Real-time PCR system (Life technology). Gene expression was
detected using SYBR Green [FastStart Universal SYBR Green Master (Rox), Roche] based
PCR with GAPDH as the internal reference. The primer sequences were designed by Invitro-
gen Biotechnology (Shanghai) Co. LTD. (Shanghai, China) and listed in Table 2. The cycle
procedures were as follows: 95 ˚C initial denaturation for 2 min, then 45 cycles of 95 ˚C dena-
turation for 30 s, 60 ˚C annealing for 30 s and 72 ˚C extension for 30 s. A melting curve analy-
sis, from 55 to 98 ˚C, was conducted after the finish of the amplification cycles. Finally, the
relative expression levels were normalized to GAPDH and calculated using the 2-ΔΔCt method.
Western blot analysis
Total protein in the colon tissues was homogenized in ice-cold RIPA lysis buffer containing 50
mM Tris (pH 7.4), 150 mM NaCl, 1% sodium deoxycholate, 0.1% SDS, 10 mM NaF, 5 mM
EDTA, 1 mM Na3VO4, and 1% protease inhibitor (Roche) for 1 min, incubated for 30 min on
ice and centrifuged at 14000 g for 10 min. Protein concentration of liquid supernatant was
determined using BCA assay kit (Thermo Scientific Pierce). The proteins were denatured,
loaded on polyacrylamide gel (10 μg/well), separated by electrophoresis, and then transferred
onto the PVDF membrane. This membrane was blocked with 5% defatted milk in TBST for 1
h and incubated at 4 ˚C overnight with primary antibodies against β-actin (internal control,
Cell Signaling Technology), Bax, Bcl-2, ZO-1, ZO-2, claudin-1, or occluding (Santa Cruz).
Table 2. Primers for Real-time PCR.
Gene
Sequences (5’-3’)
ProductSize (bp)
Genbank ID
GAPDH
F: ATTGTCAGCAATGCATCCTG
R: ATGGACTGTGGTCATGAGCC
F: CCAAGCGTAGCCCCTATGAG
R: GTGGGGTGACTTGCTCCTAC
F: TTCCAACCCTCCTCCTACCAC
R: CTCCACCATTCCACCAGACG
102
114
189
NM-001289726.1
Mucin-1
Mucin-2
NM-013605.2
NM-023566.3
The sequences are available through GenBank (http://www.ncbi.nlm.nih.gov/nuccore/) under the accession numbers listed above.
https://doi.org/10.1371/journal.pone.0194069.t002
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
5 / 15

Berberrubine and DSS-induced ulcerative colitis
Subsequently, the membranes were incubated with HRP-conjugated secondary antibodies
(Cell Signaling Technology), and blots were developed using the ECL detection reagents
(Millipore) and analyzed by Image J software (Rawak Software, Inc. Germany).
Statistical analysis
Data were presented as means standard error (SEM) and imaged using Graphpad Prism5
software (GraphPad Prism, USA). Statistical significance between groups was evaluated by
one-way ANOVA followed by the Dunnett’t test. Difference was considered significant at
P < 0.05.
Results
BB mitigated the clinical symptoms in DSS-induced colitis mice
Consistent with previous study [31], challenging mice with DSS administration induced acute
colitis characterized by bloody diarrhea, ulceration, colon shortening and loss of body weight,
indicative of successful establishment of the UC murine model with typical symptoms. As
shown in Fig 2A, the bodyweight of mice in control group was gradually increased, while the
bodyweight of DSS group was sustainably and substantially reduced compared to the control
group. In contrast, the bodyweight of mice in BB (20 mg/kg), BBR (50 mg/kg) or SASP (200
mg/kg) groups recovered greatly from day 5 to day 8.
The DAI score, which is an indicator of the severity of colitis, is based on the results includ-
ing weight loss, stool charter and fecal occult blood [32]. As shown in Fig 2B, DAI score for the
DSS group was significantly higher as compared to the control group (P < 0.01). However, the
DAI scores for the groups treated with BB (20 mg/kg), BBR or SASP were all significantly
lower as compared to the DSS group (P < 0.05). As expected, colitis manifested severe intesti-
nal inflammation, leading to colon shortening [5], a morphological indicator of colon inflam-
mation. In accordance with the DAI, the colon of mice in DSS group was distinctly shorter
Fig 2. BB remitted the clinical symptoms in mice with DSS-induced colitis. (A) Bodyweight was shown as a mean
value of daily weight from days 1 to 8. (B) DAI scores. (C) Gross morphology of colonic tissues. (D) Measuring result
of gut length. Results are expressed as means SEM (n = 10). ##P < 0.01 vs. Control group,ÃP < 0.05 andÃÃP < 0.01 vs.
DSS group.
https://doi.org/10.1371/journal.pone.0194069.g002
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
6 / 15

Berberrubine and DSS-induced ulcerative colitis
than that of the control group on day 8, while mice treated with BB, BBR or SASP exhibited
remarkably ameliorating colon shortening compared to the DSS-treated model mice (Fig 1C
and 1D).
BB attenuated the colonic histopathological changes in mice colitis
Histological characteristics of the colons were subsequently examined by H&E staining. Mice
in control group maintained integrated normal colonic structures (Fig 2A), characteristic of
clear outer membrane, muscular layer, submucosa and mucosa. However, DSS treatment elic-
ited deteriorating pathological alternations, such as epithelium cell layer demolition, crypt
lack, mucosa inflammation and cell infiltration, resulting in significantly higher histological
scores as compared with the control group (Fig 3B). This colonic damage as determined patho-
logically was paralleled to that of macroscopically visible colonic injures. By contrast, mice
treated with BB (20 mg/kg), BBR (50 mg/kg) or SASP (200 mg/kg) showed remarkably amelio-
rated intestinal injury, relieved mucosa inflammation and significantly decreased histological
scores (Fig 3B) as compared to the DSS mice. Treatment with BB (10 mg/kg) was shown to
only slightly ease the gut structural lesions, however, the histological score difference failed to
reach statistical significance when compared with the DSS group.
MPO activity, an index to evaluate the neutrophil infiltration and inflammation, is believed
to be proportional to the concentration of neutrophils in lesion tissue [33]. As shown in Fig
3C, DSS treatment significantly increased the MPO activity as compared with the control
(P < 0.01). Whereas, BB (20 mg/kg), BBR (50 mg/kg) or SASP (200 mg/kg) treatment was
found to appreciably decrease the elevated MPO activity induced by DSS, which was congru-
ent with the histological findings.
BB decreased colonic cytokines concentration in mice with colitis
Development of colitis is often associated with chronic inflammation, characterized by inflam-
matory cellular infiltration and series of cytokines secretion, such as TNF-α, IFN-γ, IL-6, IL-
Fig 3. BB mitigated the deteriorating colonic histopathological changes in mice with DSS-induced colitis. (A)
Representative H&E staining images of colonic sections from different treatments. (B) Histopathology scores. (C)
MPO activity. The results shown are means SEM (n = 6). ##P < 0.01 vs. Control group, ÃP < 0.05 and ÃÃP < 0.01vs.
DSS group.
https://doi.org/10.1371/journal.pone.0194069.g003
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
7 / 15

Berberrubine and DSS-induced ulcerative colitis
Fig 4. BB suppressed colonic levels of inflammatory cytokines in mice with DSS-induced colitis. (A) TNF-α, (B)
IFN-γ, (C) IL-6, (D) IL-1β, (E) IL-4, and (F) IL-10 levels were examined by ELISA. The results shown are
means SEM (n = 10). ##P < 0.01 vs. Control group, ÃP < 0.05 and ÃÃP < 0.01 vs. DSS group.
https://doi.org/10.1371/journal.pone.0194069.g004
1β, IL-4, and IL-10 [31, 34]. Cytokines perform essential roles in the intestinal immune system
and are shown to have a central role in the pathophysiology of UC. Hence, we detected these
above-mentioned indicators to estimate the potential anti-inflammatory effect of BB on DSS-
induced colitis. Results indicated that DSS treatment induced remarkable augments of colonic
levels of cytokines (TNF-α, IFN-γ, IL-6, IL-1β, IL-4 and IL-10) compared to the control group
(Fig 4). However, treatment with BB (especially at the dose of 20 mg/kg), BBR (50 mg/kg) or
SASP (200 mg/kg) obviously reversed these elevations induced by DSS (P < 0.05). These data
indicated that treatment with BB effectively ameliorated the colonic inflammation caused by
DSS.
BB preserved intestinal barrier function in the colon of DSS-treated mice
The colonic epithelium is composed of trefoil peptides such as mucin-1 and mucin-2, which
play an important role in maintaining the barrier function of colon. To evaluate the potential
effect of BB on colonic mucins, mRNA levels of the mucins (mucin-1 and mucin-2) in the
colon of DSS-colitis mice were measured by RT-PCR. As shown in Fig 5, the gene expression
of mucin-1 and mucin-2 was observably suppressed by DSS treatment relative to the control
(P < 0.01). On the contrary, BB (20 mg/kg), BBR (50 mg/kg) and SASP (200 mg/kg) were
shown to significantly upregulate the expression of these two genes (P < 0.01).
Intestinal epithelial tight junctions play a key role in protecting against inflammation, and
disrupted tight junctions are a main cause of intestinal barrier dysfunction and inflammation.
Apoptosis is also a well-known inducer of mucosal injury in many intestinal diseases, which
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
8 / 15

Berberrubine and DSS-induced ulcerative colitis
Fig 5. BB prevented disruption of intestinal integrity in mice with DSS-induced colitis. Gene expression was
normalized to GAPDH in each group. The results shown are means SEM (n = 10). ## P < 0.01 vs. Control group,
ÃP < 0.05 and ÃÃP < 0.01 vs. DSS group.
https://doi.org/10.1371/journal.pone.0194069.g005
can result in barrier dysfunction. Therefore, maintaining TJs and suppressing apoptosis to
protect barrier function may provide benefits in the therapy of UC. To verify the involvement
of apoptosis and epithelial TJ, the expression levels of apoptosis-associated proteins (Bax, Bcl-
2) and TJ-associated proteins (ZO-1, ZO-2, claudin-1, occluding) were determined on colon
tissues by Western blotting.
As shown in Fig 6A, the down-regulation of anti-apoptotic Bcl-2 and up-regulation of pre-
apoptotic Bax were observed during DSS-induced colitis. By contrast, BB treatment markedly
augmented the expression of Bcl-2 (P < 0.01) and slightly attenuated the expression of Bax,
resulting in significantly decreased Bax/Bcl-2 ratio (P < 0.01) in colonic tissues. Furthermore,
the protein expression of ZO-1, ZO-2, claudin-1 and occluding was all significantly down-reg-
ulated in mice treated with DSS alone, as compared with normal mice (P < 0.01). However,
these proteins expression was prominently up-regulated by BB (especially at 20 mg/kg), BBR
(50 mg/kg) and SASP (200 mg/kg) (Fig 6B and 6C). These results indicated that BB might pre-
vent DSS-induced disruption of intestinal integrity by preserving tight junctional function and
decreasing apoptosis.
Fig 6. BB alleviated the apoptosis and recovered the intestinal barrier function in mice with DSS-induced colitis. Homogenates of colonic tissue were analyzed by
Western blotting and representative images were shown (A). Quantitative results of expression levels of apoptosis-related proteins Bax and Bcl-2 (B1), Bax/Bcl-2
expression ratio (B2), tight junction-associated proteins (ZO-1 and ZO-2) (C), and occludin and claudin-1 (D). β-actin was used as a loading control. The results
shown are means SEM (n = 6). ##P < 0.01 vs. Control group, ÃP < 0.05 and ÃÃP < 0.01 vs. DSS group.
https://doi.org/10.1371/journal.pone.0194069.g006
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
9 / 15

Berberrubine and DSS-induced ulcerative colitis
Discussion
Berberine (BBR) is a commonly-used therapeutic agent for the treatment of gastroenteritis
and infectious diarrhea in China. Previous study has suggested that BBR remitted DSS-
induced colitis by inhibiting inflammatory responses in colonic macrophages and epithelial
cells in DSS-treated mice [14]. Even though BBR possesses a low oral bioavailability, it has
exhibited appreciable biological activities in vivo and the levels of its major metabolites like BB
was relatively high [18]. These reports suggested that the metabolites might be active contribu-
tors to the biological activities of BBR in vivo. Indeed, various studies have revealed that the
metabolites of BBR showed similar bioactivities. BB, the main primary metabolite of BBR, was
more lipophilic and could be absorbed more efficiently in intestine than BBR [19]. Further-
more, BB was rapidly absorbed and widely distributed in various tissues [35]. Therefore, we
hypothesized that BB might have similar beneficial or superior effect to BBR on UC. In the
present work, pioneering endeavor was initiated to investigate the anti-UC effect of BB on
DSS-induced colitis in comparison with BBR, and probe the possible underlying mechanism.
DSS-induced experimental colitis, one of the most widely used models of chemically
induced colitis, has clinical symptoms similar to human UC [36–38]. In the present work,
treatment with BB, as well as BBR, significantly ameliorated clinical symptoms of UC such as
diarrhea, stool charter, bloody stool and bodyweight loss, thereby reducing the DAI score.
Additionally, administration with BB (20 mg/kg) relieved signs of inflammation and mucosal
injury as indicated by improved colon length and higher histological score, suggesting a pro-
tective effect of BB in the model of colitis. Noteworthy, BB was shown to exert similar effect to
BBR and positive control SASP in attenuating DSS-induced UC with much smaller dosage.
Inflammatory responses, characteristic of gut barrier disruption in IBD, play a vital role in
the pathogenesis of UC [39, 40]. Gut inflammation activates accumulated colonic macro-
phages, resulting in over-production of pro-inflammatory cytokines, such as TNF-α, IL-1β,
IL-6 and IL-4, which further deteriorate UC [41] [42]. IFN-γ released by excessive function of
Th1 cells is generally associated with intestinal inflammation especially in IBD [43, 44]. Fur-
thermore, the level of MPO activity, proportional to the concentration of neutrophils in lesion
tissue, was a common index to evaluate the neutrophil infiltration and inflammation [45]. Pre-
ceding investigations have reported BBR alleviated experimental colitis induced by DSS or tri-
nitrobenzene sulfonic acid in rodent, which was closely associated with its anti-inflammatory
activity. In this study, we found the induced productions of TNF-α, IFN-γ, IL-6, IL-4 and IL-
1β by DSS treatment were dramatically suppressed by BB (especially at the dose of 20 mg/kg),
BBR and SASP (Fig 4A–4E, P < 0.05). Besides, BB and BBR also decreased the levels of IL-10
in DSS-treated colitis mice (Fig 4F, P < 0.05). IL-10, which was mainly secreted by Treg cells,
has been defined as anti-inflammatory cytokine. However, report has also suggested that T
cells in UC patients expressed high level of IL-10 in intestine [46, 47], and high-level of IL-10
may result in the induction of pro-inflammatory cytokines in IBD [47]. The increased IL-10 in
DSS mice in the present work was consistent with our preceding investigation [48] and other
previous reports [49]. These results showed that suppression of inflammatory response in the
colonic tissue of mice might contribute to the ameliorative effect of BB against DSS-induced
colitis, which paralleled the histological evidence of protection.
The barrier dysfunction involved in the initiation and propagation of inflammation, and
inflammatory cytokines could induce barrier dysfunction with vicious cycles. Most pro-
inflammatory cytokines (e.g. IFN-γ, TNF-α, and IL-1β) could reduce key TJ-associated pro-
teins such as intracytoplasmic proteins (ZO-1, ZO-2) and transmembrane proteins (occluding
and claudin), resulting in disruption of intestinal TJ barrier and the development of intestinal
inflammation [50]. Furthermore, the integrity of intestinal structure critically involves the
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
10 / 15

Berberrubine and DSS-induced ulcerative colitis
function of the mucous layer, which comprised of mucin (primarily including mucin-1 and
mucin-2) excreted by enterocyte, exerting lubricant and protective effect on intestinal tract [7].
Therefore, restoring intestinal barrier function may be a potentially beneficial strategy in the
treatment of UC. Previous studies have indicated that BBR promoted barrier function in
human retinal pigment epithelial cells, endothelial cells and Caco-2 human epithelial colorectal
adenocarcinoma cells [51]. In this study, we observed the loss of colonic TJ (ZO-1, ZO-2,
occludin and claudin-1) and colonic mucin (mucin-1 and mucin-2) expression in DSS-
induced mice were dramatically suppressed by BB and BBR (Fig 6, P < 0.05). These results
indicated that the ameliorative effect of BB against DSS-induced colitis might be tightly associ-
ated with its protection on intestinal mucosal barrier via enhancing the expression of TJ pro-
teins and mucins.
Besides, increased apoptosis in intestinal epithelial cells also does serious damage to the
mucosal barrier and induces gut inflammation. This has been reported in patients with UC,
which suggested that the loss of epithelial cells in active UC was induced mainly by apoptosis
in crypts of involved and adjacent uninvolved areas [52]. The same phenomenon also has been
observed in CD patients [53] and murine models of colitis [54]. The key of keeping normal tis-
sue homeostasis is to achieve balance of epithelial cell apoptosis and proliferation. The present
study suggested that BB treatment significantly up-regulated the anti-apoptotic Bcl-2 protein
expression and markedly decreased the Bax/Bcl-2 ratio, indicating the anti-apoptosis effect
might contribute to the protection of BB against DSS-induced experimental UC.
In the current work, BB, the demethylation metabolite of BBR, was found to be more
pharmacologically active than BBR in alleviating the DSS-induced colitis in mice, which was in
concert with previous reports that BB possessed better hepatoprotective property [55] and OH
scavenging activity [56] than BBR. These results suggested that the metabolite BB might con-
tribute to the biological activities of BBR in vivo. The BB molecule is very similar to BBR except
that the methoxy (OCH3) group at position 9 is replaced byhydroxyl group (OH) group,
resulting in enhanced anti-UC activity. Indeed, the OH group at the C-9 position of BB was
believed to be essential for its biological activities [56, 57]. Although the pharmacokinetic and
pharmacodynamic relationships between BB and BBR in vivo merited further in-depth investi-
gation, this observation provided important implication for the design of novel therapeutic
entity with improved anti-UC efficacy. Furthermore, BB is also a naturally-occurring proto-
berberine alkaloid oriented from the medicinal plant Berberis vulgaris, which has been shown
to possess anti-UC effect. Hence, it was deduced that BB might be one of the active principle
obligatory for biological effect of Berberis vulgaris in the treatment of UC.
Since BB was a main metabolite of BBR, which serves as a safe and effective agent for the
treatment of gastrointestinal diseases in clinic, BB was expected to provide a wide margin of
safety. Furthermore, BB possessed similar anti-UC effect to BBR and the positive control SASP
with much smaller dosage. Hence, BB might have the potential to be further developed into an
effective candidate for the treatment of UC. Future studies for elucidating the detailed molecu-
lar mechanism underlying the anti-UC effect of BB, long-term safety and pharmacokinetics
would likely pave an avenue for promising drug development process.
Conclusion
This was the first report to indicate that BB had pronounced protective effect on DSS-induced
colitis by significantly easing the clinical symptoms, suppressing the inflammatory response
and repairing mucosal barrier function. These effects were mediated, at least in part, via ame-
lioration of pro-inflammatory cytokines production and modulation of TJ proteins, mucins
genes and apoptosis-related proteins in the colonic tissue. The anti-UC effect of BB was similar
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
11 / 15

Berberrubine and DSS-induced ulcerative colitis
to that of BBR and positive control SASP with much lower dosage. Therefore, we speculated
that BB might be one of the active metabolites of BBR responsible for its anti-UC effect, and
BBR together with BB might form the material basis of BBR in vivo. BB was believed to have
the potential to be further developed into a promising therapeutic agent in the treatment of
UC.
Acknowledgments
At the end of this paper, we would like to express our sincere thanks to all those who helped us
during the writing of this paper, and express our deep gratitude to the colleagues who offered
valuable suggestions to us in the academic studies. Without their help, this paper could not
have reached its present form.
Author Contributions
Conceptualization: Xiu-Ting Yu, Yi-Fei Xu, Jian-Ping Chen, Xiao-Jun Zhang.
Data curation: Xiu-Ting Yu, Yi-Fei Xu, Chang Qu, Lin Zheng.
Formal analysis: Xiu-Ting Yu, Yi-Fei Xu, Yan-Feng Huang, Chang Qu, Lie-Qiang Xu.
Funding acquisition: Zi-Ren Su, Hui-Fang Zeng, Jian-Ping Chen.
Investigation: Yi-Fei Xu, Yan-Feng Huang, Chang Qu, Lie-Qiang Xu, Hui-Fang Zeng, Xiao-
Jun Zhang.
Methodology: Jian-Ping Chen, Xiao-Jun Zhang.
Project administration: Jian-Ping Chen, Xiao-Jun Zhang.
Resources: Chang Qu, Lie-Qiang Xu, Lin Zheng.
Supervision: Zi-Ren Su, Hui-Fang Zeng, Jian-Ping Chen, Xiao-Jun Zhang.
Validation: Yi-Fei Xu, Yan-Feng Huang.
Visualization: Tie-Gang Yi, Hui-Lin Li.
Writing – original draft: Xiu-Ting Yu, Yi-Fei Xu.
Writing – review & editing: Xiu-Ting Yu, Zi-Ren Su, Jian-Ping Chen, Xiao-Jun Zhang.
References
1. Lombardi VRM, Etcheverria I, Carrera I, Cacabelos R, Chacon AR. Prevention of Chronic Experimental
Colitis Induced by Dextran Sulphate Sodium (DSS) in Mice Treated with FR91. Journal of Biomedicine
and Biotechnology. 2012. https://doi.org/10.1155/2012/826178 PMID: 22619498
2. Siegel CA. Review article: explaining risks of inflammatory bowel disease therapy to patients. Alimen-
tary Pharmacology & Therapeutics. 2011; 33(1):23–32. https://doi.org/10.1111/j.1365-2036.2010.
04489.x PMID: 21083583
3. Rodriguez-Canales M, Jimenez-Rivas R, Canales-Martinez MM, Garcia-Lopez AJ, Rivera-Yanez N,
Nieto-Yanez O, et al. Protective Effect of Amphipterygium adstringens Extract on Dextran Sulphate
Sodium-Induced Ulcerative Colitis in Mice. Mediators of Inflammation. 2016. https://doi.org/10.1155/
2016/8543561 PMID: 27635116
4. Perrier C, Rutgeerts P. Cytokine blockade in inflammatory bowel diseases. Immunotherapy. 2011;
3(11):1341–52. https://doi.org/10.2217/imt.11.122 PMID: 22053885
5. Han F, Zhang H, Xia X, Xiong H, Song D, Zong X, et al. Porcine beta-defensin 2 attenuates inflamma-
tion and mucosal lesions in dextran sodium sulfate-induced colitis. Journal of immunology (Baltimore,
Md: 1950). 2015; 194(4):1882–93. Epub 2015/01/21. https://doi.org/10.4049/jimmunol.1402300 PMID:
25601921.
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
12 / 15

Berberrubine and DSS-induced ulcerative colitis
6. Kim T II. The Role of Barrier Dysfunction and Change of Claudin Expression in Inflammatory Bowel Dis-
ease. Gut and Liver. 2015; 9(6):699–700. https://doi.org/10.5009/gnl15430 PMID: 26503569
7. Hayashi T, Ishida T, Motoya S, Itoh F, Takahashi T, Hinoda Y, et al. Mucins and immune reactions to
mucins in ulcerative colitis. Digestion. 2001; 63:28–31. https://doi.org/10.1159/000051907 PMID:
11173906
8. Laukoetter MG, Nava P, Nusrat A. Role of the intestinal barrier in inflammatory bowel disease. World
journal of gastroenterology. 2008; 14(3):401–7. Epub 2008/01/18. https://doi.org/10.3748/wjg.14.401
PMID: 18200662.
9. Edelblum KL, Turner JR. The tight junction in inflammatory disease: communication breakdown. Cur-
rent Opinion in Pharmacology. 2009; 9(6):715–20. https://doi.org/10.1016/j.coph.2009.06.022 PMID:
19632896
10. Mitic LL, Anderson JM. Molecular architecture of tight junctions. Annual review of physiology. 1998;
60:121–42. Epub 1998/04/29. https://doi.org/10.1146/annurev.physiol.60.1.121 PMID: 9558457.
11. Fillon S, Robinson ZD, Colgan SP, Furuta GT. Epithelial Function in Eosinophilic Gastrointestinal Dis-
eases. Immunology and Allergy Clinics of North America. 2009; 29(1):171–+. https://doi.org/10.1016/j.
iac.2008.09.003 PMID: 19141352
12. He K, Hu YR, Ma H, Zou ZY, Xiao YB, Yang Y, et al. Rhizoma Coptidis alkaloids alleviate hyperlipidemia
in B6 mice by modulating gut microbiota and bile acid pathways. Biochimica Et Biophysica Acta-Molec-
ular Basis of Disease. 2016; 1862(9):1696–709. https://doi.org/10.1016/j.bbadis.2016.06.006 PMID:
27287254
13. Cui HS, Hayasaka S, Zhang XY, Hayasaka Y, Chi ZL, Zheng LS. Effect of berberrubine on interleukin-8
and monocyte chemotactic protein-1 expression in human retinal pigment epithelial cell line. Life Sci-
ences. 2006; 79(10):949–56. https://doi.org/10.1016/j.lfs.2006.05.004 PMID: 16797033
14. Yan F, Wang LH, Shi Y, Cao HW, Liu LP, Washington MK, et al. Berberine promotes recovery of colitis
and inhibits inflammatory responses in colonic macrophages and epithelial cells in DSS-treated mice.
American Journal of Physiology-Gastrointestinal and Liver Physiology. 2012; 302(5):G504–G14.
https://doi.org/10.1152/ajpgi.00312.2011 PMID: 22173918
15. Pan GY, Wang GJ, Liu XD, Fawcett JP, Xie YY. The involvement of P-glycoprotein in berberine absorp-
tion. Pharmacology & Toxicology. 2002; 91(4):193–7. https://doi.org/10.1034/j.1600-0773.2002.t01-1-
910403.x
16. Caliceti C, Franco P, Spinozzi S, Roda A, Cicero AFG. Berberine: New Insights from Pharmacological
Aspects to Clinical Evidences in the Management of Metabolic Disorders. Current Medicinal Chemistry.
2016; 23(14):1460–76. https://doi.org/10.2174/0929867323666160411143314 PMID: 27063256
17. Wang K, Feng X, Chai L, Cao S, Qiu F. The metabolism of berberine and its contribution to the pharma-
cological effects. Drug metabolism reviews. 2017; 49(2):139–57. Epub 2017/03/16. https://doi.org/10.
1080/03602532.2017.1306544 PMID: 28290706.
18. Zuo F, Nakamura N, Akao T, Hattori M. Pharmacokinetics of berberine and its main metabolites in con-
ventional and pseudo germ-free rats determined by liquid chromatography/ion trap mass spectrometry.
Drug Metabolism and Disposition. 2006; 34(12):2064–72. https://doi.org/10.1124/dmd.106.011361
PMID: 16956957
19. Spinozzi S, Colliva C, Camborata C, Roberti M, Ianni C, Neri F, et al. Berberine and Its Metabolites:
Relationship between Physicochemical Properties and Plasma Levels after Administration to Human
Subjects. Journal of Natural Products. 2014; 77(4):766–72. https://doi.org/10.1021/np400607k PMID:
24593257
20. Minaiyan M, Ghannadi A, Mahzouni P, Jaffari-Shirazi E. Comparative Study of Berberis vulgaris Fruit
Extract and Berberine Chloride Effects on Acetic Acid-Induced Colitis in Rats. Iranian Journal of Phar-
maceutical Research. 2011; 10(1):97–104. PMID: 24363687
21. Tanideh N, Afaridi E, Mehrabani D, Azarpira N, Hosseinzadeh M, Amini M, et al. The Healing Effect of
Berberis vulgaris in Acetic Acid-Induced Ulcerative Colitis in Rat. Middle East Journal of Scientific
Research. 2014; 21(8):1288–94.
22. Kim SH, Lee SJ, Lee JH, Sun WS, Kim JH. Antimicrobial activity of 9-O-acyl- and 9-O-alkylberberrubine
derivatives. Planta Medica. 2002; 68(3):277–81. https://doi.org/10.1055/s-2002-23128 PMID:
11914971
23. I T, I Y. Antitumor activity of 13-methyl-berberrubine derivatives. D—7901854. (- 0386-846X (Print)):-
469–74.
24. Li YH, Li Y, Yang P, Kong WJ, You XF, Ren G, et al. Design, synthesis, and cholesterol-lowering effi-
cacy for prodrugs of berberrubine. Bioorganic & Medicinal Chemistry. 2010; 18(17):6422–8. https://doi.
org/10.1016/j.bmc.2010.06.106 PMID: 20673726
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
13 / 15

Berberrubine and DSS-induced ulcerative colitis
25. Pongkittiphan V, Chavasiri W, Supabphol R. Antioxidant Effect of Berberine and its Phenolic Derivatives
Against Human Fibrosarcoma Cells. Asian Pacific journal of cancer prevention: APJCP. 2015; 16
(13):5371–6. Epub 2015/08/01. PMID: 26225680.
26. Li RJ, Wu JB, He Y, Hai L, Wu Y. Synthesis and in vitro evaluation of 12-(substituted aminomethyl) ber-
berrubine derivatives as anti-diabetics. Bioorganic & Medicinal Chemistry Letters. 2014; 24(7):1762–5.
https://doi.org/10.1016/j.bmcl.2014.02.032 PMID: 24613165
27. Zhong M, Ma YX, Liu JX, Di DL. A new quaternary protoberberine alkaloid isolated from Dicranostigma
leptopodum (Maxim) Fedde. Natural Product Research. 2014; 28(8):507–10. https://doi.org/10.1080/
14786419.2013.879586 PMID: 24499388
28. Li CZ, Xi Y, Li S, Zhao Q, Cheng WJ, Wang ZT, et al. Berberine ameliorates TNBS induced colitis by
inhibiting inflammatory responses and Th1/Th17 differentiation. Molecular Immunology. 2015; 67
(2):444–54. https://doi.org/10.1016/j.molimm.2015.07.013 PMID: 26224047
29. Murano M, Maemura K, Hirata I, Toshina K, Nishikawa T, Hamamoto N, et al. Therapeutic effect of
intracolonically administered nuclear factor kappa B (p65) antisense oligonucleotide on mouse dextran
sulphate sodium (DSS)-induced colitis. Clinical and Experimental Immunology. 2000; 120(1):51–8.
https://doi.org/10.1046/j.1365-2249.2000.01183.x PMID: 10759763
30. Li J, Zhong W, Wang WW, Hu SP, Yuan JH, Zhang B, et al. Ginsenoside Metabolite Compound K Pro-
motes Recovery of Dextran Sulfate Sodium- Induced Colitis and Inhibits Inflammatory Responses by
Suppressing NF-kappa B Activation. Plos One. 2014; 9(2). https://doi.org/10.1371/journal.pone.
0087810 PMID: 24504372
31. Zhu YS, Li XQ, Chen JQ, Chen TJ, Shi ZM, Lei MN, et al. The pentacyclic triterpene Lupeol switches
M1 macrophages to M2 and ameliorates experimental inflammatory bowel disease. International Immu-
nopharmacology. 2016; 30:74–84. https://doi.org/10.1016/j.intimp.2015.11.031 PMID: 26655877
32. Pan T, Guo HY, Zhang H, Liu AP, Wang XX, Ren FZ. Oral administration of Lactobacillus paracasei
alleviates clinical symptoms of colitis induced by dextran sulphate sodium salt in BALB/c mice. Benefi-
cial Microbes. 2014; 5(3):315–22. https://doi.org/10.3920/BM2013.0041 PMID: 24889889
33. Choudhary S, Keshavarzian A, Yong S, Wade M, Bocckino S, Day BJ, et al. Novel antioxidants Zolimid
and AEOL11201 ameliorate colitis in rats. Digestive Diseases and Sciences. 2001; 46(10):2222–30.
https://doi.org/10.1023/a:1011975218006 PMID: 11680601
34. Atreya R, Mudter J, Finotto S, Mullberg J, Jostock T, Wirtz S, et al. Blockade of interleukin 6 trans sig-
naling suppresses T-cell resistance against apoptosis in chronic intestinal inflammation: Evidence in
Crohn disease and experimental colitis in vivo. Nature Medicine. 2000; 6(5):583–8. https://doi.org/10.
1038/75068 PMID: 10802717
35. Zhao YQ, Yang N, Fei F, Sun RB, Feng SQ, He J, et al. Sensitive Analysis and Pharmacokinetic Study
of Berberrubine Using LC-MS/MS. Chinese Herbal Medicines. 2017; 9(3).
36. Mennigen R, Nolte K, Rijcken E, Utech M, Loeffler B, Senninger N, et al. Probiotic mixture VSL#3 pro-
tects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a
murine model of colitis. American Journal of Physiology-Gastrointestinal and Liver Physiology. 2009;
296(5):G1140–G9. https://doi.org/10.1152/ajpgi.90534.2008 PMID: 19221015
37. Seril DN, Liao J, Yang GY, Yang CS. Oxidative stress and ulcerative colitis-associated carcinogenesis:
studies in humans and animal models. Carcinogenesis. 2003; 24(3):353–62. Epub 2003/03/29. PMID:
12663492.
38. Tanaka T. Animal models of carcinogenesis in inflamed colorectum: potential use in chemoprevention
study. Current drug targets. 2012; 13(14):1689–97. Epub 2012/11/13. PMID: 23140280.
39. Salim SY, Soderholm JD. Importance of Disrupted Intestinal Barrier in Inflammatory Bowel Diseases.
Inflammatory Bowel Diseases. 2011; 17(1):362–81. https://doi.org/10.1002/ibd.21403 PMID: 20725949
40. Pastorelli L, De Salvo C, Mercado JR, Vecchi M, Pizarro TT. Central role of the gut epithelial barrier in
the pathogenes of chronic intestinal inflammation: lessons learned from animal models and human
genetics. Frontiers in Immunology. 2013; 4. https://doi.org/10.3389/fimmu.2013.00280 PMID:
24062746
41. Bain CC, Scott CL, Uronen-Hansson H, Gudjonsson S, Jansson O, Grip O, et al. Resident and pro-
inflammatory macrophages in the colon represent alternative context-dependent fates of the same
Ly6Chi monocyte precursors. Mucosal immunology. 2013; 6(3):498–510. Epub 2012/09/20. https://doi.
org/10.1038/mi.2012.89 PMID: 22990622.
42. Dohi T, Fujihashi K, Koga T, Shirai Y, Kawamura YI, Ejima C, et al. T helper type-2 cells induce ileal vil-
lus atrophy, goblet cell metaplasia, and wasting disease in T cell-deficient mice. Gastroenterology.
2003; 124(3):672–82. https://doi.org/10.1053/gast.2003.50092 PMID: 12612906
43. Powrie F, Leach MW, Mauze S, Menon S, Caddle LB, Coffman RL. Inhibition of Th1 responses pre-
vents inflammatory bowel disease in scid mice reconstituted with CD45RBhi CD4+ T cells. Immunity.
1994; 1(7):553–62. Epub 1994/10/01. PMID: 7600284.
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
14 / 15

Berberrubine and DSS-induced ulcerative colitis
44. McGovern D, Powrie F. The IL23 axis plays a key role in the pathogenesis of IBD. Gut. 2007; 56
(10):1333–6. Epub 2007/09/18. https://doi.org/10.1136/gut.2006.115402 PMID: 17872562.
45. El Kebir D, Jozsef L, Pan WL, Filep JG. Myeloperoxidase delays neutrophil apoptosis through CD11b/
CD18 integrins and prolongs inflammation. Circulation Research. 2008; 103(4):352–9. https://doi.org/
10.1161/01.RES.0000326772.76822.7a PMID: 18617697
46. Melgar S, Yeung MMW, Bas A, Forsberg G, Suhr O, Oberg A, et al. Over-expression of interleukin 10 in
mucosal T cells of patients with active ulcerative colitis. Clinical and Experimental Immunology. 2003;
134(1):127–37. https://doi.org/10.1046/j.1365-2249.2003.02268.x PMID: 12974765
47. Tsuchiya K, Ikeda T, Batmunkh B, Choijookhuu N, Ishizaki H, Hotokezaka M, et al. Frequency of CD4
+CD161+T Cell and Interleukin-10 Expression in Inflammatory Bowel Diseases. Acta Histochemica Et
Cytochemica. 2017; 50(1):21–8. https://doi.org/10.1267/ahc.16035 PMID: 28386147
48. Qu C, Yuan ZW, Yu XT, Huang YF, Yang GH, Chen JN, et al. Patchouli alcohol ameliorates dextran
sodium sulfate-induced experimental colitis and suppresses tryptophan catabolism. Pharmacological
research. 2017; 121:70–82. Epub 2017/05/01. https://doi.org/10.1016/j.phrs.2017.04.017 PMID:
28456683.
49. Mu HX, Liu J, Fatima S, Lin CY, Shi XK, Du B, et al. Anti-inflammatory Actions of (+)-3’alpha-Angeloxy-
4’-keto-3’,4’-dihydroseselin (Pd-Ib) against Dextran Sulfate Sodium-Induced Colitis in C57BL/6 Mice. J
Nat Prod. 2016; 79(4):1056–62. Epub 2016/02/26. https://doi.org/10.1021/acs.jnatprod.5b01071 PMID:
26905227.
50. Al-Sadi R, Boivin M, Ma T. Mechanism of cytokine modulation of epithelial tight junction barrier. Fron-
tiers in bioscience (Landmark edition). 2009; 14:2765–78. Epub 2009/03/11. PMID: 19273235.
51. Valenzano MC, DiGuilio K, Mercado J, Teter M, To J, Ferraro B, et al. Remodeling of Tight Junctions
and Enhancement of Barrier Integrity of the CACO-2 Intestinal Epithelial Cell Layer by Micronutrients.
Plos One. 2015; 10(7). https://doi.org/10.1371/journal.pone.0133926 PMID: 26226276
52. Iwamoto M, Koji T, Makiyama K, Kobayashi N, Nakane PK. Apoptosis of crypt epithelial cells in ulcera-
tive colitis. The Journal of pathology. 1996; 180(2):152–9. Epub 1996/10/01. https://doi.org/10.1002/
(SICI)1096-9896(199610)180:2<152::AID-PATH649>3.0.CO;2-Y PMID: 8976873.
53. Di Sabatino A, Ciccocioppo R, Luinetti O, Ricevuti L, Morera R, Cifone AG, et al. Increased enterocyte
apoptosis in inflamed areas of Crohn’s disease. Diseases of the Colon & Rectum. 2003; 46(11):1498–
507. PMID: 14605569
54. Qin L, Yao ZQ, Chang Q, Zhao YL, Liu NN, Zhu XS, et al. Swimming attenuates inflammation, oxidative
stress, and apoptosis in a rat model of dextran sulfate sodium-induced chronic colitis. Oncotarget.
2017; 8(5):7391–404. https://doi.org/10.18632/oncotarget.14080 PMID: 28030847
55. El-Salam MA, Mekky H, El-Naggar EMB, Ghareeb D, El-Demellawy M, El-Fiky F. Hepatoprotective
properties and biotransformation of berberine and berberrubine by cell suspension cultures of Dodo-
naea viscosa and Ocimum basilicum. South African Journal of Botany. 2015; 97:191–5. https://doi.org/
10.1016/j.sajb.2015.01.005
56. Jang MH, Kim HY, Kang KS, Yokozawa T, Park JH. Hydroxyl radical scavenging activities of isoquino-
line alkaloids isolated from Coptis chinensis. Archives of Pharmacal Research. 2009; 32(3):341–5.
https://doi.org/10.1007/s12272-009-1305-z PMID: 19387576
57. Kim SA, Kwon Y, Kim JH, Muller MT, Chung IK. Induction of topoisomerase II-mediated DNA cleavage
by a protoberberine alkaloid, berberrubine. Biochemistry. 1998; 37(46):16316–24. https://doi.org/10.
1021/bi9810961 PMID: 9819224
PLOS ONE | https://doi.org/10.1371/journal.pone.0194069 March 14, 2018
15 / 15