Structural and functional highlights of methionine aminopeptidase 2 from Leishmania donovani

Article abstract of DOI:10.1016/j.ijbiomac.2018.04.090

Methionine aminopeptidase 2 (MAP2) is a principal regulator of apoptosis for Leishmania donovani and a potential candidate for the design and synthesis of novel antileishmanials. The LdMAP2 gene was cloned in pET28a(+)-SUMO vector, expressed in E. coli and then purified by chromatographic methods. It was found to be a monomer and required divalent metal ion for its activity against synthetic substrates with Co(II), Mg(II), Mn(II) and Ni(II) being the major activators. Moreover, Ca(II) showed the tightest binding with K_m value of 124.7 ± 9.2 μM, while Co(II) proved most efficient for catalysis with k_cat value of 128.1 ± 4 min^?1. The naturally occurring aminopeptidase B inhibitor bestatin was found to be a potent inhibitor of LdMAP2 with a K_i value of 0.86 μM. Further, structural studies with circular dichroism (CD) showed an increase in the α-helical and β-sheet contents and a decrease in random coils in LdMAP2 upon interactions with both bestatin and fluorogenic substrates. Finally, structural studies pointed out key differences in the structure of LdMAP2 and HsMAP2 and their interactions with inhibitor bestatin, Ala-AMC, Leu-AMC and Met-AMC. The structural differences of two orthologs and different binding modes with bestatin can be crucial for the development of novel and specific inhibitor against leishmaniasis.

Full text of DOI:10.1016/j.ijbiomac.2018.04.090

Accepted Manuscript
Structural and functional highlights of methionine aminopeptidase
2 from Leishmania donovani
Saleem Yousuf Bhat, Arijit Dey, Insaf A. Qureshi
PII:
DOI:
Reference:
S0141-8130(18)30321-0
doi:10.1016/j.ijbiomac.2018.04.090
BIOMAC 9498
To appear in:
Received date:
Revised date:
Accepted date:
18 January 2018
16 April 2018
17 April 2018
Please cite this article as: Saleem Yousuf Bhat, Arijit Dey, Insaf A. Qureshi , Structural
and functional highlights of methionine aminopeptidase 2 from Leishmania donovani. The
address for the corresponding author was captured as affiliation for all authors. Please
check if appropriate. Biomac(2017), doi:10.1016/j.ijbiomac.2018.04.090
This is a PDF file of an unedited manuscript that has been accepted for publication. As
a service to our customers we are providing this early version of the manuscript. The
manuscript will undergo copyediting, typesetting, and review of the resulting proof before
it is published in its final form. Please note that during the production process errors may
be discovered which could affect the content, and all legal disclaimers that apply to the
journal pertain.

ACCEPTED MANUSCRIPT
Structural and Functional Highlights of Methionine Aminopeptidase 2 from Leishmania
donovani
Saleem Yousuf Bhat, Arijit Dey and Insaf A. Qureshi*
Department of Biotechnology & Bioinformatics, School of Life Sciences, University of
Hyderabad, Prof. C.R. Rao Road, Hyderabad 500046, India
*Correspondence E-mail: insaf@uohyd.ac.in

ACCEPTED MANUSCRIPT
Abstract
Methionine aminopeptidase 2 (MAP2) is a principal regulator of apoptosis for Leishmania
donovani and a potential candidate for the design and synthesis of novel antileishmanials.
The LdMAP2 gene was cloned in pET28a(+)-SUMO vector, expressed in E. coli and then
purified by chromatographic methods. It was found to be a monomer and required divalent
metal ion for its activity against synthetic substrates with Co(II), Mg(II), Mn(II) and Ni(II)
being the major activators. Moreover, Ca(II) showed the tightest binding with Km value of
124.7±9.2 μM, while Co(II) proved most efficient for catalysis with kcat value of 128.1±4
min−1. The naturally occurring aminopeptidase B inhibitor bestatin was found to be a potent
inhibitor of LdMAP2 with a Ki value of 0.86 μM. Further, structural studies with circular
dichroism (CD) showed an increase in the α-helical and β-sheet contents and a decrease in
random coils in LdMAP2 upon interactions with both bestatin and fluorogenic substrates.
Finally, structural studies pointed out key differences in the structure of LdMAP2 and
HsMAP2 and their interactions with inhibitor bestatin, Ala-AMC, Leu-AMC and Met-AMC.
The structural differences of two orthologs and different binding modes with bestatin can be
crucial for the development of novel and specific inhibitor against leishmaniasis.
Keywords
Methionine aminopeptidase 2; Leishmania donovani; enzyme kinetics; bestatin; molecular
docking; molecular dynamics studies

ACCEPTED MANUSCRIPT
Introduction
Protozoan dimorphic parasites of genus Leishmania cause leishmaniasis which is
characterized by a wide spectrum of clinical manifestations that includes ulcerative skin
lesions to life-threatening visceral infections. Leishmania parasites are transmitted through
the bite of sandfly to the mammalian hosts [1]. Approximately 12 million people are affected
by leishmaniasis in 80 countries with about 4,00,000 new cases reported each year [2]. There
are estimates of about 70,000 deaths occurring annually and a further 350 million at risk of
getting infected [3]. Due to the unavailability of any significant vaccination, chemotherapy
along with vector control, continue to remain a significant element in the control of all forms
of leishmaniasis. The prominent antileishmanials used currently include pentavalent
antimony, amphotericin B and miltefosine. Even though effective, the current line of
antileishmanials are toxic, unaffordable and carry a risk of turning ineffective due to the
emergence of drug resistant parasites [4][5]. This highlights the need to design and develop
new drugs against leishmaniasis. Aminopeptidases are exopeptidases catalyzing the cleavage
of amino acids from N-terminal in proteins and peptides [6]. The metal dependent
aminopeptidase-catalyzed degradation of smaller peptides in the terminal stages of protein
degradation pathway provides free amino acids to the organism [7][8]. The genome of L.
donovani encodes at least twelve aminopeptidases most of which belong to the M1, M20,
M18, M17 and M24 aminopeptidases. There are several reports of these proteins to be
druggable targets against many adversaries like cancer and malaria [9][10].
Methionine aminopeptidases (MAPs) are ubiquitous and highly conserved metal dependent
hydrolases that remove N-terminal initiator methionine from nascent polypeptides either co-
translationally or post-translationally [11] and belong to the M24 class of peptidases as per
the MEROPS peptidase database classification (https://merops.sanger.ac.uk/). The excision of
initiator methionine amino acid residue is a prerequisite for further posttranslational

ACCEPTED MANUSCRIPT
modifications of nascent polypeptides viz. myristoylation, localization, proper folding, and
protein activity in both prokaryotes and eukaryotes [12][13][14]. To hydrolyze the methionyl
amino acid residue in the ultimate position, MAPs require a small uncharged residue (usually
Gly or Ala) at the penultimate position of the nascent polypeptide chain [15].
MAPs are grouped into two categories: type I (MAP 1) and type II (MAP 2), with the unique
insertion of nearly 60 amino acids residues in MAP2 at the C terminus of the catalytic
domain [16]. While as, the MAPs of prokaryotic bacteria and archaea contain the minimal
catalytic domain, MAPs of eukaryotes possess additional N-terminal domains [17] viz. the
occurrence of N-terminal zinc-finger motif (like in human or yeast MAPs) or the existence of
a polybasic/polyacidic domain like the one reported for human MAP type IIb that is
responsible for the phosphorylation blockade of eukaryotic initiation factor 2a subunit [18].
Notably, eukaryotes harbour both isoforms unlike prokaryotic genomes that encode only one
isoform: type I in bacteria and type II in archaea [19]. A previous report on the abundance of
two isoforms in eukaryotes suggests MAP1 to be constitutively expressed and is thence
considered as a house-keeping enzyme. On the contrary, MAP2 expression is regulated by
extra-cellular signals and cell cycle status [20].
MAPs require divalent transition metal ions as cofactors for activity [21]. Previous studies on
MAPs from different organisms indicate cobalt ions to be the most preferred divalent metal
activator [22]. However, MAPs also exhibit activity with other divalent cations like Mn(II),
Ca(II), Ni(II) or Fe(II) [23]. In contrast, Zn(II) is not a very suitable metal cofactor for the
amidolytic activity of most MAPs [24]. The lethal phenotypes developed by MAP knockouts
in both prokaryotes and eukaryotes highlights the importance of this family of enzymes
[25][26]. A recent report on LdMAP2 suggests it to be a key regulator of apoptosis for the
human parasite L. donovani [27]. Moreover, given their essentiality [25], MAPs are emerging
as potential targets for the discovery of novel chemotherapeutics to combat bacterial,

ACCEPTED MANUSCRIPT
microsporidial and parasitical organisms [28][29][13]. The specific inhibitors of MAP2 like
fumagillin and its derivatives have captivated interest in medicine as pro-drugs for diseases
like obesity and cancer [30][31][32][33]. Even though in clinical trials as a potent inhibitor of
MAP2, the use of pro-drug TNP-470 hasn’t captivated interest in the recent years due to
reports of its toxicity [34][35]. This highlights the need to find newer drugs which are small,
potent, highly specific and affordable.
We herein report our findings on the expression, purification, and characterization of
LdMAP2 as well as its interaction and inhibition with aminopeptidase inhibitor bestatin. We
also show recombinant LdMAP2 to be active in the MAP2 enzymatic assay against
fluorogenic substrates. The structural analysis using in silico approach suggests key
differences between the human and parasitic orthologs in the MAP2 prosite, catalytic pocket
and a different binding mode to broad-spectrum aminopeptidase inhibitor bestatin pointing
towards its suitability as a new druggable target. Our results also suggest LdMAP2 to have
more affinity towards divalent calcium paving way for its use as a non-toxic biocatalyst.
Materials and methods
Bacterial strains, plasmids, and enzymes
The competent E. coli DH5-alpha and BL21 (DE3) cells utilised for cloning procedures and
protein expression respectively were procured from Invitrogen (USA). The expression
plasmid pET28a-SUMO was generously gifted by Dr Mohd Akif of the Department of
Biochemistry, University of Hyderabad. Taq polymerase, Phusion polymerase, restriction
enzymes and T4 ligase were procured from Thermo Scientific (USA).

ACCEPTED MANUSCRIPT
Sequence analysis and cloning of LdMAP2
The LdMAP2 sequence comprising of 465 amino acid residues was retrieved from the online
database KEGG (http://www.genome.jp/kegg/). The protein sequence was subjected to Pfam
[36], TOPCONS [37] and Expasy Protparam [38] tool for sequence analysis. The full length
LdMAP2 ORF (1398 nucleotides) was amplified by PCR at an annealing temperature of
58°C from the genomic DNA of Leishmania donovani using gene specific primers as,
forward primer 5' TATGGATCCCCACCAAAGATGTCTGCGAAAAAC 3' and reverse
primer 5' CATCTCGAGCTAGTAGTCGCTTCCCTTGGAAAG 3'. The amplicon was
extracted and purified with GeneJet DNA extraction kit (Thermo Scientific, USA) and
digested overnight at 37°C with restriction enzymes BamHI and XhoI (Thermo Scientific,
USA). The LdMAP2 insert was then purified again and put in frame between the restriction
sites of BamHI and XhoI of the plasmid expression vector pET28a(+)-SUMO. The clone was
confirmed with DNA sequencing (CDFD, Hyderabad) to corroborate the LdMAP2 sequence.
Expression and purification of LdMAP2
The E. coli BL21 (DE3) competent cells for protein expression were transformed with
LdMAP2 clone using a standard transformation procedure. The expression cells transformed
with LdMAP2 were cultured overnight in Luria-Bertani (LB) media carrying 50 μg/ml
kanamycin at 37°C in a shaking incubator. Afterwards, the LB media with 50 μg/ml
kanamycin were inoculated by 1 percent of the starter culture and the culture grown at 37°C
till an OD of 0.5 was obtained at 600 nm. Subsequently, the expression of LdMAP2 was
induced by 0.5 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG). The culture was then
further grown at 37°C for 4 hours before being harvested by centrifugation at 5000 rpm for
20-25 min at 4°C. For protein purification procedures, the cells were suspended in lysis
buffer (50 mM Tris-HCl pH 8.0, 400 mM NaCl, 5% glycerol, 25 mM imidazole) followed by
cell lysis using sonication at a pulse break ratio of 10:10 with 35% amplitude. A DNase

ACCEPTED MANUSCRIPT
treatment in the presence of 10 μm MgCl2 was given to the cell lysate before centrifugation at
14,000 rpm for 45 minutes at 4°C to remove the cell debris. Finally, the soluble recombinant
LdMAP2 protein in the supernatant was allowed to bind to a pre-packed His-trap purification
column (GE Healthcare) with a constant flow rate of 0.5 ml/min on AKTA purification
system (GE Healthcare). After rigorous washing to ward off the non-specificities, the protein
was eluted by elution buffer which was comprised of 50 mM Tris-HCl pH 8.0, 400 mM
NaCl, 5% glycerol and 250 mM imidazole.
To remove metal contaminants, EDTA was incorporated to the pure protein to a final
concentration of 1mM which was later removed by extensive dialysis. To excise the N-
terminal SUMO-tag, SUMO protease (purified separately by affinity chromatography) was
added to the pure protein in 1:100 ratio and subjected to dialysis for 12-16 hours at 4°C in 50
mM Tris-HCl pH 8.0 and 100 mM NaCl. The digested protein was again passed through His-
trap purification column to cause the entrapment of SUMO tag and SUMO protease as both
carry an N-terminal 6X His-tag. While as, the pure protein was collected in the flow through
and then protein quality analysed with 10% (w/v) SDS-PAGE.
Consequently, LdMAP2 was concentrated with a 10 kDa Millipore concentrator and the
volume reduced to 1 ml or less. For buffer exchange, size-exclusion chromatography using
Superdex™75 10/300 GL column (GE Healthcare) was performed with a buffer containing
50 mM Tris-HCl pH 8.0, 150 mM NaCl. The purity of the recombinant LdMAP2 was
verified by SDS-PAGE and the protein concentration was determined on Nano drop (Thermo
Scientific, USA) using molar absorption coefficient of 46870 mol−1 cm−1 and molec lar
weight of 51300 Da (computed using ExPASy- ProtParam).
Enzyme activity assay
The aminopeptidase activity of LdMAP2 was assessed by recording the rate of liberation of
L-methionine, L-leucine and L-alanine from three fluorogenic substrates i.e. methionine-4-

ACCEPTED MANUSCRIPT
methyl-coumaryl-7-amide, leucine-4-methyl-coumaryl-7-amide, and alanine-4-methyl-
coumaryl-7-amide (Sigma Aldrich, USA). The released florescent product (AMC) was
measured using Infinite M200 Pro spectrofluorometer (TECAN, Switzerland) with specific
wavelength pairs suggested by the manufacturer for emission and excitation and as reported
previously [39][40] with modifications wherever necessary. To determine the pH optima for
aminopeptidase activity, 50 mM acetate buffer (pH 3.5, 4.5 and 5.5), 50 mM MES (pH 6.5),
50 mM Tris–HCl, pH (7.5–8.5) and 100 mM CAPS (pH 9.5) were used. All buffers used
were supplemented with 100 μM CoCl2 and 0.1 μM LdMAP2 for activity. After activation at
37°C for 30 minutes, fluorogenic substrate (0.2 mM) was added and the activity was
measured at 37°C. The divalent metal ion requirement was investigated by assaying the
LdMAP2 activity after pre-incubating the enzyme at 37°C for 30 minutes in 50 mM Tris–HCl
(pH 8.0) containing a different metal chloride independently (HiMedia Laboratories, India).
Enzyme kinetics
The steady state kinetic parameters Km and Vmax of LdMAP2 were determined by pre-
incubating the enzyme with 100 μM of metal chloride for 30 minutes at 37°C as reported
previously [40] with necessary modifications. The amidolytic activity was measured in the
substrate concentration range of 10-400 μM with each well blanked by the respective
substrate blank while data plotting. The linear portions of the florescence versus time curve
were used to determine the initial velocity and the kcat determined by converting the
florescence to AMC using an AMC standard curve. The Km and Vmax values were determined
from three independent experiments performed under same conditions.
Influence of metal cofactors
To determine the best divalent activator of LdMAP2, the apo-enzyme was pre-incubated at
37°C for 30 minutes in reaction buffer supplemented with metal chlorides of Co(II), Mg(II),
Mn(II), Ca(II), Cu(II), Ni(II), Fe(II) and Zn(II) in final assay concentrations of 0.1, 10, 100,

ACCEPTED MANUSCRIPT
250, 500, 1000, 5000 and 10000 μM in Tris-HCl buffer (50 mM) at a pH optimum of 7.5. For
every measurement, a control with no metal cofactor was used to reflect the metal
dependence of LdMAP2.
Stability, substrate specificity and inhibition with bestatin
LdMAP2 temperature stability was assessed at seven different pre-incubation temperatures
with the standard condition for activity assays being between 35 and 40°C. The apo-enzyme
was prepared in reaction buffer supplemented with 100 μM CoCl2 as a cofactor. The reaction
mixtures were pre-incubated separately at 10. 20, 30, 40, 50, 60 and 70°C and the reaction
started by adding 200 μM of substrate. After incubation at specified temperatures for 30
minutes, the released AMC was recorded using Infinite M200 Pro spectrofluorometer
(TECAN, Switzerland). To study substrate specificity, three different fluorogenic substrates
(Ala-AMC, Leu-AMC, Met-AMC) were used and the activity of LdMAP2 for each substrate
recorded in triplicates. Furthermore, to evaluate the inhibitory efficacy of bestatin, the protein
was pre-incubated with 100 μM CoCl2 and varying concentrations of bestatin (1-50 μM) for
30 minutes at 37°C. This was followed by the addition of substrate and the measurement of
residual activity at 37°C for 60 minutes with a break of 3 minutes between measurements.
Circular Dichroism (CD) Spectroscopy
CD spectra of LdMAP2 in the presence of substrates and substrate analog bestatin were
recorded on JASCO-J1500 CD spectropolarimeter in a quartz cell with a path length of 0.2
cm. The spectropolarimeter was set to accumulate three scans for each spectra at a scan speed
of 50 nm min−1. The data was collected at every nanometer from 190 to 250 nm with the final
concentration of LdMAP2 used at 0.003 mM. The concentrations of substrates and substrate
analog were in the range of 0.001-0.010 mM. To study thermo-stability of LdMAP2, spectral
changes were recorded in the temperature range of 20 to 100°C. The Gibbs free energy of
unfolding (ΔG) was determined by denaturing the protein with urea (10 mM- 6 M). Besides,

ACCEPTED MANUSCRIPT
three scans were accumulated in the far-UV region for protein in the pH range of 3.5 to 9.5.
The secondary structure content of LdMAP2 and the changes underwent by it were analyzed
using the K2D algorithm available on DICHROWEB [41].
Homology modelling and Molecular docking
The program Modeller 9.15 version [42] was used to predict the three-dimensional structure
of LdMAP2 by satisfying its spatial restraints using a template with high identity, coverage
and similarity to the query LdMAP2sequence. The program BLAST-P was used to search
similar crystallographic protein structures with crystal structure of human MAP2 (PDB ID:
1BN5) chosen as template for homology modelling. After fixing the Ramachandran outliers
and loop refinement with ModLoop [43], energy minimization was performed with Gromacs
4.6.3 [44]. The geometry of the model was analysed with RAMPAGE [45] and the LdMAP2
structure visualized using PyMOL [46]. The energy minimized structure of LdMAP2 was
used for molecular docking using AutoDockVina1.1.2 version [47]. The structural
coordinates of substrates i.e. leucine-4-methyl-coumaryl-7-amide, methionine-4-methyl-
coumaryl-7-amide, alanine-4-methyl-coumaryl-7-amide and the inhibitor bestatin were
retrieved from the online database Pubchem [48], and the geometry was optimized with
Discovery studio 3.5 software [49]. To define all possible binding sites and to have structural
inputs, a grid based procedure was followed [50]. The macromolecule and ligands were saved
as PDBQT files as input files for Autodock Vina. The grid dimension used was 80x88x80
points for blind docking on the macromolec le y the program to rid with a spacing of
0. 0 . All other parameters were inserted at their default settings.
Molecular Dynamics Simulations
Molecular dynamics simulations were executed with Gromacs 4.6.3 [44] using GROMACS
96 as a force field and SPC as water model for 30 ns for both native LdMAP2 and LdMAP2-
bestatin complex as reported previously [51] with certain modifications. For LdMAP2-

ACCEPTED MANUSCRIPT
bestatin complex, the docking conformation with highest binding affinity was selected. The
topology and itp files for bestatin were generated from PRODRG server [52] and added to
LdMAP2 topology file to generate a complex topology file. Then, the simulations of native
protein and LdMAP2 with bestatin were done in water as solvent with SPC model in a cubic
box. To neutralize the system, eight Na+ ions were added by replacing the solvent (H2O)
molecules. Energy minimization was executed by the steepest decent method for 5000 steps.
The application of retardants to the ligand and temperature coupling group treatments were
imparted during all simulations. Using GROMACS genester module, the itp file for the
bestatin was generated and this information was included in the topology file. A special index
group of protein and bestatin was created using make_ndx module to treat protein and ligand
separately followed by equilibration Phase I (NVT) and Phase II (NPT) for 50 ps before
setting up a run for 30 ns production simulations at 300K. All MD simulations and results
analysis were performed with the 16 node OSCAR Linux cluster at the Bioinformatics
Facility of School of Life Sciences, University of Hyderabad, India.
Results and discussion
Protein sequence analysis of LdMAP2
The Expasy Protparam tool revealed the protein to be 465 residues long with an approximate
molecular weight of 51.30 kDa. The theoretical pI value and the instability index of the
sequence were computed to be 6.64 and 44.50 respectively. Besides, the aliphatic index was
found to be 69.68 and the grand total average of hydropathicity being -0.620 making the
protein slightly hydrophobic. The analysis with TOPCONS revealed no trans-membrane
region or signal peptide sequence in the LdMAP2 sequence. While as, the Pfam program
displayed a two domain organisation of LdMAP2 like other members of M24
aminopeptidases [53]. The cloned sequence carries
a
MAP2 signature motif

ACCEPTED MANUSCRIPT
DVCKLDFGVHVNGYIID which matches the general prosite motif of this class of
aminopeptidases DA-LIVMY-x-K-LIVM-D-x-G-x-HQ-LIVM-DNS-G-x(3)-D [54]. The
sequence alignment of LdMAP2 sequence with human MAP2 revealed the catalytic residues
to be conserved in two orthologs. Consequent to the multiple amino acid substitutions in
signature motif of LdMAP2 and the presence of different residues near the prosite, the
structure assumed different conformation and a slightly different active site organization
which may prove significant for drug design. The multiple sequence alignment reflects nearly
57% sequence identity of LdMAP2 with human MAP2 (Fig. 1). Previous reports suggest
MAP2 enzymes to be cobalt activated proteins with two cobalt ions bound to two aspartic
acids, a histidine and two glutamic acids (D, D, H, E and E) at the active site [16][53].
Cloning, expression and purification of LdMAP2
The full length MAP2 of human parasite L. donovani was cloned into the expression vector
pET28a(+)-SUMO. DNA sequencing result and sequence alignment of MAP2 sequence with
human MAP2 sequence confirmed that the LdMAP2 clone belongs to MAP2 category of
M24 methionine aminopeptidases. The protein was expressed in E. coli BL21 (DE3) cells
and purified by metal affinity chromatography. The quality of protein was checked on 8%
(w/v) SDS-PAGE before and after the cleavage of SUMO tag (Fig. 2A). Furthermore,
analysis of partition coefficient (kav) versus log10 molecular weight of standard set of proteins
with the kav value of recombinant LdMAP2 suggested it to be a monomer (Fig. 2B). Notably,
other members of the M24 methionine aminopeptidases (MAPs) including the human MAP2
exist as monomers as well [55][53].
Co(II) is the major activator of LdMAP2 for amidolytic activity against synthetic
substrates
The amidolytic activity of LdMAP2was assessed with eight metal chlorides Ca(II), Co(II),
Cu(II), Mg(II), Mn(II), Ni(II), Zn(II), and Fe(II) at an optimum metal ion concentration of

ACCEPTED MANUSCRIPT
100 μM (Fig. 3A, 3B & 3C) and the kinetic parameters determined using Graphpad prism 4.0
(Table 1). The optimal pH for the catalytic activity of LdMAP2 against the fluorogenic
substrates used in this study was 7.5 (Fig. 4C and 4D). To ascertain reasons behind less or no
activity of LdMAP2 at low and high pH, CD spectra were taken at different pH. The spectra
taken at extreme pH recorded a sharp dip in LdMAP2 secondary structural elements
particularly at pH 3.5 and pH 9.5 where protein had lost significant secondary structure. The
protein had highest secondary structural content at pH 7.5 and thence more catalytic activity
(Fig. 4D) much like other MAPs [24][19]. Although LdMAP2 exhibited highest enzyme
activity with Co(II), the Km was least when LdMAP2 was activated by Ca(II). This suggests
the high affinity of Ca(II) for LdMAP2 (Table 1), while Zn(II) activated LdMAP2 like its
human counterpart showed negligible amidolytic activity towards the fluorogenic substrates
[22]. The Co(II) or Ca(II) activated LdMAP2 was largely active at all metal concentrations
below1000 μM. However, activity diminished significantly at higher concentrations possibly
due to the interference of high metal concentrations in catalysis [16]. Interestingly, the
spectra of LdMAP2 taken at higher metal concentration showed significant loss of secondary
structure (Fig. 4A and 4B). Additionally, CD results indicated that high concentrations of
metal decreased the thermal stability of LdMAP2 as the protein was denatured at apparently
lesser temperatures compared to the apoenzyme (Fig. 4F and 4H). The higher activity
exhibited by LdMAP2 with Co(II) can be attributed to the formation of low spin trigonal
bipyramidal complexes which tend to be more stable than the complexes formed by zinc [56].
Furthermore, the binding of additional solvents leads to high coordination number of cobalt
complexes which intensifies the positive charge of divalent cobalt ions and in turn enhances
substrate binding and intermediate stabilization [57][58]. Moreover, Mn(II) and Mg(II)
activated LdMAP2 resulted in significant activity like TbMAP1 [24], whereas Ni(II), Cu(II)
and Fe(II) activated LdMAP2 had a less catalytic efficiency. For Fe(III) or Fe(II) activated

ACCEPTED MANUSCRIPT
LdMAP2, a feeble activity was noticed at all metal ion concentrations supplemented in the
assay buffer.
Influence of temperature and SUMO-tag on LdMAP2 activity
In order to check the effect of temperature on the LdMAP2 activity, a temperature range of
10-90°C with an interval of 10°C was used and the LdMAP2 activity recorded after the
addition of substrate Ala-AMC. The LdMAP2 enzyme was stable and exhibited significant
aminopeptidase activity up to 50°C (Fig. 4E). Beyond this the aminopeptidase activity
declined since the LdMAP2 denatures profusely after 50°C (Fig. 4F). A similar stability
pattern was seen for the calcium activated enzyme (Fig. 4H). Furthermore, the enzymatic
activities of recombinant LdMAP2 were studied only after the complete cleavage of N-
terminal SUMO-tag. The enzymatic activity of LdMAP2 with SUMO tag was lesser when
compared to the protein without tag possibly due to the structural alterations or interference
caused by this N-terminal tag. Furthermore, in the absence of metal ion or in the presence of
a metal chelator (EDTA) in the reaction buffer, the LdMAP2 activity was undetectable.
However, the activity of LdMAP2 enhanced steeply in presence of Co(II), Mn(II) or Mg(II)
as is the case with other aminopeptidases [22][28].
LdMAP2 prefers smaller synthetic substrate Ala-AMC to Met-AMC or Leu-AMC
The enzymatic activity of LdMAP2 was determined against three fluorogenic substrates
namely leucine-4-methyl-coumaryl-7-amide, methionine-4-methyl-coumaryl-7-amide and
alanine-4-methyl-coumaryl-7-amide. The fluorogenic substrate Ala-AMC was used for
enzyme activity as aminopeptidase activity of LdMAP2 was found to be poor against the
synthetic fluorogenic substrates Met-AMC like its human counterpart [22]. This could be
because Met- MC is a synthetic s strate and doesn’t match the physiological s strates of
LdMAP2 where it prefers a smaller residue such as Gly or Ala at the pen-ultimate position for
cleavage of N-terminal methionine [15]. However, LdMAP2 cleaved smaller amino acid

ACCEPTED MANUSCRIPT
residue Ala efficiently from the substrate Ala-AMC in comparison to Met-AMC and Leu-
AMC which it cleaved poorly and slowly (Fig. 4G). Amongst three substrates, the activity of
LdMAP2 was maximum against Ala-AMC suggesting it to be more active in hydrolyzing
smaller amino acid residues from synthetic substrates. The activity against Ala-AMC was
defined as 100% while comparison of LdMAP2 activity against other fluorogenic substrates.
Bestatin inhibits LdMAP2 in a dose dependent manner
Bestatin is a naturally occurring dipeptide and a prominent metalloaminopeptidase inhibitor
produced by Streptomyces olivoretuculii (Actinomycetes) [59]. It is reported to inhibit many
aminopeptidases including the members of M17 aminopeptidases [60], aminopeptidase B and
induces programmed cell death [61]. Besides, bestatin has found use in the treatment of acute
myelocytic leukemia [62] and melanoma [63]. Bestatin inhibits other families of
aminopeptidases like the M1 and M17 aminopeptidases and has shown potential as a prodrug
due to its low toxicity in experimental animals [64][65]. Notably, bestatin has been
formulated to use as a drug against squamous cell carcinoma in humans [61]. The major
molecular targets of bestatin are the metal dependent aminopeptidases in cells [66]. Bestatin
inhibited the enzyme activity of LdMAP2 in in vitro inhibition assays in a dose dependent
manner (Fig. 5A). Moreover, bestatin proved to be a potent inhibitor of LdMAP2 with a Ki
value of 0.86 μM. Analysis of bestatin binding mode with LdMAP2 revealed it to be a
competitive inhibitor of LdMAP2 as the binding occurred at the active site like other
aminopeptidases inhibited by it [67][68]. The binding mechanism was elucidated by plotting
the Line-weaver Burk plot (Fig. 5B) of the uninhibited and inhibited LdMAP2 and docking of
bestatin with the modelled structure of LdMAP2 (Fig. 8B). The inhibitory efficacy of bestatin
suggests it to be a useful scaffold which can guide the design of novel and small molecule
inhibitors for the selective inhibition of LdMAP2.

ACCEPTED MANUSCRIPT
Addition of bestatin and fluorogenic substrates increased secondary structural elements
of LdMAP2
CD spectroscopy was employed to study the changes occurred in LdMAP2 secondary
structure upon binding to fluorogenic substrates and bestatin and to study the thermodynamic
stability. To calculate Gibbs free energy (ΔG), the spectral data taken at different
concentrations of urea was normalized and fitted into two-state unfolding transition [69]. The
free energy (ΔG) was computed to be approximately 2.2 kcal mol-1 (Fig. 6A and 6B). A
concentration dependent increase in the ellipticity at 208 and 222 nm were observed in the
CD spectra of LdMAP2 upon addition of its substrates and bestatin. We reasoned that the
secondary structural change may have come into existence due to the helix stabilization upon
the addition of Ala-AMC, Met-AMC, Leu-AMC and bestatin. This behaviour is already
known for a metal dependent aminopeptidase [70] and human serum albumin [71]. The
secondary structural elements of LdMAP2 and the changes in the structure thereof were
analyzed by using the K2D algorithm of the software program DICHROWEB. In the
apoLdMAP2, the secondary structure consists of 2 % α-helix, 42% β-sheets and 30% random
coils which are in close agreement with the secondary structural elements seen in the 3D
structure of LdMAP2. Furthermore, the signal at 208 nm increased predominantly at all
concentration of Ala-AMC, Met-AMC, Leu-AMC and bestatin. At 0.010 mM concentration
of bestatin, the α-helical content soared to 32%, while the proportion of β-sheets increased to
50% and random coils plunged to 18%, respectively (Fig. 6C and 6D). A similar pattern was
observed with synthetic substrates of LdMAP2 used in this study. These results indicate that
the secondary structure of LdMAP2 gained more order and random coil declined due to the
addition of substrates and bestatin which presumably leads to respective complex formations.
The differential changes in LdMAP2 conformation upon binding of bestatin, Ala-AMC, Met-
AMC and Leu-AMC may be attributed to differences in the sizes of the amino acid chains of

ACCEPTED MANUSCRIPT
these substrates. Moreover, it is clearly observed that bestatin has less influence than Ala-
AMC, Leu-AMC and Met-AMC which might be due to the larger size of these substrates.
The change in the average secondary structure of LdMAP2 may not be due to the flexibility
of two domains in the proteins as MDS st dies didn’t s ggest any considera le flexi ility in
the overall protein structure.
Homology modelling of LdMAP2and molecular docking studies
The full length protein sequence comprised of nearly 100 residues in disordered region at the
N-terminus for which multiple searches with BLAST-P didn’t find a template. Therefore,
LdMAP2 sequence was modelled without the initial 99 amino acid residues. Analysis of the
modelled structure with RAMPAGE suggested two residues (S39 and K42) to be in the
disallowed regions of the Ramachandran plot. However, when the outliers in the modelled
structure were fixed with program ModLoop and the structure subjected to energy
minimization with Gromacs 4.6.3, one amino acid residue (proline at seventh position) from
the N-terminus was found to be in the disallowed region. We further proceeded for the
docking with bestatin and fluorogenic substrates as the residue was far off from the C-
termin s catalytic domain and hadn’t any effect on the ligand binding of LdMAP2 and the
interactions thereof. The superimposition of the modelled and energy minimized structure
revealed an RMSD of 0.16 which suggests trivial differences and great structural
conservation between the two structures. The superimposition of the LdMAP2 structure with
HsMAP2 structure showed an RMSD of 0.22 suggesting significant structural similarity
between the two orthologs. The modelled LdMAP2 structure is composed of thirteen β-sheets
and eight α-helices with four active site residues (D139, H119, E252 and E347) embedded in
the β-sheets 3, 7, 9 and 12 respectively. Another catalytic residue D150 is located in the
central loop connecting two small β-sheets. Like HsMAP2 [53], LdMAP2 has its active site

ACCEPTED MANUSCRIPT
located approximately at the centre of central β sheet on the concave face with two adjacent
pairs of α helices and a short COOH-terminal tail covering the sheet’s convex face (Fig. 7A).
Consequently, Autodock Vina 1.1.2 program was employed to understand the interactions of
bestatin and other substrates with LdMAP2. Amongst all generated binding conformations
between LdMAP2 and ligands, the conformer with the lowest binding free energy in every
case was used for further analysis. The docking results showed that all the docked ligands
bind at the active site of LdMAP2. However, bestatin and substrate Ala-AMC because of
lesser size embedded deep and had strong contacts with LdMAP2 active site when compared
with the Met-AMC and Leu-AMC. Interestingly, the latter were not the most favourable
substrates for LdMAP2 in the enzymatic assays too. The key substitutions in the MAP2
prosite (Fig. 7B) like the presence of residues V, M and N in LdMAP2 structure confer
different interactions to the structure with inhibitor bestatin and substrates Ala-AMC, Met-
AMC and Leu-AMC. Bestatin, which proved to be a potent inhibitor of LdMAP2, binds
strongly to residues S217, H227, S231 and the active site residue E252 in the catalytic pocket
(Fig. 8B). While as, bestatin interacted with only E255 feebly ( ond distance .49 ) at the
catalytic pocket of the crystal structure of HsMAP2 (Fig. 8A). Therefore, the docking studies
suggest Met-AMC and Leu-AMC to be less preferred substrates of LdMAP2. This is
presumably because of the failure of Met-AMC and Leu-AMC to make a good contact with
the active site of LdMAP2 like Ala-AMC and bestatin. After a thorough analysis of the
molecular docking studies, it was concluded that the interactions between LdMAP2 and
substrates are majorly due to the hydrophobic forces and hydrogen bonding (Fig. 8C-E)
which is similar to the atomic interactions reflected in the crystal structures of TbLAP with
bestatin [72] and PfM1AAP with bestatin [73].

ACCEPTED MANUSCRIPT
Bestatin formed a stable complex with LdMAP2 during molecular dynamics studies
The molecular dynamics simulations were used to calculate the stability of the LdMAP2 and
its complexes with bestatin. The parameters RMSD and RMSF along with the radius of
gyration (Rg) of the protein (LdMAP2) and its complexes were used for the analysis of the
rigidity, protein micro-environment and complex stability during 30 ns MD simulations. The
system proved to be stable which reflects the authenticity of molecular docking results where
bestatin is bound to LdMAP2 at the active site. The root mean square deviation (RMSD)
values of atoms in native LdMAP2 and LdMAP2-bestatin complex were plotted from 0 to 30
ns. It was observed that the RMSDs of both systems reached to equilibrium and there was a
progressive increase in RMSD until 3 ns with LdMAP2 RMSD increasing to approximately
0.33 Å at approximately 3.5 ns. The LdMAP2-bestatin complex marked a dip in RMSD at 8
ns and a sharp rise at 20 ns followed by a dip towards the end of MDS. As shown in the Fig.
9A, both LdMAP2 and LdMAP2-bestatin complex were stable throughout the 30 ns MDS run
with the LdMAP2-bestatin complex having contrastingly lesser fluctuation towards the end.
The flexibility of the protein during MDS was investigated by calculating RMSF values of
free LdMAP2 and LdMAP2-bestatin complex. The RMSF (in nm) was plotted against residue
numbers on a 30 ns trajectory and clearly indicated that LdMAP2-bestatin complex had lower
fluctuations than native LdMAP2. The non-catalytic residues (Y351, P354, T355 and E358)
at C-terminus of the protein in LdMAP2-bestatin complex showed greater fluctuations. Since
the fluctuating residues do not make up the catalytic site and the catalytic residues in the
complex have less fluctuation, it can be asserted that the structure of LdMAP2 active site in
the complex stood rigid during MDS (Fig. 9B).
The compactness of LdMAP2 and LdMAP2-bestatin complex was analyzed by plotting Rg
values against time. The radius of gyration (Rg) which describes the overall mobility of the
molecules and can be referred to as the root-mean-square distance of atomic assemblies from

ACCEPTED MANUSCRIPT
their common centre of gravity was determined and plotted. A thorough analysis revealed
that the Rg values to be stable for both native LdMAP2 and LdMAP2-bestatin complex
throughout the 30 ns MDS run and pointed towards negligible fluctuations. This steadiness
highlights that the stability, folding and compactness of the protein to be almost similar with
and without bestatin (Fig. 9C). Therefore, the results depict that the MD simulations achieved
equilibrium after 25 ns and emphasize that bestatin binds to LdMAP2 in MD simulations due
to a probable change in the microenvironment of LdMAP2 which leads to conformational
changes in the LdMAP2 structure. This was reaffirmed by the changes in the secondary
structure seen during MDS after analysis with the program DSSP [74] (Fig. 9D). All results
obtained are substantiated by the results of circular dichroism where we noted changes in the
secondary structural elements of LdMAP2 upon binding of substrates and bestatin.
Therefore, from the MD simulation data we conclude that LdMAP2-bestatin complex was
stabilized by conformational rearrangements in the structure of LdMAP2. It was also found
that the binding of bestatin to LdMAP2 slightly recasts the loop regions connecting the β-
sheets and helices at the active site pocket. Bestatin interacts with LdMAP2 majorly through
hydrogen bonding and conformational adjustments in the protein structure. Thus, the results
of CD are in close agreement with the MD simulations results as both suggest the occurrence
of conformational changes in the LdMAP2 upon bestatin binding. Such conformational
changes have previously been reported for the E. coli aminopeptidase N upon bestatin
binding [75].
Conclusions
In conclusion, we purified LdMAP2 to homogeneity, analysed its metal dependence,
enzymatic characteristics and substrate preferences. Our findings from biochemical assays
asserted that LdMAP2 functions optimally at physiological pH and its activity was enhanced

ACCEPTED MANUSCRIPT
by divalent cations with cobalt emerging as the major enhancer for amidolytic activity. We
then underscored the need to repurpose bestatin as a prodrug as it potently inhibited
LdMAP2. Additionally, CD studies revealed that bestatin and fluorogenic substrates increase
the α-helical and β-sheet contents of LdMAP2. Molecular docking suggested that the
LdMAP2-bestatin complex was stabilized by the hydrophobic interactions and hydrogen
bonding. Furthermore, structural studies indicated that the catalytic pocket of LdMAP2 is
different from its human counterpart and suggested different binding modes of two orthologs
with bestatin. This substantiates the idea that LdMAP2 can be a potential druggable target to
design and develop novel antileishmanials. Our studies provide important insights into the
structure of LdMAP2 and critical quantitative and mechanistic data on the binding affinity of
bestatin with LdMAP2 which may guide bestatin based drugs against leishmaniasis.
Author Contributions
This manuscript was drafted by SYB who also conducted experiments for this study with
help of AD. IAQ conceived, designed and supervised the study. All authors critically
reviewed the work and manuscript.
Acknowledgements
This work was supported by a grant awarded to Dr. Insaf A. Qureshi by the Council of
Scientific and Industrial Research, India (CSIR, project no. 37(1686)/17/EMR-II),
Government of India. The authors are grateful to the University of Hyderabad in general for
Fellowship and Department of Biotechnology and Bioinformatics, University of Hyderabad
in particular for extending facilities and support for this work. The authors are also thankful
to Prof. Swati Saha for providing genomic DNA of Leishmania donovani as well as Drs. N.P.
Prabhu, Mohd. Akif and M. Venkataramana for their suggestions during this work.

ACCEPTED MANUSCRIPT
Conflict of interest
The authors hereby declare to have no conflict of interest whatsoever.
References
[1] B.L. Herwaldt, Leishmaniasis, Lancet. 354 (1999) 1191–1199. doi:10.1016/S0140-
6736(98)10178-2.
[2] World Health Organization, Control of the leishmaniases: Report of a meeting of the
WHO Expert Committee on the Control OF Leishmaniasis. GENEVA, World Health
Organ. Tech. Rep. Ser. (2010) 185. doi:https://goo.gl/6iYa7H.
[3] J. Alvar, I.D. Vélez, C. Bern, M. Herrero, P. Desjeux, J. Cano, J. Jannin, M. de Boer,
Leishmaniasis worldwide and global estimates of its incidence, PLoS One. 7 (2012).
doi:10.1371/journal.pone.0035671.
[4] S. Sundar, Drug resistance in Indian visceral leishmaniasis, Trop. Med. Int. Heal. 6
(2001) 849–854. doi:10.1046/j.1365-3156.2001.00778.x.
[5] S. Mohapatra, Drug resistance in leishmaniasis: Newer developments, Trop. Parasitol.
4 (2014) 4. doi:10.4103/2229-5070.129142.
[6]
a Taylor, Aminopeptidases: structure and function., FASEB J. 7 (1993) 290–298.
doi:10.1186/1750-1326-5-48.
[7] T. Gonzales, J. Robert-Baudouy, Bacterial aminopeptidases: properties and functions,
FEMS Microbiol. Rev. 18 (1996) 319–344. doi:10.1016/0168-6445(96)00020-4.
[8] M. Hilde randt, . International Conference on Dipeptidyl minopeptidases (2002ꢀ:
Berlin, Dipeptidyl aminopeptidases in health and disease, 2003. doi:10.1007/b105297.
[9] P. Selvakumar, A. Lakshmikuttyamma, J.R. Dimmock, R.K. Sharma, Methionine
aminopeptidase 2 and cancer, Biochim. Biophys. Acta - Rev. Cancer. 1765 (2006)

ACCEPTED MANUSCRIPT
148–154. doi:10.1016/j.bbcan.2005.11.001.
[10] T.S. Skinner-Adams, J. Lowther, F. Teuscher, C.M. Stack, J. Grembecka, A. Mucha,
P. Kafarski, K.R. Trenholme, J.P. Dalton, D.L. Gardiner, Identification of phosphinate
dipeptide analog inhibitors directed against the Plasmodium falciparum M17 leucine
aminopeptidase as lead antimalarial compounds, J. Med. Chem. 50 (2007) 6024–6031.
doi:10.1021/jm070733v.
[11] W.T. Lowther, B.W. Matthews, Structure and function of the methionine
aminopeptidases, Biochim. Biophys. Acta - Protein Struct. Mol. Enzymol. 1477 (2000)
157–167. doi:10.1016/S0167-4838(99)00271-X.
[12] J. a Boutin, Myristoylation., Cell. Signal. 9 (1997) 15–35. doi:10.1016/S0898-
6568(96)00100-3.
[13] X. Chen, S. Xie, S. Bhat, N. Kumar, T.A. Shapiro, J.O. Liu, Fumagillin and
fumarranol interact with P. falciparum methionine aminopeptidase 2 and inhibit
malaria parasite growth in vitro and in vivo, Chem. Biol. 16 (2009) 193–202.
doi:10.1016/j.chembiol.2009.01.006.
[14] C. Giglione, A. Boularot, T. Meinnel, Protein N-terminal methionine excision, Cell.
Mol. Life Sci. 61 (2004). doi:10.1007/s00018-004-3466-8.
[15] P.H. Hirel, M.J. Schmitter, P. Dessen, G. Fayat, S. Blanquet, Extent of N-terminal
methionine excision from Escherichia coli proteins is governed by the side-chain
length of the penultimate amino acid., Proc. Natl. Acad. Sci. U. S. A. 86 (1989) 8247–
51. doi:10.1073/pnas.86.21.8247.
[16] A. Addlagatta, X. Hu, J.O. Liu, B.W. Matthews, Structural basis for the functional
differences between type I and type II human methionine aminopeptidases,
Biochemistry. 44 (2005) 14741–14749. doi:10.1021/bi051691k.

ACCEPTED MANUSCRIPT
[17] R.A. Bradshaw, W.W. Brickey, K.W. Walker, N-terminal processing: The methionine
aminopeptidase and N(alpha)-acetyl transferase families, Trends Biochem. Sci. 23
(1998) 263–267. doi:10.1016/S0968-0004(98)01227-4.
[18] B. Datta, M.K. Ray, D. Chakrabarti, D.E. Wylie, N.K. Gupta, Glycosylation of
eukaryotic peptide chain initiation factor 2 (eIF-2)-associated 67-kDa polypeptide
(p67) and its possible role in the inhibition of eIF-2 kinase-catalyzed phosphorylation
of the eIF-2ꢀalpha-subunit, J. Biol. Chem. 264 (1989) 20620–20624.
[19] S. Calcagno, C.D. Klein, N-Terminal methionine processing by the zinc-activated
Plasmodium falciparum methionine aminopeptidase 1b, Appl. Microbiol. Biotechnol.
100 (2016) 7091–7102. doi:10.1007/s00253-016-7470-3.
[20] M. Chatterjee, N. Chatterjee, R. Datta, B. Datta, N.K. Gupta, Expression and activity
of p67 are induced during heat shock, Biochem Biophys Res Commun. 249 (1998)
113–117. doi:10.1006/bbrc.1998.9056.
[21] V.M. D’so za, B. Bennett, A.J. Copik, R.C. Holz, Divalent metal binding properties of
the methionyl aminopeptidase from Escherichia coli, Biochemistry. 39 (2000) 3817–
3826.
[22] G. Yang, R.B. Kirkpatrick, T. Ho, G.F. Zhang, P.H. Liang, K.O. Johanson, D.J.
Casper, M.L. Doyle, J.P. Marino, S.K. Thompson, W. Chen, D.G. Tew, T.D. Meek,
Steady-state kinetic characterization of substrates and metal-ion specificities of the
full-length and N-terminally truncated recombinant human methionine
aminopeptidases
(Type
2),
Biochemistry.
40
(2001)
10645–10654.
doi:10.1021/bi010806r.
[23] L. Meng, S. R e sh, V.M. D’so za, .J. Copik, S. Ts nasawa, R.C. Holz,
Overexpression and divalent metal binding properties of the methionyl aminopeptidase

ACCEPTED MANUSCRIPT
from
Pyrococcus
furiosus,
Biochemistry.
41
(2002)
7199–7208.
doi:10.1021/bi020138p.
[24] A. Marschner, C.D. Klein, Metal promiscuity and metal-dependent substrate
preferences of Trypanosoma brucei methionine aminopeptidase 1, Biochimie. 115
(2015) 35–43. doi:10.1016/j.biochi.2015.04.012.
[25] X. Li, Y.-H. Chang, Amino-terminal protein processing in Saccharomyces cerevisiae
is an essential function that requires two distinct methionine aminopeptidases, Proc.
Natl. Acad. Sci. U.S.A. 92 (1995) 12357–12361. doi:10.1073/pnas.92.26.12357.
[26] S.Y. Chang, E.C. McGary, S. Chang, Methionine aminopeptidase gene of Escherichia
coli is essential for cell growth, J. Bacteriol. 171 (1989) 4071–2.
[27] R. Kumar, K. Tiwari, V.K. Dubey, Methionine aminopeptidase 2 is a key regulator of
apoptotic like cell death in Leishmania donovani, Sci. Rep. 7 (2017) 95.
doi:10.1038/s41598-017-00186-9.
[28] M. Altmeyer, E. Amtmann, C. Heyl, A. Marschner, A.J. Scheidig, C.D. Klein, Beta-
aminoketones as prodrugs for selective irreversible inhibitors of type-1 methionine
aminopeptidases, Bioorganic Med. Chem. Lett. 24 (2014) 5310–5314.
doi:10.1016/j.bmcl.2014.09.047.
[29] J.J. Alvarado, A. Nemkal, J.M. Sauder, M. Russell, D.E. Akiyoshi, W. Shi, S.C. Almo,
L.M. Weiss, Structure of a microsporidian methionine aminopeptidase type 2
complexed with fumagillin and TNP-470, Mol. Biochem. Parasitol. 168 (2009) 158–
167. doi:10.1016/j.molbiopara.2009.07.008.
[30] E. Brakenhielm, Angiogenesis inhibitor, TNP-470, prevents diet-induced and genetic
obesity
in
mice,
Circ.
Res.
94
(2004)
1579–1588.
doi:10.1161/01.RES.0000132745.76882.70.

ACCEPTED MANUSCRIPT
[31] Y.M. Kim, J.J. An, Y.J. Jin, Y. Rhee, B.S. Cha, H.C. Lee, S.K. Lim, Assessment of the
anti-obesity effects of the TNP-470 analog CKD-732, J. Mol. Endocrinol. 38 (2007)
455–465. doi:10.1677/jme.1.02165.
[32] F. Frottin, W. V. Bienvenut, J. Bignon, E. Jacquet, A. Sebastian Vaca Jacome, A. Van
Dorsselaer, S. Cianferani, C. Carapito, T. Meinnel, C. Giglione, MetAP1 and MetAP2
drive cell selectivity for a potent anti-cancer agent in synergy, by controlling
glutathione
redox
state,
Oncotarget.
7
(2016)
63306–63323.
doi:10.18632/oncotarget.11216.
[33] J.W. Stern, J. Fang, S. Shusterman, G. Pierson, R. Barr, B. Pawel, L. Diller, S.A.
Grupp, Angiogenesis inhibitor TNP-470 during bone marrow transplant: safety in a
preclinical model, Clin. Cancer Res. 7 (2001) 1026–1032.
[34] C.S. Rutland, K. Jiang, G.A. Soff, C.A. Mitchell, Maternal administration of anti-
angiogenic agents, TNP-470 and angiostatin4.5, induces fetal microphthalmia, Mol.
Vis. 15 (2009) 1260–1269. doi:134 [pii].
[35] R. Satchi-Fainaro, M. Puder, J.W. Davies, H.T. Tran, D.A. Sampson, A.K. Greene, G.
Corfas, J. Folkman, Targeting angiogenesis with a conjugate of HPMA copolymer and
TNP-470, Nat. Med. 10 (2004) 255–261. doi:10.1038/nm1002.
[36] R.D. Finn, A. Bateman, J. Clements, P. Coggill, R.Y. Eberhardt, S.R. Eddy, A. Heger,
K. Hetherington, L. Holm, J. Mistry, E.L.L. Sonnhammer, J. Tate, M. Punta, Pfam: the
protein families database, Nucleic Acids Res. 42 (2014) D222-230.
doi:10.1093/nar/gkt1223.
[37] K.D. Tsirigos, C. Peters, N. Shu, L. Käll, A. Elofsson. The TOPCONS web server for
consensus prediction of membrane protein topology and signal peptides. Nucleic Acids
Res. 43 (2015) W401-407. doi:10.1093/nar/gkv485.

ACCEPTED MANUSCRIPT
[38] E. Gasteiger, C. Hoogland, A. Gattiker, S. Duvaud, M.R. Wilkins, R.D. Appel, A.
Bairoch, Protein Identification and Analysis Tools on the ExPASy Server, in: J.M.
Walker (Ed), The Proteomics Protocols Handbook, Humana Press 2005, pp. 571-607.
[39] J. González-Bacerio, J. Osuna, A. Ponce, R. Fando, K. Figarella, Y. Méndez, J.L.
Charli, M.D.L.Á. Chávez, High-level expression in Escherichia coli, purification and
kinetic characterization of Plasmodium falciparum M1-aminopeptidase, Protein Expr.
Purif. 104 (2014) 103–114. doi:10.1016/j.pep.2014.08.002.
[40] J. Zheng, Z. Cheng, H. Jia, Y. Zheng, Characterization of aspartyl aminopeptidase
from Toxoplasma gondii, Sci. Rep. 6 (2016) 34448. doi:10.1038/srep34448.
[41] L. Whitmore, B.A. Wallace, DICHROWEB, an online server for protein secondary
structure analyses from circular dichroism spectroscopic data, Nucleic Acids Res. 32
(2004) W668-73. doi:10.1093/nar/gkh371.
[42] A. Sali, MODELLER A Program for Protein Structure Modeling Release 9v4, r6262,
Structure. (2008) 779–815.
[43] A. Fiser, A. Sali, ModLoop: Automated modeling of loops in protein structures,
Bioinformatics. 19 (2003) 2500–2501. doi:10.1093/bioinformatics/btg362.
[44] D. Van Der Spoel, E. Lindahl, B. Hess, G. Groenhof, A.E. Mark, H.J.C. Berendsen,
GROMACS: Fast, flexible, and free, J. Comput. Chem. 26 (2005) 1701–1718.
doi:10.1002/jcc.20291.
[45] W. Wang, M. Xia, J. Chen, F. Deng, R. Yuan, X. Zhang, F. Shen, Data set for
phylogenetic tree and RAMPAGE Ramachandran plot analysis of SODs in Gossypium
raimondii
doi:10.1016/j.dib.2016.05.025.
[46] W.L. DeLano, The PyMOL Molecular Graphics System, Schrödinger LLC
and
G.
arboreum,
Data
Br.
9
(2016)
345–348.

ACCEPTED MANUSCRIPT
Wwwpymolorg. Version 1. (2002) http://www.pymol.org. doi:citeulike-article-
id:240061.
[47] O. Trott, A.J. Olson, AutoDock Vina, J. Comput. Chem. 31 (2010) 445–461.
doi:10.1002/jcc.21334.
[48] S. Kim, P.A. Thiessen, E.E. Bolton, J. Chen, G. Fu, A. Gindulyte, L. Han, J. He, S. He,
B.A. Shoemaker, J. Wang, B. Yu, J. Zhang, S.H. Bryant, PubChem substance and
compound databases, Nucleic Acids Res. 44 (2016) D1202–1213.
doi:10.1093/nar/gkv951.
[49] San Diego: Accelrys Software Inc., Discovery Studio Modeling Environment, Release
3.5, Accelrys Softw. Inc. (2012).
[50] P. Alam, S.K. Chaturvedi, M.K. Siddiqi, R.K. Rajpoot, M.R. Ajmal, M. Zaman, R.H.
Khan, Vitamin k3 inhibits protein aggregation: Implication in the treatment of amyloid
diseases, Sci. Rep. 6 (2016) 26759. doi:10.1038/srep26759.
[51] M. Gokara, V. V. Narayana, V. Sadarangani, S.R. Chowdhury, S. Varkala, D.B.
Ramachary, R. Subramanyam, Unravelling the binding mechanism and protein
stability of human serum albumin while interacting with nefopam analogues: a
biophysical and in silico approach, J. Biomol. Struct. Dyn. 35 (2017) 2280–2292.
doi:10.1080/07391102.2016.1216895.
[52] D.M.F. van Aalten, R. Bywater, J.B.C. Findlay, M. Hendlich, R.W.W. Hooft, G.
Vriend, PRODRG, a program for generating molecular topologies and unique
molecular descriptors from coordinates of small molecules, J. Comput. Aided. Mol.
Des. 10 (1996) 255–262. doi:10.1007/BF00355047.
[53] S. Liu, J. Widom, C.W. Kemp, C.M. Crews, J. Clardy, Structure of human methionine
aminopeptidase-2 complexed with fumagillin., Science. 282 (1998) 1324–1327.

ACCEPTED MANUSCRIPT
doi:10.1126/science.282.5392.1324.
[54] P. Zhang, D.E. Nicholson, J.M. Bujnicki, X. Su, J.J. Brendle, M. Ferdig, D.E. Kyle,
W.K. Milhous, P.K. Chiang, Angiogenesis inhibitors specific for methionine
aminopeptidase 2 as drugs for malaria and leishmaniasis, J. Biomed. Sci. 9 (2002) 34–
40. doi:10.1159/000048197.
[55] Z.-Q. Ma, S.-X. Xie, Q.-Q. Huang, F.-J. Nan, T.D. Hurley, Q.-Z. Ye, Structural
analysis of inhibition of E. coli methionine aminopeptidase: implication of loop
adaptability in selective inhibition of bacterial enzymes, BMC Struct. Biol. 7 (2007)
84. doi:10.1186/1472-6807-7-84.
[56] J. Wang, K.A. Stieglitz, E.R. Kantrowitz, Metal specificity is correlated with two
crucial active site residues in Escherichia coli alkaline phosphatase, Biochemistry. 44
(2005) 8378–8386. doi:10.1021/bi050155p.
[57] O. Kleifeld, L. R líšek, O. Bogin, . Frenkel, Z. Havlas, Y. B rstein, I. Sagi, Higher
metal-ligand coordination in the catalytic site of cobalt-substituted
Thermoanaerobacter brockii alcohol dehydrogenase lowers the barrier for enzyme
catalysis, Biochemistry. 43 (2004) 7151–7161. doi:10.1021/bi0302696.
[58] D.R. Holland, A.C. Hausrath, D. Juers, B.W. Matthews, Structural analysis of zinc
substitutions in the active site of thermolysin, Protein Sci. 4 (1995) 1955–1965.
doi:10.1002/pro.5560041001.
[59] H. Umezawa, T. Aoyagi, H. Suda, M. Hamada, T. Takeuchi, Bestatin, an inhibitor of
aminopeptidase B, produced by actinomycetes., J. Antibiot. (Tokyo). 29 (1976) 97–99.
doi:10.7164/antibiotics.29.97.
[60] R.E. Morty, J. Morehead, Cloning and characterization of a leucyl aminopeptidase
from three pathogenic Leishmania species, J. Biol. Chem. 277 (2002) 26057–26065.