Characterization of serine acetyltransferase (CysE) from methicillin-resistant Staphylococcus aureus and inhibitory effect of two natural products on CysE

Article abstract of DOI:10.1016/j.micpath.2019.04.002

Methicillin-resistant Staphylococcus aureus (MRSA) is a major hospital-acquired infective pathogen that has developed resistance to many antibiotics. It is imperious to develop novel anti-MRSA drugs to control the emergence of drug resistance. The biosynthesis of cysteine in bacteria is catalyzed by CysE and CysK. CysE was predicted to be important for bacterial viability, it could be a potential drug target. The serine acetyltransferase activity of CysE was detected and its catalytic properties were also determined. CysE homology model was built to investigate interaction sites between CysE and substrate L-Ser or inhibitors by molecular docking. Docking data showed that residues Asp94 and His95 were essential for serine acetyltransferase activity of CysE, which were confirmed by site-directed mutagenesis. Colorimetric assay was used to screen natural products and six compounds which inhibited CysE activity (IC₅₀ ranging from 29.83 μM to 203.13 μM) were found. Inhibition types of two compounds 4 (11-oxo-ebracteolatanolide B) and 30 ((4R,4aR)-dihydroxy-3-hydroxymethyl-7,7,10a-trimethyl-2,4,4a,5,6,6a,7,8,9,10,10a,l0b-dodecahydrophenanthro[3,2-b]furan-2-one) on CysE were determined. Compounds 4 and 30 showed inhibitory effect on MRSA growth (MIC at 12.5 μg/ml and 25 μg/ml) and mature biofilm. The established colorimetric assay will facilitate further high-throughput screening of CysE inhibitors from different compound libraries. The compounds 4 and 30 may offer structural basis for developing new anti-MRSA drugs.

Full text of DOI:10.1016/j.micpath.2019.04.002

MicrobialPathogenesis131(2019)218–226
Contents lists available at ScienceDirect
Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath
Characterization of serine acetyltransferase (CysE) from methicillin-resistant
Staphylococcus aureus and inhibitory effect of two natural products on CysE
Changming Chena,1, Qiulong Yana,1, Mengxing Taoa, Huaying Shia, Xiuyan Hana, Liqiu Jiaa,
Yukun Huanga, Lizhe Zhaoa, Chao Wangb, Xiaochi Mab, Yufang Maa,∗
a Department of Biochemistry and Molecular Biology, Dalian Medical University, Dalian, 116044, China
b College of Pharmacy, Dalian Medical University, Dalian, 116044, China
A R T I C L E I N F O
A B S T R A C T
Keywords:
MRSA
Serine acetyltransferase
CysE
Natural products
Inhibitors
Methicillin-resistant Staphylococcus aureus (MRSA) is a major hospital-acquired infective pathogen that has
developed resistance to many antibiotics. It is imperious to develop novel anti-MRSA drugs to control the
emergence of drug resistance. The biosynthesis of cysteine in bacteria is catalyzed by CysE and CysK. CysE was
predicted to be important for bacterial viability, it could be a potential drug target. The serine acetyltransferase
activity of CysE was detected and its catalytic properties were also determined. CysE homology model was built
to investigate interaction sites between CysE and substrate L-Ser or inhibitors by molecular docking. Docking
data showed that residues Asp94 and His95 were essential for serine acetyltransferase activity of CysE, which
were confirmed by site-directed mutagenesis. Colorimetric assay was used to screen natural products and six
compounds which inhibited CysE activity (IC50 ranging from 29.83 μM to 203.13 μM) were found. Inhibition
types of two compounds 4 (11-oxo-ebracteolatanolide B) and 30 ((4R,4aR)-dihydroxy-3-hydroxymethyl-7,7,10a-
trimethyl-2,4,4a,5,6,6a,7,8,9,10,10a,l0b-dodecahydrophenanthro[3,2-b]furan-2-one) on CysE were determined.
Compounds 4 and 30 showed inhibitory effect on MRSA growth (MIC at 12.5 μg/ml and 25 μg/ml) and mature
biofilm. The established colorimetric assay will facilitate further high-throughput screening of CysE inhibitors
from different compound libraries. The compounds 4 and 30 may offer structural basis for developing new anti-
MRSA drugs.
1. Introduction
characterized in Escherichia coli, Salmonella typhimurium, Mycobacterium
tuberculosis, Corynebacterium glutamicum and Entamoeba histolytica
Staphylococcus aureus is an opportunistic pathogen, which can cause
skin and soft-tissue infections, sepsis, and necrotizing pneumonia in the
world [1,2]. Methicillin-resistant Staphylococcus aureus (MRSA)
emerged in the 1960s, spreading rapidly due to the emergence of drug
resistance to β-lactam antibiotics [3–5]. Moreover, MRSA clinical
strains showed decreased susceptibility to vancomycin and became
more resistant to daptomycin and linezolid [6,7]. As a consequence, it is
a matter of urgency to find more effective candidates of novel anti-
MRSA drugs.
Sulfur element is essential for life and plays a core role in numerous
microbial metabolic processes. It is used in the biosynthesis of cysteine
and methionine in its reduced form. Cysteine can be converted to im-
portant coenzymes and mycothiol involved in the redox defense [8–11].
The serine acetyltransferase (CysE) and O-acetylserine sulfhydrylase
(CysK) involved in the biosynthetic pathway of cysteine had been
[12–18]. However, the CysE and CysK of Staphylococcus aureus have not
been identified. The amino acid sequences of CysE from seven bacterial
species, Staphylococcus aureus, MRSA, Escherichia coli, Salmonella ty-
phimurium, Mycobacterium tuberculosis, Corynebacterium glutamicum and
Entamoeba histolytica were compared in this study (Fig. 1). The align-
ment results showed that the amino acids sequences of CysE highly
conserved between MRSA and Staphylococcus aureus, but the low
homology of CysE existed between MRSA and other bacterial species.
Moreover, since microbial and plants sulfur metabolic pathways are
largely absent in humans and CysE involved in the cysteine synthesis is
essential [19], it is assumed that CysE could serve as a potential drug
target for anti-Staphylococcus aureus. It is necessary to understand the
catalytic mechanism of MRSA CysE and find inhibitors on MRSA CysE.
S. aureus and MRSA are etiological intermediary to lead to countless
human acute infections and their biofilm is the cause of chronic and
∗ Corresponding author. Department of Biochemistry and Molecular Biology, Dalian Medical University, 9 W. Lvshun South Road, Dalian, 116044, China.
E-mail address: yufang_ma@hotmail.com (Y. Ma).
1 Both authors contribute equally to this work.
https://doi.org/10.1016/j.micpath.2019.04.002
Received 15 January 2019; Received in revised form 19 March 2019; Accepted 1 April 2019
Availableonline09April2019
0882-4010/©2019ElsevierLtd.Allrightsreserved.

C. Chen, et al.
MicrobialPathogenesis131(2019)218–226
Fig. 1. Sequence alignment of CysE amino acids from seven bacterial species, Staphylococcus aureus, MRSA, Escherichia coli, Salmonella typhimurium, Mycobacterium
tuberculosis, Corynebacterium glutamicum and Entamoeba histolytica. The highly conserved residues were showed in orange color and lowly conserved residues were
presented in brown color. The residues of CysE which were predicted as the active sites with substrate L-Ser or compound 4 and 30 were signified in box. The symbols
used in “Consensus” were as follows: “.” means no consensus; an upper case abbreviation of an amino acids means a perfect consensus; a lower case abbreviation of
an amino acids means an imperfect consensus where the amino acid was not present in all. (For interpretation of the references to color in this figure legend, the
reader is referred to the Web version of this article.)
even recalcitrant disease [20,21]. Therefore, it is also needed to find
inhibitors which are capable to effectively inhibit biofilm formation
and/or destroy the biofilm.
In this study, MRSA cysE gene was cloned and MRSA CysE protein
was expressed in E. coli, and purified CysE protein was obtained
through Ni2+ affinity chromatography. The enzymatic activity of CysE
protein was detected and the catalytic properties of CysE were de-
termined. The colorimetric assay of CysE was developed to screen
natural products and six CysE inhibitors were found as well as their
action mechanism was explored in this study.
TGTAATCATCTTGAATC 3’ (underlined sequence is XhoІ site). The
amplified PCR product was ligated into pJET1.2 blunt vector to yield
plasmid pJET-cysE. After confirmation by DNA sequencing, the cysE
gene was ligated into the NdeI and XhoI sites of pET-29b (Novagen),
resulting in pET29b-cysE. pET29b-cysE was transformed to Escherichia
coli BL21(DE3) competent cells, generating a CysE expressing strain
BL21(DE3)/pET29b-cysE.
BL21(DE3)/pET29b-cysE was cultured in LB broth with 50 μg/ml
kanamycin and induced with 1 mM isopropyl-D-thiogalactopyranoside
(IPTG) at 30 °C for 6 h. The cells were harvested and suspended in lysis
buffer (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 25 mM MgCl2, 20%
glycerol, 1 mM EDTA and 1 mM PMSF) followed by sonication. After
centrifugation at 20,000×g for 15 min, the supernatant was applied to
Ni-NTA superflow column (Qiagen) and the column was then washed
with 20 ml wash buffer (lysis buffer with 25 mM imidazole). CysE
protein with a His-tag at its C-terminus was eluted by 10 ml elution
buffer (lysis buffer with 200 mM imidazole) and the first 5 ml elution
fraction was collected for further experiments. The concentration of
CysE protein was determined by Bradford method, using bovine serum
albumin (BSA) as standard. The purified CysE protein was detected by
15% SDS-PAGE and Western blotting.
The serine acetyltransferase activity of CysE protein was detected by
both DTNB [5, 5′-dithiobis-(2-nitrobenzoic acid)] colorimetric assay
and HPLC assay [13,23]. For colorimetric assay, the reaction condition
was the same as above. The reaction was stopped with stop solution
containing 50 mM Tris-HCl (pH 7.5) and 6 M guanidine hydrochloride.
After adding colorimetric reagent solution containing 0.2 mM DTNB,
the SH- group of CoA turned DTNB to NTB− which absorbance at
wavelength of 405 nm was read using a microplate reader. The control
containing all components except CysE protein was used to correct the
2. Materials and methods
2.1. Bacteria strains and plasmids
Methicillin-resistant Staphylococcus aureus (ATCC 33591) was ob-
tained from American type culture collection, and it was used for pre-
paration of genomic DNA. Escherichia coli NovaBlue (Novagen) was
used for cysE gene cloning and BL21(DE3) (Novagen) for CysE protein
expression, respectively. Cloning plasmid pJET1.2 blunt (Thermo) with
ampicillin resistance gene was used for cloning of cysE gene. Expression
vector pET29b (Novagen) carrying kanamycin resistance gene was
utilized to express CysE protein in E. coli BL21(DE3).
2.2. Detection of serine acetyltransferase activity of CysE protein
MRSA genomic DNA was prepared as previously described [22].
MRSA cysE gene was amplified from MRSA genomic DNA by using
forward primer, 5′ CCCCATATGATCTTGTTAAAAAGAATG 3’ (under-
lined sequence is NdeІ site) and reverse primer, 5′ CCCTCGAGTATAA
219

C. Chen, et al.
MicrobialPathogenesis131(2019)218–226
errors from the -SH group of CysE and positive control containing
0.2 mM CoA was used for calculating the amount of CoA produced in
reactions. All experiments were performed in triplicate.
The Z′ factor had been proposed a value to estimate the quality of
the assay itself in high-throughput screening [24–26]. To evaluate the
sensitivity and reproducibility of the assay, the statistical parameter Z’
value was calculated. The reaction with CysE was positive control, and
the reaction without CysE was negative control.
component prepared from different chinese herbal medicine in our
previous studies, e.g. Euphorbia fischeriana and Euphorbia ebracteolata
were dissolved in DMSO solvent [29]. The CysE was pre-incubated with
different compounds on ice for 5 min and then CysE activity was de-
tected. The enzyme reaction only containing DMSO solvent was used as
a negative control. All experiments were performed in triplicate.
2.7. Resazurin assay
For HPLC assay, the reaction mixture containing 0.4 μg CysE, 5 mM
MgCl2, 50 mM Tris-HCl (pH 7.5), 2 mM L-serine (L-Ser) and 0.4 mM
acetyl coenzyme A (AcCoA) was incubated at 37 °C for 20 min. The
mixture was then injected into Nova-Pak C18 column (3.9 × 150 mm;
Waters, Manchester, UK). The mobile phase was 20 mM KH2PO4
(pH6.5)-methanol (95:5) with 0.8 mL/min flow rate at 25 °C. The pro-
duct CoA was monitored at 259 nm.
To test whether the compounds had inhibitory effect on growth of
MRSA, an resazurin assay was used as described [30,31]. The resazurin
dye is able to indicate the bacterial growth and metabolism based on
the color conversion of the dye from blue to pink. The 50 μl Tryptic Soy
Broth (TSB) medium containing compounds at the final concentrations
from 1.56 μg/ml to 200 μg/ml was added in the 96-well plates. The
MRSA culture suspension (2 × 106 cfu/ml) was prepared by mixing
bacterial stock with TSB medium and 50 μl of culture suspension was
then added into above wells. The wells containing DMSO and the cul-
ture were used as controls. After the culture was incubated for 12 h in a
37 °C incubator, 100 μl of 0.01% resazurin solution was added to each
well and the color of culture was observed after an additional 3–5 h of
incubation. If the resazurin color remained blue, bacterial growth was
considered to be inhibited. The lowest concentration of the compounds
at which bacterial growth was inhibited was considered as minimum
inhibitory concentrations (MIC). Vancomycin and clindamycin
(Aladdin), the effective antibiotics for treating MRSA, were used as
positive controls in this experiment.
2.3. Kinetic properties of CysE
The kinetic properties of CysE were determined using above-men-
tioned colorimetric assay. The initial velocity of CysE was determined
by performing the reactions at variable CysE concentrations and dif-
ferent incubation times. The reaction for enzyme concentration-curve
was carried out in reaction buffer with different concentrations of CysE
(2, 4, 6, 8 and 10 μg/ml) at 37 °C for 5, 10 and 15 min. Time-course
curves were plotted by calculating the amount of CoA at different re-
action times (3, 5, 10, 15 and 20 min) with varying concentrations of
CysE (4, 6 and 8 μg/ml) at 37 °C. In the range of initial velocity, the
optimal pH, temperature, and the effect of 4 cations on CysE were
determined by setting variable pH buffers (4–10), different tempera-
tures (16–80 °C) and different concentrations of Mg2+, Ca2+, Ba2+ and
K+ (0–20 mM), respectively. In dual-substrate reactions, the steady-
state kinetic parameters Km and Vmax of AcCoA were determined by
double reciprocal plots prepared by various concentration of AcCoA
(0.04–0.2 mM) while L-Ser was in excess (2 mM) under optimal con-
ditions, and the Km and Vmax of L-Ser were measured by different
concentration of L-Ser (0.2–1.6 mM) with AcCoA at a saturated con-
centration (0.2 mM). All experiments were performed in triplicate.
2.8. Effects of compounds on the growth of MRSA
MRSA was grown in TSB medium at 37 °C and the cultures were
treated with different inhibitors at 1 × MIC and 2 × MIC respectively
when the OD595 of cultures reached 0.3. Then the OD595 of cultures was
measured at the interval of 1 h, moreover, 10 μl of cultures were taken
for determining colony forming unit (CFU) at every time point. CFU/
ml = colony number × dilution multiple × 100. All experiments were
performed in triplicate.
2.4. Homology model building and molecular docking
2.9. Inhibition types of CysE inhibitors
In accordance with the default parameter values, the homology
model of CysE was built using SWISS-MODEL (http://swissmodel.
expasy.org/). 4hzd.1.A (PDB ID) was used as a template of the
homology model. Structural Analysis and Verification Server (version
4) (http://services.mbi.ucla.edu/SAVES/) were used to assess the pre-
dicted model. The molecular docking program Autodock (version 4.2)
was used for docking analysis of CysE and its substrate L-Ser [27]. The
docking gridbox of receptor was also set by Autodock, whose number
grid points in XYZ is 126 × 126 × 126, and spacing is 0.375 Å. The
Lamarckian Genetic Algorithm (LGA) of Autodock was selected as si-
mulated method. The docking results were visualized by PyMol, LIG-
PLOT and DSViewer Pro 5.0 programs [28].
To investigate the inhibition types of inhibitors on CysE, CysE re-
actions with different compounds at IC50 and two folds of IC50 were
performed respectively. The inhibitory constant (Ki) and inhibition
types were determined by double reciprocal plots. Molecular docking
was also used to analyze the interaction of CysE and its inhibitors.
2.10. Biofilm assay
In order to determine whether the two inhibitors had inhibitory
effect on MRSA biofilm, biofilm assay was performed. MRSA was grown
in TSB at 37 °C until the OD595 of the culture reached 0.6. The 100 μl
culture was then added into each well of PVC plate and incubated at
37 °C. Once formed, biofilm was washed three times by 0.1 mM PBS to
remove planktonic cells. The fresh TSB medium with different in-
hibitors was then added into the formed biofilm respectively. After
incubation for 24 h, crystal violet staining was applied to detect the
effect of those two inhibitors on mature biofilm. The wells only con-
taining DMSO were used as controls.
2.5. Site-directed mutagenesis
In order to investigate the catalytic mechanism of CysE, six amino
acid residues (Asp29, Asp94, His95, Lys128, Arg129 and Asn148) of
CysE, which were predicted to be important for binding with L-Ser,
were substituted to alanine using MutanBEST Kit (Takara). All CysE
mutant proteins were expressed, purified, quantified and their enzy-
matic activity was determined.
2.11. Cytotoxicity assay
The 3-[4, 5-dimethylthiazol-2yl]-2, 5-dipheny tetrazolium bromide
(MTT) assay and TransDetect™ Cell Counting Kit (CCK) assay were
utilized to test the cytotoxicity of two inhibitors on RAW264.7 and
THP-1 macrophage cells separately. RAW264.7 cells were grown in the
wells of 96-well plate containing DMEM medium plus 10% fetal bovine
2.6. Screening of CysE inhibitors
The DTNB colorimetric assay of CysE was developed for high-
through screening of CysE inhibitors. The natural products with single
220

C. Chen, et al.
MicrobialPathogenesis131(2019)218–226
Fig. 2. Map of pET29b-cysE (A) and analysis of CysE protein by SDS-PAGE (B) and Western blot (C). M. PageRuler™ Prestained Protein Ladder; Lane 1. The purified
CysE protein with an expected molecular weight of 24 kDa.
serum (FBS), while THP-1 cells were grown with RPMI 1640 medium
plus 10% FBS. The medium containing different concentration of
compounds was then added to the culture followed by incubation for 2
days. MTT was added in each well for additional 4 h incubation and
OD595 was read by a microplate reader. While CCK was added in the
wells, the OD450 was read. The medium containing DMSO was used as
control.
3.3. Kinetic properties of CysE
The kinetic properties of CysE were determined using DTNB col-
orimetric assay. From time course and enzyme concentration curves,
the initial velocity of CysE was determined in 5 min and its optimal
concentration was 4 μg/ml (Supplement figure 1A and Supplement
figure 1B). The CysE activity was determined at varying pH with ap-
propriate buffer systems (4–10) and different temperature from 16 to
80 °C. The results showed that CysE had maximal activity at pH 7.5
(Fig. 4A) and at the temperature of 37 °C (Fig. 4B). The enzymatic ac-
2.12. Statistical analysis
tivity of CysE was not significantly changed by varying the Mg2+, Ca2+
,
Statistical analysis of experimental groups was performed using
unpaired two-tailed t-test by GraphPad Prism v.6.01 software. All
Ba2+and K+ concentration (Supplement Fig. 1C–F), indicating that the
CysE activity did not rely on Mg2+, Ca2+, Ba2+and K+. The Km and
Vmax values of CysE against substrates AcCoA and L-Ser were de-
termined from the double reciprocal plots (Fig. 4C). The Km and Vmax
measurements were presented as the mean
SD obtained from three
independent experiments to correct the trial errors.
against L-Ser were 0.4587
min, respectively, while the Km and Vmax against AcCoA were
0.0982 mM and 0.0137
0.0012 mM/
3. Results
0.2956
(Fig. 4D).
0.01374 mM and 0.0170
0.0008 mM/min, respectively
3.1. Expression and purification of CysE protein
Expression vector pET29b-cysE was constructed and its map was
shown in Fig. 2A. The soluble CysE protein with His-tag at its C-ter-
minus was expressed in E. coli BL21(DE3) by induction with 1 mM IPTG
and purified by Ni2+ affinity chromatography. The results of SDS-PAGE
and Western blot showed that the purified CysE protein had an ex-
pected molecular weight of 24.6 kDa (Fig. 2B and C).
3.4. Homology model building and molecular docking of CysE
The homology model of CysE was built by using SWISS-MODEL and
the interaction between CysE and L-Ser (Fig. 5A) was investigated by
Autodock (version 4.2). As shown in Fig. 5A, docking simulation results
revealed the interactions between L-Ser and amino acid residues of
CysE. The structure of CysE bound by L-Ser was expressed as CysE (L-
Ser). Three amino acid residues (Asp29, Asp94 and His95) formed three
H-bonds with L-Ser. Two-dimensional representation of these interac-
tions, plotted by LIGPLOT [28], was shown in Fig. 5B. In addition,
Lys128, Arg129 and Asn148 which were predicted interaction sites,
formed H-bonds or ionic bonds with L-Ser. Therefore, Asp29, Asp94,
His95, Lys128, Arg129 and Asn148 were likely to play a crucial role in
the activity of CysE.
3.2. Serine acetyltransferase activity of CysE protein
As shown in Fig. 3A, serine acetyltransferase activity of CysE cata-
lyzed the formation of OAS along with CoA from L-Ser and AcCoA.
Serine acetyltransferase activity of CysE was detected using DTNB
colorimetric assay. The reaction showed an obvious color change from
clear to yellow after DTNB reagent was added, and the OD value at
405 nm was obtained. The specific activity of the CysE was
According to molecular docking data, six residues (Asp29, Asp94,
His95, Lys128, Arg129 and Asn148) of CysE, which were showed to be
bound with L-Ser, were substituted by alanine. CysE mutant proteins
Asp94Ala, His95Ala, Lys128Ala, Arg129Ala and Asn148Ala were ex-
pressed and purified. Unfortunately, soluble Asp29Ala failed to be ex-
pressed. The results revealed that five CysE mutant proteins lost their
acetyltransferase activity at different degrees (Fig. 5C). The specific
activity of mutant proteins was showed Table 1. The results provided
further evidence for the critical role of those five residues in binding of
CysE and L-Ser.
3.8098
0.03 μmol/min/mg. The product CoA in the enzymatic re-
action of CysE protein was detected by HPLC analysis (Fig. 3B). The
results demonstrated that CysE protein had the serine acetyltransferase
activity. Compared with HPLC assay, DTNB colorimetric assay was
more efficient and was utilized for kinetic studies of CysE.
The Z-factor described the sensitivity and reproducibility of an
assay. The Z-factor of a good assay should be greater than 0.5 and less
than 1 [24,32]. The results showed that the mean and standard de-
viation values of OD405 were 0.2396 and 0.0049 from the 60 positive
controls and 0.1263 and 0.0063 from the 60 negative controls, re-
spectively. The Z-factor of 0.7034 was obtained for the assay, which
indicated that the assay was suitable for screening of CysE inhibitors.
221

C. Chen, et al.
MicrobialPathogenesis131(2019)218–226
Fig. 3. Detection of serine acetyltransferase activity of CysE protein by DTNB colorimetric assay (A) and HPLC assay (B). A. 1. Enzymatic reaction of MRSA CysE
(4 μg/ml); 2. The reaction lacking MRSA CysE protein and substrates but containing 200 μM CoA; 3. Negative control, the reaction lacking MRSA CysE protein. B. (a)
CoA standard; (b) Enzymatic reaction of MRSA CysE protein (4 μg/ml); (c) The reaction containing all reactants except MRSA CysE protein as a control.
Fig. 4. Determination of the effect of pH (A) and temperature (B) on the activity of MRSA CysE and determination of Km and Vmax of MRSA CysE enzyme against L-
Ser and AcCoA (C and D) from double reciprocal plot.
222

C. Chen, et al.
MicrobialPathogenesis131(2019)218–226
Fig. 5. Post-docking interactions between active site residues of protein (MRSA CysE) with ligand (L-Ser). The protein was depicted in cartoon view and ligand L-Ser
as stick in the binding state (A); Interactions of CysE and the L-Ser by Ligplot (B); The specific activity of different MRSA CysE mutants (C); The inhibitory effect of six
compounds on MRSA CysE activity (D) and the structural formula of six compounds (E). C. Differences among groups were calculated by unpaired two-tailed t-test.
The asterisks represented the statistical differences between the relative activity of MRSA CysE and MRSA CysE mutants. ****, P < 0.0001. D. Differences among
groups were calculated by unpaired two-tailed t-test. The asterisks represented the statistical differences between the relative activity of MRSA CysE in DMSO group
and different compound treated groups. **, P < 0.01; ***, P < 0.001.
3.5. Identification of CysE inhibitors from natural product library
exhibited more obviously inhibitory effect on MRSA growth.
The DTNB colorimetric assay was used to screen CysE inhibitors. Six
compounds exhibited inhibitory activity against CysE (Fig. 5D). The
IC50 of compounds 1 (6β,11α,17-trihydroxyhelioscopinolide E), 4 (11-
oxo-ebracteolatanolide B) and 30 ((4R,4aR)-dihydroxy-3-hydro-
xymethyl-7,7,10a-trimethyl-2,4,4a,5,6,6a,7,8,9,10,10a,l0b-dodecahy-
3.7. Inhibition types of CysE inhibitors
The inhibitory constant (Ki) and inhibition types of compounds 4
and 30 on CysE were determined by double reciprocal plots (Fig. 8A
and Table 2). Kinetic parameters of compound 4 on CysE showed that
the inhibition was mixed with L-Ser and competitive with AcCoA.
However, compound 30 was competitive with L-Ser and mixed with
AcCoA. The docking results of CysE and compounds revealed that those
two compounds formed hydrogen bonds with Ala43, Gly44 and His95,
whereas compound 30 formed hydrogen bonds with Asp94 (Fig. 8B).
This indicated that these amino acid residues of CysE were action sites
of two compounds.
drophenanthro[3,2-b]furan-2-one)
71.84 0.2678 and 71.84
formula of six compounds were shown in Fig. 5E.
was
29.83
0.2133,
0.1495 μM, respectively. The structural
3.6. Inhibitory effect of inhibitors on MRSA growth
The six inhibitors were subsequently tested for their efficacy against
MRSA strain using resazurin assay. Compound 4 had the lowest MIC
value (12.5 μg/ml) among these tested compounds, and the MIC value
of compound 30 was 25 μg/ml (Fig. 6A and B). The MICs of compounds
1, 8 (7-deoxylangduin B), 21 (phorbol-13-acetate) and 29 (yuex-
iandajisu E) were 200, 50, 200 and 100 μg/ml respectively. The results
indicated that compounds 4 and 30 were more effective in inhibiting
the growth of MRSA. As positive controls, the MIC of vancomycin was
1 μg/ml and the MIC of clindamycin was 12.5 μg/ml. Compound 4 had
the same MIC value with clindamycin.
3.8. Inhibitory effect of compounds 4 and 30 on MRSA biofilm
As shown in Fig. 6C and D, compounds 4 and 30 were also effective
in destroying MRSA biofilm after treatment at the MIC value and
2 × MIC value for 48 h compared to controls. Compound 30 showed
better inhibition for biofilm compared to compound 4.
3.9. Cytotoxicity of compounds 4 and 30
MRSA was then treated with compounds 4 and 30 at 1 × MIC and
2 × MIC, respectively. Both growth curves (Fig. 7A and C) and CFU
curves (Fig. 7B and D) of MRSA showed that the bacteria treated by
1 × MIC compounds 4 and 30 grew slowly rather than control group.
When the concentration of compounds reached to 2 × MIC, they
Since compounds 4 and 30 exhibited inhibitory effects on MRSA
growth, we evaluated whether these compounds had toxicity to mam-
malian cells. Cytotoxicity of compounds 4 and 30 on human macro-
phage cell THP-1 and mouse macrophage cell RAW264.7 was tested
Table 1
The specific activity of five MRSA CysE mutants.
Mutants
WT CysE
3.8098
Asp94
His95
Lys128
0.6962
Arg129
0.0812
Asn148
0.1405
Specific activity (nmol/min/mg)
0.0243
0.0304
0.0052
0.2184
0.0289
0.0162
0.0244
0.0312
223

C. Chen, et al.
MicrobialPathogenesis131(2019)218–226
Fig. 6. The inhibitory effect of different compounds on the growth of MRSA (A and B) and MRSA biofilm (C and D). The value of crystal violet uptake (C) and
polystyrene wells stained by crystal violet (D). a. MRSA; b. MRSA with DMSO; c. TSB medium without MRSA (control); d. MRSA treated with compound 4 at
2 × MIC; e. MRSA treated with compound 4 at 1 × MIC; f. MRSA treated with compound 30 at 2 × MIC; g. MRSA treated with compound 30 at 1 × MIC. C.
Differences among groups were calculated by unpaired two-tailed t-test. The asterisks represented the statistical differences between the relative viability of MRSA in
untreated group and different compound treated groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001. (For interpretation of the references to color in this figure
legend, the reader is referred to the Web version of this article.)
respectively. The results showed that compounds 4 and 30 had weak
cytotoxicity (with more than 80% cell viability) on both THP-1 and
RAW264.7 macrophage cells (Supplement Figure 2).
candidates for developing effective anti-S. aureus and MRSA drugs. In
recent years, sulfur metabolic pathways like cysteine biosynthetic
provide a new probability for therapeutic intervention in treating
bacterial infections [8].
Sulfur is a significant element for life and plays an important role in
microbial metabolic processes. Many enzymes encoded by genes cysNC,
cysD, cysQ, sirA and subI, etc. Were involved in the metabolism of sulfur
and up-regulated when bacteria faced with oxidative stress, nutrient
starvation, dormancy adaptation, and survival [8,33,34]. Sulfur
4. Discussion
The emergence of antibiotic resistance on Staphylococcus aureus has
greatly aroused people's attention. The identification of more novel
compounds targeting specific enzymes will provide more drug
Fig. 7. The growth curve (A and C) and CFU (B and D) of MRSA. The MRSA cultures were grown in TSB medium with different concentration of compound 4 (A and
B) and compound 30 (C and D). The OD595 value and CFU were monitored at the interval of 1h. The arrow indicated the time point when compound was treated.
224

C. Chen, et al.
MicrobialPathogenesis131(2019)218–226
Fig. 8. The inhibition types of different compounds on MRSA CysE (A) and Post-docking interactions between active residues of MRSA CysE with compounds 4 and
30 respectively (B).
Table 2
of M. tuberculosis in macrophages. One of those genes was cysE, which
was essential for survival in a mouse model of M. tuberculosis infection
[20]. In addition, inactivation of the cysB gene (CysB was the major
positive regulator of cysteine biosynthesis) and a resulting disruption of
cysteine biosynthesis were found to be the major mechanism of amdi-
nocillin resistance in clinical isolates of E. coli [36]. Therefore, it is
necessary for us to deeply understand the synthesis of cysteine and CysE
properties, which is helpful in finding CysE inhibitors.
The inhibition types of different inhibitors on MRSA CysE.
Compounds
Ki (μM)
Ki-com/L-Ser
Ki-non/L-Ser
Ki-com/AcCoA
Ki-non/AcCoA
4
30
225.3896
47.6583
107.1599
─
53.8975
111.5701
─
130.6895
A colorimetric assay for detection of CysE activity was developed
allowing us to measure kinetic properties of CysE and screen CysE in-
hibitor from natural products in this study. Six compounds exhibited
inhibition on CysE activity and MRSA growth. Compounds 4 and 30 of
them exhibited better inhibitory effect on CysE activity and MRSA
growth. To confirm the specificity those two compounds on acetyl-
transferase of CysE, we tested whether they were capable to act on the
acetyltransferase activity of S. aureus GlmU which is a bifunctional
enzyme with glucosamine-1-phosphate acetyltransferase activity and N-
acetylglucosamine-1-phosphate uridyltransferase activity in UDP-
GlcNAc biosynthetic pathway. GlmU acetyltransferase activity cata-
lyzes the conversion of substrates glucosamine-1-phosphate and acetyl
coenzyme A to products N-actylglcosamine-1-phosphate and coenzyme
metabolic can be divided into sulfation branch and reductive branch. In
its reduced branch, sulfur is involved in the biosynthesis of the amino
acids cysteine and methionine [34]. The biosynthesis of cysteine occurs
via serine acetyltransferase CysE and O-acetylserine sulfhydrylase CysK.
Turnbull et al. reported that elevated cysE expression brought about
more resistance to oxidative stress and antibiotics [18]. Microbial pa-
thogens such as M. tuberculosis can survive in complicated and hostile
environmental conditions, including nutrient deprivation, high levels of
oxidative stress and low pH of the host macrophage. The infected
bacteria under these conditions require the coordinated regulation of
gene expression to survive [35]. Rengarajan et al. used a microarray-
based technique to identify 126 genes which were necessary to survival
225

C. Chen, et al.
MicrobialPathogenesis131(2019)218–226
A. However, the results showed that compounds 4 and 30 were unable
to inhibit S. aureus GlmU acetyltransferase activity (unpublished data in
our laboratory). This suggested that compounds 4 and 30 were speci-
fically targeting CysE.
[6] E. Nannini, B.E. Murray, C.A. Arias, Resistance or decreased susceptibility to gly-
copeptides, daptomycin, and linezolid in methicillin-resistant Staphylococcus
aureus, Curr. Opin. Pharmacol. 10 (2010) 516–521.
[7] S.J. Peacock, G.K. Paterson, Mechanisms of methicillin resistance in Staphylococcus
aureus, Annu. Rev. Biochem. 84 (2015) 577–601.
[8] H. Paritala, K.S. Carroll, New targets and inhibitors of mycobacterial sulfur meta-
bolism, Infect. Disord. - Drug Targets 13 (2013) 85–115.
[9] M.I. Voskuil, I.L. Bartek, K. Visconti, G.K. Schoolnik, The response of myco-
bacterium tuberculosis to reactive oxygen and nitrogen species, Front. Microbiol. 2
(2011) 105.
[10] M.A. Forrellad, L.I. Klepp, A. Gioffre, Y. Sabio, J. Garcia, H.R. Morbidoni, M. de la
Paz Santangelo, et al., Virulence factors of the Mycobacterium tuberculosis com-
plex, Virulence 4 (2013) 3–66.
[11] T. Hampshire, S. Soneji, J. Bacon, B.W. James, J. Hinds, K. Laing, et al., Stationary
phase gene expression of Mycobacterium tuberculosis following a progressive nu-
trient depletion: a model for persistent organisms? Tuberculosis 84 (2004)
228–238.
[12] N.M. Kredich, G.M. Tomkins, The enzymic synthesis of L-cysteine in Escherichia
coli and Salmonella typhimurium, J. Biol. Chem. 241 (1966) 4955–4965.
[13] J. Qiu, D. Wang, Y. Ma, T. Jiang, Y. Xin, Identification and characterization of
serine acetyltransferase encoded by the Mycobacterium tuberculosis Rv2335 gene,
Int. J. Mol. Med. 31 (2013) 1229–1233.
[14] Y. Haitani, N. Awano, M. Yamazaki, M. Wada, S. Nakamori, H. Takagi, Functional
analysis of L-serine O-acetyltransferase from Corynebacterium glutamicum, FEMS
Microbiol. Lett. 255 (2006) 156–163.
[15] S. Kumar, I. Raj, I. Nagpal, N. Subbarao, S. Gourinath, Structural and biochemical
studies of serine acetyltransferase reveal why the parasite Entamoeba histolytica
cannot form a cysteine synthase complex, J. Biol. Chem. 286 (2011) 12533–12541.
[16] E. Salsi, B. Campanini, S. Bettati, S. Raboni, S.L. Roderick, P.F. Cook, et al., A two-
step process controls the formation of the bienzyme cysteine synthase complex, J.
Biol. Chem. 285 (2010) 12813–12822.
[17] T. Wang, T.S. Leyh, Three-stage assembly of the cysteine synthase complex from
Escherichia coli, J. Biol. Chem. 287 (2012) 4360–4367.
[18] A.L. Turnbull, M.G. Surette, Cysteine biosynthesis, oxidative stress and antibiotic
resistance in Salmonella typhimurium, Res. Microbiol. 161 (2010) 643–650.
[19] R. Schnell, D. Sriram, G. Schneider, Pyridoxal-phosphate dependent mycobacterial
cysteine synthases: structure, mechanism and potential as drug targets, Biochim.
Biophys. Acta 1854 (2015) 1175–1183.
[20] N.K. Archer, M.J. Mazaitis, J.W. Costerton, J.G. Leid, M.E. Powers, M.E. Shirtliff,
Staphylococcus aureus biofilms: properties, regulation, and roles in human disease,
Virulence 2 (2011) 445–459.
[21] S. Dastgheyb, J. Parvizi, I.M. Shapiro, N.J. Hickok, M. Otto, Effect of biofilms on
recalcitrance of staphylococcal joint infection to antibiotic treatment, J. Infect. Dis.
211 (2015) 641–650.
[22] P. Francois, D. Pittet, M. Bento, B. Pepey, P. Vaudaux, D. Lew, et al., Rapid detection
of methicillin-resistant Staphylococcus aureus directly from sterile or nonsterile
clinical samples by a new molecular assay, J. Clin. Microbiol. 41 (2003) 254–260.
[23] Y. Zhou, Y. Xin, S. Sha, Y. Ma, Kinetic properties of Mycobacterium tuberculosis
bifunctional GlmU, Arch. Microbiol. 193 (2011) 751–757.
The consistent results in the kinetic and docking analyses were also
found. Kinetic studies of compound 4 on CysE showed that the inhibi-
tion was mixed with L-Ser and competitive with AcCoA. Compound 30
exhibited competitive with L-Ser and mixed with AcCoA. In addition,
the docking results revealed that the key residue His95 was predicted to
form hydrogen bonds with the two inhibitors. That means the inhibitors
competed with the binding sites of substrates L-Ser. It is helpful for us to
understand the action sites of the inhibitors through docking.
Previous studies had shown that many bacteria like S. aureus pro-
duced a multilayered biofilm consisting of glycocalyx and slime layers
with heterogeneous protein expression throughout [37,38]. The bac-
terial biofilm is regarded as a microbially-derived sessile community
and are embedded in a matrix of extracellular polymeric substance.
Once establishing the biofilm, the bacteria were recalcitrant to the host
response and antimicrobial treatment, and turned into etiological agent
of many recurrent infections like osteomyelitis, indwelling medical
device infection, periodontitis, chronic wound infection, chronic rhi-
nosinusitis, endocarditis and ocular infection [20]. Therefore, attempts
to develop an effective anti-Staphylococcus aureus biofilm drug are also
required. In this study, we also found that compound 4 and 30 could
destroy the MRSA biofilm, which would provide some insights to de-
velop novel drugs against bacterial biofilm.
Taken together, CysE was encoded by the cysE gene in the methi-
cillin-resistant Staphylococcus aureus. CysE was characterized in terms
of optimal catalytic conditions, kinetic parameters and active sites. Six
compounds inhibiting CysE activity were found. They also had in-
hibitory effect on MRSA growth and two of them were capable to de-
stroy mature MRSA biofilm. The binding sites of compound 4 and 30 to
CysE protein were revealed by molecular docking. The compounds 4
and 30 as inhibitors on CysE, MRSA and MRSA biofilm may offer
structural basis for new anti-S. aureus and anti-MRSA drugs.
[24] C.M. Sassetti, D.H. Boyd, E.J. Rubin, Genes required for mycobacterial growth
defined by high density mutagenesis, Mol. Microbiol. 48 (2003) 77–84.
[25] P.J. Brennan, Structure, function, and biogenesis of the cell wall of Mycobacterium
tuberculosis, Tuberculosis 83 (2003) 91–97.
[26] X. Shi, S. Sha, L. Liu, X. Li, Y. Ma, A 96-well microtiter plate assay for high-
throughput screening of Mycobacterium tuberculosis dTDP-d-glucose 4,6-dehy-
dratase inhibitors, Anal. Biochem. 498 (2016) 53–58.
Declaration
We declare that we have no conflict of interest and the work de-
scribed has not been published previously.
[27] G.M. Morris, R. Huey, W. Lindstrom, M.F. Sanner, R.K. Belew, D.S. Goodsell, et al.,
AutoDock4 and AutoDockTools4: automated docking with selective receptor flex-
ibility, J. Comput. Chem. 30 (2009) 2785–2791.
Acknowledgements
[28] A.C. Wallace, R.A. Laskowski, J.M. Thornton, LIGPLOT: a program to generate
schematic diagrams of protein-ligand interactions, Protein Eng. 8 (1995) 127–134.
[29] C.J. Wang, Q.L. Yan, Y.F. Ma, C.P. Sun, C.M. Chen, X.G. Tian, et al., Ent-Abietane
and Tigliane Diterpenoids from the Roots of Euphorbia Fischeriana and Their
Inhibitory Effects against Mycobacterium Smegmatis, (2017).
[30] M.A. Jyoti, K.W. Nam, W.S. Jang, Y.H. Kim, S.K. Kim, B.E. Lee, et al.,
Antimycobacterial activity of methanolic plant extract of Artemisia capillaris con-
taining ursolic acid and hydroquinone against Mycobacterium tuberculosis, J.
Infect. Chemother. 22 (2016) 200–208.
[31] M.A. Jyoti, T. Zerin, T.H. Kim, T.S. Hwang, W.S. Jang, K.W. Nam, et al., In vitro
effect of ursolic acid on the inhibition of Mycobacterium tuberculosis and its cell
wall mycolic acid, Pulm. Pharmacol. Therapeut. 33 (2015) 17–24.
[32] Ji-Hu Zhang TDYC, Kevin R. Oldenburg, A simple statistical parameter for use in
evaluation and validation of high throughput screening assays, J. Biomol. Screen 4
(1999) 67–73.
[33] H.W. Boucher, G.H. Talbot, J.S. Bradley, J.E. Edwards, D. Gilbert, L.B. Rice, et al.,
Bad bugs, no drugs: no ESKAPE! an update from the Infectious Diseases Society of
America, Clin. Infect. Dis. 48 (2009) 1–12.
[34] D.P. Bhave, W.B. Muse 3rd, K.S. Carroll, Drug targets in mycobacterial sulfur me-
tabolism, Infect. Disord. - Drug Targets 7 (2007) 140–158.
[35] C. Nathan, M.U. Shiloh, Reactive oxygen and nitrogen intermediates in the re-
lationship between mammalian hosts and microbial pathogens, Proc. Natl. Acad.
Sci. U. S. A. 97 (2000) 8841–8848.
[36] E. Thulin, M. Sundqvist, D.I. Andersson, Amdinocillin (Mecillinam) resistance
mutations in clinical isolates and laboratory-selected mutants of Escherichia coli,
Antimicrob. Agents Chemother. 59 (2015) 1718–1727.
[37] L. Hall-Stoodley, J.W. Costerton, P. Stoodley, Bacterial biofilms: from the natural
environment to infectious diseases, Nat. Rev. Microbiol. 2 (2004) 95–108.
[38] K.K. Jefferson, What drives bacteria to produce a biofilm? FEMS Microbiol. Lett.
236 (2004) 163–173.
The present study was supported by the National Natural Science
Foundation of China (81573469 and 81872970).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.micpath.2019.04.002.
References
[1] S.K. Fridkin, J.C. Hageman, M. Morrison, L.T. Sanza, K. Como-Sabetti,
J.A. Jernigan, et al., Methicillin-resistant Staphylococcus aureus disease in three
communities, N. Engl. J. Med. 352 (2005) 1436–1444.
[2] B.A. Diep, Q. Phung, S. Date, D. Arnott, C. Bakalarski, M. Xu, et al., Identifying
potential therapeutic targets of methicillin-resistant Staphylococcus aureus through
in vivo proteomic analysis, J. Infect. Dis. 209 (2014) 1533–1541.
[3] M.C. Enright, D.A. Robinson, G. Randle, E.J. Feil, H. Grundmann, B.G. Spratt, The
evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA), Proc.
Natl. Acad. Sci. U. S. A. 99 (2002) 7687–7692.
[4] S.R. Gill, D.E. Fouts, G.L. Archer, E.F. Mongodin, R.T. Deboy, J. Ravel, et al.,
Insights on evolution of virulence and resistance from the complete genome ana-
lysis of an early methicillin-resistant Staphylococcus aureus strain and a biofilm-
producing methicillin-resistant Staphylococcus epidermidis strain, J. Bacteriol. 187
(2005) 2426–2438.
[5] G.J. Moran, A. Krishnadasan, R.J. Gorwitz, G.E. Fosheim, L.K. McDougal,
R.B. Carey, et al., Methicillin-resistant S. aureus infections among patients in the
emergency department, N. Engl. J. Med. 355 (2006) 666–674.
226