A T42M substitution in bacterial 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) generates enzymes with increased resistance to glyphosate.

Article abstract of DOI:10.1271/bbb.67.1405

Mutants of class I enolpyruvylshikimate 3-phosphate synthase (EPSPS) with resistance to glyphosate were produced in a previous study using the staggered extension process with aroA genes from S. typhimurium and E. coli. Two of these mutants shared a common amino acid substitution, T42M, near the hinge region between the large globular domains of EPSPS. Using site-directed mutagenisis, we produced the T42M mutants without the other amino acid changes of the original mutants. The T42M substitution alone produced enzymes with a 9- to 25-fold decreased K(m)[PEP] and a 21- to 26-fold increased K(i)[glyphosate] compared to the wild-type enzymes. These results provide more testimony for the powerful approach for protein engineering by the combination of directed evolution and rational design.

Full text of DOI:10.1271/bbb.67.1405

This article was downloaded by: [The Aga Khan University]
On: 27 October 2014, At: 04:46
Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer
House, 37-41 Mortimer Street, London W1T 3JH, UK
Bioscience, Biotechnology, and Biochemistry
Publication details, including instructions for authors and subscription information:
http://www.tandfonline.com/loi/tbbb20
A T42M Substitution in Bacterial 5-
Enolpyruvylshikimate-3-phosphate Synthase (EPSPS)
Generates Enzymes with Increased Resistance to
Glyphosate
Ming HEa, Yan-Fang NIEa & Peilin XUa
a Biotechnology Research Center, The Key Laboratory of Gene Engineering of Education
Ministry, Zhongshan UniversityGuangzhou, 510275, The People's Republic of China
Published online: 22 May 2014.
To cite this article: Ming HE, Yan-Fang NIE & Peilin XU (2003) A T42M Substitution in Bacterial 5-Enolpyruvylshikimate-3-
phosphate Synthase (EPSPS) Generates Enzymes with Increased Resistance to Glyphosate, Bioscience, Biotechnology, and
Biochemistry, 67:6, 1405-1409, DOI: 10.1271/bbb.67.1405
To link to this article: http://dx.doi.org/10.1271/bbb.67.1405
PLEASE SCROLL DOWN FOR ARTICLE
Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained
in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no
representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of
the Content. Any opinions and views expressed in this publication are the opinions and views of the authors,
and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied
upon and should be independently verified with primary sources of information. Taylor and Francis shall
not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other
liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or
arising out of the use of the Content.
This article may be used for research, teaching, and private study purposes. Any substantial or systematic
reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any
form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://
www.tandfonline.com/page/terms-and-conditions

Biosci. Biotechnol. Biochem., 67 (6), 1405–1409, 2003
Note
A T42M Substitution in Bacterial 5-Enolpyruvylshikimate-3-phosphate
Synthase (EPSPS) Generates Enzymes with Increased Resistance to Glyphosate
†
Ming H
E
, Yan-Fang NIE, and Peilin X
U
Biotechnology Research Center, The Key Laboratory of Gene Engineering of Education Ministry,
Zhongshan University, Guangzhou, 510275, The People's Republic of China
Received November 26, 2002; Accepted February 12, 2003
Mutants of class I enolpyruvylshikimate 3-phosphate
synthase (EPSPS) with resistance to glyphosate were
produced in a previous study using the staggered exten-
sion process with aroA genes from S. typhimurium and
E. coli. Two of these mutants shared a common amino
acid substitution, T42M, near the hinge region between
the large globular domains of EPSPS. Using site-direct-
ed mutagenisis, we produced the T42M mutants without
the other amino acid changes of the original mutants.
The T42M substitution alone produced enzymes with a
of a stable but non-covalent ternary complex of
enzyme, S3P, and glyphosate.3–6) When the enzyme is
bound to S3P and either PEP or glyphosate, a large
conformational change alters the relationship
between the two globular domains. A similar confor-
mational change was ˆrst shown to occur in the struc-
turally related enzyme, MurA.7) The free enzyme
adopts an ``open'' conformation but in an inhibitor-
enzyme complex the conformation is ``closed''.7)
Similarly, EPSPS adopts an ``open'' conformation
as the free-enzyme or a ``closed'' conformation in the
ternary complex of enzyme-S3P- and either PEP or
glyphosate, as shown in X-ray crystallography stu-
dies.8,9) The conformational changes in these enzymes
can occur because of ‰exibility in a hinged region
between the two globular domains. As the globular
domains close in a screw-like fashion, the active site
is formed.7) In the closed conformation, speciˆc
amino acids are protected from chemical modiˆca-
tion, and a trypsin site is hidden.7) Furthermore,
chemical modiˆcation and site-directed mutagenesis
studies indicate that amino acids important for bind-
ing substrates and inhibitor are present on both
globular domains. Lastly, the presence of S3P and
PEP or glyphosate in the ``closed'' conformation
conˆrms that the active site is located in the cleft
between the globular domains.9) These active site
studies and the crystal structure indicate that the
binding sites for glyphosate and PEP are overlapping
but not superimposable, therefore it should be possi-
ble to alter the binding properties of the enzyme for
PEP and glyphosate separately.
9- to 25-fold decreased
Km [PEP] and a 21- to 26-fold
increased i[glyphosate] compared to the wild-type
K
enzymes. These results provide more testimony for the
powerful approach for protein engineering by the
combination of directed evolution and rational design.
Key words: bacterial aroA; glyphosate; mutagenesis;
herbicide;
5-enolpyruvylshkimate-3-
phosphate synthase (EPSPS)
Glyphosate is one of the most potent broad-
spectrum herbicides in use today. Glyphosate inhibits
a key enzyme in the synthesis of aromatic amino
acids, 5-enolpyruvylshikimate 3-phosphate synthase
(EPSPS),1,2) thereby depriving weeds of aromatic
amino acids. Tolerance to glyphosate can be con-
ferred in plants using the transgenic introduction of
bacterial enzymes with engineered or naturally occur-
ring tolerance. Two classes of enzyme, sharing less
than 50
z
amino acid similarity, perform the reac-
phosphoenol-
tion: shikimate-3-phosphate (S3P)
＋

＋
pyruvate (PEP) EPSP Pi. The class I enzymes
include those found in plants and the bacteria E. coli
and S. typhimurium. The class II enzymes are
found in Agrobacterium tumifaciens sp. CP4,
Achromobacter sp. LBAA, and Pseudomonas sp.
PG2982. Most of the reported studies of enzyme
kinetics and active site analysis concern the class I
enzymes.
We have used the staggered extension process10) for
random recombination and mutation of class I aroA
genes from S. typhimurium and E. coli. Several
mutant enzymes with increased
Ki[glyphosate] and
lowered
Km[PEP] were isolated after selection for
resistance to glyphosate in bacterial culture.11) These
mutants contained multiple amino acid substitutions
and crossovers between the parental sequences. Two
of these mutants shared a T42M substitution, which
Inhibition of EPSPS by glyphosate appears com-
petitive with respect to PEP and is done by formation
†
To whom correspondence should be addressed.
Abbreviations: S3P, shikimate-3-phosphate; PEP, phosphoenolpyruvate; EPSPS, 5-enolpyruvylshkimate-3-phosphate synthase

1406
M. H et al.
E
Fig. 1. Overview of the Site-directed Mutagenesis Strategy Used to Change Threonine to Methionine at Position 42 in EcaroA and StaroA
The mutation codons were generated using two rounds of PCR and the mutagenic PCR fragments were placed into the corresponding
restriction sites of pET-EcaroA and pET-StaroA
.
.
lies near the hinge between the two globular domains
of EPSPS. In this communication, we report that the
T42M substitution causes a large change in the
1 and 3 were used to produce the mutagenic frag-
ments in the ˆrst round of PCR. These fragments
were digested with NcoI and NdeI and ligated in
place of the corresponding portion of the genes in
pET-EcaroA and pET-StaroA (Fig. 1). The resulting
K
i[glyphosate] and Km[PEP] resulting in an EPSPS
with high resistance to glyphosate.
The T42M substitution in the E. coli and S.
typhimurium EPSPS were introduced using overlap-
PCR mutagenesis. The oligonucleotide primers used
to generate the T42M mutant of E. coli EPSPS
were: CATGCCATGGAATCCCTGACGTTACAA
(primer 1), CACGTCATCGCTATCCAGCAGAT-
constructs were designated pET-EcaroA-T42M and
pET-StaroA-T42M.
The E. coli strain BL21 (DE3) (F－ ompT hsdSD(r－b
m－b ) gal dcm (DE3)) harboring the mutant or wild
type aroA genes in pET-11d constructs were grown
overnight in M9 media (6 g L of Na2HPO4, 3 g l of
W
W
T
CAT TAATAC (primer 2) and GGAATTCCATA-
K2HPO4, 1 g l of NH4Cl, 0.5 g l of NaCl, 1 m
M
W
W
TGGCGCACGTCATCGCTATCCAGC (primer 3).
The oligonucleotide primers used to generate the
T42M mutant of S. typhimurium EPSPS were:
primers 1 and 3, and GACGTCATCGCTATCCAG-
MgSO4, 0.4
and 50 g ml of ampicillin) and 0.1 ml was used to
inoculate fresh 20-ml cultures. Cells were grown at
37 C to a density of 0.1 A600, then protein expression
was induced using 1 m IPTG. Glyphosate was
added at the same time as IPTG. Cells harboring
pET-EcaroA T42M and pET-StaroA T42M were
compared with those of the wild types in the presence
of 30 and 60 m glyphosate. Cells harboring the
pET-StaroA T42M grew better than cells harboring
pET-EcaroA T42M ; but cells harboring either the
z
[w v] glucose, 100 mg l of thiamine,
W
W
m
W
9
CAGATTCAT CAGAGC (primer 4). NcoI and Nde
I
M
restriction sites (underline) were contained in primers
1 and 3. The mutagenic nucleotides (italic) used to
convert codons ACC and ACG to ATG were incor-
porated in primer 2 and primer 4, respectively.
Primers 2 and 4 overlapped primer 3 by 19 nucleo-
tides.
-
-
M
-
-
Overlap-PCR mutagenesis was done in two rounds
of PCR. The pET-EcaroA and pET-StaroA plasmids
cloned previously11) were used as the templates in the
ˆrst reaction to produce a 150-bp fragment using
primers 1 and 2 or primes 1 and 4. Primer 1
corresponded to nucleotides 1–21 of EcaroA and
StaroA. Primer 2 was complementary to nucleotides
118–150 of EcaroA, and primer 4 was complementa-
ry to nucleotides 118–150 of StaroA. Primers 2 and 4
contained the mutagenic oligonuclotides designed to
introduce the T42M mutation. Primer 3 was com-
plementary to nucleotides 128–159 of EcaroA and
StaroA and included a 19-nucleotide overlapping
fragment with primers 2 and 4. Primer 3 also con-
tained an NdeI site at nucleotides 154 to159. Primers
wild type pET-EcaroA or pET-StaroA grew poorly
(Fig. 2).
Cell-free extracts of expression bacteria were
assayed for the kinetic properties of EPSPS activity,
measured in the forward direction by the release of
inorganic phosphate.12) BL21 (DE3) pLysS harboring
the mutant or wild type aroA genes in pET-11d con-
structs were grown to 0.75 A600 in 200 ml of LB media
containing 50
induced with 1 m
were collected by centrifugation and resuspended in
20 ml of 50 m Tris-HCl buŠer, pH 7.0, containing
9
1 m DTT. The cell suspension was frozen at 70 C
mg ml ampicillin. Expression was
W
M
IPTG. After 3 hours the cells
M
－
M
then thawed at room temperature, and cells were
lysed by sonication. The crude homogenate was clari-

T42M Substitution in EPSPS
1407
Fig. 3. SDS-PAGE of Crude Extracts Prepared from BL21 Cells
Harboring Either Wild Types or Mutants pET Expression
Plasmids.
M, molecular size marker; lane 1, cell containing no expres-
sion plasmid; lane 2, cell harboring pET-EcaroA; lane 3, cell
harboring pET-StaroA; lane 4, cell harboring pET-EcaroA
T42M ; and lane 5, cell harboring pET-StaroA T42M. Equal
amounts of total protein were separated on a 12 poly-
-
-
z
acryamide gel then stained with Coomassie blue. The expressed
proteins were indicated by an arrow.
of malachite green-ammonium molybdate colorimet-
ric solution was added, and 1 min later, 0.1 ml of
34
z sodium citrate solution was added. After 15 min
of incubation at room temperature, samples were
measured at 660 nm. Glyphosate inhibition was
found to be competitive in the kinetic plots (data not
shown). Compared to the wild types, the EcaroA
T42M and StaroA T42M enzymes had, respectively,
a 9- to 25-fold lower m[PEP], a 21- to 26-fold higher
-
-
K
K
i[glyphosate], and a 4.7- to 23.5-fold increased
speciˆc activity (Table 1).
Fig. 2. Growth Curves of E. coli Expression Cells Harboring
pET-EcaroA pET-StaroA pET-EcaroA T42M and pET-
StaroA T42M Plasmids.
Cells were grown in liquid M9 minimal medium at 37
IPTG and glyphosate were added at time zero at a cell density of
0.1 A600. After 16 h of growth, 1-ml proteins were withdrawn
from each culture, and measured for cell density at approxi-
mately 2-h intervals.
A structural model of E. coli EPSPS shows the
position of the T42M substitution (Fig. 4). The
protein comprises two equally sized and structurally
similar globular domains connected by a two-strand-
,
,
-
,
-
9C.
ed hinge.14) In the EcaroA
-T42M and StaroA-T42M
mutants, the hydrophilic side group of threonine was
replaced with the bulkier, hydrophobic side group of
methionine. The T42M substitution in EPSPS is
close to both strands of the hinge and its modiˆcation
could aŠect the screw-like closure of the hinge, alter-
ing the relative positions of the clusters of active
site amino acids that reside on opposite globular
domains. For example, mutations of R100A, D242A,
and D384A show a drastic decrease in activity but
none of these amino acids are involved in substrate
binding, and instead may hinder domain closure.15)
Simarily, we speculate that the T42M amino acid
substitution alters the relationship of the two globu-
lar domains.
×
ˆed using centrifugation at 12,000
g for 30 min.
The protein concentration of the mutant and wild
type enzymes were essentially identical as estimated
by the intensity of the 45 kDa bands in SDS-PAGE
(Fig. 3) allowing the direct comparison of EPSPS
kinetic properties. EPSPS activity was carried out at
30
Hepes, pH 7.0, 2 m
broth of Klebsiella pneumoniae ATCC 25597 accord-
ing the method described by Lanzetta et al.,13) 1 m
9
C in a ˆnal volume of 100
m
l containing 50 m
M
M
S3P (prepared from the culture
M
PEP (Sigma, USA), 0.1 m
M
(NH4)6Mo7O24 2H2O,
･
In a previous study, we generated a set of mutant
class I EPSPS enzymes with signiˆcantly increased
and crude extracts. After incubation for 20 min, 1 ml

1408
M. H
E
et al.
Table 1. Kinetic Properties of Mutants and Wild Type EPSPS
*
Speciˆc activity
W
Km(PEP)
Ki(Glyphosate)
Enzymes
－
3
×
M
(u mg protein 10
)
(
m
)
( m )
M
±
±
±
1.48 0.459
EcaroA
EcaroA
StaroA
7.558 0.468
22.28 6.26
±
±
±
30.49 10.06
-
T42M
35.704 4.979
2.36 0.39
±
±
±
0.49 0.13
±
12.81 2.04
5.759 0.419
43.60 13.26
±
±
StaroA
-
T42M
135.573 23.395
1.75 0.23
*
1 u mg protein
W
＝
16.67 nkat mg protein.
W
Fig. 4. Ribbon Diagram of the Crystal Structure of EPSPS in the ``Open and Closed'' Conformation.
Amino acids 1–42 are highlighted in yellow. An arrow indicates the site of the T42M substitution. Position 42 is near the hinge region
and may aŠect the closure of the hinge.
resistance to glyphosate.11) Sequence analysis showed
that the mutants resulted from a combination of
point mutations and crossovers between the two
parental genes, EcaroA and StaroA. The amino acid
substitution, T42M, was common to two of the
aroA
-
M4, grows faster in the presence of glypho-
T42M, even with a lower
T42M, grows slightly
T42M in 60 m glyphosate, as its
sate.11) Similarly, StaroA
-
K
i[glyphosate] than EcaroA-
better than EcaroA
-
M
K
m[PEP] is 25
z
lower and its speciˆc activity is 3.8-
T42M
mutants, aroA
-
M4 and aroA
-M11. In this study, we
fold higher compared to that of EcaroA
-
.
engineered this amino acid substitution into the
EcaroA and StaroA enzymes and conˆrmed the
contribution of this T42M substitution to glyphosate
resistance using bacterial culture and kinetic analysis.
This single amino acid substitution decreased the
This work conˆrms that the T42M substitution was
primarily responsible for the resistant phenotype in
the aroA-M4 and aroA-
M11 mutants11) and that the
other amino acid substitutions in these mutants were
either not relevant or actually detrimental to
resistance. However, we also found several other
mutants without the T42M substitution that also
gave rise to glyphosate resistance. How any of these
mutations, especially the T42M, alter the conforma-
tion of the enzyme remains to be answered using
NMR and crystallography.
K
m[PEP], increased the Ki[glyphosate] and increased
the speciˆc activity. Our results demonstrate that
enzymatic properties can be changed greatly by a
single mutation at a position distant from the active
site, a result that sometimes cannot be predicted.
It is also apparent from the study that the rate of
cell growth does not simply and solely depends upon
the
m[PEP] and the activity of the enzyme as well, for
M1, which has similar
M4 but has
m[PEP] and higher speciˆc activity than
Ki[glyphosate]; it has very much to do with
Acknowledgments
K
example the mutant aroA
-
Financial support was received from the China
National ``863'' grant 2001AA212191 and China
National Science Foundation.
K
i[glyphosate] to that of mutant aroA-
lower
K

T42M Substitution in EPSPS
1409
Stegeman, R. A., Anderson, K. S., Sikorski, J. A.,
Padgette, S. R., and Kishore, G. M., Structure and
topological symmetry of the glyphosate target 5-
enopyruvylshikimate-3-phosphate synthase: a distinc-
tive protein fold. Proc. Natl. Acad. Sci. USA, 88,
5046–5050 (1991).
References
1) Schmid, J., and Amrhein, N., Molecular organiza-
tion of the shikimate pathway in higher plants.
Phytochemistry, 39, 737–749 (1995).
2) Herrmann, K. M., and Weaver, L. M., The shikimate
pathway. Annu. Rev. Plant Physiol. Plant Mol.
Biol., 50, 473–503 (1999).
3) Ream, J. E., Yuen, H. K., Frazier, R. B., and
Sikorski, J. A., EPSP syntase: binding studies using
isothermal titration microcalorimetry and equilibri-
um dialysis and their implication for ligand recogni-
9) Schoä nbrunn, E., Eschenburg, S., Shuttleworth, W.
A., Schloss, J. V., Amrhein, N., Evans, J. N. S., and
Kabsch, W., Interaction of the herbicide glyphosate
with its target enzyme 5-enolpyruvylshikimate 3-
phosphate synthase in atomic detail. Proc. Natl.
Acad. Sci. USA, 98, 1376–1380 (2001).
10) Zhao, H., Giver, L., Shao, Z., AŠholter, J. A., and
Arnold, F. H., Molecular evolution by staggered ex-
tension process (StEP) in vitro recombination. Nature
Biotech., 16, 258–261 (1998).
11) He, M., Yang, Z. Y., Nie, Y. F., Wang, J., and Xu,
P., A new type of class I bacterial 5-enopyruvyl-
shikimate-3-phosphate synthase mutants with en-
hanced tolerance to glyphosate. Biochim. Biophys.
Acta, 1568, 1–6 (2001).
12) Knowles, P. F., and Sprinson, D. B., Preparation of
shikimate-5-phosphoate. Methods Enzymol., 17A,
351–354 (1997).
13) Lanzetta, P. A., Alvarez, L. J., Reinach, P. S., and
Candia, O. A., An improved assay for nanomole
tion and kinetic mechanism. Biochemistry
5528–5534 (1992).
, 31,
4) Marzabadi, M. R., Gruys, K. J., Pansegrau, P. D.,
Walker, M. C., Yuen, H. K., and Sikorski, J. A., An
EPSP synthase inhibitor joining shikimate 3-
phosphate with glyphosate: synthesis and ligand bind-
ing studies. Biochemistry, 35, 4199–4210 (1996).
5) McDowell, L. M., Schmidt, A., Cohen, E. R.,
Studelska, D. R., and Schaefer, J., Structural con-
straints on the ternary complex of 5-enolpyruvylshiki-
mate 3-phosphate synthase from rotational-echo
double-resonance NMR. J. Mol. Biol., 256, 160–171
(1996).
6) Lewis, J., Johnson, K. A., and Anderson, K. S., The
catalytic mechanism of EPSP synthase revisited.
Biochemistry, 38, 7372–7379 (1999).
7) Krekel, F., Oecking, C., Amrhein, N., and
Macheroux, P., Substrate and inhibitor-induced
conformational changes in the structurally related
enzymes UDP-N-acetylglucosamine enolpyruvyl
transferase (MurA) and 5-enolpyruvylshikimate 3-
amounts of inorganic phosphate. Anal. Biochem.
100, 95–97 (1979).
,
14) StauŠer, M. E., Young, J. K., Helms, G. L., and
Evans, J. N. S., Chemical shift mapping of
shikimate-3-phosphate binding to the isolated N ter-
minal domain of 5-enolpyruvylshikimate 3-phosphate
synthase. FEBS Lett., 499, 182–186 (2001).
15) Shuttleworth, W. A., Pohl, M. E., Helms, G. L.,
Jakeman, D. L., and Evans, J. N. S., Site-directed
mutagenesis of putative active site residues of 5-enol-
pyruvylshikimate 3-phosphate synthase. Biochemis-
try, 38, 296–302 (1999).
phosphate synthase (EPSPS). Biochemistry
8864–8878 (1999).
8) Stallings, W. C., Abdel-Meguid, S. S., Lim, L. W.,
Shieh, H., Dayringer, H. E., Leimgruber, N. K.,
, 38,