4-hydroxybenzo[d]oxazol-2(3H)-one ameliorates LPS/D-GalN-induced acute liver injury by inhibiting TLR4/NF-κB and MAPK signaling pathways in mice

Article abstract of DOI:10.1016/j.intimp.2020.106445

The purpose of this study was to synthesize 4-hydroxybenzo[d]oxazol-2(3H)-one (HBO) and to investigate its protective effects on lipopolysaccharide (LPS)/D-galactosamine (D-GalN)-induced acute liver injury. HBO (C₇H₅O₃N) was synthesized based on 2-nitro-resorcinol and identified by physicochemical analysis. In the animal experiment, mice were pretreated with HBO (50, 100, 200 mg/kg) for 10 days. At the end of pretreatment, the animals were injected with LPS (10 μg/kg)/D-GalN (700 mg/kg). The results showed that HBO significantly alleviated liver injury induced by LPS/D-GalN in mice. It remarkably decreased inflammatory response by reducing the levels of tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β). Moreover, HBO notably attenuated hepatocyte apoptosis by inhibiting the release of Cytochrome C (Cyt C) from mitochondria into the cytoplasm and regulating the expression of B-cell lymphoma-2 (Bcl-2) family. Furthermore, the result showed that HBO inhibited the expressions of nuclear factor kappa-B p50 (NF-κBp50), toll-like receptor 4 (TLR4), and myeloid differentiation factor 88 (MyD88), as well as the phosphorylation of inhibitor of nuclear factor kappa-B (IκB), inhibitor of nuclear factor kappa-B kinase-α/β (IKK-α/β), nuclear factor kappa-B p65 (NF-κBp65), suggesting that HBO had a certain influence on the TLR4/NF-κB pathway. In addition, the mitogen-activated protein kinase (MAPK) signaling pathway was also affected by HBO, as evidenced by the decrease in the phosphorylation levels of extracellular regulated protein kinase 1/2 (ERK1/2), c-Jun N-terminal kinase (JNK) and p38 mitogen-activated protein kinase (p38). In conclusion, our study suggested that HBO could protect against LPS/D-GalN-induced liver injury, moreover, treatment with HBO appeared to be capable of further regulating the TLR4/NF-κB and MAPK signaling pathways.

Full text of DOI:10.1016/j.intimp.2020.106445

InternationalImmunopharmacology83(2020)106445
Contents lists available at ScienceDirect
International Immunopharmacology
journal homepage: www.elsevier.com/locate/intimp
4-hydroxybenzo[d]oxazol-2(3H)-one ameliorates LPS/D-GalN-induced
acute liver injury by inhibiting TLR4/NF-κB and MAPK signaling pathways
in mice
Hongyuan Wanga, Xiugui Weia, Xian Weib, Xuemei Suna, Xiukun Huanga, Yingqin Lianga,
Wanpeng Xua, Xunshuai Zhua, Xing Lina,⁎, Jun Lina,⁎
a Department of Pharmacology, Guangxi Medical University, Nanning 530021, China
b Youjiang Medical University for Nationalities, Youjiang, Guangxi, China
A R T I C L E I N F O
A B S T R A C T
Keywords:
4-hydroxybenzo[d]oxazol-2(3H)-one
Liver injury
TLR4/NF-κB pathway
MAPK pathway
The purpose of this study was to synthesize 4-hydroxybenzo[d]oxazol-2(3H)-one (HBO) and to investigate its
protective effects on lipopolysaccharide (LPS)/D-galactosamine (D-GalN)-induced acute liver injury. HBO
(C7H5O3N) was synthesized based on 2-nitro-resorcinol and identified by physicochemical analysis. In the an-
imal experiment, mice were pretreated with HBO (50, 100, 200 mg/kg) for 10 days. At the end of pretreatment,
the animals were injected with LPS (10 µg/kg)/D-GalN (700 mg/kg). The results showed that HBO significantly
alleviated liver injury induced by LPS/D-GalN in mice. It remarkably decreased inflammatory response by re-
ducing the levels of tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β). Moreover, HBO notably atte-
nuated hepatocyte apoptosis by inhibiting the release of Cytochrome C (Cyt C) from mitochondria into the
cytoplasm and regulating the expression of B-cell lymphoma-2 (Bcl-2) family. Furthermore, the result showed
that HBO inhibited the expressions of nuclear factor kappa-B p50 (NF-κBp50), toll-like receptor 4 (TLR4), and
myeloid differentiation factor 88 (MyD88), as well as the phosphorylation of inhibitor of nuclear factor kappa-B
(IκB), inhibitor of nuclear factor kappa-B kinase-α/β (IKK-α/β), nuclear factor kappa-B p65 (NF-κBp65), sug-
gesting that HBO had a certain influence on the TLR4/NF-κB pathway. In addition, the mitogen-activated protein
kinase (MAPK) signaling pathway was also affected by HBO, as evidenced by the decrease in the phosphorylation
levels of extracellular regulated protein kinase 1/2 (ERK1/2), c-Jun N-terminal kinase (JNK) and p38 mitogen-
activated protein kinase (p38). In conclusion, our study suggested that HBO could protect against LPS/D-GalN-
induced liver injury, moreover, treatment with HBO appeared to be capable of further regulating the TLR4/NF-
κB and MAPK signaling pathways.
1. Introduction
the acute liver injury.
The previous study showed that various signaling pathways such as
Liver injury is a severe syndrome, which can lead to high mortality.
It can be induced by many risk factors such as viruses, toxins, drugs,
and alcohol. Lipopolysaccharide (LPS)/D-galactosamine (D-GalN)-in-
duced acute liver injury has been widely recognized as a model to
evaluate the efficiency of hepatoprotective agents [1]. Many experi-
mental studies have confirmed that LPS/D-GalN-induced acute liver
injury leads to hepatocyte apoptosis, large areas of leukocyte infiltra-
tion, and the production of proinflammatory cytokines [2,3]. It is well
accepted that the inflammatory response is the most critical factor in
the progression of this acute liver injury model [4]. Therefore, reducing
inflammatory cytokines may be an effective way for the treatment of
Mitogen-activated protein kinase (MAPK) and Nuclear factor-κB (NF-
κB) could be activated by inflammatory cytokine like TNF-α [5]. In
addition, some studies have reported that LPS can bind to Toll-like
receptor 4 (TLR4) of the cell membrane; afterward, TLR4 can activate
many intracellular signaling pathways such as NF-κB and MAPK [6,7].
Furthermore, the activated NF-κB and MAPKs pathways in turn lead to
further inflammation responses and more production of pro-in-
flammatory cytokines [8]. Thus, inhibiting the TLR4/NF-κB and MAPK
signaling pathways should be a potential strategy to alleviate in-
flammatory response.
The effects of HBO on LPS/D-GalN-induced acute liver injury have
⁎ Corresponding authors.
E-mail addresses: gxlx60@163.com (X. Lin), junlin898@126.com (J. Lin).
https://doi.org/10.1016/j.intimp.2020.106445
Received 5 November 2019; Received in revised form 16 March 2020; Accepted 24 March 2020
1567-5769/©2020ElsevierB.V.Allrightsreserved.

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
not been investigated, and its potential mechanisms remain unclear so
far. Thus, the present study aimed to explore whether HBO could al-
leviate LPS/D-GalN-induced acute liver injury. Additionally, TLR4/NF-
κB and MAPK pathways are closely related to this model, therefore, the
study investigated whether HBO could regulate TLR4/NF-κB and MAPK
pathways.
Bifendate Pills are commonly used for the elevation of ALT caused
by the chemical poisons and drugs, and several studies demonstrated
the beneficial role of Bifendate in the protection from hepatitis and liver
injury [9]. Therefore, based on its beneficial protective effects on the
liver, Bifendate was chosen as the positive control drug in this study.
subjected to reflux for 4–5 h; thereafter, the heating was stopped and let
the mixture cool slightly. The activated carbon was removed by filtra-
tion, and the methanol was removed by evaporation under reduced
pressure; then a dark brown viscous liquid was obtained. N-butyl
acetate (620 ml) was added to the above viscous liquid; subsequently,
the urea (144 g, 2.4 mol) was added when the mixture was heated to
about 90 °C. Now, the mixture was refluxed for 5 h with stirring. The
reaction mixture was vacuum evaporated to remove n-butyl acetate.
Next, the solid substance was washed twice by adding 500 ml water
each time, stirring, heating, holding for 30 min at 80–90 °C. At that
moment, the filter cake was obtained by filtering. The obtained solid
was added into n-butanol twice (800 ml × 2) refluxed, and the solution
was filtered when it was still hot. Afterward, the filtrate was combined,
and the impurities were removed by 200 ml of water under decom-
pression. After filtrating and drying, the brown product was got, and it
was recrystallized from ethanol. The product was identified on the basis
of physicochemical properties and spectral data: mp 293–294 °C; ESI-
MS m/z 149.84 [M−]; 1H NMR (600 MHz, MeOD) δ 6.90 (d), 6.70 (dd),
6.64 (dd); 13C NMR (151 MHz, EtOD) δ 155.39, 144.66, 141.66,
121.55, 117.54, 109.88, 100.22, 47.43.
2. Materials and methods
2.1. Materials
D-GalN and LPS were purchased from Sigma-Aldrich (St. Louis,
MO). Bifendate, a positive control drug, was supplied by Beijing Union
Pharm (Beijing, China). Mitochondria Isolation Kit was obtained from
Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China).
Alanine aminotransferase (ALT), aspartate aminotransferase (AST) and
total bilirubin (TBIL) were purchased from Shanghai Zhicheng
Biological Technology Co., Ltd. (Shanghai, China). Tumor necrosis
factor-α (TNF-α) and interleukin-1β (IL-1β) were provided by
Elabscience Biotechnology Co., Ltd. (Wuhan, China). Glutathione
(GSH), Glutathione peroxidase (GSH-PX), Superoxide dismutase (SOD),
Malondialdehyde (MDA), Catalase (CAT), Nitric oxide (NO), Inducible
nitric oxide synthase (iNOS) and bicinchoninic acid (BCA) assay kits
were produced by Nanjing Jiancheng Bioengineering Institute (Nanjing,
China).
2.3. Animals experiments
Male C57BL/6J mice (Quality certificate number: SCXK Xiang 2019-
0004), weighing 20
Animal Co., Ltd. (Hunan, China), and housed at the well-prepared an-
imal laboratory (22 2 °C, 12 h light/dark cycle) with standard lab
2 g, were obtained from Hunan SJA Laboratory
chow and water freely. All animal experiments were in compliance with
the National Institutes of Health Guide for Care and Use of Laboratory
Animals and were approved by the Animal Ethics Committee of
Guangxi Medical University (Ethic Committee number: 201901053),
China.
2.2. Preparation of HBO
The animals were divided into six groups randomly: normal control
group (n = 10 per group), model group, positive control group, and
HBO-treated groups (high-, medium- and low-dosages). The normal
control group and model group were pre-treated intragastrically with
0.5% CMC-Na. In addition, the HBO and Bifendate were prepared with
0.5% CMC-Na, and the positive control group was pre-treated in-
tragastrically with Bifendate (150 mg/kg/d), and the HBO-treated
groups were pre-treated intragastrically with HBO (200, 100 and
HBO (C7H5O3N, purity
>
98%) was synthesized in our
Pharmaceutical Chemistry Laboratory (Guangxi Medical University,
Guangxi, China) (Fig. 1). In brief, a mixture of 8.0 g FeCl3·6H2O and
18 g activated carbon using methanol as solvent was heated for 30 min
under reflux, and then the 2-nitro-resorcinol (62.0 g, 0.4 mol) was
poured into the mixture. Then 1.5 mol hydrazine hydrate (75%,
100 ml) was added by dripping slowly, and the reaction mixture was
Fig. 1. A schematic synthesizing route illustrating the preparation method of HBO.
2

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
Fig. 2. The experiment schedule.
50 mg/kg/d). After 10 days, the normal control group was given one
intraperitoneal injection of normal saline. The LPS and D-GalN were
dissolved in normal saline, and all mice except the normal control
group were given one intraperitoneal injection of LPS (10 µl/kg) and D-
GalN (700 mg/kg). About 6 h later, all mice were sacrificed; moreover,
the serum was collected and liver samples were separated immediately
for further analysis (Fig. 2).
2.8. Determination of oxidative stress markers
The activities of NO, iNOS, MDA, GSH-PX, GSH, SOD and CAT in
liver homogenates were measured by assay kits, and the protein con-
centrations in liver homogenates were tested by the BCA protein de-
tection kit. All assays were performed according to the manufacturer's
instructions.
2.4. Histological analysis
2.9. Immunohistochemistry
A part of each liver sample was fixed in 4% paraformaldehyde for
48 h, embedded in paraffin and sliced into 5-µm sections. Then, the
sections were stained by hematoxylin and eosin (H&E) and examined
under a light microscope [10]. Moreover, the Terminal dUTP nick end
labeling (TUNEL) method was used to detect hepatocyte apoptosis [11].
The protein expression of c-jun in livers was detected by im-
munohistochemical analysis method. Briefly, liver samples were sec-
tioned into slices as described previously [10]. The sample slices were
incubated with the primary antibody against c-jun (1:500, Proteintech
Group, Inc., Wuhan, China) at 4 °C overnight. After washing, a species-
specific secondary antibody was incubated and applied for 60 min at
room temperature. Lastly, the samples were stained by horseradish
peroxidase and diaminobenzidine; moreover, samples were re-stained
by hematoxylin [12].
2.5. Preparation of tissue homogenate and mitochondria
2.5.1. Preparation of tissue homogenate
Liver tissue samples were homogenized with cold Tris buffer (pH
7.4) on ice, and the homogenates were centrifuged at 4 °C. Then, the
supernatants were divided and stored at −80 °C.
2.10. Real-time PCR (RT-PCR) analysis
PCR experiment was conducted with reagent kits (Takara
Biomedical Technology, Beijing, China) following the manufacturer’s
protocol. The mRNA levels of TNF-α, IL-1β, TLR4, NF-κB p65, NF-κB
p50, ERK, p38, JNK and c-jun were tested. Firstly, total RNA from liver
samples of mice was isolated by the Trizol method. Secondly, cDNA was
synthesized by removing genomic DNA reaction and reverse tran-
scription reaction. Finally, the PCR reaction solution was prepared and
then the real-time PCR reaction was performed with an Applied
Biosystems Prism 7300 Fast Sequence Detection System, and the ex-
perience was performed with the following conditions: 30 s at 95 °C,
followed by 40 cycles of 5 s at 95 °C, and 31 s at 60 °C. Moreover,
GAPDH was used as an internal control. The result of each gene ex-
pression was calculated using the 2−△△Ct method according to the
formula RQ = 2−△△Ct [13]. The primers used in the studies were
listed in Table 1.
2.5.2. Preparation of mitochondria
Mitochondria were prepared using a commercially-available kit.
First, fresh liver tissue samples were washed with PBS, cut by scissors,
and homogenized with Lysis Buffer. Next, the homogenate was cen-
trifuged at 4 °C several times according to the instructions, and the
extracted cytoplasm was preserved. Moreover, the pellet was re-
suspended in the Wash Buffer and the mixture was centrifuged. At last,
the final pellet was resuspended in the Store Buffer.
2.6. Evaluation of liver function
The levels of ALT, AST and TBIL were determined using commer-
cially-available kits to assess the severity of the liver injury.
2.7. Enzyme-linked immunosorbent assay (ELISA)
2.11. Western blot assay
The levels of cytokines in tissue homogenates such as TNF-α and IL-
1β were examined using ELISA kits in accordance with the kit in-
structions.
The protein samples were subjected to sodium dodecyl sulfate-
polyacrylamide gel (SDS-PAGE) electrophoresis, then subsequently
Table 1
The sequences of primers used for real-time quantitative PCR.
Gene
Forward primers (5′–3′)
Reverse primers (5′–3′)
TNF-α
IL-1β
GCCAGGAGGGAGAACAGAAACTC
TCCAGGATGAGGACATGAGCAC
TCCTGTGGACAAGGTCAGCAAC
ATTGCTGTGCCTACCCGAAAC
TCCGGGAGCCTCTAGTGAGAA
TCCTGCTGAACACCACTTGTGA
GATGAGCCTGTTGCTGACCCTTA
GGCCAGTGAGTGAAAGGGACA
GAACGTCACACACCAGCAGGTTA
TTACACTCAGACTCGGCACTTAGCA
TTTGAGATCTGCCCTGATGGTAA
TCCATTTGTGACCAACTGAACGA
CCAACGTGTGGCTACGTACTCTG
TGGTGGCACAAAGCTGATGAC
TLR4
NF-κB p65
NF-κB p50
ERK
p38
JNK
c-jun
GAPDH
GACACTTGACAGGATAGGATGAGCA
ATCCACGGCCAACATGCTC
TGTGTCCGTCGTGGATCTGA
CTAGCGCTGAGGCAACACTGA
ACGTTTGCAACTGCTGCGTTAG
TTGCTGTTGAAGTCGCAGGAG
3

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
transferred to PVDF membranes (Millipore, USA). After blocking with
5% skim milk, the PVDF membranes were incubated at 4 °C overnight
with the primary antibodies: TLR4 (1:500, Abcam), MyD88 (1:1000,
Abcam), p-IKK-α/β (1:1000, Cell Signaling Technology Inc), IκB-α
(1:1000, Cell Signaling Technology Inc), p-IκB-α (1:1000, Cell Signaling
Technology Inc), NF-κBp50 (1:2000, Abcam), NF-κBp65 (1:500,
Abcam), p-NF-κBp65 (1:1000, Abcam), MEK1 (1:1000, Boster), p-MEK1
(1:1000, Boster), ERK1/2 (1:1000, Cell Signaling Technology Inc), p-
ERK1/2 (1:1000, Cell Signaling Technology Inc), JNK1/2 (1:1000, Cell
Signaling Technology Inc), p-JNK1/2 (1:1000, Cell Signaling
Technology Inc), p38 (1:1000, Cell Signaling Technology Inc), p-p38
(1:1000, Cell Signaling Technology Inc), Bcl-2 (1:1000, Proteintech),
Bcl-xl (1:1000, Proteintech), BAX (1:1000, Boster), BAK (1:1000,
Boster), and GAPDH (1:2500, Abcam).
After that, the membranes were washed three times with TBST and
were incubated with fluorescence-labeled rabbit anti-goat IgG (Licor,
USA) at 1:10,000 dilution at room temperature for 1 h. Finally, the
membranes were washed again; and the bands were observed by Image
Studio software.
In addition, the expressions of Cytochrome C (Cyt C) (1:2500,
Abcam) in the mitochondria and cytoplasm were examined using
Western blotting, and the procedure was the same as previously de-
scribed procedures.
CAT were significantly decreased in LPS/D-GalN-treated group as
compared to the normal control group, interestingly, these alterations
induced by LPS/D-GalN were reversed by HBO and Bifendate treat-
ment. Moreover, the LPS/D-GalN treatment led to an increase in MDA
content, which was partially alleviated by HBO and Bifendate treatment
(Fig. 4E). These data indicated that the protective effect of HBO on liver
injury might be associated with its ability to reduce oxidative stress.
3.3. HBO alleviated inflammatory response
The production of NO is related to iNOS, and the high expression of
iNOS can lead to organ destruction in some inflammatory. The result
showed that the content of NO and iNOS was significantly higher in the
LPS/D-GalN-treated group compared with the normal group
(Fig. 4F–G). In contrast, HBO and Bifendate treatment largely decreased
the levels of NO and iNOS. Inflammatory cytokines play an important
role in LPS/D-GalN-induced acute liver injury, especially TNF-α,
therefore the levels of TNF-α and IL-1β were tested. As indicated in
Fig. 4H, the content of TNF-α and IL-1β was strikingly increased after
LPS/D-GalN treatment, whereas HBO and Bifendate pre-treatment sig-
nificantly reduced the over-expressions of these inflammatory cyto-
kines. In addition, this study also detected the levels of TNF-α and IL-1β
mRNA by RT-PCR. Obviously, the TNF-α and IL-1β mRNA expression
levels were increased after LPS/D-GalN treatment, while HBO and Bi-
fendate could inhibit this elevation to a large extent (Fig. 4I). These
data suggested that HBO was able to ameliorate LPS/D-GalN-induced
acute liver injury by alleviating inflammatory response.
2.12. Statistical analysis
Statistical analysis was conducted using SPSS 11.5 for Windows.
Data from the different groups were subjected to the one-way analysis
of variance (ANOVA) followed by Tukey’s test for post-hoc compar-
3.4. HBO mitigated LPS/D-GalN-induced hepatocyte apoptosis
isons. All data were presented as means
SD. The difference was
considered statistically significant if p-value < 0.05.
In the present study, TUNEL staining was used for examining he-
patocyte apoptosis. The TUNEL result was shown in Fig. 5A. Brownish
black dots suggested that LPS/GalN induced massive hepatocyte
apoptosis, whereas HBO and Bifendate treatment markedly decreased
these effects. Moreover, the expression levels of apoptosis-related pro-
teins were examined by Western blotting. As shown in Fig. 5B, LPS/D-
GalN treatment significantly up-regulated the expression of pro-apop-
totic protein BAX and BAK, which were decreased when treated with
HBO and Bifendate; furthermore, the expression of anti-apoptotic pro-
tein Bcl-2 and Bcl-xl were contrary to the pro-apoptotic protein.
In order to further explain the apoptotic reaction of the hepatic cell,
mitochondrial Cyt C and cytosolic Cyt C were detected. In the present
work, the ratio of mitochondrial to cytosolic Cyt C in normal group was
markedly higher than the model group, however, HBO and Bifendate
pre-treatment effectively restored this ratio (Fig. 5C). The results de-
monstrated that HBO and Bifendate could suppress Cyt C release from
mitochondria into the cytoplasm. These results indicated that HBO had
a strong inhibitory effect on apoptosis.
3. Results
3.1. HBO exerted a protective effect on LPS/D-GalN-induced acute liver
injury
The livers in each group of mice were shown in Fig. 3A. The samples
in the normal group were light red in color and nice smooth in ap-
pearance. Obviously, the livers in LPS/D-GalN-treated group were deep
red in color, rough in appearance and swelling in size as compared with
the normal control group, and the livers of HBO-treated groups and
Bifendate-treated group had been improved as compared with the
model group, particularly in the high HBO-treated group and Bifendate-
treated group. To further assess the extent of the damage in the liver,
this study also evaluated histological changes and biochemical markers
(serum levels of AST, ALT and TBIL). As shown in Fig. 3A, H&E staining
revealed that the livers in the normal control group exhibited the
normal structure with hepatic cells in the ordered arrangement and no
pathological lesion area. But LPS/D-GalN-treated group was found to
have the architecture disruption, characterized by massive necrosis,
hemorrhage and inflammatory infiltration. It should be noted that the
damaged tissues induced by LPS/D-GalN were alleviated both in Bi-
fendate and HBO treatment groups. Moreover, treatment with Bi-
fendate and 200 mg/kg HBO evidently reduced the percentage of ne-
crotic area. In addition, serum AST, ALT and TBIL levels were strongly
elevated by LPS/D-GalN treatment, however, their activities were de-
creased by the pre-treatment of Bifendate and HBO (Fig. 3B and C).
These data clearly indicated that HBO could alleviate the severity of
LPS/D-GalN-induced acute liver injury.
3.5. Effects of HBO on the change of the TLR4/NF-κB signaling pathway in
LPS/D-GalN-induced acute liver injury
The TLR4 signaling pathway is considered to be an important
pathway in modulating TNF-α, hence the effect of HBO on the TLR4/
NF-κB pathway activation in the liver was measured. The results
showed that the protein expression levels of NF-κBp50, TLR4 and
MyD88, and the phosphorylation of IKK-α/β, IκB and NF-κBp65 in the
LPS/D-GalN-treated mice liver were distinctly elevated compared with
the normal control mice (Fig. 6A–E). After treatment with HBO and
Bifendate, the expressions of NF-κBp50, TLR4 and MyD88, and the
phosphorylation of IKK-α/β, IκB and NF-κBp65 aforementioned were
significantly decreased. Moreover, the mRNA levels of TLR4, NF-κBp65
and NF-κBp50 in liver tissues were further examined by RT PCR. As
shown in Fig. 6F, compared to the normal group, the mRNA expressions
of TLR4, NF-κBp65 and NF-κBp50 were remarkably enhanced by LPS/
D-GalN, however, the mRNA expression levels of these genes were
3.2. HBO suppressed LPS/D-GalN-induced hepatic oxidative stress
The anti-oxidative stress effect of HBO was evaluated by de-
termining the levels of GSH, GSH-PX, SOD, MDA and CAT in hepatic
tissues. As shown in Fig. 4A–D, the levels of GSH, GSH-PX, SOD and
4

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
Fig. 3. HBO significantly alleviated liver injury in mice (n = 10). (A) Changes in liver morphology. And hepatic histological changes in each group were observed by
H&E staining. (B to C) The activity of serum ALT, AST and TBIL were measured using an automatic biochemistry analyzer. Data are expressed as means
#P < 0.05 VS. the normal group; *P < 0.05 VS. the model group.
SD.
partially inhibited by HBO and Bifendate treatment. The above evi-
dence demonstrated that HBO could alleviate the reversed abnormal
expressions of the proteins in the TLR4/NF-κB pathway induced by
LPS/D-GalN.
mRNA levels of ERK1/2, JNK, p38 and c-jun were remarkably reduced
by treatment with HBO and Bifendate (Fig. 7F). These data indicated
that the effects of LPS/D-GalN on the levels of ERK1/2, JNK and p38
phosphorylations were largely abolished by HBO.
3.6. Effects of HBO on the change of the MAPK signaling pathway in LPS/
4. Discussion
D-GalN-induced acute liver injury
LPS/D-GalN-induced acute liver injury in mammals is a well-known
model that has been widely used to simulate the formation of acute
liver injury in humans and elucidate the exact pathogenesis [2]. It has
been authenticated that LPS could lead to the macrophage activation
and inflammatory responses, and LPS is considered as an important
factor in causing hepatic injury. Moreover, D-GalN, a hepatotoxic
agent, can consume uridine monophosphate in the liver, inhibiting the
glycoprotein, nucleic acid and lipid synthesis, damaging the hepato-
cytes and causing liver injury. It is noteworthy that D-GalN can enhance
the toxic effects of LPS. In this study, the liver injury model was induced
by LPS/D-GalN in mice. The histopathological results showed that HBO
clearly ameliorated the widespread cellular necrosis and damages of
liver architecture. Generally, under normal conditions, ALT and AST
mostly exist in liver cells, however, they are transferred into the serum
when the liver is damaged, causing a prominent increase in their serum
levels. At present, ALT and AST have been regarded as a symbol of the
hepatocyte injury, whose activation levels can assess the severity of
liver damage [14,15]. Moreover, the content of TBIL in serum is the
index of the functional transport ability in the liver [16]. In the present
study, we found that the levels of ALT, AST and TBIL were significantly
increased after LPS/D-GalN treatment, indicating the acute liver injury;
conversely, the ALT, AST and TBIL levels were significantly attenuated
by Bifendate and HBO treatment. The above results indicated that LPS/
Given the critical role of MAPKs family in LPS/D-GalN-induced
acute liver injury, this study also examined the effect of HBO on the
MAPK pathway in liver tissues. Fig. 7A–D showed that liver tissue levels
of MEK, ERK1/2, JNK and p38 phosphorylations were significantly
enhanced in LPS/D-GalN treatment mice compared to the normal
group. Strikingly, the phosphorylation of these molecules was re-
markably suppressed by HBO and Bifendate treatment. The protein
level of c-jun in the liver was further examined by Im-
munohistochemical detection, and if there are brown granules in the
nucleus, cytoplasm, cell membrane or interstitium, it will be positive
cells. In our Immunohistochemical staining experiment, the positive
signal of c-jun protein was localized in the cytoplasm and nucleus of
liver injury tissue, showing brown-yellow granule shape. The liver
section from the normal group revealed that c-jun was only faintly
expressed; after challenged by LPS/D-GalN, the expression of c-jun was
significantly observed, as the intense brown staining was shown in
Fig. 7E. However, the expression of c-jun was markedly inhibited by
treatment with HBO compared to the model group. To further explore
whether HBO could inhibit the MAPK signaling pathway, RT-PCR
analysis was carried out to determine the mRNA expression. As ex-
pected, with the treatments of LPS/D-GalN, ERK1/2, JNK, p38 and c-
jun mRNA expressions were evidently enhanced. Nevertheless, the
5

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
Fig. 4. HBO significantly alleviated lipid peroxidation and inflammatory response. (A to G) The levels of GSH, GSH-PX, SOD, CAT, MDA, iNOS and NO were detected
using commercially available kits. (H) The content of TNF-α and IL-1β was determined by enzyme-linked immunosorbent assay. (I) The mRNA levels of TNF-α and IL-
1β were determined using RT-PCR assays. Values are expressed as means
group.
SD (n = 10 in each group). #P < 0.05 VS. the normal group; *P < 0.05 VS. the model
D-GalN-induced acute liver injury was dramatically alleviated by HBO.
Oxidative stress plays a crucial role in the onset of LPS/D-GalN-
induced acute liver injury. GSH is a major naturally-occurring anti-
oxidant, and it can prevent oxidative damage by scavenging free radi-
cals; moreover, GSH-Px, as a free radical scavenger, can catalyze the
decomposition of hydrogen peroxide. Furthermore, SOD is an anti-
oxidative enzyme, which plays a vital role in the balance of oxidation
and anti-oxidation. And SOD can catalyze the disproportionation to
produce hydrogen peroxide, while CAT accelerates the dismutation
reaction of hydrogen peroxide. That is, the functions of SOD and CAT
are interrelated, and both of them can scavenge oxygen radical species,
and protect the integrity of cells [17,18]. MDA is the final product of
lipid peroxidation, and the content of MDA can indicate the extent of
oxidative damage in the liver [19]. In this study, after treatment with
LPS/D-GalN, the levels of GSH, GSH-Px, SOD and CAT were sig-
nificantly decreased, and the levels of MDA was evidently increased,
demonstrating the serious oxidative injury in the liver. In contrast, HBO
and Bifendate treatment could increase the levels of SOD, GSH, CAT
and decrease the content of MDA. The results showed that the anti-
oxidant capacity of HBO might be one of its important protective
mechanisms against LPS/D-GalN-induced acute liver injury.
The inflammatory response is a major contributing factor in the
development of acute liver injury induced by LPS/D-GalN. LPS excites
kupffer cells, causing the excretion of various pro-inflammatory cyto-
kines such as TNF-α and IL-1β [20]. Neutrophil activation and in-
filtration are elicited by TNF-α, thus TNF-α has been regarded as the
main cellular regulator in the early inflammatory response, and it is a
central mediator in the progress of LPS/D-GalN-induced acute liver
injury [21]. In common with the TNF-α, IL-1β is a significant pro-in-
flammatory cytokine involving in liver injury, which could activate
lymphocytes and lead to the release of other cytokines. Consequently,
several pieces of evidence proved that regulation of the inflammatory
response, especially the production of TNF-α, is an effective way for the
treatment of the acute liver injury. In addition, NO could serve the
function of regulating inflammatory response [22], and the level of
iNOS could be an indicator of the degree of inflammation [23]. In the
present study, the levels of TNF-α, IL-1β, NO and iNOS in the liver were
evidently heightened after LPS/D-GalN treatment; similarly, the TNF-α
and IL-1β mRNA levels were significantly increased. Interestingly,
treatment with HBO and Bifendate noticeably reduced the contents of
6

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
Fig. 5. Inhibition of LPS/D-GalN-induced hepatocyte apoptosis by HBO. (A) TUNEL staining was performed to observe apoptotic cells in liver tissue sections. (B to C)
Apoptosis-related proteins levels were determined by Western blot. Data are presented as means
*P < 0.05 VS. the model group.
SD (n = 3 in each group). #P < 0.05 VS. the normal group;
TNF-α, IL-1β, NO and iNOS, as well as the mRNA levels of TNF-α and
IL-1β, suggesting that the protective effects of HBO against liver injury
induced by LPS/D-GalN probably through the restraint of inflammatory
response.
overproduction and release of Cyt C by mitochondria [25]. In this
study, the results showed that HBO significantly reduced hepatocyte
apoptosis. Moreover, HBO pre-treatment effectively inhibited the ex-
pression of BAX, BAK, while increased the levels of Bcl-2 and Bcl-xl.
HBO also reduced Cyt C release from mitochondria to cytosol. Hepa-
tocyte apoptosis has been identified as an important pathological
manifestation of LPS/D-GalN-induced acute liver injury, and our results
suggested that HBO treatment reduced the apoptosis obviously.
Since the TLR4/NF-κB pathway played a crucial role in the acute
liver injury process induced by LPS/D-GalN, in this study the protein
levels of TLR4/NF-κB pathway were examined. For actually, the ex-
pression of TLR4 was substantially increased by LPS/D-GalN, and then
the NF-κB signaling pathway was activated; afterwards, the in-
flammatory response was triggered [20,26]. Accordingly, much atten-
tion has been given to the NF-κB pathway. NF-κB, a nuclear transcrip-
tion factor, acts a pivotal part in LPS/D-GalN-induced inflammation and
apoptosis [27]. In the inactive state, the p65/p50 translocation is
In the LPS/D-GalN-induced acute liver injury model, the high per-
centage of hepatic cells apoptosis is a common phenomenon. Hence,
hepatocyte apoptosis is a momentous target for ameliorating liver in-
jury [24]. TUNEL staining can visually observe the cellular apoptosis of
hepatic tissue. In addition, the expression of apoptosis-related proteins
was being noted in this study. Apoptosis may occur by the mitochon-
drial pathway. The release of mitochondrial cytochrome c into the cy-
toplasm is a crucial event in controlling apoptosis progress. Further-
more, the Bcl-2 family is reported to be the key regulator for the
maintenance of the membrane stability of mitochondria. The up-reg-
ulation of pro-apoptosis proteins such as BAX and BAK and down-reg-
ulation of anti-apoptosis proteins such as Bcl-2 and Bcl-xl change per-
meability of the mitochondrial membrane, which could lead to the
7

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
Fig.6. Effects of HBO on the change of the TLR4/NF-κB signaling pathway. (A–E) Protein levels were determined by Western blot. (F) The mRNA expression levels of
TLR4, NF-κBP65 and NF-κBP50 were determined by RT-PCR assays. Data are presented as means
SD (n = 3 in each group). #P < 0.05 VS. the normal group;
*P < 0.05 VS. the model group.
commonly secluded in the cytoplasm owing to inhibitory protein IκBα.
The IκB kinase (IKK) complex could be activated by various stimuli,
next, the IκBα protein is phosphorylated. Then the p65/p50 hetero-
dimer could transfer to the nucleus and activate the downstream gene
transcription such as pro-inflammatory mediators [28,29]. Consistent
with the previous studies, our results showed that TLR4 and NF-κB
pathways were visibly activated by LPS/D-GalN [28]. Contrarily, HBO
and Bifendate successfully reduced the expressions of TLR4, MyD88 and
NF-κBp50, and markedly inhibited the phosphorylations of IKK-α/β,
IκB-α and NF-κBp65. Similarly, HBO and Bifendate suppressed mRNA
levels of TLR4, NF-κBp50 and NF-κB p65. The NF-κB pathway could be
activated by TLR4, this is a recognized phenomenon in LPS/D-GalN-
induced acute liver injury. And our results suggested that HBO could
weaken the TLR4 expression and the phosphorylation of proteins in the
NF-κB pathway, these findings indicated that HBO played a positive
role in preventing TLR4/NF-κB activation.
TLR4, and the MAPK signaling pathway appears to perform a con-
siderable regulatory function of inflammatory response via its three
major proteins including ERK, p38 and JNK. Moreover, a previous study
has demonstrated that activation of the MAPK signaling pathway con-
tributes to the production of multiple inflammatory factors (for ex-
ample, TNF-α) [30]. ERK is involved in the regulation of cell pro-
liferation, differentiation and survival. p38 mediates pro-inflammatory
mediators and apoptosis, thus becomes a potential target for the anti-
inflammatory cure. JNK plays a vital role in controlling apoptosis [31].
Indeed, we found that ERK, p38 and JNK pathways were activated by
LPS/D-GalN, which is consistent with the previous studies [32]. Con-
versely, our data indicated that HBO and Bifendate treatment sig-
nificantly diminished the phosphorylation of MEK, ERK, JNK, and p38,
and inhibited the expression of c-jun. Additionally, the mRNA levels of
JNK, ERK, p38 and c-jun were inhibited by HBO and Bifendate. These
analyses indicated that HBO clearly repaired the enhanced of the MAPK
signaling pathway.
MAPK signaling pathway also plays a key role in LPS/D-GalN-in-
duced acute liver injury, accordingly, the MAPK signaling pathway was
investigated. The MAPKs family can be stimulated by the activation of
In conclusion, our study demonstrates that HBO can ameliorate
LPS/D-GalN-induced acute liver injury in mice. Surprisingly, HBO
8

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
Fig. 7. Effects of HBO on the change of the MAPK signaling pathway. (A–D) Protein levels were determined by Western blot. (E) The expression of c-jun in liver
tissues was analyzed by immunohistochemistry staining. (F) The mRNA expression levels of ERK, P38, JNK and c-jun were determined by RT-PCR assays. Data are
presented as means
SD (n = 3 in each group). #P < 0.05 VS. the normal group; *P < 0.05 VS. the model group.
treatment can down-regulate the phosphorylation of essential cytokines
in TLR4/NF-κB and MAPK signaling pathways, and inhibit the further
development of inflammation and hepatocyte apoptosis (Fig. 8). Our
study probably provides a new insight for HBO as a potential agent for
the treatment of liver injury.
CRediT authorship contribution statement
Hongyuan Wang: Conceptualization, Methodology, Validation,
Formal analysis, Data curation, Writing - original draft. Xiugui Wei:
Formal analysis, Investigation, Data curation. Xian Wei: Methodology,
9

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
Fig. 8. A schematic diagram illustrating HBO ameliorates LPS/D-GalN-induced acute liver injury. (1) HBO regulated the expression of Bcl-2 family, and protected
mitochondria from damage induced by LPS/D-GalN, reducing hepatocyte apoptosis; (2) HBO down-regulated the phosphorylation of essential cytokines in the TLR4/
NF-κB and MAPK pathways and consequently reduced inflammatory responses, alleviating hepatic injury.
Validation. Xuemei Sun: Methodology, Validation. Xiukun Huang:
Methodology, Validation. Yingqin Liang: Validation, Investigation.
Wanpeng Xu: Validation. Xunshuai Zhu: Resources. Xing Lin:
Conceptualization, Writing - review & editing, Supervision, Project
administration. Jun Lin: Conceptualization, Supervision, Project ad-
ministration, Funding acquisition.
Physiol. 234 (5) (2019) 6463–6476.
[7] E.-H. Joh, W. Gu, D.-H. Kim, Echinocystic acid ameliorates lung inflammation in
mice and alveolar macrophages by inhibiting the binding of LPS to TLR4 in NF-κB
and MAPK pathways, Biochem. Pharmacol. 84 (3) (2012) 331–340.
[8] M. Qi, L. Zheng, Y. Qi, X. Han, Y. Xu, L. Xu, L. Yin, C. Wang, Y. Zhao, H. Sun,
Corrigendum to“ Dioscin attenuates renal ischemia/reperfusion injury by inhibiting
theTLR4/MyD88 signaling pathway via up-regulation of HSP70”[Pharmacol. Res.
100 (2015) 341-352], Pharmacol. Res. 150 (2019) (2015) 104449.
[9] R.-Z. Zhang, H. Qiu, N. Wang, F.-L. Long, D.-W. Mao, Effect of Rheum palmatum L.
on NF-κB signaling pathway of mice with acute liver failure, Asian Pacific J.
Tropical Med. 8 (10) (2015) 841–847.
Declaration of Competing Interest
[10] S. Haga, M. Ozaki, Relevance of FXR-p62/SQSTM1 pathway for survival and pro-
tection of mouse hepatocytes and liver, especially with steatosis, BMC
Gastroenterol. 17 (1) (2017) 9.
[11] D.-Y. Liang, L.-M. Liu, C.-G. Ye, L. Zhao, F.-P. Yu, D.-Y. Gao, Y.-Y. Wang, Z.-
W. Yang, Y.-Y. Wang, Inhibition of UII/UTR system relieves acute inflammation of
liver through preventing activation of NF-κB pathway in ALF mice, PLoS One 8 (6)
(2013) e64895.
[12] H.Z. Li, Y. Wang, Y. Gao, J. Shao, X.L. Zhao, W.M. Deng, Y.X. Liu, J. Yang, Z. Yao,
Effects of raf kinase inhibitor protein expression on metastasis and progression of
human epithelial ovarian cancer, Mol. Cancer Res. 6 (6) (2008) 917–928.
[13] N. Brink, M. Szamel, A. Young, K. Wittern, J. Bergemann, Comparative quantifi-
cation of IL-1β, IL-10, IL-10r, TNFα and IL-7 mRNA levels in UV-irradiated human
skin in vivo, Inflamm. Res. 49 (6) (2000) 290–296.
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influ-
ence the work reported in this paper.
Acknowledgment
The authors gratefully acknowledge the financial support provided
by the National Natural Science Foundation of China (Nos. 81660106
and 81660693).
[14] M.A. Hyder, M. Hasan, A.H. Mohieldein, Comparative levels of ALT, AST, ALP and
GGT in liver associated diseases, Eur. J. Exp. Biol. 3 (2) (2013) 280–284.
[15] W. Jiang, R. Zhou, P. Li, Y. Sun, Q. Lu, Y. Qiu, J. Wang, J. Liu, K. Hao, X. Ding,
Protective effect of chrysophanol on LPS/d-GalN-induced hepatic injury through
the RIP140/NF-κB pathway, Rsc Adv. 6 (44) (2016) 38192–38200.
[16] M. Li, S. Wang, X. Li, L. Jiang, X. Wang, R. Kou, Q. Wang, L. Xu, N. Zhao, K. Xie,
Diallyl sulfide protects against lipopolysaccharide/d-galactosamine-induced acute
liver injury by inhibiting oxidative stress, inflammation and apoptosis in mice, Food
Chem. Toxicol. 120 (2018) 500–509.
[17] S. Sheik Abdulazeez, D. Thiruvengadam, Effect of lycopene on oxidative stress in-
duced during D-galactosamine/lipopolysaccharide-sensitized liver injury in rats,
Pharm. Biol. 51 (12) (2013) 1592–1599.
[18] F.-N. Chai, J. Zhang, H.-M. Xiang, H.-S. Xu, Y.-F. Li, W.-Y. Ma, X.-G. Li, X.-L. Ye,
Protective effect of Coptisine from Rhizoma Coptidis on LPS/D-GalN-induced acute
liver failure in mice through up-regulating expression of miR-122, Biomed.
Pharmacother. 98 (2018) 180–190.
References
[1] K. Hamesch, E. Borkham-Kamphorst, P. Strnad, R. Weiskirchen,
Lipopolysaccharide-induced inflammatory liver injury in mice, Lab. Anim. 49
(1_suppl) (2015) 37–46.
[2] W. Chen, Y.-J. Lin, X.-Y. Zhou, H. Chen, Y. Jin, Rosiglitazone protects rat liver
against acute liver injury associated with the NF-κB signaling pathway, Can. J.
Physiol. Pharmacol. 94 (1) (2015) 28–34.
[3] L. Zong, Q. Yu, Y. Du, X. Deng, Edaravone protects endotoxin-induced liver injury
by inhibiting apoptosis and reducing proinflammatory cytokines, Braz. J. Med. Biol.
Res. 47 (3) (2014) 231–236.
[4] F. Yang, X. Li, L.-K. Wang, L.-W. Wang, X.-Q. Han, H. Zhang, Z.-J. Gong, Inhibitions
of NF-κB and TNF-α result in differential effects in rats with acute on chronic liver
failure induced by d-Gal and LPS, Inflammation 37 (3) (2014) 848–857.
[5] S. Zhang, N. Yang, S. Ni, W. Li, L. Xu, P. Dong, M. Lu, Pretreatment of lipopoly-
saccharide (LPS) ameliorates D-GalN/LPS induced acute liver failure through TLR4
signaling pathway, Int. J. Clin. Exp. Path. 7 (10) (2014) 6626.
[19] C.-W. Pan, G.-Y. Zhou, W.-L. Chen, L. Zhuge, L.-X. Jin, Y. Zheng, W. Lin, Z.-Z. Pan,
Protective effect of forsythiaside A on lipopolysaccharide/d-galactosamine-induced
liver injury, Int. Immunopharmacol. 26 (1) (2015) 80–85.
[6] A. Sivanantham, D. Pattarayan, R. Bethunaickan, A. Kar, S.K. Mahapatra,
R.K. Thimmulappa, R. Palanichamy, S. Rajasekaran, Tannic acid protects against
experimental acute lung injury through downregulation of TLR4 and MAPK, J. Cell.
[20] T. Fu, H. Li, Y. Zhao, E. Cai, H. Zhu, P. Li, J. Liu, Hepatoprotective effect of α-
mangostin against lipopolysaccharide/d-galactosamine-induced acute liver failure
in mice, Biomed. Pharmacother. 106 (2018) 896–901.
10

H. Wang, et al.
InternationalImmunopharmacology83(2020)106445
[21] X. Yang, M. Fujisawa, T. Yoshimura, T. Ohara, M. Sato, M. Mino, T.H. San, T. Gao,
S.L. Kunkel, A. Matsukawa, Spred2 deficiency exacerbates D-galactosamine/lipo-
polysaccharide-induced acute liver injury in mice via increased production of
TNFα, Sci. Rep. 8 (1) (2018) 188.
[27] M. Qi, L. Yin, L. Xu, X. Tao, Y. Qi, X. Han, C. Wang, Y. Xu, H. Sun, K. Liu, Dioscin
alleviates lipopolysaccharide-induced inflammatory kidney injury via the
microRNA let-7i/TLR4/MyD88 signaling pathway, Pharmacol. Res. 111 (2016)
509–522.
[28] Y. Tian, Z. Li, B. Shen, Q. Zhang, H. Feng, Protective effects of morin on lipopo-
lysaccharide/d-galactosamine-induced acute liver injury by inhibiting TLR4/NF-κB
and activating Nrf2/HO-1 signaling pathways, Int. Immunopharmacol. 45 (2017)
148–155.
[29] W. Wang, L. Wu, Q. Li, Z. Zhang, L. Xu, C. Lin, L. Gao, K. Zhao, F. Liang, Q. Zhang,
Madecassoside prevents acute liver failure in LPS/D-GalN-induced mice by in-
hibiting p38/NF-κB and activating Nrf2/HO-1 signaling, Biomed. Pharmacother.
103 (2018) 1137–1145.
[30] T. Tian, W. Tian, F. Yang, R. Zhao, Q. Huang, Y. Zhao, Sphingosine kinase 1 in-
hibition improves lipopolysaccharide/D-galactosamine-induced acute liver failure
by inhibiting mitogen-activated protein kinases pathway, United Eur.
Gastroenterol. J. 4 (5) (2016) 677–685.
[22] M. Yoshikawa, N. Nishida, K. Ninomiya, T. Ohgushi, M. Kubo, T. Morikawa,
H. Matsuda, Inhibitory effects of coumarin and acetylene constituents from the
roots of Angelica furcijuga on D-galactosamine/lipopolysaccharide-induced liver
injury in mice and on nitric oxide production in lipopolysaccharide-activated mouse
peritoneal macrophages, Bioorg. Med. Chem. 14 (2) (2006) 456–463.
[23] T. Hijikawa, M. Kaibori, Y. Uchida, M. Yamada, K. Matsui, T. Ozaki, Y. Kamiyama,
M. Nishizawa, T. Okumura, Insulin-like growth factor 1 prevents liver injury
through the inhibition of TNF-α and iNOS induction in D-galactosamine and LPS-
treated rats, Shock 29 (6) (2008) 740–747.
[24] D. Zhou, Q. Ai, L. Lin, X. Gong, P. Ge, Q. Che, J. Wan, A. Wen, L. Zhang, 5-
Aminoimidazole-4-carboxamide-1-β-D-ribofuranoside-attenuates LPS/D-Gal-in-
duced acute hepatitis in mice, Innate Immun. 21 (7) (2015) 698–705.
[25] L. Xu, X. Zheng, Y. Wang, Q. Fan, M. Zhang, R. Li, J. Ye, X. Wu, W. Zhao, Y. Zhang,
Berberine protects acute liver failure in mice through inhibiting inflammation and
mitochondria-dependent apoptosis, Eur. J. Pharmacol. 819 (2018) 161–168.
[26] H. Yao, C. Hu, L. Yin, X. Tao, L. Xu, Y. Qi, X. Han, Y. Xu, Y. Zhao, C. Wang, Dioscin
reduces lipopolysaccharide-induced inflammatory liver injury via regulating TLR4/
MyD88 signal pathway, Int. Immunopharmacol. 36 (2016) 132–141.
[31] A. Plotnikov, E. Zehorai, S. Procaccia, R. Seger, The MAPK cascades: signaling
components, nuclear roles and mechanisms of nuclear translocation, Biochimica et
Biophysica Acta (BBA)-Molecular, Cell Res. 1813 (9) (2011) 1619–1633.
[32] X. Wang, L. Zhang, Z. Wei, X. Zhang, Q. Gao, Y. Ma, X. Liu, Y. Jiang, X. Liu, C. Guo,
The inhibitory action of PDCD4 in lipopolysaccharide/D-galactosamine-induced
acute liver injury, Lab. Invest. 93 (3) (2013) 291.
11