Structure-function analysis of porcine cytochrome P450 3A29 in the hydroxylation of T-2 toxin as revealed by docking and mutagenesis studies

Article abstract of DOI:10.1371/journal.pone.0106769

T-2 toxin, one of the type A trichothecenes, presents a potential hazard to human and animal health. Our previous work demonstrated that porcine cytochrome P450 3A29 (CYP3A29) played an important role in the hydroxylation of T-2 toxin. To identify amino a

Full text of DOI:10.1371/journal.pone.0106769

Structure-Function Analysis of Porcine Cytochrome P450
3A29 in the Hydroxylation of T-2 Toxin as Revealed by
Docking and Mutagenesis Studies
Guyue Cheng1., Changcun Liu2., Xu Wang1, Hongmin Ma3, Yuanhu Pan2, Lingli Huang2, Haihong Hao1,
Menghong Dai1, Zonghui Yuan1,2
*
1 MOA Laboratory for Risk Assessment of Quality and Safety of Livestock and Poultry Products, Huazhong Agricultural University, Wuhan, China, 2 National Reference
Laboratory of Veterinary Drug Residues (HZAU), MOA Key Laboratory for Detection of Veterinary Drug Residues, Huazhong Agricultural University, Wuhan, China, 3 Key
Laboratory of Combinatorial Biosynthesis and Drug Discovery (Ministry of Education) at the School of Pharmaceutical Sciences, Wuhan University, Wuhan, China
Abstract
T-2 toxin, one of the type A trichothecenes, presents a potential hazard to human and animal health. Our previous work
demonstrated that porcine cytochrome P450 3A29 (CYP3A29) played an important role in the hydroxylation of T-2 toxin. To
identify amino acids involved in this metabolic process, T-2 toxin was docked into a homology model of CYP3A29 based on
a crystal structure of CYP3A4 using AutoDock 4.0. Nine residues of CYP3A29, Arg105, Arg106, Phe108, Ser119, Lys212,
˚
Phe213, Phe215, Arg372 and Glu374, which were found within 5 A around T-2 toxin were subjected to site-directed
mutagenesis. In the oxidation of nifedipine, the CLint value of R106A was increased by nearly two-folds compared with the
wild-type CYP3A29, while the substrate affinities and CLint values of S119A and K212A were significantly reduced. In the
hydroxylation of T-2 toxin, the generation of 39-OH-T-2 by R105A, S119A and K212A was significantly less than that by the
wild-type, whereas R106A slightly increased the generation of 39-OH-T-2. These results were further confirmed by isothermal
titration calorimetry analysis, suggesting that these four residues are important in the hydroxylation of T-2 toxin and Arg105
may be a specific recognition site for the toxin. Our study suggests a possible structure-function relationship of CYP3A29 in
the hydroxylation of T-2 toxin, providing with new insights into the mechanism of CYP3A enzymes in the biotransformation
of T-2 toxin.
Citation: Cheng G, Liu C, Wang X, Ma H, Pan Y, et al. (2014) Structure-Function Analysis of Porcine Cytochrome P450 3A29 in the Hydroxylation of T-2 Toxin as
Revealed by Docking and Mutagenesis Studies. PLoS ONE 9(9): e106769. doi:10.1371/journal.pone.0106769
Editor: Alexey Porollo, Cincinnati Childrens Hospital Medical Center, United States of America
Received March 14, 2014; Accepted August 8, 2014; Published September 3, 2014
Copyright: ß 2014 Cheng et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its
Supporting Information files.
Funding: This work was supported by the National Natural Science Foundation of China (grant no. 31272614) and the Fundamental Research Funds for the
Central Universities (program no. 2013QC002). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the
manuscript. No additional external funding was received for this study.
Competing Interests: The authors have declared that no competing interests exist.
* Email: yuan5802@mail.hzau.edu.cn
. These authors contributed equally to this work.
metabolites, 39-OH-T-2 and 39-OH-HT-2, were far less cytotoxic
to Reuber hepatoma cells than the parent compound [5]. The
decreasing order of the apoptosis-inducing activity of T-2 toxin
Introduction
T-2 toxin is a fungal sesquiterpenoid metabolite belonging to
the type A trichothecenes, which are widely distributed in corns,
and its metabolites was found to be T-2 toxin.39-OH T-2 toxin.
HT-2 toxin.39-OH HT-2 toxin [6]. When T-2 toxin was
biotransformed into NEO, there was a substantial decrease in
oats and mixed feeds. Feeding with feeds contaminated by these
toxins may lead to growth retard and production decline of
livestock. Trichothecenes can also make animal sick and even
the level of toxic activity [6,7]. De-epoxy T-2 toxin was one-400th
cause death when the situation is serious, posing a potential threat
as toxic as T-2 toxin in a rat skin irritation bioassay [8]. Therefore,
to human health. The toxicity of trichothecenes is most likely a
it is of vital significance to study the metabolism of T-2 toxin for
result of their ability to inhibit protein synthesis and partially
inhibit RNA and DNA synthesis in cells [1].
the prevention of its potential hazard.
It is presently known that carboxylesterases are involved in the
T-2 toxin is metabolized in organisms to form various
metabolites, resulting in detoxification of this toxin. HT-2 toxin,
biotransformation of T-2 toxin into HT-2 toxin, cytochrome
P450s take part in the 39-hydroxylation of isovaleryl group of T-2
toxin, and epoxide hydrolases contribute most in the de-epoxy
metabolism [9]. Previous studies demonstrated that cytochrome
neosolaniol (NEO), 39-OH-T-2, 39-OH-HT-2, T-2 triol, T-2
tetraol, and some de-epoxy products are the common phase I
metabolites of T-2 toxin [2,3]. Biotransformation of T-2 toxin to
P450 3As (CYP3As) were involved in the hydroxylation of T-2
HT-2 toxin in Vero cells and rat spleen lymphocytes resulted in a
reduced inhibition of protein synthesis [4]. The two hydroxylated
toxin in pigs. CYP3A22 and CYP3A46 mainly catalyzed T-2 toxin
to generate 39-OH T-2 [10,11]. Recombinant porcine CYP3A29
PLOS ONE | www.plosone.org
1
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
was able to convert T-2 and HT-2 toxins into 39-OH-T-2 and 39-
OH-HT-2, respectively [12]. Since CYP3A29 is highly expressed
in the livers and small intestines of pigs and serves as the major
CYP3A contributor [13], it can easily draw the conclusion that
CYP3A29 contributes most in the hydroxylation of T-2 toxin
among CYP3As in pigs. However, the catalytic mechanism of
CYP3A29 metabolizing T-2 toxin is still unknown.
The b-nicotinamide adenine dinucleotide phosphate sodium salt
(b-NADP+) was from Roche (Beijing, China). T-2 toxin, Grace’s
insect medium and fetal bovine serum were obtained from
Invitrogen (Carlsbad, CA, USA). Insect GeneJuice Transfection
Reagent was purchased from Merck (KgaA, Darmstadt, Ger-
many). HPLC-grade methanol was purchased from Fisher
Scientific (Waltham, MA, USA). All other chemicals and reagents
commercially available were of the highest analytical grade.
Cytochrome P450s are a superfamily of hemoproteins that play
key roles in the metabolism of a wide variety of xenobiotic and
endogenous compounds [14]. Although there is a wealth of
information from X-ray crystal structures of mammalian P450s,
the deep understanding about how these enzymes recognize a
variety of structurally diverse chemicals is still limited. Among
CYP3A subfamily, only crystal structures of human CYP3A4 have
been resolved. The overall structure of CYP3A4 conforms to the
fold that is characteristic of the P450 superfamily, with a
C-terminal domain that contains the heme and the active site
[15]. The crystal structures of CYP3A4 in complex with or
without ligands demonstrate that the heme iron is ligated by a
conserved cysteine (Cys442) and the propionates of the heme
interact with the side chains of Arg105, Trp126, Arg130, Arg375,
and Arg440 [16,17]. Phe213 and Phe215 point toward the active
site and form a ‘‘Phe-cluster’’ together with other five phenylal-
anines (Phe108, Phe219, Phe220, Phe241, and Phe304), which are
involved in the initial recognition of the substrates [16].
Cells and plasmids
Spodoptera frugiperda (Sf9) cells and baculovirus transfer vector
pFastBac HTb were obtained from BD Gentest (Franklin Lakes,
New Jersey, USA). Esherichia coli DH 5a, E. coli DH10Bac and
pMD 18-T vector were purchased from Takara (Dalian, China).
The plasmids pFastBac1-CYP3A29, pFastBac1-pNPR and pFast-
Bac1-pb5 were previously constructed and stored in our lab [22].
Homology modeling and molecular docking
Amino acid sequence alignment was performed with Clustal X
[23]. The amino acid sequence of CYP3A29 was screened against
the PDB structure database (http://www.rcsb.org/pdb/home/
home.do). From a series of templates, the crystal structure of
ligand-free CYP3A4 (PDB ID: 1tqn) [17], exhibiting the highest
sequence identity of 76% with CYP3A29, was selected as the
modeling template. A three dimensional model of CYP3A29 was
constructed by homology modeling tool Modeller [24]. The model
with the highest score was validated by Procheck [25], which
evaluated the stereochemical quality of a protein structure by
analyzing residue-by-residue geometry and overall structural
geometry.
Since P450 enzymes are highly dynamic and flexible, under-
going large conformational changes to allow substrate access and
product release [18], it may not be necessary to study each
enzyme-ligand interaction by crystallization due to the tedious
procedure. The method of homology modeling and molecular
docking in conjunction with site-directed mutagenesis has been
extensively employed to study the substrate orientation within the
active site of P450 enzyme and to identify potential residues
involved in the positioning and catalytic mechanisms. Some results
between crystallization or mutagenesis studies and modeling and
docking studies were proven in satisfactory agreement [19–21].
In this study, in order to investigate the mechanism of porcine
CYP3A29 in the hydroxylation of T-2 toxin, the homology model
of CYP3A29 was constructed based on the crystal structure of
ligand-free CYP3A4 (PDB ID: 1tqn) [17], which exhibits 76%
amino acid sequence identity with CYP3A29 [22]. Molecular
docking between CYP3A29 model and T-2 toxin molecule was
performed to screen the possible amino acids responsible for the
binding or catalyzing of T-2 toxin, followed by site-directed
mutagenesis and enzymatic activity assay to investigate the
functions of these residues in the hydroxylation of the toxin. It
was demonstrated that Arg105 might be a specific recognition site
of CYP3A29 for T-2 toxin. Besides, Arg106, Ser119 and Lys212
played important roles in the hydroxylation of T-2 toxin and the
oxidation of nifedipine. This study sheds light on a possible
structure-function relationship of porcine CYP3A29 in the
hydroxylation of T-2 toxin, which may provide a deeper
understanding for the metabolism of T-2 toxin in pigs.
The structure model of T-2 toxin, whose energy was minimized
using the molecular mechanics method (MM2), was generated by
ChemDraw (CambridgeSoft, Waltham, MA, USA). The docking
on the monomer model of CYP3A29 with T-2 toxin was
performed using Autodock 4.0 [26], which is based on Lamarckian
Genetic Algorithm (LGA), a hybrid genetic algorithm with local
optimization that uses a parameterized free-energy scoring to
estimate the binding energy. In this docking simulation, semi-
flexible docking protocols were used, in which the target protein
CYP3A29 was kept as rigid. The Kollman charges, solvation
parameters and polar hydrogen were added into the water free
CYP3A29 model for the preparation of protein in docking
simulation. The substrate T-2 toxin was treated as flexible ligand
by modifying their rotatable torsions. The rigid root of the T-2
toxin ligand was defined automatically. All rotatable dihedrals in
the ligand were assigned by Auto-Tors program and were allowed
to rotate freely. AutoGrid 4.0 program was employed for
generating grid maps for the ligands. The grid box was fixed in
the catalytic active region between heme moiety and Ser 119 of
˚
˚
˚
CYP3A29. The box size was set as 60 A660 A660 A to cover the
whole active site and let the ligand rotate freely. The spacing
˚
between grid points was 0.375 A. The LGA was utilized to search
for the best conformer of the ligand. The individual LGA
executions were clustered and ranked to generate the final docking
model, and the potential binding sites were defined as amino acids
Materials and Methods
˚
in distances of less than 5 A to T-2 toxin.
Chemicals
Nifedipine (NIF), oxidized nifedipine (ONIF), glucose
6-phosphate, and anti-human CYP3A4 monoclonal antibody
were purchased from Sigma (St. Louis, MO, USA). The goat anti-
mouse IgG labeled with horseradish peroxidase (HRP) was from
TIANGEN (Beijing, China). Immobilon Western HRP substrate
was obtained from Millipore (Billerica, MA, USA). Bicinchoninic
acid protein kit was purchased from Pierce (Rockford, IL, USA).
Site-directed mutagenesis
Using plasmid pFastBac1-CYP3A29 [22] as template, the
mutants were constructed by one step site-directed mutagenesis
[27] by using the primers shown in Table 1. The constructed
plasmids were sequenced by GenScript (Nanjing, China) and
confirmed to be correct.
PLOS ONE | www.plosone.org
2
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
Table 1. Primers for site-directed mutagenesis.
Primer
Sequence (from 59 to 39 end)
R105A
Fwd: CTGTCTTCACAAACGCGAGGTCTTTTGGTCC
Rev: GGACCAAAAGACCTCGCGTTTGTGAAGACAG
R106A
F108P
S119A
K212A
F213A
F215A
R372A
E374A
Fwd: TATTCTGTCTTCACAAACCGGGCGTCTTTTGGTCCATTG
Rev: CAATGGACCAAAAGACGCCCGGTTTGTGAAGACAGAATA
Fwd: CTTCACAAACCGGAGGTCTGCTGGTCCATTGGGCGCTA
Rev: TAGCGCCCAATGGACCAGCAGACCTCCGGTTTGTGAAG
Fwd: TATGAGAAACGCTCTCGCTCTGGCTGAGGATGAAG
Rev: CTTCATCCTCAGCCAGAGCGAGAGCGTTTCTCATA
Fwd: CCCCTTTGTGGAAAACAGCAAGAAGCTCTTAGCCTTTAGTTTCTTTG
Rev: CAAAGAAACTAAAGGCTAAGAGCTTCTTGCTGTTTTCCACAAAGGGG
Fwd: CCCCTTTGTGGAAAACAGCAAGAAGCTCTTAAAAGCGAGTTTCTTTG
Rev: CAAAGAAACTCGCTTTTAAGAGCTTCTTGCTGTTTTCCACAAAGGGG
Fwd: GCAAGAAGCTCTTAAAATTTAGTGCCTTTGATCCATTCCTTCTCTC
Rev: GAGAGAAGGAATGGATCAAAGGCACTAAATTTTAAGAGCTTCTTGC
Fwd: CCCAATTGCTGCTGCACTTGAGAGGGCCTGTAAG
Rev: CTTACAGGCCCTCTCAAGTGCAGCAGCAATTGGG
Fwd: GCTAGACTTGCGAGGGCCTGTAAGAAGGATG
Rev: CATCCTTCTTACAGGCCCTCGCAAGTCTAGC
Note: The mutated sites are underlined in bold and italic.
doi:10.1371/journal.pone.0106769.t001
Expression of CYP3A29 and its mutants
SDS-PAGE and immunoblot analysis
The empty vector, pFastBac HTb, and the recombinant
vectors, pFastBac1-CYP3A29 [22] (wild-type) and its variants,
were transformed into E. coli DH10Bac cells, respectively. The
positive clones were selected as white color, using 5-bromo-4-
chloro-3-indolyl-b-D-galactopyranoside (X-gal) as the substrate.
The recombinant baculovirus DNA (Bacmid-CYP3A29 or its
mutants) was isolated from E. coli DH10Bac positive clones and
then transfected into Sf9 cells using Insect GeneJuice Transfection
Reagent. The medium containing viruses was collected three to
four days post transfection and stored as virus stock.
The SDS-PAGE was carried out with glycine-Tris buffer system
[32]. The gel was stained with Coomassie brilliant blue G-250. For
immunoblot analysis, microsomal proteins separated by SDS-
PAGE were electro-transferred to a polyvinylidene difluoride
membrane. The blots were developed with the primary antibody
raised against human CYP3A4 (MAb HL3, dilution 1:1000)
followed by the goat anti-mouse IgG labeled with HRP (dilution
1:20000). The individual blots were visualized on X-film using
luminol chemiluminescent reagent of Immobilon Western HRP
substrate.
For each batch of enzyme preparation, Sf9 cells were cultured
to 26107 cells/liter in Grace’s insect medium, and the cells were
infected with recombinant viruses at six times higher concentra-
tion than that under expression conditions. The cells were co-
infected with viruses encoding pNPR (porcine NADPH-P450
reductase) and pb5 (porcine cytochrome b5) as described
previously [22]. The Sf9 cell lines were maintained in flasks
(75 cm2) at 27uC in Grace’s medium containing 10% fetal bovine
serum and 6 mM heme complexes of hemoglobin. The Sf9 cells
were harvest after culturing for 72 h, and the microsomes were
prepared by ultrasonication and differential speed centrifugation
(10,000 and 105,000 g).
The microsomal protein content was determined according to
Lowry et al. [28] using the bicinchoninic acid protein assay
(Pierce). The content of P450 was measured using the carbon
monoxide-difference spectrum [29], the co-expressed pNPR
activity was measured using the cytochrome c reduction assay
[30], and the concentration of co-expressed pb5 was estimated
according to the method described previously [31]. After
quantification, the microsomal proteins were frozen and stored
at 270uC until use.
Assay for enzymatic activity of CYP3A29 and its mutants
NIF oxidation activity was measured as previously described
[22]. The reaction mixture (200 mL) for the assay consisted of NIF
(0,80 mM) as substrate, recombinant CYP3A29 or its mutants
(5 pmol of P450), and the NADPH-generating system (2 mM
NADP, 20 mM glucose 6-phosphate, 2 U/mL glucose 6-phos-
phate dehydrogenase and 5 mM MgCl2) in 50 mM potassium
phosphate buffer (pH 7.4). All incubations were conducted in
triplicate. The reactions were initiated by addition of the NADPH-
generating system after preincubation at 37uC for 5 min. After
incubation at 37uC for 10 min, the reaction was terminated by
addition of 50 mL of ice-cold 15% (w/v) trichloroacetic acid,
followed by centrifugation for 20 min at 10,000 g to precipitate
the proteins. The supernatants were subjected to HPLC analysis.
The HPLC condition was set as previously described [22]. The
formation of ONIF in the reaction mixture was determined based
on calibration curves constructed from a series of standards of
0.01,1 mM ONIF. Intraday (n = 5) and interday (n = 5) precisions
did not exceed 10% in any of the assays. Kinetic parameters for
the oxidation of NIF were calculated by fitting the data to the Hill
equations, v = Vmax [S]n/(Km+[S]n), using nonlinear regression
analysis. Equations were selected by goodness of fit based on R2
PLOS ONE | www.plosone.org
3
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
values and least residual sum of squares. The intrinsic clearance
(CLint) was considered as the ratio of Vmax to Km.
demonstrating that 91.5% of the residues were in the most
favored regions, 6.9% in additional allowed regions, and 0.5% in
generously allowed regions. Overall, the refined model of
CYP3A29 was all well within the acceptable range with high
quality.
Identification and semi-quantitation of T-2 toxin
metabolites
When T-2 toxin was docked into CYP3A29, nine residues,
Arg105, Arg106, Phe108, Ser119, Lys212, Phe213, Phe215,
Arg372 and Glu374, were found to be located in a distance
˚
within 5A to T-2 toxin, among which, Arg105 and Lys212 formed
hydrogen bonds with the toxin molecule (Fig. 1).
The reaction mixture (200 mL) for the assay consisted of 40 mM
of T-2 toxin as substrate, recombinant CYP3A29 or its mutants
(10 pmol of P450), and the NADPH-generating system cited above
in 50 mM Tris-HCl buffer (pH 7.4). All incubations were
conducted in triplicate. The reaction mixture was initiated by
the addition of the NADPH-generating system. The reaction
mixture was maintained at 37uC for 90 min, and the reaction was
terminated by addition of 50 mL of ice-cold 15% (w/v) trichlor-
oacetic acid. Equal volume of ice-cold acetonitrile (100 mL) was
added to terminate the reaction. The mixture was vortexed and
centrifuged at 15,000 g for 15 min. The supernatant was filtered
through a 0.22 mm microbore cellulose membrane, and 10 mL of
aliquot was analyzed by ESI-IT-TOF mass spectrometry coupled
with a high-performance liquid chromatography system (LC/MS-
IT-TOF, Shimadzu, Kyoto, Japan) according to Wu et al [12] to
identify the metabolites. The peak area of hydroxylation products
was used for semi-quantitative analysis.
Heterologous expression of CYP3A29 and its variants in
Sf9 insect cells
The screened nine amino acids, including 4 basic residues
(Arg105, Arg106, Lys212 and Arg372), 1 acidic residue (Glu374),
1 polar residue (Ser119), and 3 phenylalanines (Phe108, Phe213
and Phe215) were respectively replaced with the small non-polar
residue, alanine. Porcine CYP3A29 or its mutants were co-
expressed with pNPR and pb5 in Sf9 insect cells, and about 50
pmol of P450, 200 units of pNPR and 110 pmol of pb5 were
detected per 106 cells. The expression of each CYP3A29 variant,
as presented in the microsomal proteins, was detected by
immunoblot analysis using anti-CYP3A4 antibodies (Fig. S2),
and the molecular mass of each mutant was about 55 kDa, in
consistence with the theoretical molecular mass of CYP3A29 of
57188.7 Da.
Isothermal titration calorimetry (ITC) measurement
Calorimetry pool was filled with CYP3A29 or its mutants (10
pmol of P450) and 1 mM NADPH, and the pool was thermostated
to 37uC and stirred at 502 rpm. After the calorimeter was
balanced for 60 s, 100 mM T-2 toxin was titrated by single drop.
Then the toxin was continuously titrated by 20 drops, each drop
for 10 mL with an interval of 300 s, and the heat and the time were
recorded.
Kinetic analysis of CYP3A29 and its mutants in the
oxidation of nifedipine
As shown in Fig. 2, when NIF was incubated with Sf9
microsomes containing the recombinant CYP3A29, the oxidized
product, ONIF, was generated (Fig. 2C), while no ONIF was
generated when NIF was incubated with the microsomes of Sf9
cells transfected with the empty vector (Fig. 2D) or with
microsomes containing the recombinant CYP3A29 but in the
absence of NADPH-generating system (Fig. 2E), demonstrating
that the heterogeneously expressed CYP3A29 was of biological
The ITC experiment directly measured the thermal power (P).
Each peak represented the thermal effect associated with each
injection. The heat evolved (Q) from each injection was calculated
according to the following formula: P = dQ/dt. The Q generated
by the enzymatic conversion of substrate to product was calculated
as the difference between Q of the enzyme sample and Q of the
dilution buffer.
Statistical analyses
Descriptive statistical parameters such as mean and standard
deviation were calculated using Microsoft Excel 2003. Statistical
analyses were performed with Student’s t-test and Bonferroni
revision, and differences were considered to be statistically
significant when the p-value was ,0.05 or ,0.01.
Results
Homology model of porcine CYP3A29 and docking of T-2
toxin
Amino acid sequence alignment demonstrated that the second
structures and the substrate recognition sites of porcine CYP3A29
(GenBank ID: Z93099), CYP3A22 (GenBank ID: AB006010),
CYP3A46 (GenBank ID: EF625347) and human CYP3A4
(GenBank ID: AF182273) were substantially identical (Fig. S1).
The X-ray crystal structure of CYP3A4 (PDB ID: 1tqn) was
chosen as template since it exhibited highest protein sequence
identity (76%, 382 aa/503 aa) to that of CYP3A29. Among the
five models generated by the MODELER program, the model
with the lowest probability density function (PDF) total energy and
discrete optimized potential energy (DOPE) score was selected and
further refined by energy minimization. The quality of the refined
model was assessed by PROCHECK Ramachandran plot,
Figure 1. The binding pocket of porcine CYP3A29 docked with
T-2 toxin. CYP3A29 interaction residues, Arg105, Arg106, Phe108,
Ser119, Lys212, Phe213, Phe215, Arg372 and Glu374, are in distances
˚
within 5A to T-2 toxin molecule. The T-2 toxin is colored in orange. The
heme is represented in violet color. The green lines and numbers
denote hydrogen bonds and bond lengths.
doi:10.1371/journal.pone.0106769.g001
PLOS ONE | www.plosone.org
4
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
Figure 2. HPLC chromatograms of the metabolite of nifedipine (NIF) catalyzed by recombinant CYP3A29. (A) NIF standard. (B) Oxidized
nifedipine (ONIF) standard. (C) NIF incubated with Sf9 microsomes containing the recombinant CYP3A29 at 37uC for 30 min in the presence of
NADPH-generating system. (D) NIF incubated with Sf9 microsomes free of the recombinant CYP3A29 at 37uC for 30 min in the presence of NADPH-
generating system. (E) NIF incubated with Sf9 microsomes containing the recombinant CYP3A29 at 37uC for 30 min in the absence of NADPH-
generating system.
doi:10.1371/journal.pone.0106769.g002
PLOS ONE | www.plosone.org
5
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
activity. Equal amount (5 pmol of P450 in 200 mL reaction
mixture) of each CYP3A29 variant was used for the subsequent
enzymatic activity assays.
the peak areas of the LC/MS data. As shown in Fig. 4, the yields
of 39-OH-T-2 by R105A (1.48-fold change), S119A (1.37-fold
change) and K212A (1.28-fold change) were decreased signifi-
cantly, while was slightly increased by R106A (1.11-fold change),
compared with the wild-type. The hydroxylation of T-2 toxin by
other mutants had no significant changes.
The kinetic data for the generation of ONIF by wild-type and
each variant CYP3A29 were examined. The relationship between
substrate concentration and reaction velocity is shown in Fig. S3,
and the Vmax and Km values are listed in Table 2. The Vmax/Km
values, representing intrinsic clearance (CLint), were calculated and
compared between wild-type CYP3A29 (Vmax, 8.5360.69 nmol/
The above four mutants affecting the metabolism of T-2 toxin
were further confirmed by ITC measurement. As shown in Fig. 5,
the thermal powers of R105A, S119A and K212A in the
metabolism of T-2 toxin were significantly reduced compared
with the wild-type, while the thermal power of R106A was
increased slightly. Heat evolved (Qenzyme-Qdilution) from the
metabolism of T-2 toxin by R105A, S119A and K212A also
changed significantly. The heats evolved by R105A (9.35 mJ,
3.59-fold change), S119A (15.18 mJ, 2.21-fold change) and
K212A (19.31 mJ, 1.74-fold change) were decreased significantly
compared with the wild-type (33.54 mJ). The heat evolved by
R106A (36.16 mJ, 1.08-fold change) was slightly increased
compared with that of the wild-type. Since the ITC measured
the total heat produced by the enzymatic reaction, the ITC data
manifested the biotransformation of T-2 toxin to both 39-OH-T-2
and NEO. The NEO formation (hydrolysis of the C8-isovaleryloxy
ester of T-2 toxin) was a heat absorbed reaction but not a major
reaction catalyzed by CYP3A29, thus the fold changes of these
four residues were different between the ITC data and the LC/
MS data but with a similar tendency.
min/nmol P450; Km, 15.6862.96 mmol/L; CLint
,
0.546
0.03 mL/nmol P450/min) and each mutant. The Vmax of
S119A was slightly increased (11.0360.85 nmol/min/nmol
P450) compared with the wild-type, but the Km value
(24.1563.68 mmol/L) was predominantly increased by nearly
1.6 folds, resulting in
a weak decrease of CLint value
(0.4560.01 mL/nmol P450/min). Similarly, K212A also exhibit-
ed a higher Km (21.7161.83 mmol/L) and a lower CLint
(0.4660.03 mL/nmol P450/min). In contrast, the NIF oxidation
activity of CYP3A29 was significantly increased by replacing
Arg106 with Ala. R106A exhibited a slight increase in Vmax
(9.8660.37 nmol/min/nmol P450), a notable decrease in Km
(10.6360.93 mmol/L), and accordingly the CLint (0.9360.02 mL/
nmol P450/min) was nearly twice as much as that of the wild-type.
No statistically significant differences were identified in other
mutants.
Metabolizing of T-2 toxin by CYP3A29 and its mutants
Previous study demonstrated that 39-OH-T-2 and NEO were
detected as the metabolites of T-2 toxin when incubating with
recombinant pig CYP3A29 [12]. Similarly, T-2 toxin was shown
in this study to be metabolized to 39-OH-T-2 and NEO by the Sf9
microsomes containing recombinant CYP3A29 (Fig. 3) or its
mutants (Fig. S4), while nearly no 39-OH-T-2 or NEO was found
by the microsomes containing no expressed recombinant
CYP3A29 (vector control). The relative amount of 39-OH-T-2
was much higher than that of NEO (Fig. 3 and Fig. S4), suggesting
that the hydroxylated metabolite was the major metabolite.
Unfortunately, there was no 39-OH-T-2 standard compound
and the yield of 39-OH-T-2 could not be calculated by the
substrate disappearance due to that the biotransformation of T-2
toxin by CYP3A29 did not result in only one metabolite (i.e. 39-
OH-T-2). Therefore, the production of 39-OH-T-2 by CYP3A29
or its mutants was semi-quantitated and compared according to
Discussion
This study demonstrates that porcine CYP3A29 is able to
metabolize T-2 toxin to form 39-OH-T-2 and NEO, implying that
CYP3A29 is involved in the hydroxylation of the isovaleryl group
and the hydrolysis of the C8-isovaleryloxy ester of T-2 toxin.
These two biotransformation processes make T-2 toxin more polar
and water-soluble to exclude from the body. Hydroxylation and
hydrolysis metabolism of T-2 toxin are thought to reduce the toxic
effects of the toxin [5,33], therefore, CYP3A29 is very important
in the detoxification of T-2 toxin. Similarly, previous studies
demonstrated that T-2 toxin could be metabolized to 39-OH-T-2
by porcine CYP3A22 and CYP3A46 [10,11], but those studies did
not test the carboxylesterase activity (hydrolysis of the ester bond)
of porcine CYP3As for T-2 toxin. It is reported that human
CYP3A4 can mediate the hydrolysis of the ester bond [34,35],
Table 2. Enzyme kinetic parameters of recombinant CYP3A29 and its mutants oxidizing nifedipine.
Enzymes
SRS
Vmax (nmol/min/nmol P450)
Km (mmol/L)
CLint (mL/nmol P450/min)
n
Wild-type
R105A
R106A
F108A
S119A
K212A
F213A
F215A
R372A
E374A
8.5360.69
8.4260.71
9.8660.37*
7.5460.57
11.0360.85*
10.0260.89
8.4560.61
9.4661.03
8.5860.78
8.4860.72
15.6862.96
14.6063.07
10.6360.93*
13.4362.37
24.1563.68*
21.7161.83*
14.5062.45
17.6764.45
15.8863.60
17.0563.08
0.5460.03
0.5860.07
0.9360.02**
0.5660.03
0.4560.01**
0.4660.03*
0.5860.04
0.5360.08
0.5460.05
0.5060.05
1.10
1.09
1.34
1.26
1.41
1.48
1.25
1.18
1.07
1.41
SRS1
SRS1
SRS1
SRS1
SRS5
SRS5
Note: The values are expressed as means 6 standard deviations of the results of three independent experiments. n indicates the Hill coefficients.
**(p,0.01) and *(p,0.05) indicate statistically significant difference between the wild-type and the mutant.
doi:10.1371/journal.pone.0106769.t002
PLOS ONE | www.plosone.org
6
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
Figure 3. Identification of the metabolites of T-2 toxin after incubation with recombinant CYP3A29. (A) Accurate extracted ion
chromatograms of the metabolites of T-2 toxin after incubation with CYP3A29. (B) Accurate MS spectrum of 39-OH-T-2. (C) Accurate MS spectrum of
NEO. (D) Structural illustration of the metabolites of T-2 toxin metabolized by CYP3A29.
doi:10.1371/journal.pone.0106769.g003
reaction was quite weak. Conclusively, porcine CYP3As play a
vital role in the hydroxylation of T-2 toxin in pigs.
Although the homology model of porcine CYP3A29 is very
similar to the crystal structure of human CYP3A4, CYP3A29 has
a relatively lower NIF oxidase activity than CYP3A4 [22]. The
most distinct differences in the amino acid sequences of these two
inferring that human CYP3A4 and porcine CYP3A29 are
orthologous proteins. Based on the metabolic study of T-2 toxin
in pigs, the metabolic process of T-2 toxin in the human body can
be speculated. Nevertheless, the hydroxylation of T-2 toxin was
the main reaction catalyzed by CYP3A29, and the hydrolysis
PLOS ONE | www.plosone.org
7
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
Figure 4. The peak area of the mass spectra of 39-OH-T-2 generated by CYP3A29 metabolizing T-2 toxin. The data were expressed as
means 6 standard deviations (error bars) (n = 3). **(p,0.01) and *(p,0.05) indicate statistically significant difference between the wild-type CYP3A29
and each mutant.
doi:10.1371/journal.pone.0106769.g004
enzymes were found to be located in the helices F–G region
(Fig. S1), and this region was considered important in determi-
nation of the substrate specificity of CYP3As [36]. In CYP3A4,
Leu210 is implicated in the effector binding as well as the stereo-
and regio-selectivity profile and both Leu211 and Asp214 are
implicated in the cooperativity of the enzyme [37,38]. Further-
more, a variety of studies have concentrated upon the ability of
CYP3A4 to accommodate more than one substrate molecule
simultaneously and the resultant activation/enhancer effects [38–
41]. It is also reported that CYP3A29 displays ligand binding that
does not follow the Michaelis-Menten kinetics, but in the
sigmoidal or autoactivation kinetic behaviors with Hill coefficients
(n) .1 [22]. Sigmoidal kinetics can be interpreted by the allosteric
effect hypothesis. CYP3As usually undergo dramatic conforma-
tional changes upon ligand binding with an increasing volume in
the active site, which could enhance the adaptability of enzyme to
the ligands [42]. In this study, the mutants of CYP3A29 displayed
different Hill coefficients in the oxidation of NIF, but all with n.1
(Table 2 and Fig. S3). The Hill coefficients of R106A (n = 1.34),
S119A (n = 1.41), K212A (n = 1.48) and E374A (n = 1.41) were
increased significantly compared with the wild-type (n = 1.10),
indicating that these mutations enlarged the volume of the active
site.
the charge was eliminated, thus NIF might be more easily to get
into the active center. In contrast, S119A substitution weakened
the ability of CYP3A29 metabolizing NIF, with higher Km thus
lower CLint. Ser119 is conservative among CYP3A subfamily
members. Studies show that Ser119 of CYP3A4 has a major
impact on the substrate stereoselectivity [43,44], therefore, S119A
substitution may affect the orientation of NIF in the active center
of the enzyme, thus affect its oxidation. Similarly, K212A also
exhibited a higher Km and a lower CLint. Helices F-G are
important for the substrate specificity of CYP3As [36]. This region
is recognized to adopt different conformations dependent on the
presence of different ligands. It was shown that broad substrate
specificity of CYP3A4 stemed from the malleability of the F–F’
loop (residues 211–218, between helix F and F’) that resided in the
vicinity of the channel connecting the active site and bulk solvent
[45]. Arg212, located in this loop, was found in the active site in a
ligand-free structure of CYP3A4, but moved towards the surface
of the enzyme in the ketoconazole-CYP3A4 complex [42].
Therefore, K212A substitution might affect the transportation of
NIF to the active center of CYP3A29.
In the hydroxylation of T-2 toxin by CYP3A29, since there was
no standard compound of 39-OH-T-2, only semi-quantitative
assay was done by using LC/MS. R105A, S119A and K212A
substitutions significantly reduced the generation of the hydrox-
ylation product, 39-OH-T-2, while R106A substitution slightly
increased the hydroxylation rate (Fig. 4). This result was further
confirmed by the isothermal titration calorimeter analysis based on
the heat evolved produced by CYP3A29 and its mutants (Fig. 5).
According to the results of molecular docking, T-2 toxin form
hydrogen bonds with Arg105 and Lys212 in CYP3A29. Hydrogen
In the metabolism of NIF, among the amino acids determined
by docking T-2 toxin into CYP3A29, R106A exhibited an
increased Vmax and a reduced Km, resulting in that the metabolic
capacity of R106A improved significantly by nearly two-fold
compared with that of the wild-type. Arg106 is located in SRS1
(SRS, substrate recognition site), when it was mutated into the
small residue, alanine, the steric hinderance was reduced as well as
PLOS ONE | www.plosone.org
8
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
Figure 5. The thermogram of CYP3A29 and its mutants metabolizing T-2 toxin.
doi:10.1371/journal.pone.0106769.g005
bonding, electrostatic interaction, and p-p-conjugated contribute
to the orientation of the substrate in the active center [46–48].
Mutation at these two sites might destroy the formation of
hydrogen bonds between T-2 toxin and CYP3A29, influencing the
orientation of the toxin molecule in the active-site cavity of the
enzyme, thus the yields of 39-OH-T-2 by R105A or K212A were
much lower than that by the wild-type. In addition, S119A also
exhibited a weaker metabolic capacity in the hydroxylation of T-2
toxin, and Ser119 might affect the orientation of T-2 toxin in the
active center as in the case of NIF oxidation. Compared with the
wild-type, the catalytic capability of R106A in the metabolism of
NIF was increased more obviously than in the metabolism of T-2
toxin (Table 2 and Fig. 4). This may be due to the different kinetic
characteristics of the enzyme for these two different substrates.
The oxidation of NIF by CYP3A29 followed an auto-activation
kinetic behavior as discussed above and R106A substitution might
make the substrate access the active center more easily, while the
metabolism of T-2 toxin by CYP3A29 was likely to be a
PLOS ONE | www.plosone.org
9
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
hyperbolic saturation kinetics process. Combining the results of
CYP3A29 metabolizing NIF and T-2 toxin, it can be speculated
that Arg105, Arg106, Ser119 and Lys212 of CYP3A29 are crucial
to the substrate positioning and binding. Furthermore, since
R105A substitution did not influence the oxidation of NIF, Arg105
might be a unique recognition site of CYP3A29 for T-2 toxin.
Other sites, including Phe108, Phe213, Phe215, Arg372 and
Glu374 did not show significant impact on the metabolism of NIF
or T-2 toxin. Previous studies showed that Phe108, Phe213 and
Phe215 formed the ‘‘Phe-cluster’’ on the ceiling of the active-site
cavity of CYP3A4 [15]. When binding large substrates, phenyl-
alanine residues in the ‘‘Phe-cluster’’ were repositioned, resulting
in an extension of helix F and a larger active site [16,42].
However, F108A, F213A and F215A substitutions did not change
the metabolic capacity for either NIF or T-2 toxin in our study.
Correspondingly, the Hill coefficients of these mutants didn’t alter
much when compared with that of the wild-type (Table 2). This
may be due to the small molecular sizes of the NIF (Mr 346.34)
and T-2 toxin (Mr 466.53), which might not cause great
conformation changes in the active center of CYP3A29, thus
mutation of ‘‘Phe-cluster’’ did not influence the metabolism of
these two substrates. This is in consistence with the case of
progesterone (Mr 314.47), which induced very little conforma-
tional change in CYP3A4 [16]. R372A and E374A, although
located in SRS5, did not have significant impact on the metabolic
capability either, suggesting they are not the functional sites of
CYP3A29 for metabolizing NIF or T-2 toxin.
(red) are indicated by letters, and b-sheets (blue) are indicated by
numbers above the sequences. The substrate recognition sites
(SRSs) are indicated by pane (pink). Mutated sites are marked with
fresh green.
(TIF)
Figure S2 Immunoblot analysis of recombinant CYP3A29 and
its mutants. Microsomal proteins from Sf9 cells expressing R105A,
R106A, F108A, S119A, K212A, F213A, F215A, R372A and
E374A (from lanes 1 to 9) were subjected to SDS-PAGE. After
electrophoresis, the proteins were transferred to a polyvinylidene
fluoride membrane and probed with anti-human CYP3A4
immunoglobulin as described in Materials and Methods. Arrow
indicates CYP3A29 and its mutants. M, protein molecular mass
standard.
(TIF)
Figure S3 Nifedipine oxidation kinetics of recombinant
CYP3A29 and its mutants. Nifedipine at concentration of 0, 2,
4, 8, 1, 20, 40, 60 and 80 mM were respectively incubated with 25
pmol CYP3A29 or its mutants at 37uC for 10 min as described in
Materials and Methods. The Hill equation (v = Vmax [S]n/(Km+
[S]n)) was fitted by the data points. The solid red lines through the
experimental data showed the best fits for the non-linear
regression analysis using the Hill equation for sigmoidal kinetics.
The standard deviations of three replicates did not exceed 10% of
the mean values.
(TIF)
In conclusion, our study revealed that Arg105, Arg106, Ser119,
Lys212 might be important to the function of CYP3A29 in the
metabolism of NIF or T-2 toxin, and Arg105 might be a unique
binding site of CYP3A29 for T-2 toxin. These findings provide a
possible interpretation for the structure-function relationship of
CYP3A29 in the hydroxylation of T-2 toxin, giving a deeper
understanding of the metabolic processes of T-2 toxin by
cytochrome P450s. Since the hydroxylation and hydrolysis of
T-2 toxin by CYP3A29 are detoxification reactions, CYP3A29
could be used as a detoxification enzyme. Moreover, our study
indicates a protein engineering direction for this detoxification
enzyme in the future, which may improve the efficiency of the
prevention of T-2 toxin mediated hazard.
Figure S4 Accurate extracted ion chromatograms of the
metabolites of T-2 toxin after incubation with recombinant
CYP3A29 or its mutants. The CYP3A29 mutants include
R105A, R106A, F108A, S119A, K212A, F213A, F215A, R372A
and E374A.
(DOC)
Author Contributions
Conceived and designed the experiments: GC CL ZY. Performed the
experiments: GC CL. Analyzed the data: GC CL XW HH. Contributed
reagents/materials/analysis tools: HM YP LH MD ZY. Contributed to the
writing of the manuscript: GC CL. Edited and revised the manuscript: GC
XW ZY.
Supporting Information
Figure S1 Amino acid sequence alignment of porcine
CYP3A29, CYP3A22, CYP3A46 and human CYP3A4. Helices
References
1. Wu Q , Dohnal V, Kuca K, Yuan Z (2013) Trichothecenes: structure-toxic
activity relationships. Curr Drug Metab 14: 641–660.
9. He J, Zhou T, Young J, Boland G, Scott P (2010) Chemical and biological
transformations for detoxification of trichothecene mycotoxins in human and
animal food chains: A review. Trends in Food Sci Technol 21: 67–76.
10. Wang J, Jiang J, Zhang H, Wang J, Cai H, et al. (2011) Integrated
transcriptional and proteomic analysis with in vitro biochemical assay reveal
the important role of CYP3A46 in T-2 toxin hydroxylation in porcine primary
hepatocytes. Mol Cell Proteomics 10: M111 008748.
2. Wu Q , Dohnal V, Huang L, Kuca K, Yuan Z (2010) Metabolic pathways of
trichothecenes. Drug Metab Rev 42: 250–267.
3. Dohnal V, Jezkova A, Jun D, Kuca K (2008) Metabolic pathways of T-2 toxin.
Curr Drug Metab 9: 77–82.
4. Thompson WL, Wannemacher RW Jr (1986) Structure-function relationships of
12,13-epoxytrichothecene mycotoxins in cell culture: comparison to whole
animal lethality. Toxicon 24: 985–994.
11. Ge X, Wang J, Liu J, Jiang J, Lin H, et al. (2010) The catalytic activity of
cytochrome P450 3A22 is critical for the metabolism of T-2 toxin in porcine
reservoirs. Catalysis Communications 12: 71–75.
5. Kobayashi J, Horikoshi T, Ryu JC, Tashiro F, Ishii K, et al. (1987) The
cytochrome P-450-dependent hydroxylation of T-2 toxin in various animal
species. Food Chem Toxicol 25: 539–544.
12. Wu Q , Huang L, Liu Z, Yao M, Wang Y, et al. (2011) A comparison of hepatic
in vitro metabolism of T-2 toxin in rats, pigs, chickens, and carp. Xenobiotica
41: 863–873.
6. Islam Z, Nagase M, Ota A, Ueda S, Yoshizawa T, et al. (1998) Structure-
function relationship of T-2 toxin and its metabolites in inducing thymic
apoptosis in vivo in mice. Biosci Biotechnol Biochem 62: 1492–1497.
7. Anderson DW, Black RM, Lee CG, Pottage C, Rickard RL, et al. (1989)
Structure-activity studies of trichothecenes: cytotoxicity of analogues and
reaction products derived from T-2 toxin and neosolaniol. J Med Chem 32:
555–562.
13. Yao M, Dai M, Liu Z, Cui W, Li D, et al. (2012) mRNA expression profiles of
P450 3A enzymes in the liver and small intestine of the domestic pig. Res Vet Sci
93: 360–365.
14. Guengerich FP, Wu ZL, Bartleson CJ (2005) Function of human cytochrome
P450s: characterization of the orphans. Biochem Biophys Res Commun 338:
465–469.
8. Swanson SP, Helaszek C, Buck WB, Rood HD Jr, Haschek WM (1988) The role
of intestinal microflora in the metabolism of trichothecene mycotoxins. Food
Chem Toxicol 26: 823–829.
15. Scott EE, Halpert JR (2005) Structures of cytochrome P450 3A4. Trends
Biochem Sci 30: 5–7.
PLOS ONE | www.plosone.org
10
September 2014 | Volume 9 | Issue 9 | e106769

Hydroxylation of T-2 Toxin by Porcine CYP3A29
16. Williams PA, Cosme J, Vinkovic DM, Ward A, Angove HC, et al. (2004) Crystal
structures of human cytochrome P450 3A4 bound to metyrapone and
progesterone. Science 305: 683–686.
17. Yano JK, Wester MR, Schoch GA, Griffin KJ, Stout CD, et al. (2004) The
structure of human microsomal cytochrome P450 3A4 determined by X-ray
crystallography to 2.05-A resolution. J Biol Chem 279: 38091–38094.
18. Li H, Poulos TL (2004) Crystallization of cytochromes P450 and substrate-
enzyme interactions. Curr Top Med Chem 4: 1789–1802.
34. Zhang D, Ly VT, Lago M, Tian Y, Gan J, et al. (2009) CYP3A4-mediated ester
cleavage as the major metabolic pathway of the oral taxane 39-tert-butyl-39-N-
tert-butyloxycarbonyl-4-deacetyl-39-dephenyl-39-N-debenzoyl-4-O-methoxycar-
bonyl-paclitaxel (BMS-275183). Drug Metab Dispos 37: 710–718.
35. Yang D, Wang X, Chen YT, Deng R, Yan B (2009) Pyrethroid insecticides:
isoform-dependent hydrolysis, induction of cytochrome P450 3A4 and evidence
on the involvement of the pregnane X receptor. Toxicol Appl Pharmacol 237:
49–58.
19. Lewis DFV, Ito Y, Goldfarb PS (2005) Cytochrome P450 structures and their
substrate interactions. Drug Develop Res 66: 19–24.
20. Zhao C, Gao Q , Roberts AG, Shaffer SA, Doneanu CE, et al. (2012) Cross-
linking mass spectrometry and mutagenesis confirm the functional importance of
surface interactions between CYP3A4 and holo/apo cytochrome b(5).
Biochemistry 51: 9488–9500.
21. Moore CD, Shahrokh K, Sontum SF, Cheatham TE 3rd, Yost GS (2010)
Improved cytochrome P450 3A4 molecular models accurately predict the
Phe215 requirement for raloxifene dehydrogenation selectivity. Biochemistry 49:
9011–9019.
22. Yao M, Dai M, Liu Z, Huang L, Chen D, et al. (2011) Comparison of the
substrate kinetics of pig CYP3A29 with pig liver microsomes and human
CYP3A4. Biosci Rep 31: 211–220.
36. Torimoto N, Ishii I, Toyama K, Hata M, Tanaka K, et al. (2007) Helices F-G
are important for the substrate specificities of CYP3A7. Drug Metab Dispos 35:
484–492.
37. Harlow GR, Halpert JR (1997) Alanine-scanning mutagenesis of a putative
substrate recognition site in human cytochrome P450 3A4. Role of residues 210
and 211 in flavonoid activation and substrate specificity. J Biol Chem 272:
5396–5402.
38. Harlow GR, Halpert JR (1998) Analysis of human cytochrome P450 3A4
cooperativity: construction and characterization of a site-directed mutant that
displays hyperbolic steroid hydroxylation kinetics. Proc Natl Acad Sci U S A 95:
6636–6641.
39. Domanski TL, He YA, Harlow GR, Halpert JR (2000) Dual role of human
cytochrome P450 3A4 residue Phe-304 in substrate specificity and cooperativity.
J Pharmacol Exp Ther 293: 585–591.
23. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, et al. (2003) Multiple
sequence alignment with the Clustal series of programs. Nucleic Acids Res 31:
3497–3500.
24. Sali A, Blundell TL (1993) Comparative protein modelling by satisfaction of
spatial restraints. J Mol Biol 234: 779–815.
40. Fowler SM, Riley RJ, Pritchard MP, Sutcliffe MJ, Friedberg T, et al. (2000)
Amino acid 305 determines catalytic center accessibility in CYP3A4.
Biochemistry 39: 4406–4414.
41. Wang H, Dick R, Yin H, Licad-Coles E, Kroetz DL, et al. (1998) Structure-
function relationships of human liver cytochromes P450 3A: aflatoxin B1
metabolism as a probe. Biochemistry 37: 12536–12545.
25. Laskowski RA, Rullmannn JA, MacArthur MW, Kaptein R, Thornton JM
(1996) AQUA and PROCHECK-NMR: programs for checking the quality of
protein structures solved by NMR. J Biomol NMR 8: 477–486.
26. Morris GM, Huey R, Lindstrom W, Sanner MF, Belew RK, et al. (2009)
AutoDock4 and AutoDockTools4: Automated docking with selective receptor
flexibility. J Comput Chem 30: 2785–2791.
27. Zheng L, Baumann U, Reymond JL (2004) An efficient one-step site-directed
and site-saturation mutagenesis protocol. Nucleic Acids Res 32: e115.
28. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement
with the Folin phenol reagent. J Biol Chem 193: 265–275.
29. Omura T, Sato R (1964) The Carbon Monoxide-Binding Pigment of Liver
Microsomes. I. Evidence for Its Hemoprotein Nature. J Biol Chem 239: 2370–
2378.
30. Strobel HW, Dignam JD (1978) Purification and properties of NADPH-
cytochrome P-450 reductase. Methods Enzymol 52: 89–96.
31. Holmans PL, Shet MS, Martin-Wixtrom CA, Fisher CW, Estabrook RW (1994)
The high-level expression in Escherichia coli of the membrane-bound form of
human and rat cytochrome b5 and studies on their mechanism of function. Arch
Biochem Biophys 312: 554–565.
32. King J, Laemmli UK (1971) Polypeptides of the tail fibres of bacteriophage T4.
J Mol Biol 62: 465–477.
33. Konigs M, Mulac D, Schwerdt G, Gekle M, Humpf HU (2009) Metabolism and
cytotoxic effects of T-2 toxin and its metabolites on human cells in primary
culture. Toxicology 258: 106–115.
42. Ekroos M, Sjogren
T (2006) Structural basis for ligand promiscuity in
cytochrome P450 3A4. Proc Natl Acad Sci U S A 103: 13682–13687.
43. He YA, Roussel F, Halpert JR (2003) Analysis of homotropic and heterotropic
cooperativity of diazepam oxidation by CYP3A4 using site-directed mutagenesis
and kinetic modeling. Arch Biochem Biophys 409: 92–101.
44. Khan KK, Halpert JR (2000) Structure-function analysis of human cytochrome
P450 3A4 using 7-alkoxycoumarins as active-site probes. Arch Biochem Biophys
373: 335–345.
45. Park H, Lee S, Suh J (2005) Structural and dynamical basis of broad substrate
specificity, catalytic mechanism, and inhibition of cytochrome P450 3A4. J Am
Chem Soc 127: 13634–13642.
46. Kirton SB, Murray CW, Verdonk ML, Taylor RD (2005) Prediction of binding
modes for ligands in the cytochromes P450 and other heme-containing proteins.
Proteins 58: 836–844.
47. Lewis DF, Jacobs MN, Dickins M (2004) Compound lipophilicity for substrate
binding to human P450s in drug metabolism. Drug Discov Today 9: 530–537.
48. Wang JF, Wei DQ , Li L, Zheng SY, Li YX, et al. (2007) 3D structure modeling
of cytochrome P450 2C19 and its implication for personalized drug design.
Biochem Biophys Res Commun 355: 513–519.
PLOS ONE | www.plosone.org
11
September 2014 | Volume 9 | Issue 9 | e106769