Cytoplasmic delivery of functional siRNA using pH-Responsive nanoscale hydrogels

Article abstract of DOI:10.1016/j.ijpharm.2019.03.013

The progress of short interfering RNA (siRNA) technologies has unlocked the development of novel alternatives for the treatment of a myriad of diseases, including viral infections, autoimmune disorders, or cancer. Nevertheless, the clinical use of these therapies faces significant challenges, mainly overcoming the charged and large nature of these molecules to effectively enter the cell. In this work, we developed a cationic polymer nanoparticle system that is able to load siRNA due to electrostatic interactions. The pH-responsiveness and membrane-disrupting ability of these carriers make them suitable intracellular delivery vehicles. In the work presented herein we synthesized, characterized, and evaluated the properties of nanoparticles based on 2-diethylaminoethyl methacrylate and tert-butyl methacrylate copolymers. A disulfide crosslinker was incorporated in the nanogels to enable the degradation of the nanoparticles in reductive environments, showing no significant changes on their physicochemical properties. The capability of the developed nanogels to be internalized, deliver siRNA, and induce gene knockdown were demonstrated using a human epithelial colorectal adenocarcinoma cell line. Overall, these findings suggest that this platform exhibits desirable characteristics as a potential siRNA-delivery platform.

Full text of DOI:10.1016/j.ijpharm.2019.03.013

Accepted Manuscript
Cytoplasmic Delivery of Functional siRNA Using pH-Responsive Nanoscale
Hydrogels
William B. Liechty, Rebekah L. Scheuerle, Julia E. Vela Ramirez, Nicholas A.
Peppas
PII:
S0378-5173(19)30191-7
https://doi.org/10.1016/j.ijpharm.2019.03.013
IJP 18197
DOI:
Reference:
International Journal of Pharmaceutics
To appear in:
Received Date:
Revised Date:
Accepted Date:
9 January 2019
4 March 2019
6 March 2019
Please cite this article as: W.B. Liechty, R.L. Scheuerle, E.V. Ramirez, N.A. Peppas, Cytoplasmic Delivery of
Functional siRNA Using pH-Responsive Nanoscale Hydrogels, International Journal of Pharmaceutics (2019),
doi: https://doi.org/10.1016/j.ijpharm.2019.03.013
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Cytoplasmic Delivery of Functional siRNA Using pH-Responsive Nanoscale
Hydrogels
William B. Liechtya, Rebekah L. Scheuerlea,
Julia E. Vela Ramirez*a,b,c, and Nicholas A. Peppas*a,b,c,d,e
a McKetta Department of Chemical Engineering, The University of Texas at Austin, Austin, TX
78712, USA
b Department of Biomedical Engineering, The University of Texas at Austin, Austin, TX 78712,
USA
c Institute for Biomaterials, Drug Delivery, and Regenerative Medicine, The University of Texas
at Austin, Austin, TX 78712, USA
d Department of Surgery and Perioperative Care, Dell Medical School, The University of Texas
at Austin, Austin, TX 78712, USA
e Division of Molecular Pharmaceutics and Drug Delivery, College of Pharmacy, The University of
Texas at Austin, Austin, Texas 78712, USA
Submitted to the International Journal of Pharmaceutics
Keywords: cationic, polymer, nanoparticles, drug delivery, intracellular, siRNA
* To whom all correspondence should be addressed
BME 3.503C, 107 W. Dean Keeton, BME Building, 1 University Station, C0800, Austin, TX
78712
Phone: (512) 471-6644; email: jvela87@utexas.edu, peppas@che.utexas.edu
1

ABSTRACT
The progress of short interfering RNA (siRNA) technologies has unlocked the
development of novel alternatives for the treatment of a myriad of diseases, including viral
infections, autoimmune disorders, or cancer. Nevertheless, the clinical use of these therapies faces
significant challenges, mainly overcoming the charged and large nature of these molecules to
effectively enter the cell. In this work, we developed a cationic polymer nanoparticle system that
is able to load siRNA due to electrostatic interactions. The pH-responsiveness and membrane-
disrupting ability of these carriers make them suitable intracellular delivery vehicles. In the work
presented herein we synthesized, characterized, and evaluated the properties of nanoparticles based
on 2-diethylaminoethyl methacrylate and tert-butyl methacrylate copolymers. A disulfide
crosslinker was incorporated in the nanogels to enable the degradation of the nanoparticles in
reductive environments, showing no significant changes on their physicochemical properties. The
capability of the developed nanogels to be internalized, deliver siRNA, and induce gene
knockdown were demonstrated using a human epithelial colorectal adenocarcinoma cell line.
Overall, these findings suggest that this platform exhibits desirable characteristics as a potential
siRNA-delivery platform.
2

1. INTRODUCTION
The discovery of RNA interference (RNAi) has prompted an enormous research effort in
all fields of biological science and our understanding of gene regulation mechanisms has
increased.(Fire et al., 1998) In principle, RNAi mediated by siRNA could be used as a powerful
and versatile treatment modality to treat nearly any disease resulting from aberrant gene
expression. As with many biotherapeutics, efficient delivery has been implicated as the major
hurdle to its widespread clinical application.(Whitehead et al., 2009)
Several materials-based strategies have been developed to circumvent the challenges
associated with cytoplasmic delivery of siRNA. The most common classes of materials are lipids
and lipidoids, polycationic polymers, and siRNA conjugates.(Whitehead et al., 2009) Lipids are
perhaps the most widely studied class of materials for siRNA delivery and lipid-based formulations
for RNAi have progressed to the clinic in greater number than other delivery systems.(Siegwart et
al., 2011)
The first evidence of RNAi in humans was demonstrated using polycationic cyclodextrin
nanoparticles.(Davis et al., 2010) However, alternative strategies have emerged to enable siRNA
delivery to target cells and tissues. Khormaee et al.(Khormaee et al., 2012) reported the use of a
membrane-disruptive anionic pseudo-peptide to deliver siRNA in vivo. Polysaccharides from
yeast cell walls have been used to deliver inflammation-suppressing siRNA via oral
administration.(Aouadi et al., 2009)
Amine-containing methacrylates, such as 2-(diethylaminoethyl) methacrylate (DEAMA)
(Tamura et al., 2009)and 2-(dimethylaminoethyl) methacrylate (DMAEMA)(Convertine et al.,
2009), are attractive foundations for polymeric nucleic-acid-delivery systems because of their
ability to form cooperative electrostatic interactions with polyanionic siRNA. In our previous
work, we explored the aqueous solution properties, membrane-disruptive properties, and
3

internalization mechanisms of pH-responsive nanoscale hydrogels (nanogels).(Liechty et al.,
2018)
As we have shown before (Fisher et al., 2008; Forbes and Peppas, 2012, 2014a, b;
Hariharan and Peppas, 1996; Liechty et al., 2011), that we have found our most promising
nanoparticle platform for siRNA delivery consists of a (1) ionizable core of 2-(diethylaminoethyl
methacrylate) (DEAEMA), (2) the hydrophobic comonomer of tert-butyl methacrylate (TBMA),
and (3) a grafted corona of poly(ethylene glycol) tethers. The polymer was synthesized using 30
mol of TBMA per 100 mol DEAEMA. The resulting nanogel (named PDETB30) undergoes a
volume phase transition from collapsed hydrophobe to swollen hydrophile at approximately pH
6.5 and is highly disruptive to model membrane systems in this transition region.(Liechty et al.,
2018) Additionally, PDETB30 displays excellent biocompatibility with Caco-2 and RAW 264.7
cells as evaluated using in vitro toxicity assays.(Liechty et al., 2013)
However, intracellular delivery systems require the incorporation of mechanisms that
allow the release of the payload inside the cell under specific conditions.(Antimisiaris et al., 2017;
Knipe et al., 2015; Knipe et al., 2016; Wagner, 2012) Disulfide linkers can be cleaved by the
reductive tripeptide glutathione (GSH); present at intracellular concentrations of 1 - 11
mM.(Winter et al., 2006) By incorporating these linkers into polycationic nanogels, degradability
can be imparted to the network while retaining their mechanical integrity and pH-responsive
behavior. In this work, we concentrate on the synthesis and characterization of nanogels with
reducible disulfide crosslinks and discuss studies showing their suitability as siRNA carriers in
comparison to non-degradable PDETB30 nanogels.
4

2. MATERIALS AND METHODS
2.1 Synthesis of disulfide crosslinker
Dichloromethane (>99.5%) was purchased from Fisher Scientific (Plainfield, NJ).
Methacryloyl chloride (97%) and anhydrous pyridine (99.8%) were purchased from Sigma-
Aldrich (St. Louis, MO). 2-Hydroxyethyldisulfide (90%) was purchased from Acros (Geel,
Belgium).
The bifunctional disulfide crosslinker, bis(2-methacryloyloxyethyl) disulfide (SSXL), was
synthesized according to the method reported by Gao, et al.(Gao et al., 2005) Briefly, organic
solvents were dried over MgSO4 before use. Dichloromethane was purged with N2 for 15 min and
placed in a dry nitrogen atmosphere (O2 < 0.1 ppm, H2O < 0.1 ppm). Pyridine (15.8 mL, 0.195
mol) and bis(2-hydroxyethyl) disulfide (10.00 g, 0.065 mol) were added to cold (4°C)
dichloromethane and agitated briefly. Methacryloyl chloride was added dropwise to the stirring
organic mixture. The flask was then sealed, removed from the ice bath, and the reaction was
allowed to proceed for 12 h in a nitrogen atmosphere.
The reaction product in dichloromethane was successively washed with 1 N HCl, 1 N
NaOH, and DI water. The organic phase was retained and dried. The product was then dissolved
in diethyl ether and passed through a column of sodium carbonate and basic alumina. Diethyl ether
was removed through rotary evaporation.
Additional flash chromatography purification was performed using a Teledyne-Isco
Companion Automated Flash Chromatography Instrument (Lincoln, NE) equipped with a 100 g
silica column. The solvent gradient was established as follows: Solvent A – hexanes, Solvent B-
ethyl acetate. The gradient was adjusted from 0 – 15% B over 40 minutes and then from 15 – 100%
5

B over 10 minutes. Fractions of interest were determined by monitoring absorbance at 258 nm.
Product fractions were pooled and solvent was removed by rotary evaporation.
2.2 Characterization of disulfide crosslinker
The composition of raw materials, purification fractions, and final product of the SSXL
synthesis were confirmed using a Varian (Palo Alto, CA) DirectDrive 400 MHz nuclear magnetic
resonance spectrometer equipped with an automatic sampler. Chloroform-d (CDCl3, 99.8%) was
obtained from Acros Organics (Fairlawn, NJ). SSXL was dissolved at 1% (vol/vol) in CDCl3 for
1H-NMR analysis. All NMR spectra were analyzed using SpinWorks 3TM software.
2.3 Synthesis and Characterization of Degradable Nanogels
The nomenclature of the copolymer nanogels presented in this work was established to
reflect the copolymer composition. The primary monomer in this work was DEAEMA (DE), and
the comonomers used were TBMA (TB), or TBAEMA (TBA). The number at the end of the
polymer name represents the comonomer ratio (number of moles of the comonomer per 100 mol
of the primary monomer). To impart a mechanism for biodegradation to the responsive nanogel
PDETB30, SSXL was used as a replacement for tetra(ethylene glycol) dimethacrylate (TEGDMA)
in the photoemulsion polymerization. SSXL was added to pre-polymer mixture at 2.5 mol% of
total monomer and photoemulsion polymerization and nanogel purification proceeded as
previously described.(Liechty et al., 2013; Liechty et al., 2018) The resulting nanogel, termed
PDESSB30, was stored in a desiccator at -20°C until further use.
A fluorescent version of PDESSB30 was synthesized and purified as previously shown.
The covalent conjugation of Oregon Green 488 (OG488) was enabled by the incorporation of
primary amines in the PDESSB30 core. Briefly, 2-aminoethyl methacrylate hydrochloride
(AEMA) was included in the pre-polymer feed mixture at 5 mol% of DEAEMA. The resulting
6

copolymer was named PDESSB30f to describe the amine functionality. The primary amine of
AEMA was verified with a fluorescamine assay after synthesis and purification.
Following the amine-modification of the PDESSB30f copolymer, Oregon Green 488
carboxylic acid, succinimidyl ester (OG488, Molecular Probes, Eugene, OR) was incorporated to
the polymer. First, the fluorescent probe was dissolved in DMSO to yield a 10 mg ml-1 solution,
and PDESSB30f was suspended at 10 mg ml-1 in 150 mM sodium bicarbonate buffer, pH 8.30.
OG488 was then added to the PDESSB30f suspension to give a 1:1 mol ratio between AEMA and
OG488. The reaction was stirred in the dark for 6 h. Following reaction completion, unreacted dye
was separated from labeled PDESSB30-OG488 through dialysis against DI water. Dialysis
proceeded for 3 days using12,000 – 14,000 MWCO dialysis tubing (Spectrum Labs, Rancho
Dominguez, CA). Labeled nanogels, PDESSB30-OG488, were lyophilized in the dark for 3 days.
Several characterization techniques were employed to study the physicochemical
properties of the PDESSB30 nanogels in comparison to the TMBA analogue, PDETB30. Dynamic
light scattering was used to determine the hydrodynamic diameter of PDESSB30 nanogels as a
function of environmental pH. Measurements of the ζ-potential were also performed to evaluate
the effective surface charge as a function of environmental pH. Additionally, transmission electron
microscopy (TEM) was used to determine the diameter of the dry nanogels and was conducted as
previously described. The metabolic activity of RAW 264.7 cells upon exposure to PDESSB30
and PDETB30 was measured using a commercially-available MTS Cell Proliferation assay kit as
previously reported.
2.4 RNA Binding Studies
The RNA complexation buffer was prepared with 3.15 g sodium phosphate dibasic
heptahydrate, 0.02 g potassium phosphate monobasic monohydrate, 0.20 g potassium chloride,
7

and 8.01 g sodium chloride in DI water. Following salt dissolution, the solution pH was adjusted
to pH 5.50 and the final solution volume was brought up to 100 mL. To remove nucleases from
the buffer, diethylpyrocarbonate (DEPC) was added at 0.1% and incubated at room temperature
overnight. The buffer solution was then autoclaved to inactivate the DEPC. Polymer-siRNA
complexes were formed by combining aqueous solutions of nanogels, siRNA, 10x RNAse-free
Phosphate Buffered Saline (PBS), and RNAse-free water to obtain the desired concentrations.
Silencer® GAPDH siRNA, Quant-iT™ Ribogreen® RNA Assay Kit, and RNAse Free
H2O were purchased from Life Technologies (Carlsbad, CA). Free siRNA in solution was
measured using the Ribogreen® assay according to manufacturer’s instructions. Nanogel
suspensions were diluted in RNAse free complexation buffer (pH 5.50). Concentrated siRNA was
added to yield 500 ng ml-1 RNA in a nanogel suspension at designated concentrations.
Measurements of the free siRNA were taken after 60, 120, and 180 minute complexation periods.
2.5 Cell Culture Studies
Human colorectal adenocarcinoma cells (Caco-2) were cultured in Dulbecco’s Modified
Eagles Medium (DMEM) supplemented with 100 U mL-1 penicillin, 100 μg mL-1 streptomycin,
0.25 µg mL-1Amphotericin B, and 10% Fetal Bovine Serum. Caco-2 cells were used between
passage 34 and 62. Caco-2 cells were passaged by incubation with 0.25% Trypsin-EDTA at 37°C.
Then, trypsin was neutralized by addition of fresh DMEM and cells were separated by
centrifugation. The cell suspension was resuspended in fresh media, diluted as necessary, and
added to tissue-culture treated flasks or 6-well plates. Caco-2 cells were typically passaged at a
1:5 ratio with media replenished every 2-3 days. Cells were allowed to grow to 80% confluency
before use.
8

2.6 siRNA Delivery
DyLight 647-labeled
small
interfering
RNA
(Sense:
DY647-
UAAGGCUAUGAAGAGAUACUU) was purchased from Thermo Scientific (Lafayette, CO).
Cy3-labeled Silencer® Negative Control No. 1 siRNA was purchased from Life Technologies
(Carlsbad, CA). Fluorescent nanogels, PDETB30-OG488 and PDESSB30-OG488 were
synthesized and purified as previously described.
Concentrated suspensions (20X) of fluorescent nanogels (PDETB30-OG488 or
PDESSB30-OG488), fluorescent siRNA (DY647-siRNA or Cy3-siRNA), or fluorescent nanogels
and fluorescent siRNA were prepared to contain 0.5 mg mL-1 nanogel, 26.5 µg mL-1 (~2000 nM)
siRNA, 1X complexation buffer, and RNAse free H2O. Control samples (nanogel or siRNA) were
prepared in a similar fashion, replacing the volume of the absent component(s) with RNAse free
H2O.
To separate nanogel/siRNA complexes from complexation buffer, 4 volume equivalents of
acetone were added to the suspension following complexation completion to induce a
polyelectrolyte-ionomer transition.(Liechty et al., 2013) Suspensions were centrifuged at 15,000
rpm for 5 min, supernatant was discarded, and residual solvent was evaporated. Polymer/siRNA
complexes were resuspended in the original complexation volume of RNAse free PBS at pH 7.40.
Following resuspension, 100 µL of nanogel/siRNA complexes at 500 µg ml-1 were diluted
in PBS to yield a final concentration of 25 µg ml-1. Control wells received 100 µL PBS or 100 µL
of the corresponding nanogel-only or siRNA-only solution. Nanogel exposure occurred for
designated time points at 37°C or 4°C. Following the exposure period, cells were rinsed 3X with
DPBS (with calcium and magnesium) and the media was replaced with 2 mL serum-free DMEM.
For imaging flow cytometry, Hoechst 33342 was added to each well for nuclear staining
at a final concentration of 2.5 µg ml-1. The nuclear staining process was performed for 45 min for
9

Caco-2 cells at 37°C, 5% CO2. Following Hoechst incubation, cells were rinsed 3X with DPBS
(without calcium and magnesium). No nuclear stain was used in conventional flow cytometry
experiments. Caco-2 cells were isolated by replacing the final DPBS wash with 500 µL 0.25%
trypsin-EDTA and incubating at 37°C, 5% CO2 for 8 min. Trypsin was neutralized by adding 3
mL DMEM (without phenol red) supplemented with 10% FBS. Cell suspensions were centrifuged
for 5 min at 500 g. The supernatant was discarded and the cell pellet re-suspended in flow
cytometry buffer. All cell suspensions were kept on ice until analysis. Propidium iodide (PI) was
used as a live/dead discriminator and was added to cell suspensions immediately before analysis
at a final concentration of 1 µg mL-1.
2.6.1 Flow Cytometry
Efficiency of PDETB30- and PDESSB30-mediated Cy3-siRNA delivery was compared
using a BD FACSCalibur (San Jose, CA) flow cytometer equipped with lasers at 488 nm and 635
nm. Fluorescence data were collected using FL-2 (570 – 600 nm, Cy3) and FL-3 (653 - 669 nm,
PI). Dead or dying cells were identified with propidium iodide. Typically, 40,000 cells were
collected per sample.
2.6.2 Multi-spectral Imaging Flow Cytometry
10

Analysis of uptake mechanisms and siRNA delivery was conducted using an Amnis Image
Stream (Seattle, WA) imaging flow cytometer equipped with lasers at 405 nm, 488 nm, 658 nm,
and 785 nm. Fluorescence data were collected using Channel 1 (430 – 505 nm, Hoechst), Channel
2 (505 – 595 nm, OG488), Channel 4 (595 – 660 nm, PI), Channel 5 (660 – 745 nm, DY647), and
Channel 6 (745 – 800 nm, side scatter). Brightfield images were collected in Channel 3.
Cells were imaged with a 60X objective. Fluid velocity was set to a nominal value of 40
mm/sec. Fluorescence compensation matrices were constructed using Amnis IDEAS® software
and verified manually for proper fit. At least 5,000 cells were collected for analysis. Dead cells (PI
positive) were excluded from analysis. Out-of-focus cells were also excluded from further analysis
by gating the Gradient RMS feature in IDEAS® software. Typically, cells with Gradient RMS
value <40 were considered out of focus.
2.7 siRNA-Mediated Gene Silencing
GAPDH Positive Control siRNA, KD Alert Assay Kits, and 10X Phosphate Buffered
Saline (RNAse free) were purchased from Life Technologies (Carlsbad, CA). Caco-2 cells were
seeded in tissue-culture treated 96-well plates at 2,500 cells/well and allowed to equilibrate 24
hours before use. GAPDH siRNA-loaded PDETB30 or PDESSB30 nanogels were prepared as
discussed before. Following 60 min incubation in complexation buffer, nanogel/siRNA complexes
were precipitated through the addition of acetone and centrifuged at 15,000 rpm for 5 min.
Supernatant was discarded and complexes were resuspended in RNAse-free PBS. Prior to use,
Caco-2 cells were washed with PBS and media replaced with serum free DMEM. Concentrated
(20X) nanogel/siRNA complexes or control suspensions were added to test wells and incubated at
37°C, 5% CO2 for 60 min. Following the exposure period, cells were washed 3X with pre-warmed
PBS and media replaced with complete DMEM. Cells were incubated at 37°C, 5% CO2 prior to
11

conducting the KD Alert gene silencing assay according to the manufacturer’s instructions. Care
was taken to adjust the microplate reader sensitivity to remain within the GAPDH enzyme
calibration curve established according to the manufacturer’s instructions.
2.8 Statistical Analysis
Statistical comparisons between experimental and control groups were made with two-
tailed, unpaired, Student’s t-tests. Differences were accepted as statistically significant with p <
0.05.
3. RESULTS AND DISCUSSION
3.1 Degradable Nanogel Synthesis and Characterization
The homobifunctional crosslinker 2-bis-(2-methacryloyloxyethyl disulfide) was
successfully synthesized to endow responsive DEAEMA-based nanogels with a mechanism for
biodegradation, namely reductive cleavage of the disulfide bonds. The synthesis and purification
of 2-bis-(2-methacryloyloxyethyl disulfide) (SSXL) resulted in a molar yield of approximately
50%. Analysis of the mass spectra (Figure 2) reveals a product of the expected molecular weight,
1
290 Da. The structure of SSXL was further confirmed with H-NMR. The spectra, shown in
Supplementary Figure 1, show peaks at δ= 1.95 ppm (1H, H2C=C-), 2.96 ppm (1H, H2C=C-),
4.45 (2H, CH2-CH2-S-), 5.60 ppm (2H, -O-CH2-CH2-), and 6.14 ppm (3H, CH3-C=).
Disulfide-crosslinked nanogels containing an ionizable core of DEAEMA-co-TBMA and
PEG corona were successfully synthesized via photoemulsion polymerization. This synthesis was
conducted as described in our previous reports (Fisher et al., 2008; Fisher and Peppas, 2009;
Liechty et al., 2013) and resulted in a similar yield (~1.2 g of nanogel) to previous syntheses.
12

Replacing the non-degradable linker TEGDMA (i.e. PDETB30) with SSXL had no identifiable
change on physicochemical properties like pH-dependent swelling, ζ-potential, and size, which are
consistent with previously reported results.(Forbes and Peppas, 2014a; Liechty et al., 2011;
Liechty et al., 2013) After confirming that the physicochemical characteristics of the nanoscale
hydrogels were unaffected by the change in crosslinker, studies were conducted to quantify the
kinetics and extent of degradation in response to glutathione, a reductive tripeptide. A semi-
quantitative, real-time measurement of degradation of SSXL-crosslinked nanoscale hydrogels was
performed in a reductive aqueous suspension. The experiments were conducted using a Malvern
ZetaSizer Nano ZS with the sample cell set to 37°C and measurements collected every 3 minutes.
After a brief equilibration period, sample cuvettes were injected with PBS or aqueous glutathione
to bring the final concentration to 1 mM or 10 mM glutathione in PBS.
The glutathione-dependent polymer degradation analysis is shown in Figure 3. The
presence of the degradable crosslinker SSXL in the PDESSB30 allows the synthesized nanogels
to degrade in the presence of glutathione (10 mM solution) after 5 minutes of exposure, as
demonstrated by the reduction on the particle count rate. This effect is not observed in the
PDESSB30 when subjected to PBS-only. Furthermore, there is a glutathione-concentration
dependence, since the polymer degradation does not occur in the presence of a 1 mM glutathione
solution. This response confers the SSXL-crosslinked nanogels the ability to preserve their
structural integrity in the extracellular milieu, and degrade upon entering the intracellular
environment.
13

3.2 Fluorescent Nanogel Synthesis and Characterization
To enable visualization of nanogel subcellular localization in siRNA delivery experiments,
a fluorescent version of the PDESSB30 nanogel was necessary. A primary amine-containing
analogue of PDESSB30, termed PDESSB30f, was successfully synthesized and purified.
Oregon Green 488 (OG488), an amine reactive dye, was conjugated to primary amines in
the nanogel core. Prior to the conjugation reaction, the primary amine content of PDESSB30f was
determined to be 17.0 ± 0.4 µmol g-1, which represents a 11.5% incorporation efficiency. OG488
was subsequently added to PDESSB30f at 1:1 mol ratio of dye to amine. Following dialysis and
lyophilization, the Oregon Green 488 functionalization was verified using fluorescence
spectroscopy and the percent functionalization was calculated with UV absorbance and
comparison to an Oregon Green 488 standard curve.
The fluorescence emission (λ = 465 nm) spectra of the labeled nanogel (PDESSB30-
ex
OG488) was consistent to unbound dye. The fluorescent labeling was estimated at 16.9 ± 0.3 µmol
g-1 using a standard curve of OG488 in PBS, and at 19.5 µmol g-1 calculated by the sample
absorbance at 496 nm and the OG-488 extinction coefficient (ε) of 70,000 L mol-1 cm-1, suggesting
near 100% conjugation efficiency.
3.3 siRNA Loading Efficiency of pH-responsive nanogels
The ability of the synthesized nanogels to encapsulate siRNA is a critical factor for this
platform to efficaciously deliver therapeutically relevant dosages of RNA to disease sites and
initiate gene silencing. Our previous work has shown that PDETB30 nanogels display the most
desirable attributes as endosomolytic drug delivery vehicles, but also contain fewer ionizable
DEAEMA groups than PDET or PDETBA30.(Liechty et al., 2011; Liechty et al., 2013) Previous
work also demonstrated that cationic polymers were able to bind DNA more efficiently with
14

increasing cationic density.(Dufresne et al., 2008) Thus, the RNA binding capacity was evaluated
in a high-throughput fashion analogous to that described by Siegwart et al.(Siegwart et al., 2011)
RNA binding was evaluated as a function of nanogel composition, RNA:nanogel mass ratio, and
complexation time to determine the loading efficiency of each nanogel.
The fraction of free RNA (Ff) was calculated by taking the ratio of fluorescence intensity
of sample solutions to fluorescence intensity of a polymer-free control RNA solution. Both
measurements were corrected for background fluorescence and the fraction of bound RNA, Fb =
1 - Ff. These results indicate that after a 60 min complexation, all formulations can efficiently bind
free siRNA up to a 1:1 mass ratio of polymer and siRNA and this binding is relatively independent
of polymer composition as demonstrated in Figure 4. Nearly identical results were obtained for
complexation periods of 120 and 180 min (data not shown).
The positive surface-charge of the evaluated polymer formulations at pH 5.5 may induce
the adsorption of the anionic RNA onto the particle surface through electrostatic interactions,
instead of the encapsulation of the cargo within the polymer matrix (Forbes and Peppas, 2014b).
Therefore, to separate the effects of surface adsorption and electrostatic encapsulation, nanogels,
polymer, and siRNA were allowed to complex in the acidic complexation buffer (PBS, pH 5.50)
for 60 minutes and were subsequently transferred to 3X volume of serum-free DMEM. By
immersing the polymer/siRNA complexes in a more basic solution, the effective surface charge
can be reduced from approximately 30 mV to nearly neutral (0 ± 5 mV). This step change in
surface charge serves to reduce the electrostatic interactions between the nanogel surface and
siRNA, allowing desorption of RNA from the particle surface.
According to the light scattering data presented in previous studies (Liechty et al., 2013;
Liechty et al., 2018), this pH-level will completely or partially (depending on nanogel
composition) collapse the network structure, serving to entrap RNA in the network core and limit
15

the diffusion out of the particle. As seen in Figure 5 for a 10:1 mass ratio of polymer to siRNA,
approximately 70% of the RNA is retained in the bound state following immersion in DMEM in
all evaluated formulations.
Further confirmation of siRNA and nanogel binding can be seen in Supplementary Figure
2. Complexes of PDETB30-OG488 and DY647-siRNA were visualized using Image Stream
cytometry. As expected, the siRNA-loaded nanogels are too small to visualize with brightfield
microscopy, but the fluorescence signal from PDETB30-OG488 and DY647-siRNA was visible.
As seen in the representative figure showing DY647 vs. OG488 intensity plot presented in
Supplementary Figure 2, nearly all PDETB30-OG488 nanogels contain DY647-siRNA.
Analogous observations were made for complexes of PDESSB30-OG488 and DY647-siRNA
(data not shown).
3.4 Nanogel-mediated delivery of siRNA
The ability of PDETB30, and its degradable analogue PDESSB30, to deliver fluorescent
siRNA to Caco-2 cells was evaluated using flow cytometry. Figure 6 shows the influence of
exposure time on uptake of Cy3-siRNA. As expected, naked siRNA is not able to efficiently enter
Caco-2 cells. However, by complexation with PDETB30 or PDESSB30, the median fluorescence
intensity is increased 5X after 5 min of exposure. Notably, siRNA delivery via PDETB30 and
PDESSB30 results in a rapid increase in siRNA fluorescence from 0 – 5 min, followed by an
approximately linear increase in median fluorescence from 5 min – 60 min.
As discussed in our previous work, the mechanism of cationic nanogel internalization in
Caco-2 cells is primarily macropinocytosis. This is an energy dependent internalization pathway
and the uptake of nanogel/Cy-3siRNA complexes is predictably inhibited at 4°C (Figure 7).
Moreover, these data corroborate the observations of previously reported results, whereby
16

PDETB30 can be internalized through an energy-independent pathway (Liechty et al., 2018).
Following 60 min uptake at 4°C, cells exposed to PDETB30/Cy3-siRNA and PDESSB30/Cy3-
siRNA exhibit greater median fluorescence than cells exposed to Cy3-siRNA alone. These data
suggest that PDETB30 and PDESSB30 are capable of delivery of siRNA to Caco-2 cells. This
work served as the basis for further study of the intracellular distribution of fluorescent
nanogel/siRNA complexes and the evaluation of the gene silencing activity of encapsulated
siRNA.
3.5 Internalization analysis of nanogel/siRNA complexes
Multi-spectral imaging flow cytometry was used to simultaneously acquire statistical flow
cytometry data and high-resolution fluorescence micrographs. Additionally, this analysis allowed
the sorting and gating of events with particular image features, specifically cellular internalization
(vs. surface adsorption) or probe colocalization.
As shown in Figure 8, panel A, PDETB30-OG488 is an efficient delivery vehicle for
DY647-siRNA in Caco-2 cells. Both PDETB30-OG488 and PDESSB30-OG488 (data not shown)
enhance the cytoplasmic fluorescence of DY647-siRNA relative to the siRNA only (light gray
histogram) and untreated control (gray histogram) cells. Figure 8, panel B shows the OG488
fluorescence intensity histogram in untreated (gray), PDETB30-OG488 (dark grey), and
PDETB30-OG488/DY647-siRNA (black) treated samples. Notably, the fluorescence signal in the
cells treated with nanogels only is greater than that of cells treated with nanogels/siRNA. This
suggests that the internalization of nanogel/siRNA complexes is less efficient than nanogels alone.
Figure 9 shows representative fluorescence micrographs of Caco-2 cells. Cell nuclei are
shown in blue (Hoechst), PDETB30-OG488 in green, and siRNA in red (DY647). Areas of
17

nanogel/siRNA colocalization appear yellow on the fluorescence overlay. Panels A-C show
representative images of cells exposed only to 100 nM DY647-siRNA for 60 min, panels D-F
show representative images of cells exposed only to 25 µg mL-1 PDETB30-OG488 for 60 min,
and panels G – I show representative images of cells exposed 25 µg mL-1 PDETB30-OG488 and
100 nM DY647-siRNA for 60 minutes. As expected due to its high MW (~13 kDa) and negative
charge, little to no internalization was observed by the naked siRNA. In panels G – I (PDETB30-
OG488/DY647-siRNA), the siRNA staining pattern appears mostly diffuse and distributed near
the cell membrane. Several bright, colocalized spots appear in panels H and I, suggesting vesicular
entrapment of polymer/siRNA complexes. Vesicular entrapment, and/or lysosomal accumulation,
is expected in a portion of the nanogel/siRNA complexes due to the reliance on macropinocytosis
by Caco-2 cells to internalize PDETB30-OG488.
3.6 siRNA-Mediated Gene Silencing
The efficacious delivery of functional siRNA to model cells lines is an important step in
the assessment of polymeric delivery systems. In these studies, GAPDH was chosen as the target
gene for siRNA knockdown. GAPDH is a well-known housekeeping gene, ubiquitously expressed
in nearly all cell types, and is involved in the reduction of NAD+ to NADH in the glycolysis
pathway (Tristan et al., 2011; Zainuddin et al., 2010). Knockdown was assessed by using a
KDAlert™ GAPDH Assay Kit and monitoring the increase in fluorescence (em:520/ex:590) over
a 4 minute period.
GAPDH knockdown, shown in Figure 10, reveals that GAPDH siRNA delivered via
PDETB30 induces a robust gene silencing effect, reducing GAPDH expression by 60 – 85%. This
18

knockdown effect occurred at multiple polymer:siRNA ratios ranging from 8:1 – 1000:1. These
effects were not observed upon exposure to the non-specific siRNA negative control.
Furthermore, evaluation between the efficacy of siRNA-mediated gene silencing between
Caco-2 cells treated with PDETB30/siRNA or PDESSB30/siRNA at a 200:1 nanogel:siRNA ratio
was performed as shown in Figure 11. Both nanogel formulations were capable of delivering
functional siRNA. Knockdown efficiency was 53% for cells treated with PDESSB30/siRNA and
83% for cells treated with PDETB30/siRNA. Knockdown was not observed upon exposure to the
non-specific siRNA negative control. Based on flow cytometry data in Figure 5, Caco-2 cells
treated with PDETB30/siRNA exhibited characteristically higher siRNA fluorescence than did
cells treated with PDESSB30/siRNA. Therefore, the superior knockdown efficiency of
PDETB30/siRNA relative to PDESSB30/siRNA is likely due to increased siRNA delivery
efficiency by the former combination.
In this work we have shown that GAPDH siRNA and KD Alert assays confirmed the ability
of the synthesized nanogels to induce gene silencing in Caco-2 cells. Based on these results,
further assessment of the gene silencing capabilities of this platform are necessary (i.e. qPCR),
before the in vivo evaluation of these systems.
4. CONCLUSIONS
A disulfide crosslinker was synthesized to allow degradation of pH-responsive nanogels in
reductive environments. This crosslinker was incorporated into responsive nanogels, termed
PDESSB30, without significant changes on their physicochemical properties. These nanogels
degrade within minutes upon exposure to physiological levels of glutathione as determined by
light scattering. It was shown that both, degradable (PDESSB30) and non-degradable (PDETB30)
19

nanogels, are capable of delivering functional siRNA to Caco-2 cells, achieving gene silencing of
47% and 83%, respectively. The combination of attractive physicochemical properties and siRNA
delivery efficiency make PDETB30 and PDESSB30 attractive candidates for further development
as therapeutic siRNA delivery systems.
5. ACKNOWLEDGMENTS
This work was supported in part by the National Institutes of Health Grants R01-
EB022025-2, R01-EB00246-18, and National Science Foundation Grant 1033746, the William
“Tex” Moncrief, Jr. Foundation, the Pratt Foundation, and the Cockrell Family Regents Chair.
W.B.L. acknowledges the U.S. National Science Foundation for a Graduate Research Fellowship.
Mass spectrometry studies were performed courtesy of the Mass Spectrometry Facility in the
Department of Chemistry and Biochemistry, The University of Texas at Austin.
6. CRediT AUTHOR STATEMENT
William B. Liechty: Conceptualization, Investigation, Formal Analysis, Writing-Original Draft;
Rebekah L. Scheuerle: Investigation, Validation; Julia E. Vela Ramirez: Writing- Review &
Editing, Visualization, Project Administration; Nicholas A. Peppas: Conceptualization, Writing-
Review & Editing, Supervision.
20

7. REFERENCES
Antimisiaris, S., Mourtas, S., Papadia, K., 2017. Targeted si-RNA with liposomes and exosomes
(extracellular vesicles): How to unlock the potential. International Journal of Pharmaceutics 525,
293-312.
Aouadi, M., Tesz, G.J., Nicoloro, S.M., Wang, M., Chouinard, M., Soto, E., Ostroff, G.R., Czech,
M.P., 2009. Orally delivered siRNA targeting macrophage Map4k4 suppresses systemic
inflammation. Nature 458, 1180.
Convertine, A.J., Benoit, D.S.W., Duvall, C.L., Hoffman, A.S., Stayton, P.S., 2009. Development
of a novel endosomolytic diblock copolymer for siRNA delivery. Journal of Controlled Release
133, 221-229.
Davis, M.E., Zuckerman, J.E., Choi, C.H.J., Seligson, D., Tolcher, A., Alabi, C.A., Yen, Y.,
Heidel, J.D., Ribas, A., 2010. Evidence of RNAi in humans from systemically administered siRNA
via targeted nanoparticles. Nature 464, 1067.
Dufresne, M.-H., Elsabahy, M., Leroux, J.-C., 2008. Characterization of Polyion Complex
Micelles Designed to Address the Challenges of Oligonucleotide Delivery. Pharmaceut Res 25,
2083-2093.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C.C., 1998. Potent and
specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806.
Fisher, O.Z., Kim, T., Dietz, S.R., Peppas, N.A., 2008. Enhanced Core Hydrophobicity,
Functionalization and Cell Penetration of Polybasic Nanomatrices. Pharmaceut Res 26, 51.
Fisher, O.Z., Peppas, N.A., 2009. Polybasic Nanomatrices Prepared by UV-Initiated
Photopolymerization. Macromolecules 42, 3391-3398.
Forbes, D.C., Peppas, N.A., 2012. Oral delivery of small RNA and DNA. Journal of Controlled
Release 162, 438-445.
Forbes, D.C., Peppas, N.A., 2014a. Polycationic Nanoparticles for siRNA Delivery: Comparing
ARGET ATRP and UV-Initiated Formulations. ACS Nano 8, 2908-2917.
Forbes, D.C., Peppas, N.A., 2014b. Polymeric Nanocarriers for siRNA Delivery to Murine
Macrophages. Macromolecular Bioscience 14, 1096-1105.
Gao, H., Tsarevsky, N.V., Matyjaszewski, K., 2005. Synthesis of Degradable Miktoarm Star
Copolymers via Atom Transfer Radical Polymerization. Macromolecules 38, 5995-6004.
Hariharan, D., Peppas, N.A., 1996. Characterization, dynamic swelling behaviour and solute
transport in cationic networks with applications to the development of swelling-controlled release
systems. Polymer 37, 149-161.
21

Khormaee, S., Choi, Y., Shen, M.J., Xu, B., Wu, H., Griffiths, G.L., Chen, R., Slater, N.K.H.,
Park, J.K., 2012. Endosomolytic Anionic Polymer for the Cytoplasmic Delivery of siRNAs in
Localized In Vivo Applications. Advanced Functional Materials 23, 565-574.
Knipe, J.M., Chen, F., Peppas, N.A., 2015. Enzymatic Biodegradation of Hydrogels for Protein
Delivery Targeted to the Small Intestine. Biomacromolecules 16, 962-972.
Knipe, J.M., Strong, L.E., Peppas, N.A., 2016. Enzyme- and pH-Responsive Microencapsulated
Nanogels for Oral Delivery of siRNA to Induce TNF-α Knockdown in the Intestine.
Biomacromolecules 17, 788-797.
Liechty, W.B., Caldorera-Moore, M., Phillips, M.A., Schoener, C., Peppas, N.A., 2011. Advanced
molecular design of biopolymers for transmucosal and intracellular delivery of chemotherapeutic
agents and biological therapeutics. Journal of Controlled Release 155, 119-127.
Liechty, W.B., Scheuerle, R.L., Peppas, N.A., 2013. Tunable, responsive nanogels containing t-
butyl methacrylate and 2-(t-butylamino)ethyl methacrylate. Polymer 54, 3784-3795.
Liechty, W.B., Scheuerle, R.L., Vela Ramirez, J.E., Peppas, N.A., 2018. Uptake and Function of
Membrane-destabilizing Cationic Nanogels for Intracellular Drug Delivery. Bioengineering &
Translational Medicine.
Siegwart, D.J., Whitehead, K.A., Nuhn, L., Sahay, G., Cheng, H., Jiang, S., Ma, M., Lytton-Jean,
A., Vegas, A., Fenton, P., Levins, C.G., Love, K.T., Lee, H., Cortez, C., Collins, S.P., Li, Y.F.,
Jang, J., Querbes, W., Zurenko, C., Novobrantseva, T., Langer, R., Anderson, D.G., 2011.
Combinatorial synthesis of chemically diverse core-shell nanoparticles for intracellular delivery.
Proceedings of the National Academy of Sciences 108, 12996.
Tamura, A., Oishi, M., Nagasaki, Y., 2009. Enhanced Cytoplasmic Delivery of siRNA Using a
Stabilized Polyion Complex Based on PEGylated Nanogels with a Cross-Linked Polyamine
Structure. Biomacromolecules 10, 1818-1827.
Tristan, C., Shahani, N., Sedlak, T.W., Sawa, A., 2011. The diverse functions of GAPDH: Views
from different subcellular compartments. Cellular Signalling 23, 317-323.
Wagner, E., 2012. Polymers for siRNA Delivery: Inspired by Viruses to be Targeted, Dynamic,
and Precise. Accounts of Chemical Research 45, 1005-1013.
Whitehead, K.A., Langer, R., Anderson, D.G., 2009. Knocking down barriers: advances in siRNA
delivery. Nature Reviews Drug Discovery 8, 129.
Winter, P.M., Cai, K., Chen, J., Adair, C.R., Kiefer, G.E., Athey, P.S., Gaffney, P.J., Buff, C.E.,
Robertson, J.D., Caruthers, S.D., Wickline, S.A., Lanza, G.M., 2006. Targeted PARACEST
nanoparticle contrast agent for the detection of fibrin. Magnetic Resonance in Medicine 56, 1384-
1388.
22

Zainuddin, A., Chua, K.H., Rahim, N.A., Makpol, S., 2010. Effect of experimental treatment on
GAPDH mRNA expression as a housekeeping gene in human diploid fibroblasts. BMC Molecular
Biology 11, 59.
23

FIGURE CAPTIONS
Figure 1. Cationic nanogel degradation in response to the presence of glutathione. Disulfide
crosslinks within the polymer core are sensitive to reductive conditions.
Figure 2. Mass spectrum of purified bis(2-methacryloyloxyethyl) disulfide. Anticipated
molecular weight of the bis(2-methacryloyloxyethyl) disulfide = 290.4 g/mol.
Figure 3. Light scattering analysis of glutathione-induced nanogel degradation. PDESSB30
nanogels dissolved in PBS (at pH 7.4) and exposed to 1 mM (gray) and 10 mM (black)
concentrations of glutathione (GSH) and incubated at 37°C. Normalized count rates are reduced
following glutathione exposure as nanogel degradation occurs. As a control, nanogels suspended
only in PBS maintained their count rate constant throughout the experiment (white).
Figure 4. Cationic nanogels were successfully loaded with siRNA. RNA Loading capacity of
poly(DEAEMA-g-PEGMA) (PDET), and poly(DEAEMA-co-BMA-g-PEGMA) (PDETB10),
(PDETB20), and (PDETB30) in PBS at pH 5.50. Data represent mean ± S.D. (n = 3).
Figure 5. RNA loading of poly(DEAEMA-g-PEGMA) (PDET), and poly(DEAEMA-co-
BMA-g-PEGMA) (PDETB10), (PDETB20), and (PDETB30) in PBS (at pH 5.50, filled) and
in serum-free DMEM (at pH 7.40, white). Polymer and siRNA were combined at a ratio of 10:1
[polymer]:[siRNA]. Fraction of bound RNA determined by Ribogreen assay following 180 min
incubation in PBS and 30 min incubation in DMEM. Bars represent the mean ± S.D. (n = 3).
Figure 6. siRNA delivery to Caco-2 cells as a function of incubation time. Nanogel/Cy3-siRNA
complexes were prepared at a 20:1 nanogel/siRNA ratio (g/g) and incubated with cells for
24

designated time points. Data points represent the median fluorescence of live cells as determined
by flow cytometry. Dead cells were excluded via propidium iodide.
Figure 7. siRNA delivery to Caco-2 cells as a function of nanogel composition and incubation
temperature. Nanogel/Cy3-siRNA complexes were prepared at a 20:1 nanogel/siRNA ratio (g/g)
and incubated with Caco-2 cells for 60 min. Data points represent the median fluorescence of live
cells as determined by flow cytometry. Dead cells excluded via propidium iodide.
Figure 8. Fluorescence intensity of Caco-2 cells in siRNA delivery experiments. Fluorescence
intensity histograms of DY647-siRNA and PDETB30-OG488 are shown in Panels A and B,
respectively. Fluorescence histograms generated from live, focused, single cells exposed to PBS
(untreated, gray), DY647-siRNA alone (light gray), PDETB30-OG488 alone (dark gray), or
PDETB30-OG488/DY647-siRNA (black). Data represent the results of two pooled experiments.
Figure 9. Representative fluorescent micrographs of DY647-siRNA delivery to Caco-2 cells.
Nuclear stain (Hoechst 33342, blue), PDETB30-OG488 (Oregon Green 488, green), and DY647-
siRNA (DyLight 647, red) are shown. Three representative samples of Caco-2 cells exposed to
DY647-siRNA alone (A-C), PDETB30-OG488 alone (D – F), or PDETB30-OG488/DY647-
siRNA (G – I) are shown. Images sampled from median region of DY647 histogram. Scale bar
represents 7 µm.
Figure 10. GAPDH knockdown in Caco-2 cells following exposure to PDETB30/siRNA. Cells
exposed to siRNA-loaded nanogels at designated concentrations of PDETB30 and 250 ng mL-1
(~20 nM, gray) or 1250 ng mL-1 (~100 nM, black) GAPDH siRNA, or siRNA negative control
25

(white). Expression levels measured 48 hrs after transfection. Bars represent the mean of %
remaining GAPDH expression ± S.D. (n = 3). * p < 0.05, # p < 0.01.
Figure 11. GAPDH knockdown in Caco-2 cells following exposure to PDETB30/siRNA or
PDESSB30/siRNA. Cells exposed to siRNA-loaded nanogels at 200:1 nanogel:siRNA ratio (g/g,
50 µg mL-1 nanogel and 0.25 µg ml-1 siRNA). Expression levels measured 48 hrs after transfection.
Non-specific siRNA was used as a negative control (white). Bars represent the mean of %
remaining GAPDH expression ± S.D. (n = 3). * p < 0.05.
Declaration of interests
☒ The authors declare that they have no known competing financial interests or personal
relationships that could have appeared to influence the work reported in this paper.
☐The authors declare the following financial interests/personal relationships which may be considered
as potential competing interests:
26

27

28

29