Second-Generation Inhibitors of the Mitochondrial Permeability Transition Pore with Improved Plasma Stability

Article abstract of DOI:10.1002/cmdc.201900376

Excessive mitochondrial matrix Ca²⁺ and oxidative stress leads to the opening of a high-conductance channel of the inner mitochondrial membrane referred to as the mitochondrial permeability transition pore (mtPTP). Because mtPTP opening can lead to cell death under diverse pathophysiological conditions, inhibitors of mtPTP are potential therapeutics for various human diseases. High throughput screening efforts led to the identification of a 3-carboxamide-5-phenol-isoxazole compounds as mtPTP inhibitors. While they showed nanomolar potency against mtPTP, they exhibited poor plasma stability, precluding their use in in vivo studies. Herein, we describe a series of structurally related analogues in which the core isoxazole was replaced with a triazole, which resulted in an improvement in plasma stability. These analogues were readily generated using the copper-catalyzed “click chemistry”. One analogue, N-(5-chloro-2-methylphenyl)-1-(4-fluoro-3-hydroxyphenyl)-1H-1,2,3-triazole-4-carboxamide (TR001), was efficacious in a zebrafish model of muscular dystrophy that results from mtPTP dysfunction whereas the isoxazole isostere had minimal effect.

Full text of DOI:10.1002/cmdc.201900376

Accepted Article
Title: Second generation inhibitors of the mitochondrial permeability
transition pore with improved plasma stability
Authors: Justina Sileikyte, Jordan Devereaux, Jelle de Jong, Marco
Schiavone, Kristen Jones, Aaron Nilsen, Paolo Bernardi,
Michael Forte, and Michael Cohen
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: ChemMedChem 10.1002/cmdc.201900376
Link to VoR: http://dx.doi.org/10.1002/cmdc.201900376
A Journal of
www.chemmedchem.org

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
Second generation inhibitors of the mitochondrial permeability
transition pore with improved plasma stability
Dr. Justina Šileikytė[a]#, Dr. Jordan Devereaux[b]#, Jelle de Jong[d], Dr. Marco Schiavone[d], Kristen
Jones[a], Dr. Aaron Nilsen[b], Prof. Paolo Bernardi[d], Dr. Michael Forte[a] and Dr. Michael Cohen[c]*
[a]
[b]
[c]
Dr. Justina Šileikytė, ORCID: 0000-0002-6795-6344, Kristen Jones and Dr. Michael Forte
Vollum Institute
Oregon Health and Science University
3181 SW Sam Jackson Park Road, Portland, OR 97239
Dr. Jordan Devereaux and Dr. Aaron Nilsen
Medicinal Chemistry Core
Oregon Health and Science University
3181 SW Sam Jackson Park Road, Portland, OR 97239
Dr. Michael Cohen, ORCID: 0000-0002-7636-4156
Department of Chemical Physiology & Biochemistry
Oregon Health and Science University
3181 SW Sam Jackson Park Road, Portland, OR 97239
E-mail: cohenmic@ohsu.edu
[d]
Jelle de Jong, Dr. Marco Schiavone and Prof. Paolo Bernardi
Department of Biomedical Sciences
University of Padova
Via Ugo Bassi 58/B, I-35131 Padova (Italy)
#
*
Justina Šileikytė and Jordan Devereaux equally contribute to this work.
Corresponding Author
Supporting information for this article is given via a link at the end of the document.
Abstract: Excessive mitochondrial matrix Ca2+ and oxidative stress
leads to the opening of a high-conductance channel of the inner
mitochondrial membrane referred to as the mitochondrial permeability
transition pore (mtPTP). Because mtPTP opening can lead to cell
death under diverse pathophysiological conditions, inhibitors of
mtPTP are potential therapeutics for various human diseases. High
channel of the inner mitochondrial membrane (IMM) activated by
mitochondrial accumulation of Ca2+,but is not selective for Ca2+ [3]
.
Many structurally unrelated compounds or conditions affect
mtPTP transitions between its open and closed conformation; and
the identification of numerous, discrete regulatory mechanisms
strongly suggest a molecular structure of pronounced complexity
[4–6]. mtPTP plays a key role in many diverse human pathologies
whose shared characteristics may be based in mitochondrial
dysfunction triggered by Ca2+ and potentiated by oxidative stress
(e.g., [7]). However, the molecular composition of the mtPTP has
been historically distracted by assumptions that had little
experimental evidence and have subsequently been discounted
from their participation in mtPTP formation through rigorous
genetic analysis (e.g., [8]). More recently, a novel hypothesis
proposes that the mtPTP forms from dimers of the FoF1–ATP
synthase (ATP synthase) [9]. However, alternate models have
been developed [10]; as a result, the identity of the proteins forming
the mtPTP are currently debated.
throughput screening efforts led to the identification of
a 3-
carboxamide-5-phenol-isoxazole compounds as mtPTP inhibitors.
While they showed nanomolar potency against mtPTP, they exhibited
poor plasma stability, precluding their use in in vivo studies. Herein,
we describe a series of structurally related analogs in which the core
isoxazole was replaced with a triazole, which resulted in an
improvement in plasma stability. These analogs were readily
generated using the copper-catalyzed “click chemistry”. One analog,
N-(5-chloro-2-methylphenyl)-1-(4-fluoro-3-hydroxyphenyl)-1H-1,2,3-
triazole-4-carboxamide (TR001), was efficacious in a zebrafish model
of muscular dystrophy that results from mtPTP dysfunction whereas
the isoxazole isostere had minimal effect.
The identification of pharmacological agents that specifically
inhibit the mtPTP would provide key insights into its molecular
composition. Pharmacological agents targeting the mtPTP
generally target regulatory factors, not mtPTP itself. For example
CsA targets cyclophilin D (CyPD), an essential regulator of mtPTP
[3]. An inherent limitation of CsA and other CyPD inhibitors is that
these compounds are not mtPTP blockers, as demonstrated by
the fact that the mtPTP can still open after genetic elimination of
CyPD (e.g., [11]). Recently we identified several classes of
Introduction
Cellular Ca2+ metabolism and bioenergetics function as an
integrated system, which is reflected by the mitochondrion’s high
capacity to store Ca2+ in response to signals arising from elevated
cytoplasmic Ca2+ [1,2]. While a number of specific mitochondrial
Ca2+ uptake and release pathways have been defined, the
mitochondrial permeability transition pore (mtPTP) represents a
unique kind of mitochondrial Ca2+ release pathway. Indeed, this
route of mitochondrial Ca2+ release is characterized as a voltage-
dependent, cyclosporin A (CsA)-sensitive, high-conductance
compounds that specifically target the mtPTP using robust, high
[12,13]
throughout mtPTP assays
.
We identified several
chemotypes that were optimized using medicinal chemistry efforts
to yield, to our knowledge, the most potent mtPTP inhibitors
1
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
reported to date. These mtPTP inhibitors—the most potent of
which contain an isoxazole core—are efficacious at nanomolar
concentrations, are non-toxic in mammalian cells and are
efficacious in an animal model of a human muscular dystrophy
caused, in part, by pathological mtPTP activation. However,
plasma instability of the isoxazole-based mtPTP inhibitors limited
further in vivo studies. Thus, we sought improvement of plasma
stability of these mtPTP inhibitors. Herein, we describe a new
series of triazole-based mtPTP inhibitors that exhibit improved
plasma stability. The synthesis of the triazole core of these
inhibitors was accomplished using “click chemistry” of easily
prepared aryl azides and aryl propynamides. The facile synthesis
of the triazole mtPTP inhibitors facilitated thorough structure-
activity relationship (SAR) studies. In a zebrafish model of
muscular dystrophy caused by inappropriate mtPTP activation,
the triazole-based inhibitor TR001 was more efficacious than the
nearly identical isoxazole-based inhibitor 63.
Mouse Plasma
t1/2 (min)
Compound
TR001
Structure
990
21
63[a]
72[a]
73[a]
533
85
Results and Discussion
Plasma stability of first generation mtPTP inhibitors
74[a]
151
The first generation of mtPTP inhibitors described by Roy et al.
contain a core heterocycle flanked by two aryl substituents.
[12]
The most potent compound, 63, has isoxazole with
a
[a] Compounds first reported in [12]
.
carboxamide at C-3 and an ortho substituted phenol group at C-5
(Table 1). While it exhibits nanomolar potency against mtPTP in
vitro, it has a short half-life (t1/2) in plasma (t1/2 of 21 minutes, Table
1). Replacing the isoxazole with either a pyrazole (72) or an N-2-
methyl pyrazole (73 and 74) improved plasma stability (Table 1),
but unfortunately these compounds exhibited mitochondrial
Initially, we evaluated the plasma stability of TR001. Compared
to 63, TR001 exhibited a 47-fold increase in plasma stability
(Table 1). This result demonstrates that substantial improvement
in plasma stability can be achieved by simply replacing the
isoxazole in 63 with a triazole.
toxicity [12]
.
Synthesis of triazole analogs
Previous studies demonstrated that replacement of an
isoxazole core with a triazole in TGR5 agonists resulted in a
[14]
substantial improvement in pharmacokinetic properties
.
Because we desire mtPTP inhibitors with favorable
pharmacokinetic profiles for in vivo studies, we designed and
synthesized a series of second generation analogs of 63 in which
the core isoxazole was replaced with a triazole. These analogs
exhibit various substituents on the phenolic group at N-1 position
of the triazole ring for exploring SAR on this side of the
compounds.
The synthesis of these compounds is described in Scheme 1.
Briefly, 1,3-Aminophenols 2a-i were purchased or synthesized
from aryl nitro or aryl methoxy starting materials. These anilines
were diazotized using a method adapted from Filimonov [15], then
subsequently converted into aryl azides 3a-i using standard
procedures. Aniline 4 was coupled to propiolic acid using standard
DCC coupling procedures to afford the N-phenyl propiolamide 5.
Finally, triazoles TR001-013 were synthesized readily by coupling
the aryl azides 3a-I to N-phenyl propiolamide 5 using the
copper(I)-mediated Huisgen cycloaddition reaction (commonly
referred to as “click chemistry”).
Scheme 1. General synthetic procedure for triazole analogs. Reagents: (a)
Pd/C, HBF4•Et2O, H2, MeOH; (b) 1 - NaNO2, HBF4•Et2O, AcOH, 2- NaN3, H2O,
EtOAc; (c) BBr3, DCM; (d) DCC, MeCN; (e) 3b-i, CuSO4•5 H2O, sodium
ascorbate, EtOH.
Structure-activity relationship studies
We next sought to evaluate the effects of TR001-13 on mtPTP
activity in vitro in isolated mitochondria. In isolated mitochondria,
induction of mtPTP opening leads to mitochondrial swelling due
to the oncotic pressure gradient created by matrix proteins >1.5
kDa that cannot diffuse through
Table 1. The central heterocyclic core of mtPTP inhibitors impacts mouse
plasma stability.
2
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
Figure 1. CsA, an established mtPTP inhibitor, prevents mitochondrial swelling. A) Representative traces of effect of indicated concentrations of CsA on Ca2+
overload (60 µM) induced mitochondrial swelling in isolate mouse liver mitochondria. B) Percent of inhibition was calculated at 20 min after Ca2+ addition. Data are
average ± SEM of n=39 independent preparations. C) Representative traces of calcium retention capacity (CRC) of vehicle (DMSO) or 1.25 µM CsA treated mouse
liver mitochondria. Each spike of fluorescence represents 10 µM Ca2+ injection. D, Concentration response of compound treated, CRC, to DMSO-treated, CRC0,
ratios, data are average ± SEM of n=25 independent preparations.
the open pore. In in vitro experiments, where isolated
mitochondria are routinely suspended in sucrose-based isosmotic
solutions, the change in mitochondrial size can be measured
spectrometrically by detecting the decrease in light scattering at
540 nm.
activity and eight lower activity (or were inactive) compared to
CsA (Figure 2).
First, we sought to confirm that the established mtPTP inhibitor
CsA prevents mitochondrial swelling in the expected
concentration range in our mitochondrial preparations. We
challenged isolated mouse liver mitochondria with 60 µM Ca2+ to
induce mtPTP opening in the presence of vehicle (DMSO) or
increasing concentrations of CsA. As expected, CsA dose-
dependently reversed the Ca2+-mediated decrease in light
scattering (EC50 value of 265 ± 35 nM) (Figure 1 A, B).
Next, we used the Ca2+ retention capacity (CRC) assay to
validate the activity of CsA. CRC determines the Ca2+ threshold
required for mtPTP activation; inhibitors of mtPTP are expected
to increase the Ca2+ threshold required for mtPTP induction.
Extramitochondrial Ca2+ changes are detected using the
membrane-impermeant Ca2+ indicator, Calcium Green–5N.
Consistent with previous studies, CsA increased the Ca2+ load
mitochondria could store before mtPTP opening (from ~ 70 to 320
nmol/mg protein), with a CRC ratio (drug-to-vehicle) of 4.6 at 1.25
µM CsA (Figure 1 C, D).
Figure 2. Triazole-based mtPTP inhibitors prevent mitochondrial swelling.
Percent of Ca2+ overload induced mitochondrial swelling inhibition at 265 nM of
indicated compounds; data are average SEM of n=3-41 independent
preparations. , ratios of calcium retention capacity (CRC) at 1.25 µM compound,
i.e., concentration at which CsA reaches its full efficacy, treated mitochondria to
DMSO (CRC0) treated mitochondria; data are average ± SEM of n=3–25
independent preparations.
,
±
While the majority of the substituents on the phenolic ring of
[12]
the isoxazole series
had been ortho to the hydroxyl group, it
was unclear whether this was optimal for mtPTP inhibitory activity.
Because of the readily available starting materials and facile
synthetic route we developed for the triazole series, we could
easily test the effects of ortho versus meta versus para
substitution on the phenolic ring. A series of isobaric compounds
We next determined the swelling EC50 and CRC ratios for
TR001-013 (Figure 2 and Table 2). Out of 13 compounds tested
four compounds showed superior activity, one comparable
3
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
were prepared which contain a fluorine at all three positions in the
phenolic ring. The most potent analog was the meta substituted
compound TR002 followed by ortho analog TR001 (Table 2).
Interestingly, the alternative ortho analog TR003 exhibited a 5-
fold decrease in activity compared to TR001 and the para analog
TR004 was inactive (Table 2). The difluoro analog TR005 with
substitutions at both ortho positions exhibited decreased activity
(Table 2). These results suggest that the position of the fluorine
substituent can dramatically influence activity on mtPTP, and
support very tight steric and electronic constraints on inhibitor
binding to its target.
We also synthesized analogs that contain other substituents
on the phenolic ring to further explore the SAR. Analogs of TR001
with either chlorine (TR006) or bromine (TR009) in the ortho
position exhibited decreased activity and CRC/CRC0 ratio
compared to TR001 (Table 2). Similar results were found for the
chlorine analog of TR002 (TR008) which exhibited a 2-fold
decrease in activity
Table
2.
Rh123 uptake
EC50 (µM)[c]
Mitochondrial Swelling
CRC/CRC0
Structure-
activity
Compound
TR001
EC50 (µM)[a]
at 1.25 µM
[b]
relationships
of
triazole
0.029 ± 0.008
6.8 ± 0.4
> 40
analogs.
TR002
0.010 ± 0.002
12.6 ± 0.6
14.1 ± 1.2
TR003
TR004
0.152 ± 0.036
> 20
7.4 ± 0.5
29.3 ± 3.3
> 40
1.3 ± 0.03
TR005
TR006
TR007
0.782 ± 0.114
0.135 ± 0.015
> 20
2.6 ± 0.2
3.9 ± 0.3
1.2 ± 0.1
> 40
> 40
> 40
TR008
0.028 ± 0.005
7.3 ± 1.1
> 40
TR009
TR010
TR011
TR012
0.475 ± 0.057
> 20
2.4 ± 0.2
1.1 ± 0.1
1.4 ± 0.1
1.4 ± 0.1
> 40
> 40
> 40
> 40
> 20
10.6 ± 1.4
TR013
0.534 ± 0.047
2.9 ± 0.1
6.2 ± 1.2
4
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
[a] Data are average ± SEM of n=3-41 independent preparations. [b] Compound treated mitochondrial calcium retention capacity (CRC) to DMSO treated (CRC0)
ratios. Data are average ± SEM of n=3-25 independent preparations. [c] Interference with rhodamine 123 (Rh123) uptake to mitochondria as a readout of interference
with a buildup of inner mitochondrial membrane potential. Data are average ± SEM of n=3 independent preparations.
5
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
compared to TR002 (Table 2). The methyl substituted analogs
TR011 and TR012 were inactive, suggesting a preference for
electron withdrawing groups on the phenolic ring. Interestingly,
however, the trifluoromethyl analog TR013 had significantly
reduced activity compared to either TR002 or TR008, suggesting
that the steric bulk is a greater influence than electronics.
We next evaluated the mitochondrial toxicity of the new triazole
analogs by testing their ability to interfere with accumulation of the
membrane-permeant cationic fluorescent dye rhodamine 123
(Rh123). The mitochondrial uptake of positively charged Rh123 is
driven by the negative IMM potential inside mitochondria, which
is generated by the respiratory chain or maintained by ATP
hydrolysis if certain conditions are met. The majority of triazoles
does not interfere with the buildup of IMM potential except for
TR002, TR003 and TR013 (Table 2). Hence the position and
nature of the substituent on the phenolic ring can influence
mitochondrial toxicity. It should be noted, however, that toxicity for
these compounds only occurs at ~ 10 – 1000-fold higher
concentrations compared to mtPTP inhibition.
Based on the SAR studies and mouse plasma stability data,
we decided to move forward with TR001 for more extensive
biological characterization. As noted above, mtPTP is triggered
by elevated levels of matrix Ca2+ and potentiated by oxidative
stress, leading to mitochondrial swelling. We therefore next tested
the ability of TR001 to protect from oxidizing agent-triggered
mtPTP opening. For this purpose, we used known chemical
activators of the mtPTP that react with two distinct classes of
redox sensitive protein thiols and increase mtPTP opening. We
first pretreated energized isolated mouse liver mitochondria with
10 µM Ca2+, an amount insufficient to induce mtPTP opening
(Figure 3 A-D, traces a). We then then added (i) phenylarsine
oxide (PhAsO) or Diamide (Figure 3 A and B, respectively),
reagents that primarily react with matrix thiols [16] or (ii) copper-o-
phenanthroline (Cu(OP)2) and N-ethylmaleimide (NEM) (Figure 3
C and D, respectively), reagents that react with intermembrane
space exposed thiols [17,18], to induce mtPTP transition from a
closed to open conformation (Figure 3 A-D, traces b). Samples
were treated either with 1.5 µM CsA or 1.5 µM TR001 prior to Ca2+
and oxidant addition. In all cases both CsA and TR001 delayed
mtPTP opening, with TR001 being much more effective than CsA.
TR001 is a potent inhibitor of the mtPTP
Figure 3. TR001 prevents chemical activation induced mitochondrial swelling. A-D) mouse liver mitochondria (0.25 mg/mL) were treated with 10 µM Ca2+ only
(traces a); 10 µM Ca2+ and after 2 min of incubation with: A) 7 µM PhAsO, B) 2 mM Diamide, C), 7 µM Cu(OP)2, D), 2 mM NEM (traces b-d). In traces c and d additions
were as in traces b except that mitochondria were also treated with 1.5 µM CsA (traces c) or TR001 (traces d). Traces are representative of n=4 independent
preparations.
CyPD,— the target of CsA,—we performed the CRC test in
CyPD is not a target of TR001
permeabilized WT or CypD-null HEK 293T cells. In contrast to
CsA, which had no effect on CypD-null cells, TR001 increased the
CRC in both WT and CyPD-null cells (Figure 4 B). Taken together,
these results provide strong evidence that CyPD is not the target
of TR001.
The above experiments demonstrate that TR001 is a more
potent mtPTP inhibitor than CsA. We next asked if TR001 acts on
a different target than CsA. We found that TR001 was additive
with CsA (Figure 4 A), supporting the notion that TR001 and CsA
act on different targets. To directly determine if TR001 acts on
6
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
Figure 4. TR001 inhibits the mtPTP independently of CyPD. A, CRC ratios of mouse liver mitochondria treated with TR001 only (trace a) or in combination with 2
µM CsA (trace b). Data are average ± SEM of 7 and 5 independent preparations, respectively. B, CRCs of permeabilized HEK293T WT or CyPD KO cells treated
with DMSO, 10 µM CsA or 10 µM TR001. Each spike in fluorescence indicates 10 µM Ca2+ injection. Traces are representative of 4 independent preparations.
TR001 does not affect mitochondrial or cultured cell health
A thorough evaluation of toxicity is critical for advancing TR001
for in vivo studies. Initial assessment using the Rh123 uptake
assay showed that TR001 did not interfere with IMM potential. To
more thoroughly examine mitochondrial toxicity, we
analyzed oxygen consumption rates (OCRs) using the Seahorse
XF24 extracellular flux analyzer. This allowed us to assess the
effects of TR001 on mitochondrial respiration and ATP synthesis.
We found that TR001 had no effect on rates of oxygen
consumption upon ADP stimulation (ATP production), after ATP
synthase inhibition with oligomycin (basal respiration), or
uncoupling with FCCP (maximal respiratory capacity) in isolated
mitochondria (Figure 5 A). Consequently respiratory control ratios
(i.e., the ratios between ADP-stimulated and basal respiration)
were not affected up to 50 µM TR001 (Figure 5 B). Complex III
inhibitor antimycin A shuts down the electron transport chain at
the bc1 complex and was used to account for oxygen leak. Similar
results were obtained in intact cells (i.e., TR001 did not cause
mitochondrial dysfunction in the course of ~ 2 h treatment) (Figure
5 C). Finally, TR001 (up to 50 µM) did not exhibit any adverse
effects on HeLa cell viability (Figure 5 D). Together, these results
demonstrate that the TR001 is not toxic to mitochondria or cells.
Figure 5. TR001 is not toxic to either mitochondria or intact cells. Oxygen consumption rates (OCR) of isolated mitochondria, A, or HeLa cell monolayers, C, were
measured in the presence of indicated concentrations of TR001. Traces are representative of 4 and 5 separate experiments, respectively. B, Respiratory control
7
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
ratios of isolated mitochondria. D, Interference with HeLa cell proliferation after 24 h treatment with TR001. B and D, data are average ± SEM of 4 and 6 independent
experiments.
rescued the defect observed in col6a1 morphants in a dose-
Assessment of the therapeutic potential of TR001 in a
vertebrate model of mtPTP-based disease
dependent manner; in contrast, 63 had no effect (Figure 6 A). We
next evaluated touch-evoked escape responses to determine the
ability of zebrafish embryos to start swimming after a mechanical
stimulus. Touch-evoked escape responses were measured 48
hpf, (27 hours of treatment with inhibitor). col6a1 morphants
showed a severely reduced motility, which was improved by
treatment with TR001 (Figure 6 B). By contrast, treated with 63
resulted in minimal recovery at 0.1-1.0 µM, an effect that was no
longer seen at 10 µM (Figure 6 B). It should be noted that in these
protocols, embryos were exposed to drugs for a longer period of
time than in the spontaneous coiling experiments. This difference
explain why TR001 was as effective at 0.1 µM as it was at 1 and
10 µM.
Muscle structure was assessed by birefringence analysis at 48
hpf, a time when muscle tissue is fully developed and organized
muscle fibers start to show anisotropic features. A high
percentage of severe birefringence abnormality (>75%, Figure 6
C) was detected in col6a1 morphants, indicating major defects of
muscle fiber development and organization. TR001 significantly
rescued this defect in muscle structure in col6a1 morphants
whereas 63 exhibited a minimal effect (Figure 6 C).
To test the effects of both TR001 and 63 on the respiration of
col6a1 morphant embryos, we measured the OCR on entire
embryos at 48 hpf. Sequentially, we measured (i) the basal
respiration, (ii) the coupled respiration through the addition of 10
µM oligomycin which inhibits the activity of ATP Synthase, (iii) the
maximal respiratory capacity by adding 2 µM of the uncoupler
FCCP, and (iv) the mitochondrial respiration after the inhibition of
Complexes I and III by adding 1 µM rotenone and 1 µM antimycin
A. We found that respiration of col6a1 morphants (closed
squares) was significantly lower (p<0.001) than that of embryos
injected with scrambled morpholino (open squares) (Figure 6 D).
Moreover, TR001 at a concentration of 10 µM was able to fully
restore the maximal respiratory capacity (Figure 6 D, left panel,
open diamonds, p<0.001) of col6a1 morphants. In general,
TR001 at all concentration used (Figure 6 D, left panel) was more
effective than 63 (Figure 6 D, right panel).
Lastly, fish survival was also assessed. Fifty percent of col6a1
morphant embryos treated with 0.1 µM of TR001 survived 7 days
longer than col6a1 morphants treated with DMSO (p<0.0001 from
3 to 12 dpf), and 20% were still alive at 30 dpf (29 days of
treatment) (Figure 6 E). Moreover, treatment with 1 μM TR001
was also effective at improving survival rate of col6a1 morphants
(p<0.01 from 3 to 12 dpf), while 10 μM TR001 was ineffective. The
lowest concentration of 63 tested showed decreased activity
compared to TR001 and the rest were ineffected (Figure 6 E).
Long-lasting opening of the mtPTP, likely due to mitochondrial
Ca2+ overload [19], is a common downstream mechanism during
the pathogenesis of several muscular dystrophies, like Ullrich
Congenital Muscular Dystrophy (UCMD). This is a life-threatening
disorder caused by mutations in genes encoding collagen VI.
These mutations result in defective or absent collagen VI, an
essential component of extracellular matrix in skeletal muscle.
Mouse models of UCMD with knock-outs for the murine Col6a1
gene exhibit relatively mild phenotypes when compared to those
observed in humans. However, it is widely documented that
inappropriate mtPTP activity, both in humans and mice, plays a
key role in disease pathogenesis [20–22]. Desensitization of the
mtPTP both in mice and human cell lines, using either
pharmacological treatment with CyP inhibitors (CsA and its non-
[20,23]
immunosuppressive derivatives)
gene encoding CyPD
or elimination of the Ppif
[21]
were found to restore normal
mitochondrial function and to decrease myofiber cell death. An
additional model of UCMD has been generated in zebrafish
through the injection of an antisense morpholino oligonucleotide
directed to the exon 9 splicing region of the human orthologous
col6a1 gene in zebrafish, resulting in an in-frame deletion
mimicking common mutations in human UCMD [24,25]. Morpholino-
injected animals (morphants) developed a severe myopathy
which accurately mimicked the clinical severity of human UCMD
with early-onset motor deficits and severe muscular and
mitochondrial ultrastructural changes. This severe phenotype was
reversed by treatment with non-immunosuppressive derivatives
of CsA [25]. Thus, we used the zebrafish col6a1 myopathic
morphant as a powerful in vivo system to validate the therapeutic
potential of TR001 and compared it to the isoxazole compound
63 which exhibits similar potency to TR001, but substantially
decreased plasma stability (Table 1).
Zebrafish embryos were injected with col6a1 morpholino at the
1-cell stage, dechorionated at 20 hours post fertilization (hpf) and
treated at 21 hpf with 0.1, 1 or 10 μM of either TR001 or 63.
DMSO-treated embryos injected with a scrambled morpholino
were used as a control. Motor deficits due to a delay in muscle
fiber development were evaluated by measuring both
spontaneous contractions and swimming abilities at early stages
of embryo development when the muscles are not fully developed.
Spontaneous coiling events were monitored at 24 hpf after
3 hours of inhibitor treatment. col6a1 morphants exhibited a
substantial decrease in the number of spontaneous coiling events
compared to zebrafish injected with a scrambled morpholino and
treated with vehicle (Figure 6 A). Treatment with TR001 partially
8
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
Figure 6. TR001, but not 63, showed efficacy in a zebrafish model of a muscular dystrophy based on dysregulation of the mtPTP. A, Spontaneous coiling events
were recorded at 24 hpf in DMSO-treated zebrafish injected with the scrambled morpholino (scrd_MO), DMSO-treated col6a1 morphants (col6a1_MO) and col6a1
morphants (col6a1_MO) treated with the indicated concentrations of TR001 or 63. Data report the number of spontaneous coiling events in 15 seconds and are
reported as mean ± SEM of 6 independent experiments (n=52 for each condition); **p < 0.01,***p < 0.001 as analyzed by one-way ANOVA with Bonferroni correction.
B, Touch-evoked escape responses were recorded at 48 hpf. Embryos were divided in four sub-groups according the phenotype observed: paralyzed (black bar),
coiling only (gray bar), low motility (hatched bar) and normal (white bar). Data are reported as percentage of these phenotypes per each treatment condition.
Comparison between groups were made using χ2 test and one-way ANOVA with Bonferroni correction; #/*p < 0.05, ##/**p < 0.01, ###/***p < 0.001. The symbol * is
for statistical analysis comparing DMSO-treated col6a1 morphants (col6a1_MO) and those treated with increasing doses of both TR001 and 63; the symbol # is
used for statistical analysis comparing the two groups of col6a1_MO treated with TR001 or 63. Six independent experiments were performed. C, Birefringence was
measured at 48 hpf and zebrafish embryos were divided in 3 subgroups according the phenotype observed: normal (white bar), mild (gray bar) and severe (black
bar) phenotype. Four independent experiments were performed and the final number of zebrafish embryo per group was 40 for each condition. Data are reported
as the percentage of birefringence phenotypes. Data were analyzed by using χ2 test and one-way ANOVA with Bonferroni correction; #/*p < 0.5, ##/**p < 0.01, ###/***p
< 0.001. D, oxygen consumption rate (OCR) was measured on entire zebrafish embryos at 48 hpf. Left panel represents data from embryos injected with a scrambled
morpholino (scrd_MO, ), Exon 9 col6a1 morpholino (col6a1_MO, ) and col6a1_MO embryos treated with TR001 at 0.1 µM ( ), 1.0 µM ( ), 10 µM ( ). Right
panel represents data from embryos injected with a scrambled morpholino (scrd_MO, ), Exon 9 col6a1 morpholino (col6a1_MO, ) and col6a1_MO embryos
treated with 63 at 0.1 µM ( ), 1.0 µM ( ), 10 µM ( ). Embryos were treated with oligomycin, FCCP, rotenone (R) and antimycin A (A) as indicated. Results are
presented as mean ± SEM. Both graphs report data from 5 independent experiments with n=20 for each treatment. Error bars are reported as SEM. E, Survival of
DMSO-treated zebrafish injected with the scrambled morpholino ( ), DMSO-treated col6a1 morphants ( ) and col6a1 morphants treated with: left panel, TR001
(0.1 μM, ; 1.0 μM, ; 10 μM, ) or right panel, 63 (0.1 μM, ; 1.0 μM, ; 10 μM, ) were recorded for 30 days. Treatment started at 21 hpf and repeated at 4 dpf
(arrows). Data report the percentage of surviving fish and are mean ± SEM from 3 independent experiments (n=15 for each condition in each set).
9
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
3-amino-5-(trifluoromethyl)phenol (2g). Quantitative yield. 1H NMR
(d6-DMSO) δ 9.80 (s, 1H); 6.73 (s, 2H); 6.46 (s, 1H); 6.39 (s, 1H); 6.53 (s,
1H).
3-amino-2,6-difluorophenol (2h). 87% yield. 1H NMR (d6-DMSO) δ
9.67 (s, 1H); 6.67 (m, 1H); 6.15 (m, 1H); 4.87 (s, 2H).
Conclusions
In this study, we demonstrate that replacing the core isoxazole
in our previously described mtPTP inhibitor 63 with a triazole
(TR001) results in improved plasma stability while maintaining
potent mtPTP inhibition. Because the triazole analogs could be
generated in a facile manner, we were able to perform SAR
studies focused on the effects of substituents on phenolic ring at
N-1 of the triazoles. These studies revealed a tight SAR, with a
preference for a fluorine at the ortho or meta position of the
phenolic ring. The tight SAR suggests that the phenolic ring
projects into a well-defined pocket on a yet-to-be-identified target.
The SAR studies performed in this study will guide the
development of analogs for target identification. Finally, we
demonstrated in an animal model of a muscular dystrophy based
on dysregulation of the mtPTP the triazole TR001 is more
efficacious than the sterically equivalent isoxazole 63. Our studies
guide the further development of these compounds as potential
therapies for a wide variety of human pathologies in which
dysfunction of the mtPTP plays a key role.
General procedure for aryl azide formation. Aniline (2 mmol) was
dissolved in 4 mL of AcOH. Tetrafluoroboric acid etherate (0.8 mL, 6 mmol)
was added, followed by sodium nitrite (0.2 g, 3 mmol) in three portions
over 30 min. The mixture was added dropwise to 40 mL of vigorously
stirring Et2O at 0° C. The resulting light brown precipitate was collected by
filtration, then used in the next step without further purification. Sodium
azide (0.13 g, 4 mmol) was dissolved in 20 mL of H2O at 0° C. The
diazonium from step 1 was added, followed by the addition of 20 mL of
EtOAc, then the reaction was stirred to RT over 18 hr. The reaction was
extracted 3X with 25 mL of EtOAc. The organic fractions were combined,
washed 2X with 10 mL of brine, then dried with MgSO4, filtered, and
concentrated.
3-azido-5-fluorophenol (3b). 76% yield. 1H NMR (D6-acetone) δ 9.57
(s, 1H); 6.39 (m, 3H).
3-azido-4-fluorophenol (3c). 71% yield. 1H NMR (CDCl3) δ 6.98 (t,
1H); 6.56 (m, 2H); 4.87 (s, 1H).
1
5-azido-2-chlorophenol (3d). 62% yield. H NMR (CDCl3) δ 7.32 (d,
1H); 6.73 (d, 1H); 6.59 (dd, 1H); 5.63 (s, 1H).
1
3-azido-2-fluorophenol (3e). 40% yield. H NMR (CDCl3) δ 6.99 (m,
1H); 6.80 (m, 1H); 6.67 (m, 1H); 5.25 (s, 1H).
5-azido-2-bromophenol (3f). 31% yield. 1H NMR (CDCl3) δ 7.43 (d,
1H); 6.73 (d, 1H); 6.54 (dd, 1H); 5.60 (s, 1H).
3-azido-2-chlorophenol (3g). 60% yield. 1H NMR (CDCl3) δ 7.22 (t,
1H); 6.84 (dd, 1H); 6.80 (dd, 1H); 5.70 (s, 1H).
Experimental Section
Chemistry
5-amino-2-fluorophenol tetrafluoroborate. 1 (2.5 g, 16 mmol) was
dissolved in 80 mL of EtOH. Tetrafluoroboric acid etherate (4.35 mL, 32
mmol) and Pd/C (10% w/v, 0.25 g) were added, then the mixture was
placed under a hydrogen atmosphere (20 psi) for 18 hr with shaking. The
Pd/C was removed by filtration over celite, then the solution was
concentrated to give 3.357 g of 2a (98% yield). 1H NMR (d6-DMSO) δ
10.49 (s, 1H); 9.64 (s, 3H); 7.25 (q, 1H); 6.93 (q, 1H); 6.73 (m, 1H).
5-azido-2-fluorophenol. 2a (1.655 g, 7.7 mmol) was dissolved in 15
mL of AcOH. Tetrafluoroboric acid etherate (2.62 mL, 19.2 mmol) was
added, followed by sodium nitrite (0.8 g, 11.5 mmol) in three portions over
30 min. The mixture was added dropwise to 150 mL of vigorously stirring
Et2O at 0° C. The resulting light brown precipitate was collected by filtration,
then used in the next step without further purification. Sodium azide (5 g,
77 mmol) was dissolved in 77 mL of H2O at 0° C. The diazonium from step
1 was added and stirred for 15 min at 0° C. The reaction was extracted 3X
with 25 mL of EtOAc. The organic fractions were combined, washed 2X
with 10 mL of brine, then dried with MgSO4, filtered, and concentrated to
1
5-azido-2-methylphenol (3h). 29% yield. H NMR (CDCl3) δ 7.09 (d,
1H); 6.56 (dd, 1H); 6.49 (d, 1H); 5.36 (s, 1H); 2.23 (s, 3H).
3-azido-2-methylphenol (3i). 20% yield. 1H NMR (CDCl3) δ 7.12 (t,
1H); 6.77 (d, 1H); 6.60 (d, 1H); 4.78 (s, 1H); 2.13 (s, 3H).
3-azido-5-chlorophenol (3j). 72% yield. 1H NMR (CDCl3) δ 6.65 (d,
2H); 6.42 (t, 1H); 5.10 (s, 1H).
3-azido-5-(trifluoromethyl)phenol (3k). 15% yield. 1H NMR (d6-
DMSO) δ 10.52 (s, 1H); 6.87 (s, 1H); 6.84 (s, 1H); 6.77 (s, 1H).
3-azido-2,6-difluorophenol (3l). 13% yield. 1H NMR (CDCl3) δ 6.91
(m, 1H); 6.60 (m, 1H); 5.56 (s, 1H).
1
3-azido-2-chloro-6-methylphenol (3m). 86% yield. H NMR (CDCl3)
δ 7.06 (d, 1H); 6.70 (d, 1H); 5.77 (s, 1H); 2.28 (d, 3H).
N-(5-chloro-2-methylphenyl)propiolamide. Propiolic acid (7 g, 0.1
mol) was dissolved in acetonitrile (400 mL) then cooled to 0° C. DCC (22.7
g, 0.11 mol) was added, followed by 4 (21.24 g, 0.15 mol), then the reaction
was stirred to RT over 18 hr. The precipitated DCU was removed by
filtration, then the clear solution was concentrated. The crude solid was
washed with hexanes, followed by DCM. Additional product was
precipitated from the DCM fraction at 0° C. The product was combined and
dried to give 12.57 g of 5 (65% yield). 1H NMR (CDCl3) δ 7.99 (s, 1H); 7.12
(q, 2H); 2.99 (s, 1H); 2.29 (s, 3H).
1
give 0.97 g of 3a (82% yield). H NMR (d6-DMSO) δ 10.28 (q, 1H); 7.18
(m, 1H); 6.66 (q, 1H); 6.54 (m, 1H).
General procedure for BBr3 demethylation. A flask was loaded with
molecular sieves (3Å) and flame dried under vacuum. After cooling under
argon, starting methyl ether (2 mmol) was loaded, followed by 10 mL of
dry DCM. The flask was sealed and degassed, then the solution was
cooled to -78° C. BBr3 (0.9 mL, 10 mmol) was added dropwise, then the
reaction was stirred for 18 hr to RT. The reaction was decanted into excess
aqueous sat. sodium bicarbonate, then extracted 3X with 20 mL of EtOAc.
The organic fractions were combined, washed 2X with 20 mL of brine, then
dried with MgSO4, filtered, and concentrated to give product in 20% to
quantitative yield.
General procedure for triazole coupling. Starting azide (3a-i) (1
mmol), 5 (0.19 g, 1 mmol), CuSO4•5 H2O (25 mg, 0.1 mmol), and sodium
ascorbate (0.1 g, 0.5 mmol) were dissolved in 5 mL of EtOH. The reaction
was refluxed for 18 hr at 80° C. After cooling to RT the reaction mixture
was diluted with 10 mL of 50% EtOH/50% H2O, then the resulting
precipitate was collected by filtration.
N-(5-chloro-2-methylphenyl)-1-(4-fluoro-3-hydroxyphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR001). 76% yield. 1H NMR (d6-DMSO) δ
10.10 (s, 1H); 9.37 (s, 1H); 7.62 (d, 1H); 7.58 (d, 1H); 7.41 (d, 2H); 7.32 (d,
1H); 7.24 (dd, 1H); 2.77 (s, 3H).
N-(5-chloro-2-methylphenyl)-1-(3-fluoro-5-hydroxyphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR002). 30% yield. 1H NMR (d6-DMSO) δ
10.65 (s, 1H); 10.17 (s, 1H); 9.47 (s, 1H); 7.61 (s, 1H); 7.39 (d, 1H); 7.32
(m, 2H); 7.24 (t, 1H); 6.75 (d, 1H); 2.74 (s, 3H).
N-(5-chloro-2-methylphenyl)-1-(2-fluoro-3-hydroxyphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR003). 62% yield. 1H NMR (d6-DMSO) δ
3-amino-2-fluorophenol (2b). Quant. yield. 1H NMR (CDCl3) δ 6.81
(m, 1H); 6.38 (m, 2H); 5.02 (s, 1H); 3.75 (s, 2H).
1
3-amino-5-fluorophenol (2c). 20% yield. H NMR (d6-DMSO) δ 9.28
(s, 1H); 5.81 (d, 1H); 5.78 (dt, 1H); 5.68 (dt, 1H); 5.25 (s, 2H).
5-amino-2-bromophenol (2d). 74% yield. 1H NMR (CDCl3) δ 7.19 (d,
1H); 6.39 (d, 1H); 6.20 (dd, 1H); 5.39 (s, 1H); 3.72 (s, 2H).
3-amino-2-chlorophenol (2e). Quantitative yield. 1H NMR (CDCl3) δ
6.98 (t, 1H); 6.45 (dd, 1H); 6.38 (dd, 1H); 5.44 (s, 1H); 4.05 (s, 2H).
1
3-amino-5-chlorophenol (2f). 55% yield. H NMR (d6-DMSO) δ 9.32
(s, 1H); 6.02 (d, 1H); 5.92 (d, 2H); 5.27 (s, 2H).
10
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
10.68 (s, 1H); 10.18 (s, 1H); 9.19 (s, 1H); 7.61 (s, 1H); 7.33 (t, 1H); 7.24
(m, 4H), 2.28 (s, 3H).
N-(5-chloro-2-methylphenyl)-1-(2-fluoro-5-hydroxyphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR004). 71% yield. 1H NMR (d6-DMSO) δ
10.18 (s, 1H); 10.13 (s, 1H); 9.17 (d, 1H); 7.60 (s, 1H); 7.44 (t, 1H); 7.36
(d, 1H); 7.23 (m, 2H); 7.00 (m, 1H); 2.27 (s, 3H).
N-(5-chloro-2-methylphenyl)-1-(2,4-difluoro-3-hydroxyphenyl)-1H-
1,2,3-triazole-4-carboxamide) (TR005). 61% yield. 1H NMR (d6-DMSO)
δ 11.13 (s, 1H); 10.20 (s, 1H); 9.19 (s, 1H); 7.60 (s, 1H); 7.30 (d, 3H); 2.28
(s, 3H).
N-(5-chloro-2-methylphenyl)-1-(4-chloro-3-hydroxyphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR006). 96% yield. 1H NMR (d6-DMSO) δ
10.12 (s, 1H); 9.41 (s, 1H); 7.26 (s, 3H); 7.44 (s,1H); 7.32 (d, 1H); 7.24 (d,
1H); 2.51 (s, 3H).
using a Gemini-NX C18 50x2.1 mm column (Phenomenex) with 0.1%
formic acid (solvent A) and 0.1% formic acid in acetonitrile (solvent B). The
injection volume was 10 µL at a flow rate of 0.75 mL/min. The gradient
elution was 10% B to 95% B over 5 min and held at 95% for 1 min before
returning to start conditions. The column was maintained at 40C using a
Shimadzu CTO-20AC column oven. Data were acquired using Analyst
1.6.2 and analyzed using Multiquant 3.0.1 software. The first-order rate
constant for substrate depletion was determined from a linear least
squares fit of the natural log of the percent parent compound remaining
versus time. The rate constant was used to calculate the plasma half-life
as an indicator of stability.
Mouse studies. All procedures were approved by the Institutional
Animal Care and Use Committee (IACUC) at Oregon Health and Science
University (IP00000689 to M.F.).
N-(5-chloro-2-methylphenyl)-1-(2-chloro-3-hydroxyphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR007). 85% yield. 1H NMR (d6-DMSO) δ
11.01 (s, 1H); 10.18 (s, 1H); 9.17 (s, 1H); 7.62 (s, 1H); 7.39 (m, 1H); 7.32
(m, 1H); 7.24 (m, 2H); 7.18 (m, 1H); 2.28 (s, 3H).
N-(5-chloro-2-methylphenyl)-1-(3-chloro-5-hydroxyphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR008). 82% yield. 1H NMR (d6-DMSO) δ
10.65 (s, 1H); 10.16 (s, 1H); 9.48 (s, 1H); 7.60 (d, 2H); 7.42 (s, 1H); 7.32
(d, 1H); 7.24 (d, 1H); 6.98 (s, 1H); 2.27 (s, 3H).
1-(4-bromo-3-hydroxyphenyl)-N-(5-chloro-2-methylphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR009). 81% yield. 1H NMR (d6-DMSO) δ
11.03 (s, 1H); 10.16 (s, 1H); 9.43 (s, 1H); 7.74 (d, 1H); 7.60 (m, 2H); 7.38
(d, 1H); 7.32 (d, 1H); 7.24 (m, 1H); 2.27 (s, 3H).
Isolation of mitochondria. C57BL6/N mouse liver mitochondria were
prepared from 2 to 6 month old male mice by standard differential
centrifugation. Mice fed ad libitum were euthanized with CO2 followed
cervical dislocation, their livers were existed and placed in a glass beaker
containing ice-cold isolation buffer (IB: 0.25 M sucrose, 10 mM Tris-HCl,
0.1 mM EGTA-Tris, pH 7.4) supplemented with fatty acid free bovine serum
albumin. Livers were then cut into small pieces with scissors, rinsed with
ice-cold IB, and passed through a pre-chilled Potter homogenizer with
Teflon pestle. The homogenate (~ 30 mL per liver) was transferred to
centrifuge tubes, and unbroken cells and nuclei were removed by
centrifugation at 700 g for 10 min at 4 °C. The supernatant containing
mitochondria and other organelles was transferred to new tubes and
centrifuged at 6000 g for 10 min at 4 °C. The resulting supernatant was
discarded and mitochondrial pellet was carefully suspended in ice-cold IB
and spun at 9500 g for 5 min at 4°C. The pellet was suspended in IB to
give a protein concentration of ~ 60–80 mg/mL and stored on ice.
Experiments were started immediately and completed within 5 h. Protein
concentration was determined by the Biuret method.
N-(5-chloro-2-methylphenyl)-1-(2-chloro-3-hydroxy-4-
methylphenyl)-1H-1,2,3-triazole-4-carboxamide (TR010). 90% yield. 1H
NMR (d6-DMSO) δ 10.14 (s, 1H); 9.90 (s, 1H); 9.12 (s, 1H); 7.62 (d, 1H);
7.32 (d, 2H); 7.24 (dd, 1H); 7.14 (d, 1H); 2.32 (s, 3H); 2.28 (s, 3H).
N-(5-chloro-2-methylphenyl)-1-(3-hydroxy-4-methylphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR011). 65% yield. 1H NMR (d6-DMSO) δ
10.11 (s, 1H); 10.05 (s, 1H); 9.34 (s, 1H); 7.62 (s, 1H); 7.41 (s, 1H); 7.31
(m, 3H); 7.23 (d, 1H); 2.27 (s, 3H); 2.19 (s, 3H).
Assessment of mitochondrial swelling. Changes in mitochondrial
volume of isolated mouse liver mitochondria were followed in a 96-well
clear assay plate at a final volume of 0.2 mL and 0.25 mg/mL mitochondrial
protein. Absorbance was read for 30 min at 540 nm on a Tecan Infinite
F200 plate reader. Activity of test compounds was addressed as follows:
First, 0.1 mL of sucrose assay buffer (SAB: 0.250 M sucrose, 10 mM
MOPS-Tris, 0.01 mM EGTA-Tris, 1.0 mM phosphoric acid-Tris, 10 mM
glutamate and 5 mM malate, pH 7.4) supplemented with twice the CaCl2
concentration required to induce mitochondrial swelling (which was
determined for each preparation of mitochondria, typically 50 µM) was
dispensed to the assay plate. A set of wells also contained 2.0 mM EGTA
(to prevent mitochondrial swelling). The test wells contained a range of
concentrations (in 1:2 serial dilutions) of the compounds of interest or 2%
DMSO. Experiments were started by the addition of 0.1 mL of
mitochondrial suspension (0.5 mg/mL mitochondria in SAB without
respiratory substrates) to the assay plates. EC50s ± SE were determined
with OriginPro software by applying Hill1 function fitting algorithm on
average concentration response data of n=3-41 independent preparations.
Assessment of mitochondrial membrane potential. Mitochondrial
membrane potential – to evaluate toxicity – of isolated mouse liver
mitochondria was assessed based on fluorescence quenching of the
cationic fluorescent dye Rh123 upon its accumulation into mitochondrial
matrix due to inside negative membrane potential. Compounds that
interfere with the build-up or maintenance of IMM potential would shift
Rh123 fluorescence to higher values compared to DMSO treated samples.
Uncoupler FCCP was used to account for nonspecific fluorescence. First,
0.1 mL of SAB was dispensed to a 96-well black assay plate. A set of wells
also contained 0.8 µM FCCP (to prevent Rh123 uptake). The test wells
contained a range of concentrations (in 1:2 serial dilutions) of the
compounds of interest or 2% DMSO. Then, 0.1 mL of 0.5 mg/mL
mitochondria in SAB devoid of respiratory substrates but supplemented
with 0.8 µM Rh123 were added to all wells of the assay plate. Fluorescence
intensity (ex/em 485/535 nm) was read on a Tecan Infinite F200 plate
reader for 7 min and value at 5 min was considered for analysis. EC50s ±
SE were determined with OriginPro software by applying Hill1 function
fitting algorithm on average concentration response data of n=3
independent preparations.
N-(5-chloro-2-methylphenyl)-1-(3-hydroxy-2-methylphenyl)-1H-
1,2,3-triazole-4-carboxamide (TR012). 85% yield. 1H NMR (d6-DMSO) δ
10.12 (s, 1H); 10.10 (s, 1H); 9.07 (s, 1H); 7.63 (d, 1H); 7.32 (d, 1H); 7.24
(m, 2H); 7.05 (d, 1H); 6.95 (d, 1H); 2.28 (s, 3H); 1.93 (s, 3H).
N-(5-chloro-2-methylphenyl)-1-(3-(trifluoromethyl)-5-
hydroxyphenyl)-1H-1,2,3-triazole-4-carboxamide (TR013). 32% yield.
1H NMR (d6-DMSO) δ 10.89 (s, 1H); 10.19 (s, 1H); 9.60 (s, 1H); 7.84 (s,
1H); 7.73 (s, 1H); 7.61 (s, 1H); 7.33 (d, 1H); 7. 24 (m, 2H); 2.28 (s, 3H).
Biological evaluation, in vitro studies
Reagents. General reagents were from Sigma-Aldrich or Fisher. CsA,
phenylarsine oxide, diamide, N-ethylmaleimide, carbonyl cyanide-4-
(trifluoromethoxy)phenylhydrazone (FCCP) were from Sigma–Aldrich,
digitonin was from Acros organics, rhodamine 123 (Rh123) and Calcium
Green-5N were from ThermoFisher Scientific, copper-o-phenanthroline
was prepared just before use by mixing CuSO4 with o-phenanthroline at a
1:2 molar ratio in double-distilled water.
Plasma stability determination. The degradation of TR001 in the
presence of mouse plasma (from Innovative Research) was used to
predict the plasma stability of the compound to esterase catalyzed
hydrolysis. A positive control for plasma cholinesterase, propantheline
bromide, was included in all assays. Briefly, murine plasma was incubated
with 1 µM TR001. Aliquots were removed at t=0, 5, 15, 30, and 60 and 120
min and quenched with acetonitrile containing structurally related
compound (TR073) as the internal standard. The amount of TR001
remaining in the supernatant was assessed by LC-MS/MS in multiple
reaction monitoring mode (MRM) using a 4000 QTRAP (SCIEX) with
electrospray ionization source. The instrument was operated in negative
mode with source parameters: source voltage -4500 kV, GS1 50, GS2 50,
CUR 30, TEM 650 and CAD gas MED. Optimal MRM transitions were
obtained by direct infusion of the pure compound into the source. The
mass spectrometer was interfaced to a Shimadzu (Columbia, MD) SIL-
20AC XR auto-sampler maintained at 35 °C followed by 2 LC-20AD XR
LC pumps. The internal standard and compound of interest were resolved
11
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
Assessment of Ca2+ retention capacity (CRC). CRC of isolated
mouse liver mitochondria was assessed as follows: First, 0.1 mL of SAB
were dispensed to a 96-well black assay plate in the presence of 2%
DMSO (control wells) or varying concentrations of test compounds, in 1:2
serial dilutions. Then, 0.1 mL of 0.5 mg/mL mitochondria in SAB devoid of
respiratory substrates, but supplemented with 1 µM Calcium Green-5N
were added to all wells of the assay plate. A train of 10 µM CaCl2 pulses
was added at 2 min intervals, and fluorescence intensity (ex/em 485/535
nm) was read on Tecan Infinite F200 plate reader.
Cell culture. HeLa and Hek239T cells were grown in Dulbecco’s
modified Eagle’s medium (DMEM) supplemented with 10 % fetal bovine
serum, 100 U/mL penicillin and 100 mg/mL streptomycin in a humidified
atmosphere of 5% CO2/95% air at 37 °C.
morning, the transparent wall was removed and the zebrafish were free for
courtship and mating. Fertilized eggs were collected and kept in fish water,
containing 0.5 mM NaH2PO4 (Sigma-Aldrich, S8282), 0.5 mM NaHPO4
(Sigma-Aldrich, S7909) and 3 mg/L instant ocean (Instant Ocean, SS15-
10), at 28.5°C. All procedures were approved by the OPBA of the
University of Padova and authorized by the Italian Ministry of Health
(415/2015).
Morpholino antisense injection and treatment. Knock-down of
col6a1 gene expression was obtained with a previously published
morpholino [25] with sequence GAG AGC GGA AGA CGA ACC TTC ATT
C (GeneTools, Inc.). A control morpholino with no sequence homology in
the zebrafish genome was used in parallel (CCT CTT ACC TCA GTT ACA
ATT TAT A). Zebrafish eggs from wild-type matings were injected at the 1-
2 cell stage with approximately 10 nL of 0.1 mM morpholino solution
(corresponding to 4 ng of morpholino) using a WPI pneumatic PicoPump
PV820 injector (World Precision Instruments, Inc.). Zebrafish embryos
were dechorionated at 20 hours post fertilization (hpf) and treated at 21
hpf with increasing doses (0.1, 1 and 10 µM) of both TR001 and 63
compounds dissolved in fish water with 1% DMSO (vehicle).
Motor activity. The number of spontaneous coiling events performed
in 15 seconds by single zebrafish embryos was recorded at 24 hpf by light
microscopy. Touch-evoked escape responses were recorded at 48 hpf by
observing the ability of zebrafish embryos to escape after a tail-touch with
a little tip. Embryos were subdivided in 4 groups according to the observed
phenotype: paralyzed embryos, score 0; underdeveloped embryos
showing only coiling events, score 1; embryos showing lower motility,
score 2; normal embryos, score 3.
Survival. Zebrafish survival was monitored every 3 days for 30 days.
Drug treatment with both TR001 and 63 dissolved in fish water with 1%
DMSO started at 21 hpf. After 3 days of treatment (4 days post fertilization,
dpf), zebrafish were moved to a bigger tank (50 mL) with fresh compounds
dissolved in 1% DMSO. As a control vehicle, fish water with 1% DMSO
was used.
Generation of CyPD-null cells. The CRISPR/Cas9 system was used
to create HEK293T lines lacking the expression of the gene, Ppif, encoding
CyPD.
The
guide
used
for
the
CRISPR
was
CCGACCCGCGCCCGCGATGC (TGG) which targets the second amino
acid of the coding sequence. Following transfection, individual cell lines
were selected and expanded as outlined in Antoniel et al. [26]. Western blot
analysis of selected clones indicated the absence of CyPD protein in
several clones. Subsequent sequence analysis of these null clones
indicated the introduction of an early frame shift mutation that halted
protein expression.
CRC of permeabilized cells. Wild-type or CyPD-null HEK239T cells
were cultured for 48 h to reach 70–80 % confluency, then harvested by
trypsinization and washed in KCl buffer (KB: 0.13 M KCl, 10 mM MOPS-
Tris, 1 mM phosphoric acid-Tris, 0.1 mM EGTA-Tris, pH 7.4). Cells were
then suspended in KB (except that EGTA-Tris was increased to 1.0 mM)
to 106 cells/mL and treated with 0.1 mM digitonin for 10 min on ice to
permeabilize the plasma membrane. Following excess digitonin
elimination by washing cells twice in ice-cold KB, the cells were suspended
to 2 x 107 cells per mL in ice-cold KB containing 10 µM EGTA-Tris and kept
on ice. CRC was assessed in a black 96-well plate in a final volume of 0.2
mL and buffer containing 0.13 M KCl, 10 mM MOPS-Tris, 1 mM phosphoric
acid-Tris, 0.01 mM EGTA-Tris, 5 mM glutamate, 2.5 mM malate and 0.5 µM
Calcium Green-5N. A train of 10 µM Ca2+ pulses was added at 4 min
intervals, and fluorescence intensity (ex/em 485/535 nm) was read on
Tecan Infinite F200 plate reader.
Measurement of respiration. Mitochondrial oxygen consumption of
isolated mitochondria or HeLa cell monolayer was assessed with the
Seahorse Extracellular Flux Analyzer XF24 (Seahorse Bioscience,
Billerica, MA, USA). Isolated mouse liver mitochondria: Mitochondrial
assay solution contained 220 mM mannitol, 70 mM sucrose, 25 mM MOPS-
Tris, 10 mM Pi-Tris, 5 mM MgCl2, 1 mM EGTA-Tris, 0.2% fatty acid free
BSA, 5 mM succinate and 2 µM rotenone, pH 7.4. Mitochondria (5 µg,
suspended in 50 µL mitochondrial assay solution) were added to each well
of an XF24 cell culture microplate, centrifuged at 2000 g for 20 min at 4°C
and then supplemented with 450 µL of mitochondrial assay solution
containing 4 mM ADP to initiate the experiments. Additions were as
indicated in Figure 5 A.
Birefringence. Muscle structure was monitored by birefringence
analysis, taking advantage of muscle anisotropy, which is the ability of
muscle fibers to refract polarized light. Briefly, zebrafish embryos at 48 hpf
were anesthetized with 0.02% Tricaine (Sigma-Aldrich, E10521) and
placed in 2% methylcellulose (Sigma-Aldrich, M0387) on a rectangular
glass plate, which was positioned on the light path of a Leica M165FC
stereomicroscope (Leica, Inc.). Two polarized filters were used, the first
placed between the light source and the glass slide, light being refracted
through muscle fibers; the second was placed above the zebrafish
embryos and rotated at a 90° angle relative to the first filter. With this set-
up, light refracted by muscle fibers (due to the pseudo-crystalline array of
sarcomeres) is transmitted and analyzed. Integrated area of birefringence
was calculated using ImageJ software. Birefringence values ≥ 3 x 106
pixels are typical of wild-type embryos, while values between 1 and 3 x 106
pixels and values ≤ 1 x 106 pixels were taken to indicate a mild and severe
myopathy, respectively [25,29]
.
OCR measurement. The Seahorse XF-24 extracellular flux analyzer
(Agilent Technologies, United States, California, Santa Clara) was used to
measure oxygen consumption rate in col6a1 zebrafish morphants at 48
hpf. One day prior to analysis, each well of the Seahorse XF-24
extracellular flux analyzer cartridge (Agilent Technologies, 101122-100)
was filled with 1 mL of Seahorse XF Calibrant (Agilent Technologies,
100840-000) and placed at 37°C overnight. The day after, zebrafish
embryos at 48 hpf were placed in a XF-24 islet capture microplate (one
zebrafish per well). Each well was filled with 670 µL of fish water and an
islet capture screen was fixed on top of each well to prevent zebrafish from
moving out of the measurement chamber. Subsequently, after calibration
of the Seahorse XF 24 Extracellular Flux Analyzer cartridge, the XF-24
capture microplate was loaded in the Seahorse XF-24 Extracellular Flux
Analyzer. First, basal respiration was measured. Second, respiration due
to ATP synthase was measured after addition of 10 µM oligomycin (Merck
Millipore-495455). Third, maximal respiration capacity was measured by
HeLa cells: cells were seeded at a density of 3x104 per well in 0.2 mL
DMEM and cultured for 24 h. Assays were started by re- placing the growth
medium with 0.5 mL serum and antibiotic-free unbuffered DMEM (pH 7.4)
and additions were made as indicated in Figure 5 C.
Cell viability assay. HeLa cells were seeded at a density of 104 per
well in 96-well plates and let to adhere for 6 h before treatment with varying
concentrations of TR001 or vehicle (1% DMSO. After treatment for 24 h
the relative viable cell number was determined with a CellTiter 96 Aqueous
One Solution Cell Proliferation Assay Kit (Promega).
Biological evaluation, in vivo studies in zebrafish
Zebrafish studies. Wildtype adult zebrafish were maintained in the
Zebrafish Facility of the Biology Department of the University of Padova in
aerated saline water, which was continuously filtered by a circulating
system, at 28.5°C with a precise light/dark cyclic conditions (14/10 hours),
according to standard protocols [27,28]. To obtain embryos for injection
experiments, two or three females were paired with two or three males in
a 1.5 litre tank and separated by a transparent wall until morning. The next
adding
2
µM
of
the
uncoupler
carbonyl
cyanide-4-
(trifluoromethoxy)phenylhydrazone (FCCP, Sigma-Aldrich, C2920). Last,
1 µM of the complex I inhibitor, rotenone (Sigma-Aldrich, R8875), and 1 µM
12
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
of the complex III inhibitor, antimycin A (Sigma-Aldrich, A8674) were
added to determine non-mitochondrial (residual) respiration.
Cargnelli, D. Rennison, M. a Brimble, B. Hopkins, P. Bernardi, et al.,
Biochim. Biophys. Acta 2011, 1807, 1600–5.
[19]
[20]
A. Zulian, M. Schiavone, V. Giorgio, P. Bernardi, Pharmacol. Res.
2016, 113, 563–573.
Acknowledgements
W. A. Irwin, N. Bergamin, P. Sabatelli, C. Reggiani, A. Megighian, L.
Merlini, P. Braghetta, M. Columbaro, D. Volpin, G. M. Bressan, et
al., Nat. Genet. 2003, 35, 367–371.
The authors would like to thank Dennis Koop and Lisa Bieyle of
the OHSU Bioanalytical/Pharmacokinetics Core for their
assistance in the in assessing plasma stability of listed
compounds. This work was funded by the Fondation Leducq
(16CVD04).
[21]
[22]
[23]
E. Palma, T. Tiepolo, A. Angelin, P. Sabatelli, N. M. Maraldi, E.
Basso, M. A. Forte, P. Bernardi, P. Bonaldo, Hum. Mol. Genet.
2009, 18, 2024–2031.
A. Angelin, T. Tiepolo, P. Sabatelli, P. Grumati, N. Bergamin, C.
Golfieri, E. Mattioli, F. Gualandi, A. Ferlini, L. Merlini, et al., Proc.
Natl. Acad. Sci. U. S. A. 2007, 104, 991–6.
Conflict of Interest.
T. Tiepolo, a. Angelin, E. Palma, P. Sabatelli, L. Merlini, L. Nicolosi,
F. Finetti, P. Braghetta, G. Vuagniaux, J. M. Dumont, et al., Br. J.
Pharmacol. 2009, 157, 1045–1052.
The authors declare no conflicts of interest.
Keywords: calcium • click chemistry • inhibitors • mitochondria •
muscular dystrophy • permeability transition pore
[24]
[25]
W. R. Telfer, A. S. Busta, C. G. Bonnemann, E. L. Feldman, J. J.
Dowling, Hum. Mol. Genet. 2010, 19, 2433–2444.
A. Zulian, E. Rizzo, M. Schiavone, E. Palma, F. Tagliavini, B.
Blaauw, L. Merlini, N. M. Maraldi, P. Sabatelli, P. Braghetta, et al.,
Hum. Mol. Genet. 2014, 23, 5353–63.
References:
[1]
[2]
G. Szabadkai, M. R. Duchen, Physiology 2008, 23, 84–94.
T. E. Gunter, S.-S. Sheu, Biochim. Biophys. Acta - Bioenerg. 2009,
1787, 1291–1308.
[26]
M. Antoniel, K. Jones, S. Antonucci, B. Spolaore, F. Fogolari, V.
Petronilli, V. Giorgio, M. Carraro, F. Di Lisa, M. Forte, et al., EMBO
Rep. 2018, 19, 257–268.
[3]
[4]
P. Bernardi, A. Krauskopf, E. Basso, V. Petronilli, E. Blalchy-Dyson,
F. Di Lisa, M. A. Forte, FEBS J. 2006, 273, 2077–2099.
P. Bernardi, M. Forte, Novartis Found. Symp. 2007, 287, 157–64;
discussion 164-9.
[27]
[28]
C. B. Kimmel, W. W. Ballard, S. R. Kimmel, B. Ullmann, T. F.
Schilling, Dev. Dyn. 1995, 203, 253–310.
A. Avdesh, M. Chen, M. T. Martin-Iverson, A. Mondal, D. Ong, S.
Rainey-Smith, K. Taddei, M. Lardelli, D. M. Groth, G. Verdile, et al.,
J. Vis. Exp. 2012, e4196.
[5]
[6]
P. Bernardi, Biochim. Biophys. Acta - Bioenerg. 1996, 1275, 5–9.
L. Azzolin, S. von Stockum, E. Basso, V. Petronilli, M. A. Forte, P.
Bernardi, FEBS Lett. 2010, 584, 2504–2509.
[29]
M. Schiavone, A. Zulian, S. Menazza, V. Petronilli, F. Argenton, L.
Merlini, P. Sabatelli, P. Bernardi, Pharmacol. Res. 2017, 125, 122–
131.
[7]
[8]
P. Bernardi, F. Di Lisa, J. Mol. Cell. Cardiol. 2015, 78, 100–106.
J. Šileikytė, E. Blachly-Dyson, R. Sewell, A. Carpi, R. Menabo, F. Di
Lisa, F. Ricchelli, P. Bernardi, M. Forte, J. Biol. Chem. 2014, 289,
13769–13781.
[9]
V. Giorgio, S. von Stockum, M. Antoniel, A. Fabbro, F. Fogolari, M.
Forte, G. D. Glick, V. Petronilli, M. Zoratti, I. Szabo, et al., Proc.
Natl. Acad. Sci. 2013, 110, 5887–5892.
[10]
[11]
J. Šileikytė, M. Forte, Oxid. Med. Cell. Longev. 2019, 2019, 1–11.
E. Basso, L. Fante, J. Fowlkes, V. Petronilli, M. A. Forte, P.
Bernardi, J. Biol. Chem. 2005, 280, 18558–61.
[12]
[13]
[14]
[15]
S. Roy, J. Šileikytė, M. Schiavone, B. Neuenswander, F. Argenton,
J. Aubé, M. P. Hedrick, T. D. Y. Chung, M. A. Forte, P. Bernardi, et
al., ChemMedChem 2015, 10, 1655–1671.
S. Roy, J. Šileikytė, B. Neuenswander, M. P. Hedrick, T. D. Y.
Chung, J. Aubé, F. J. Schoenen, M. A. Forte, P. Bernardi,
ChemMedChem 2016, 11, 283–288.
B. W. Budzik, K. A. Evans, D. D. Wisnoski, J. Jin, R. A. Rivero, G.
R. Szewczyk, C. Jayawickreme, D. L. Moncol, H. Yu, Bioorg. Med.
Chem. Lett. 2010, 20, 1363–1367.
V. D. Filimonov, M. Trusova, P. Postnikov, E. A. Krasnokutskaya, Y.
M. Lee, H. Y. Hwang, H. Kim, K.-W. Chi, Org. Lett. 2008, 10, 3961–
3964.
[16]
[17]
[18]
V. Petronilli, P. Costantini, L. Scorrano, R. Colonna, S. Passamonti,
P. Bernardi, J. Biol. Chem. 1994, 269, 16638–42.
P. Costantini, R. Colonna, P. Bernardi, Biochim. Biophys. Acta -
Bioenerg. 1998, 1365, 385–392.
A. Zulian, J. Šileikytė, V. Petronilli, S. Bova, F. Dabbeni-Sala, G.
13
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201900376
ChemMedChem
FULL PAPER
Entry for the Table of Contents
Our first generation mitochondrial permeability transition pore (mtPTP) inhibitors, such as 63, suffer from suboptimal mouse plasma
stability. Herein we describe design, synthesis and in vitro characterization of a triazole-based second generation mtPTP inhibitors with
significantly improved mouse plasma stability. Further, we validate the therapeutic potential of newly synthetized inhibitor TR001 in a
zebrafish model of muscular dystrophy.
14
This article is protected by copyright. All rights reserved.