New anti-cancer strategy to suppress colorectal cancer growth through inhibition of atg4b and lysosome function

Article abstract of DOI:10.3390/cancers12061523

Autophagy inhibition has been proposed to be a potential therapeutic strategy for cancer, however, few autophagy inhibitors have been developed. Recent studies have indicated that lysosome and autophagy related 4B cysteine peptidase (ATG4B) are two promis

Full text of DOI:10.3390/cancers12061523

cancers
Article
New Anti-Cancer Strategy to Suppress Colorectal
Cancer Growth Through Inhibition of ATG4B
and Lysosome Function
Yuanyuan Fu 1,†, Qianqian Gu 1,†, Li Luo 1,†, Jiecheng Xu 1, Yuping Luo 1, Fan Xia 1,
Fanghai Han 2, Liang Hong 1, Xiao-Ming Yin 3, Zhiying Huang 1,* and Min Li 1,
*
1
School of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou 510006, China;
fuyy6@mail2.sysu.edu.cn (Y.F.); guqq@mail2.sysu.edu.cn (Q.G.); luoli26@mail2.sysu.edu.cn (L.L.);
xujch6@mail2.sysu.edu.cn (J.X.); luoyp26@mail2.sysu.edu.cn (Y.L.); xiaf6@mail2.sysu.edu.cn (F.X.);
hongliang@mail.sysu.edu.cn (L.H.)
Department of Gastrointestinal Surgery, Sun Yat-sen University, Guangzhou 510120, China; fh_han@163.com
Department of Pathology and Laboratory Medicine, Tulane University School of Medicine,
New Orleans, LA 70112, USA; xmyin@tulane.edu
2
3
*
†
Correspondence: hzhiying@mail.sysu.edu.cn (Z.H.); limin65@mail.sysu.edu.cn (M.L.)
These authors contributed equally to this paper.
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Received: 29 April 2020; Accepted: 1 June 2020; Published: 10 June 2020
Abstract: Autophagy inhibition has been proposed to be a potential therapeutic strategy for cancer,
however, few autophagy inhibitors have been developed. Recent studies have indicated that lysosome
and autophagy related 4B cysteine peptidase (ATG4B) are two promising targets in autophagy for
cancer therapy. Although some inhibitors of either lysosome or ATG4B were reported, there are
limitations in the use of these single target compounds. Considering multi-functional drugs have
advantages, such as high efficacy and low toxicity, we first screened and validated a batch of
compounds designed and synthesized in our laboratory by combining the screening method of
ATG4B inhibitors and the identification method of lysosome inhibitors. ATG4B activity was effectively
inhibited in vitro. Moreover, 163N inhibited autophagic flux and caused the accumulation of
autolysosomes. Further studies demonstrated that 163N could not affect the autophagosome-lysosome
fusion but could cause lysosome dysfunction. In addition, 163N diminished tumor cell viability
and impaired the development of colorectal cancer in vivo. The current study findings indicate that
the dual effect inhibitor 163N offers an attractive new anti-cancer drug and compounds having a
combination of lysosome inhibition and ATG4B inhibition are a promising therapeutic strategy for
colorectal cancer therapy.
Keywords: ATG4B; autophagy; colorectal cancer; dual-function inhibitor; lysosome inhibition;
new anti-cancer strategy
1. Introduction
Autophagy is a lysosomal recycling mechanism that is responsible for the degradation of cellular
protein aggregates and damaged organelles [
and it is aided by lysosomal hydrolytic enzymes [
1
]. Autophagic degradation occurs in the autolysosome
]. The recycling capacity of autophagy is involved in
2
both physiological and pathophysiological conditions, and dysregulated autophagy has been linked to
various human diseases. Of particular importance is the role of autophagy in cancer, since autophagy
has been linked to playing a context-dependent role in cancer. Previous studies have indicated that
autophagy prevents tumor growth at the initiation stages. Conversely, autophagy enables the survival
Cancers 2020, 12, 1523; doi:10.3390/cancers12061523
www.mdpi.com/journal/cancers

Cancers 2020, 12, 1523
2 of 19
of established tumors at the later stages from stressful conditions by increasing the autophagy flux [3–5].
Therefore, autophagy inhibition could be an effective way to control cancer development.
Autophagy is a multi-step process and the majority of these steps are potential targets for
autophagy regulation. There is evidence that autophagy inhibition can be effective in synergizing
with chemotherapy to suppress tumor cell growth [
hydroxychloroquine (HCQ) are the most widely used autophagy inhibitors in preclinical studies or
clinical trials for cancer treatment [ 11]. Potent lysosome inhibitors such as Lys05 and VATG-032 have
also been reported to inhibit autophagy and impair cancer cell growth in preclinical studies [12 13].
6–8]. Currently, chloroquine (CQ) and the related
9–
,
However, such lysosome inhibitors may not inhibit autophagy, but this could be attributed to the
deacidification of lysosome or impaired lysosomal enzymatic function, which could cause unfavorable
side effects [
cancer treatment.
ATG4B is the main cysteine protease which cleaves newly synthesized pro-LC3 and breaks down
9,14]. Therefore, the development of more specific autophagy inhibitors is important for
LC3 from PE, an essential protein for autophagosome elongation and maturation [15]. The association
of ATG4B with cancer has recently gained much attention, due to its key role in the regulation of
autophagy and cell differentiation. ATG4B has been reported as an oncogene in various cancer cells,
including osteosarcoma, chronic myeloid leukemia (CML), human epidermal growth factor receptor
2 (HER2)-positive breast, and colorectal cancer cells [16–19]. Therefore, ATG4B may be a potential
drug target for cancer and inhibition of ATG4B activity may serve as a new mean for cancer therapy.
However, only a limited number of ATG4B inhibitors with a weak inhibition ability are available,
which limit its clinical application.
Multitarget-directed ligands (MTDLs) is a concept where small organic molecules are designed
for multifunctional effects [20]. In the last decade, the majority of multifunctional strategies have
focused on treating complex diseases such as neurodegenerative diseases [21,22] and cancer [23].
Considering the single target inhibitors of either lysosome or ATG4B have poor effect, it will be a
better therapeutic strategy to find the inhibitor of dual-function to lysosome and ATG4B. In this study,
by establishing the screening method of ATG4B inhibitors, combined with the identification method of
lysosome inhibitors, we first screened and validated a batch of compounds designed and synthesized
in our laboratory, and we found a novel compound named 163N. In vitro, 163N could efficiently
inhibit ATG4B activity. There was also suppression of autophagy by 163N, which mainly affected
the function of the lysosomes, and also reduced the degradation of autolysosomes without affecting
the fusion of autophagosomes with lysosomes. Furthermore, 163N was effective in attenuating the
growth of colorectal cancer HCT116 cells in vitro and in vivo, and in suppressing autophagy in vivo
.
These study findings demonstrate that the novel dual-function autophagy inhibitor 163N showed
excellent antitumor efficacy both in vitro and in vivo and might be a promising lead compound for
future autophagy-based multi-functional drug discovery.
2. Results
2.1. Discovery of a Potential Dual Functional Tumor Inhibitor
To weaken the acidity of lysosome inhibitors, to reduce the adverse effect of anti-lysosomal agents,
and to improve the antitumor effect of ATG4B inhibitors, we first performed a fluorescence resonance
energy transfer (FRET)-based screening for ATG4B inhibitors, using an in-house new drug library of 560
compounds, from which 15 compounds were screened out with IC50 below 50
these compounds, XOS00163, XOS00201, XOS00207, and 163N with a 2-phenylbenzofuran structure
exhibited a strong inhibition effect on ATG4B with IC50 of 6.2 M, 8.98 M, 2.31 M, and 17.82 M,
µM (Table 1). Among
µ
µ
µ
µ
respectively (Table 1). Then adherent cells HeLa and HCT116, and suspension cells HL60 were analyzed
by cell counting kit-8 (CCK-8) assay, and the results showed that only XOS00163, XOS00201, XOS00207,
and 163N could reduce the cell viability of HeLa, HCT116 and HL60 cells, and 163N exhibited the
best anticancer effect (Table 1). However, there was no growth arrest when the cells were cultured

Cancers 2020, 12, 1523
3 of 19
with other screened ATG4B inhibitors (Table 1). These findings demonstrated that the structure of
2-phenylbenzofuran is a good pharmacophore for developing therapeutic agents against ATG4B in
cancer therapy.
Moreover, we found that 163N bearing the structure of both 2-phenylbenzofuran and
6-methylpyrimidine-2,4-diamine.
Our previous results implied that compounds with a
6-methylpyrimidine-2,4-diamine structure could cause lysosome inhibition [24]. We synthesized a
series of compounds with a 6-methylpyrimidine-2,4-diamine structure (Figure S1A). As shown in
Figure S1B, treatment with this series of compounds resulted in significantly quenching of red fluorescence,
even stronger than bafilomycin A1 (Baf)-treated cells, suggesting that this series of compounds had
the ability to efficiently increase the pH of lysosome. Next, we further monitored the degradation
function of lysosome by dequenched bodipy-conjugated BSA (DQ-BSA assay). As shown in Figure S1C,
similar to Baf or E64D plus pepstatin A treatment group, the red fluorescence signal in cells treated
with this series of compounds was very weak, demonstrating that the proteolytic activity of lysosomes
was affected by this series of compounds. Overall, the data indicate that this series of compounds
are lysosome inhibitors. Thereafter, 163N bearing the structure of both 2phenylbenzofuran for ATG4B
and 6-methylpyrimidine-2,4-diamine for lysosome might be a potential dual functional tumor inhibitor.
The structure and the synthetic route for 163N are shown in Figure 1.
2.2. 163N Inhibits the Activity of ATG4B
Docking experiments using the closed-form of ATG4B (Protein Data Bank (PDB) code 2CY7) were
first done to confirm whether 163N had any effects on the activity of ATG4B, as previously reported [25].
As shown in Figure 2A, we found that 163N could fit into the docking pocket (Figure 2A, lower panel),
and was able to form two hydrogen bonds with Pro260 and Asn261. These are the two key residues
of the regulatory loop (residues 259-262) covering the entrance of the catalytic site and undergoing a
large conformational change when ATG4B interacts with LC3 [26]. FRET-based assay showed that
163N could dose-dependently suppress the activity of ATG4B with an IC50 of 17.82 µM (Figure 2C),
which was slightly higher than that of XOS00163, XOS00201, and XOS00207 (Table 1). The rankings
for these four compounds were predicted using docking results, and they were consistent with the
IC50 data, possibly due to the limited pocket size of free ATG4B as 163N has a larger structure than
the other three compounds. The docking results of XOS00163, XOS00201, and XOS00207 are shown
in Figure 2B. A gel-based assay using substrate LC3-GST was also performed and 163N displayed a
dose dependent inhibition effect on ATG4B activity (Figure 2D). We then tested whether 163N could
also inhibit ATG4A activity. We found that 163N exhibited a weak inhibition effect on ATG4A with
an IC50 of 53.67 µM by FRET-based assay (Figure 2E). In addition, we also tested the selectivity of
163N on caspase-3, another cysteine protease. As shown in Figure 2F, in contrast to the pan-caspase
inhibitor Z-VAD-fmk, 163N had no inhibition effect on caspase-3 activity, even at a concentration of
50 µM. Together, these results suggest that 163N could inhibit the activity of ATG4B.
2.3. 163N Suppresses Autophagy Flux
To identify the impact of 163N on autophagy, A549 cells stably expressing GFP-LC3 were used.
We found that 163N caused the accumulation of GFP-LC3 dots in dose- and time-dependent manners
(Figure 3A). We then examined the effect of 163N on LC3 conversion in both HeLa and HCT116 cells,
western blot analysis showed that 163N treatment resulted in dose- and time-dependent accumulation
of LC3-II in both cell lines (Figure 3C,D and Figure S2A,B). However, similar to Earle’s Balanced Salt
Solution (EBSS) treated cells, 163N treatment did not induce LC3-II in ATG5-deficient cells (Figure 3B),
an indication that 163N-induced LC3-II was autophagy-dependent. To confirm the effect of 163N on
autophagy, two autophagy inhibitors CQ and Baf were used to measure LC3-II turnover. Western blot
analysis showed that 163N treatment did not further enhance the expression level of LC3-II induced by
CQ or Baf groups (Figure 3E), therefore, 163N treatment may inhibit autophagy flux. An autophagy flux
analysis in GFP-LC3 A549 cells was consistent with the western blot analysis (Figure S2C). In addition,

Cancers 2020, 12, 1523
4 of 19
in contrast to the EBSS treated cells, 163N significantly attenuated the degradation of the autophagic
substrate SQSTM1 (Figure 3F), suggesting that 163N is a potent autophagic flux inhibitor.
Table 1. List of the screened ATG4B inhibitors.
ATG4B-IC50
HeLa-IC50
(µM)
HCT116-IC50
HL60-IC50
(µM)
Compound ID
Structure
(µM)
(µM)
XGS00025
29.19
13.03
>100
>100
>100
>100
>100
>100
XGS00031
XGS00043
XGS00046
XGS00048
36.31
39.14
13.81
>100
>100
>100
>100
>100
>100
>100
>100
>100
XGS00119
XOS00117
XOS00125
7.37
6.65
>100
>100
>100
>100
>100
>100
>100
>100
>100
40.64
XOS00149
XOS00154
XOS00163
44.03
40.71
6.2
>100
>100
31.98
>100
>100
22.97
>100
>100
31.7
XOS00176
XOS00201
XOS00207
23.81
8.98
2.31
>100
25.64
87.14
>100
19.62
17.63
>100
>100
60.7
163N
17.82
7.06
5.76
12.63
Purple represents a 2-phenylbenzofuran structure.

Cancers 2020, 12, 1523
5 of 19
Figure 1. Graphical synthetic route of 163N. (
A) The structure of 163N carries both 2-phenylbenzofuran
and 6-methylpyrimidine-2,4-diamine. (B) Synthesis of 163N.
Figure 2. 163N inhibits the activity of ATG4B. (A) Predicted binding model of compound 163N binds to
ATG4B (Protein Data Bank (PDB) ID: 2CY7) pocket. 163N can form hydrogen bonds with residues Pro260
and Asn261 of ATG4B (yellow dotted lines). (B) Predicted binding model of compound XOS00163,

Cancers 2020, 12, 1523
6 of 19
XOS00201, and XOS00207 bind to ATG4B (PDB ID: 2CY7) pocket. (
ATG4B from fitted curve by fluorescence resonance energy transfer (FRET) assay. (
was incubated with different concentrations of 163N (5, 10, 20, 50
was added to the mixture and incubated at 37◦ for another 30 min. SDS-PAGE was used to detect
C
) IC50 calculation of 163N for
) ATG4B (1 g/mL)
µ
M) at 37◦ for 30 min, then LC3B-GST
D
µ
the inhibitory effect of 163N. The inhibition rate (%) was calculated based on the band density and
quantified. Data are presented as mean
the IC50 of 163N for ATG4A by FRET assay. (
cysteine proteases. HeLa cells were treated with 1
apoptosis. Then, 2
g of the whole cell lysate were mixed with indicated compounds at 37◦ for 30 min,
M) were then added to a volume of 50 L, and the emission of 505 nm for AFC
±
SEM from three individual experiments. (
) Measurement of the specificity of 163N against other
M of staurosporine (SP) for 12 h to induce cell
E) Measurement of
F
µ
µ
Ac-DEVE-AFC (25
was recorded.
µ
µ
Figure 3. 163N inhibits autophagic flux. (
for 6 h at different concentrations or treated with 163N (10
distribution of GFP-LC3B was examined. ( ) Wild type (WT) Mouse Embryonic Fibroblast cells (MEFs)
or ATG5KO MEFs were treated with 163N (10 M) for 6 h, or EBSS for 2 h for western blotting assay.
) HCT116 cells treated with different concentrations of 163N (1, 5, 10, 20 M) for 6 h were analyzed
by western blotting for endogenous LC3B. The ratio of LC3B-II/TUBA was calculated using ImageJ
software. ( ) HCT116 cells treated with 163N (10 M) over a certain time course were analyzed
by western blotting for endogenous LC3B. The ratio of LC3B-II/TUBA was calculated using ImageJ
software. ( ) HeLa cells were treated with 163N (10 M) with or without CQ (40 M) or bafilomycin
A1 (Baf) (0.5 M) for 6 h, and then endogenous LC3B was analyzed by western blotting. The ratio of
LC3B-II/TUBA was calculated using ImageJ software. ( ) HeLa cells were treated with 163N (10 M)
A
) A549 cells expressing GFP-LC3B were treated with 163N
µM) over a certain time course, then the
B
µ
(
C
µ
D
µ
E
µ
µ
µ
F
µ
for 6 h, or EBSS for 2 h, and then immunostaining was used to detect SQSTM1 dots, and the number
of SQSTM1 dots was quantified. The LC3-II intensities in relation to TUBA are shown in this Figure,
and the uncropped blots and molecular weight markers are shown in Figure S7. Data are presented as
mean ± SEM from three individual experiments. ** p < 0.01, *** p <0.001, ns, not significant.

Cancers 2020, 12, 1523
7 of 19
2.4. 163N Increases the Accumulation of Autolysosomes
The tandem RFP-GFP-LC3 construct was further used to determine whether the effect of 163N
was due to autophagic flux suppression. The normal autophagy process causes the reduction of green
fluorescent protein (GFP) fluorescence in an acidic lysosome environment, whereas red fluorescent
protein (RFP) is more stable under acidic conditions [27]. Therefore, rapamycin (Rap) treatment led to
an increase in total puncta, as well as the red-only fluorescence puncta in HEK293 cells (Figure 4A).
However, Baf treatment led to an increase in both GFP- and RFP-positive fluorescence puncta (puncta
formation with yellow overlay), which was mimicked by 163N treatment (Figure 4A). These yellow
overlays represented both autophagosomes and autolysosomes, due to impaired degradation steps,
suggesting that 163N suppressed autophagy at a late stage.
Figure 4. 163N increases the accumulation of autolysosomes. (
fluorescent protein (GFP)-red fluorescent protein (RFP)-LC3 were treated with 163N (10
(Rap) (1 M) or Baf (0.5 M) for 6 h, then the colocalization of GFP and RFP puncta was detected.
) HeLa cells were treated with 163N (10 M), Rap (1 M) or Baf (0.5 M) for 6 h, then immunostaining
was used to detect LC3B and LAMP1. The colocalization of LC3B and LAMP1 was measured. ( ) HeLa
cells were treated with 163N (10 M) for 6 h, then transmission electron microscopy (TEM) was
used to detect the ultrastructure of HeLa cells. Red arrows indicate normal autolysosome structures.
) ATG4BKO HeLa cells expressing GFP-LC3[G120] or full length GFP-LC3 were treated with Rap
M), 163N (10 M), or CQ (40 M) for 6 h, then the distribution of GFP-LC3 was examined. And the
A
) HEK293A cells expressing green
µM), rapamycin
µ
µ
(B
µ
µ
µ
C
µ
(
D
(1
µ
µ
µ
number of GFP-LC3 dots were quantified. Data are presented as mean
experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.
±
SEM from three individual

Cancers 2020, 12, 1523
8 of 19
During the late stage of autophagy, autophagosomes fuse with lysosomes to form
autolysosomes, where the degradation of the contents occurs. To address whether 163N affected
autophagosome-lysosome fusion, we examined the localization of endogenous LC3 with the lysosome
membrane marker LAMP1. The compound 163N induced a remarkable increase of LC3 puncta,
which were well co-localized with LAMP1 (Figure 4B). This indicated that 163N inhibited autophagy
without affecting autophagosome-lysosome fusion. This was similar to the cells treated with Baf, which
blocked the degradation of autolysosomes resulting from elevated lysosomal pH (Figure 4B). However,
reduced co-localization of LC3 puncta and LAMP1 was detected in Rap-treated cells (Figure 4B).
Electron microscopy was further used to show that more autolysosomes (monolayer structures with
cellular components), but not autophagosomes, were accumulated under 163N treatment (Figure 4C).
In addition, we transfected GFP-LC3[G120] and GFP-LC3 plasmids into ATG4BKO HeLa cells,
respectively. As shown in Figure 4D, GFP-LC3 puncta were hard to find in GFP-LC3 transfected
ATG4BKO cells, with or without Rap, CQ, or 163N treatments, due to the defect conversion of pro-LC3
to LC3-I. In contrast, cells transfected with GFP-LC3[G120], which can mimic LC3-I, had more dots.
However, the level of GFP-LC3 dots in 163N treated cells was still lower than Rap or CQ treated cells,
possibly because the lack of autophagy induction (Rap) or autophagosome lysosome fusion inhibition
effect (CQ), suggesting that 163N may mainly affect the degradation of the autolysosome. These
findings indicated that 163N inhibits autophagy without blocking the fusion between autophagosomes
and lysosomes, but increases the accumulation of autolysosomes.
2.5. 163N Causes Lysosome Dysfunction
There was an increased accumulation of LC3 on autolysosomes caused by 163N and this could
be associated to elevated pH or impaired protease activity in lysosomes, or defective degradation of
LC3-PE on autophagosomal structures, due to the suppression of ATG4B activity [25]. As shown in
Figure 5A, treating cells with 163N caused a significant reduction in acidic vesicles, and this was similar
to the Baf-treated cells, although weaker than the effect of Baf. However, the red fluorescence signal
of LysoTracker Red (LTR) in Rap or E64D plus pepstatin A-treated cells was stable. Therefore, 163N
affected the acidity of the lysosome but was not as strong as Baf. Next, we monitored the degradation of
lysosome during 163N treatment using DQ-BSA [28]. Under normal lysosomal conditions, proteolysis
of DQ-BSA resulted in dequenching and release of red fluorescence in the lysosome. As shown in
Figure 5B, compared with the complete medium or Rap-treated cells, both Baf, E64D plus pepstatin
A, and 163N treatment resulted in nearly no dequenching of DQ-BSA, indicating that 163N could
significantly inhibit the proteolytic activity of the lysosome. Next, we want to know whether treatment
with this compound could cause the release of the lysosomal content, so we analyzed the colocalization
of cathepsin B and LAMP1. As shown in Figure 5C, the co-localization of cathepsin B and LAMP1 was
observed in 163N treated cells, similar to the complete medium group cells, suggesting that 163N did
not produce lysosomal membrane permeabilization. Together, these observations indicated that 163N
treatment could cause lysosome dysfunction.

Cancers 2020, 12, 1523
9 of 19
Figure 5. 163N causes lysosome dysfunction. (
E64D (25 M) plus pepstatin A (50 M) or different concentrations of 163N (5 or 10
LysoTracker Red (LTR, 25 ng/mL) was used to stain for 30 min, then the relative LTR fluorescent
intensity was quantified. ( ) HeLa cells were firstly incubated with 10 g/mL DQ-BSA in EBSS medium
for 1.5 h and then treated with Rap (1 M), Baf (0.5 M), E64D (25 M) plus pepstatin A (50 M) or
different concentrations of 163N (5 or 10 M) for another 6 h, then the relative DQ-BSA fluorescent
intensity was quantified. ( ) HeLa cells were treated with or without 163N (10 M) for 6 h, followed by
immunostaining using cathepsin B and LAMP1 antibody. The colocalization of cathepsin B and LAMP1
A
) HeLa cells were treated with Rap (1
µM), Baf (0.5
µM),
µ
µ
µM) for 6 h, then
B
µ
µ
µ
µ
µ
µ
C
µ
was measured. Data are presented as mean
*** p < 0.001.
±
SEM from three individual experiments. * p < 0.05,
2.6. 163N Suppresses the Growth of Cancer Cells in Vitro
Previous studies have shown that autophagy supplies ATP to maintain cellular biosynthesis in
tumors; there are also studies showing that autophagy inhibition through genetic or pharmacological
interventions is an effective way of overcoming treatment resistance [8,29,30]. To investigate whether
163N-mediated autophagy inhibition could affect cancer cell survival, cell viability was estimated by
CCK-8 assay. As shown in Figure 6A, 163N significantly reduced the cell viability in different cancer
cells, including HeLa (IC50 = 7.06
(IC50 = 9.33 M), SGC7901 (IC50 = 21.16
MDA-MB-231 (IC50 = 9.99
µ
M), HCT116 (IC50 = 5.76
µ
M), A549 (IC50 = 7.68
M), U87 (IC50 = 10.59 M), KYSE150 (IC50 = 13.03
M), as well as HL60 (IC50 = 12.63 M). In addition,
µ
M), MGC803
µ
µ
µ
µM),
µ
M), T98G (IC50 = 7.23
µ
µ
we found that 163N could reduce the cell viability of normal cells (L02 and MRC-5 cells) at a higher
concentration (40 M), but tumor cells were more sensitive to 163N than normal cells at a lower
concentration (10 M) (Figure S3). As expected, 163N exhibited about five times higher cytotoxicity than
µ
µ
XOS00163, XOS00201, and XOS00207 for HeLa and HCT116 cells (Figure 6A and Table 1). To further
examine the effect of 163N on cell proliferation, HCT116 cells were used to perform real-time cellular
analysis (RTCA) assays. RTCA plots were generated using RTCA software 1.1.2. As shown in Figure 6B,
2
µ
M of 163N had significant cytotoxic effects on colorectal cancer HCT116 cells. We then generated
ATG4B-deficient HCT116 cells by CRISPR/Cas9 system (Figure S4A,B). Supported by previous findings
that ATG4B was required for cell cycle regulation [16 31]. Knockout of ATG4B in HCT116 cells resulted
in lower cell proliferation rate than the wild type HCT116 cells (Figure 6B). The study also found that
,

Cancers 2020, 12, 1523
10 of 19
ATG4BKO HCT116 cells were less sensitive to 163N treatment, compared with wild type HCT116
cells (Figure 6B), and similar results were also observed using colony formation assays (Figure 6C).
In addition, inhibition of autophagy either by CQ (IC50 = 14.2
µM) or by genetic depletion of ATG16L1
(IC50 = 12.37 M) could also reduce the cytotoxicity induced by 163N (Figure S5). These results
µ
imply that 163N might target autophagy to reduce tumor viability. Moreover, we could also find that
inhibition of autophagy by 163N exhibited a much stronger inhibition effect on tumor cell viability than
the genetic deletion of ATG4B (Figure 6B,C), implying that only ATG4B inhibition is likely not sufficient
to suppress tumor growth. An evaluation of the potential roles of 163N on in vitro motility of wild type
HCT116 cells and ATG4BKO HCT116 cells was performed as well. The findings showed that there was
no significant difference that was observed in the migration of wild type HCT116 cells and ATG4BKO
HCT116 cells under normal medium (Figure 6D). However, 163N treatment significantly inhibited
the migration of wild type HCT116 cells, whereas the minimal effect was observed in ATG4BKO
HCT116 cells (Figure 6D). Moreover, inhibition of autophagy by 163N had a stronger inhibition effect
on tumor cell migration than just genetic deletion of ATG4B, indicating that single ATG4B knockout is
not enough to inhibit tumor cell migration. Together, 163N might exert its antitumor effect through
targeting autophagy, and only deletion of ATG4B is not sufficient to suppress tumor growth, which
may explain why the dual functional autophagy inhibitor 163N can potently inhibited the growth of
colorectal cancer cells.
Figure 6. 163N suppresses the growth of colorectal cancer cells in vitro. (
MGC803, SGC7901, U87, KYSE150, MDA-MB-231, T98G, and HL60 cells were treated with various
concentrations of 163N, and CCK-8 assay was performed to assess cell proliferation. ( ) HCT116
and ATG4BKO HCT116 cells (2500 per well) were seeded before treated with 163N (2 M), and 0.1%
A) HeLa, HCT116, A549,
B
µ
Dimethyl-sulfoxide (DMSO) was used as a control. The real-time cellular analysis (RTCA) plots were
generated using RTCA software 1.1.2, and the cell index was analyzed with GraphPad 7.0 software.
(
C
) HCT116 and ATG4BKO HCT116 cells were treated with a series of concentrations of 163N. Colony
formation assay was then monitored by crystal violet staining. The number of the clones were counted
and quantified. ( ) HCT116 and ATG4BKO HCT116 cells were treated with or without 163N (10 M)
D
µ
for 48 h, wound healing was recorded (left) and quantitatively analyzed (right). Data are presented as
mean ± SEM from three individual experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Cancers 2020, 12, 1523
11 of 19
2.7. 163N Suppresses the Growth of Colorectal Cancer Cells in Vivo
Next, the effect of 163N in suppressing the growth of colorectal cancer cells using a mouse xenograft
model was investigated. This was achieved by introducing HCT116 cells into immunodeficient mice.
After 7 days, when the tumors were palpable, the mice were randomized assigned to 2 groups,
and treated with vehicle corn oil or 163N. As shown in Figure 7A, tumor growth in vehicle-treated mice
increased dramatically. However, tumor growth in 163N-treated mice was less prominent, and there
were no significant changes in body weight among the vehicle control and 163N treatment groups
(Figure 7B). There were also no significant changes in weight index (Figure S6A) and morphology
(Figure S6B) of the heart, liver, spleen, lung, and kidney among vehicle control and 163N treatment
groups. To evaluate whether 163N treatment changed the morphology of HCT116 cells in vivo
,
hematoxylin-eosin (H&E) staining was performed. As shown in Figure 7C (top panels), tumor
sections from mice treated with 163N exhibited abnormal cell arrangement and signs of necrosis with
infiltration of inflammatory cells. Then, the increased levels of LC3B and SQSTM1 was detected by
immunohistochemistry as shown in Figure 7C, suggesting that 163N might inhibit autophagy in vivo
Then, transmission electron microscopy (TEM) was used. As shown in Figure 7D, the TEM studies
showed that the number of autophagic vacuoles (especially autolysosomes) was higher in the tumor
tissues of the 163N-treated mice compared with the vehicle control group. These findings indicate that
163N-mediated inhibition of tumor growth could be associated with autophagy inhibition.
.
Figure 7. 163N inhibits tumor growth in a HCT116 mouse xenograft model. (
A
) HCT116 cells (3
×
106)
were injected subcutaneously into the right flank of the immunodeficient nu/nu female mice. Seven
days after tumor cell implantation, mice with palpable tumors were divided randomly into two groups
and injected intraperitoneal on Monday, Wednesday, and Friday with either corn oil vehicle or 163N
(50 mg/kg). Tumor volumes were calculated by the length and width measured by Vernier calipers
every 2 d. (
and subjected to H&E staining and immunohistochemistry for evaluating histological morphology,
and expression of LC3B and SQSTM1. Scale bar: 50 M. ( ) TEM was used to detect the ultrastructure
B) Body weight changes of mice during 28 d of exposure. (C) Tumor tissues were sectioned
µ
D
of the representative tumor tissues. Red arrows represent normal autolysosome structures. Data are
presented as mean ± SEM. ** p < 0.01 vs VC.

Cancers 2020, 12, 1523
12 of 19
3. Discussion
There is evidence indicating that autophagy acts to promote tumor survival and growth
in established cancers at the later stages from stressful conditions, such as hypoxia, therapeutic
stresses, or nutrient deprivation [5,32–34]. At present, inhibitors targeting autophagy are mainly
lysosomal inhibitors and inhibitors against other specific autophagy targets, such as ULK1 [35],
class III PI3K (VPS34) [35], BECN1 and ATG4B have also been reported [17]. Early-stage targets
participate in the formation of autophagosomes such as ULK1, VPS34, and BECN1. Whereas late-stage
autophagy usually refers to the fusion between autophagosomes and lysosomes, or the degradation
of autolysosomes. Research indicates that autophagosomal structures serve as scaffolds to induce
apoptosis and necroptosis [36
better for cancer treatment.
,37]. Therefore, inhibitors targeting late stage of autophagy might be
As discussed above, with the exception of CQ and its derivatives, none of these reported inhibitors
of ATG protein have approved for clinical cancer treatment. One of the main concerns when using
these lysosomotropic agents is that they may function independent of autophagy, which may lead to
some unfavorable side effects. Therefore, it is of great theoretical and practical significance to develop
novel and efficient autophagy inhibitors as anticancer drugs. ATG4 is a key protein of autophagy
signal pathway. Of the four ATG4 family proteins, ATG4B is 1500-fold more efficient in the catalytically
activity towards LC3B than the other three ATG4s [38]. Studies have shown that deletion of ATG4B
or overexpression of a catalytic-negative mutant could arrest autophagy [39,40]. Therefore, targeting
ATG4B provides an alternative strategy to inhibit autophagy. The clinical association of biomarkers in
colorectal cancer have been reported [41]. A previous study has shown that high ATG4B expression
intensity was almost correlated with late tumor stages (II-IV) of colorectal cancer patients [16]. Recent
studies have demonstrated that using small molecule inhibitors of ATG4B could suppress the growth
of colorectal cancer cells [25], or sensitize colorectal cancer cells to chemotherapy [42]. These results
indicate that ATG4B may serve as a novel biomarker in colorectal cancer.
In this study, we provide a new therapeutic strategy and aim to identify a dual functional molecule
that simultaneously targets ATG4B and lysosome to inhibit autophagy, potentially serving as promising
anti-tumor agents. Currently, a series of ATG4B inhibitors have been reported. For example, NSC185058
was reported as an ATG4B inhibitor, which could suppress the growth of osteosarcoma tumors and
enhance the anti-cancer activity of radiation therapy [17,43]. Tioconazole was also identified to be a
potent ATG4B inhibitor, which could diminish autophagic flux and enhance the anti-tumor effect of
chemotherapeutic drugs [42]. S130 has been shown to inhibit autophagy flux and suppress the growth
of colorectal tumors [25]. FMK-9a was shown to be the most potent ATG4B inhibitors so far, but it could
neither inhibit autophagy nor reduce tumor cell viability [44,45]. These findings demonstrate that the
anti-canner effect of these ATG4B inhibitors may not be correlated with the inhibition efficiency of
ATG4B catalytic activity. In the current study, we employed a FRET-based assay to screen an in-house
new drug library of 560 compounds. Based on the screening, chemicals with a 2-phenylbenzofuran
structure exhibited a strong inhibition effect on ATG4B and cancer cell viability (Table 1), suggesting the
structure with a 2-phenyl benzofuran might be a good pharmacophore to develop ATG4B inhibitors for
cancer therapy. Our previous results implied that compounds with a 6-methylpyrimidine-2,4-diamine
structure could cause lysosome inhibition [24]. Thus, we synthesized a series of compounds with a
6-methylpyrimidine-2,4-diamine structure (Figure S1A), and confirmed that these chemicals are strong
lysosomotropic agents (Figure S1B,C). Thus, 163N bearing the structure of both 2-phenylbenzofuran
and 6-methylphenylpyrimidine-2,4-diamine, might be a potential dual functional autophagy inhibitor
for the potential use of cancer treatment.
Taking account of the complexity of the pathogenesis of cancer, single-target drugs are prone to drug
resistance. Considering drug combination usually leads to many shortcomings, such as complicated
pharmacokinetic properties, complex dose settings, and drug-drug interactions. Therefore, it is urgent
to develop more effective therapeutic strategies to overcome these drawbacks, and multi-functional
molecules can effectively solve the above disadvantages. Our results suggest that compared to

Cancers 2020, 12, 1523
13 of 19
XOS00163, XOS00201, and XOS00207, 163N shows a slightly lower activity on ATG4B, but has a
stronger anti-cancer effect. And compared to Baf, 163N possessed a mild lysosomotropic effect
(Figure 5A), whereas the lysosomotropic effect of Baf was weaker than L1, L2, L3, L4, L5, and L6
(Figure S1B). These findings suggest that 163N not only retains the inhibition effect on ATG4B and
lysosome, but also improves the anti-cancer effect, and reduces lysosome alkalization in cells.
For further clarification the possible mechanism of 163N on autophagy, we examined the action of
163N on LC3-II formation, autophagy flux, autophagosome-lysosome fusion, and the degradation
of autolysosome. Results show that 163N inhibited autophagic flux and caused the accumulation of
autolysosomes without affecting autophagosome-lysosome fusion. It has been reported previously
that the accumulation of LC3-II on the autolysosome may be associated to elevated pH or impaired
protease activity in lysosome, or defective degradation of LC3-PE on autophagosomal structures,
due to the suppression of ATG4B activity [25]. Results from LTR staining and DQ-BSA staining
show that 163N-mediated blockage of degradation of autolysosome might be due to lysosomal pH
elevation and impaired proteolytic activity (Figure 5A,B), but does not affect lysosomal membrane
permeabilization (Figure 5C). However, the exact target of 163N acting on lysosome to cause lysosome
dysfunction remains to be explored. Further studies in Figure 6B show that knockout of ATG4B could
reduce the sensitivity of tumor cells to 163N treatment, implying that 163N might partially target
ATG4B in cells, and this factor may also contribute to the increase of autolysosome induced by 163N
treatment. In addition, blocking autophagy by pharmacological (CQ) or genetic approaches (knockout
of ATG16L1) also partially attenuated the cytotoxicity induced by 163N (Figure S5), suggesting that
autophagy is required for 163N induced cytotoxicity. However, whether this cell protection effect is
because the loss of ATG4B, or autophagy deficiency, or both, still needs to be further investigated.
These results indicate that 163N functions as an autophagy inhibitor to exert its antitumor effect.
As described above, autophagy inhibition could be therapeutically effective for cancer control. Our
results suggest that the anti-cancer effect of 163N is consistent with its ability to suppress autophagy.
163N suppressed tumor growth in vitro and in vivo. Surprisingly, no obvious changes in animal
weight was observed in 163N-treated mice (Figure 7B). Also, the lack of any obvious changes in weight
and morphologies of heart, liver, spleen, lung and kidney were observed in mice treated with 163N
(Figure S4A,B). These results indicate that 163N might have a good safety performance. Together,
our findings suggest that the inhibition of autophagy by 163N might be an efficient way to treat
colorectal cancer.
4. Materials and Methods
4.1. Synthesis of 163N
The graphical synthetic route of compound 163N is described in Figure 1. The solution of K2CO3
(30 mM) and 4-Nitrobenzyl-bromide (10 mM) in DMF was added 2-Hydroxybenzaldehyde (10 mM).
◦
The reaction mixture was stirred at 150 C for 12 h under an inert atmosphere. After cooling to
room temperature, ethyl acetate and water were used to extract the mixture. Then, brine was used
to wash the combined organic layer, followed by anhydrous Na2SO4 drying and reduced pressure
concentrating. Finally, flash silica gel column chromatography (1:10 ethyl acetate/petroleum ether) was
used to purify the crude reaction mixture to get the 2-(4-nitrophenyl) benzofuran (75% yield).
The solution of 2-(4-nitrophenyl) benzofuran (8.5 mM) in methanol was added Raney Nickel
(M/M = 10%, 250 mg) followed by hydrazine hydrate slowly at 0 ◦C. The reaction mixture was stirred
3 h at room temperature. After completion of reaction, the mixture was filtered with kieselguhr and
washed with methanol, and the filtrate was concentrated under reduced pressure. The crude product
(100% yield) was directly in the next step.
The solution of 2, 4-dichloro-6-methylpyrimidine (20 mM) and Et3N (24 mM) in ethanol
at 0◦, 4-methoxyaniline (20 mM) was added. The reaction mixture was stirred overnight at
room temperature. After completion of reaction, the mixture was filtered and the filtrate

Cancers 2020, 12, 1523
14 of 19
was concentrated under reduced pressure. The crude product was purified by flash silica
gel column chromatography (1:10 ethyl acetate/petroleum ether) to afford the compound
2-chloro-N-(4-methoxyphenyl)-6-methylpyrimidin-4-amine (75% yield).
In
a
seal
tube,
the
solution
of
4-(benzofuran-2-yl)
aniline
(3
mM),
2-chloro-N-(4-methoxyphenyl)-6-methylpyrimidin-4-amine (3 mM) in t-butanol (30 mL) was
added, concentrated hydrochloric acid (catalytic amount). The reaction mixture was stirred at 150 ◦C
for 16 h under an inert atmosphere. After cooling to room temperature, the mixture was filtered and
washed with t-butanol. The filter cake was diluted with dichloromethane and dilute ammonia water.
The organic layer was washed with water and brine, dried with Na2SO4 and concentrated under
reduced pressure. The crude product was purified by flash silica gel column chromatography (1:100
methanol/ dichloromethane) to afford the compound 163-N (83% yield), which was characterized by
1H- and 13C-NMR, and LC-MS.
4.2. Antibodies and Reagents
Antibodies used in this study were as follow: ATG4B (15131-1-AP) was from Proteintech
(Wuhan, China), ATG5 (8540) and FIP200 (12436) were from Cell Signaling Technology (Danvers, MA, USA),
GAPDH (sc-365062) was from Santa Cruz Biotechnology (Dallas, TX, USA), LC3B (L7543) and TUBA (T6074)
were from Sigma (St. Louis, MO, USA), LAMP1 (H4A3) was from Developmental Studies Hybridoma
Bank (Iowa City, IA, USA), SQSTM1/p62 (PM045) was from MBL International (Woburn, MA, USA).
Secondary antibodies (35503, 35511, 35553, and 35561) were purchased from Thermo Fisher Scientific
(Rockford, IL, USA).
Bafilomycin A1 (Baf, B-1080) was purchased from LC Laboratories (Woburn, MA, USA), as well
as rapamycin (Rap, ASW-125). Chloroquine (CQ, A506569) was purchased from Sangon Biotech
(Shanghai, China). Z-VAD-FMK (S7023) and staurosporine (SP, S1421) was from Selleckchem (Houston,
TX, USA). Dequenched-BSA (DQ-BSA) Red (D12051), LysoTracker Red (LTR, L12492) and Lipofectamine
2000 (11668-019) were purchased from Life Technologies (Bothell, WA, USA). Substrate Ac-DEVD-AFC
(CASP-048) for caspase3 activity was from Chinese Peptide Company (Hangzhou, China). Purified
ATG4B, substrate ECFP-GATE-16-YFP (FRET-GATE16) for ATG4B were described before [45].
4.3. Cell Culture and Plasmid Transfection
HeLa, HCT116, GFP-LC3 A549, and ATG4B-deficient HeLa (ATG4BKO-HeLa) cells have been
described previously [25,44]. All cells were routinely cultured in Dulbecco’s modified eagle medium
(DMEM) medium (Thermo Scientific, Waltham, MA, USA, 11965092) with 10% fetal bovine serum
(Gibco, 10270) and standard supplements. All cells were maintained in a 37◦, 5% (v/v) CO2 incubator.
Cells were grown in 12/24 well plates before transfection using Lipofectamine 2000.
4.4. Generation of ATG4B Knockout HCT116 Cell Line
The design of gRNAs for human ATG4B has been described previously [25]. Then, HEK293T
cells were transfected with lentiCRISPRv2-gRNA, psPAX2 and pMD2.G at a ratio of 4:3:1 to produce
lentiviral particles. After 72 h, viral supernatants were collected. HCT116 cells grown in 24-well plate
format were transduced with lentivirus for 24–48 h. After that puromycin (1 µg/mL) were added for
2–3 days and then genomic DNA were extracted. Design PCR primers upstream and downstream
of the knockout site: -50 TGCTGTAAATGGCCTCTTTCG, -30 CAAGTCACAAGTTATGGCAGAG.
Perform PCR using genomic DNA as a template, and use PCR products for sequencing. Single-cell
clones were then isolated by multiple dilution in 96-well plates. Single ATG4B deficient clones were
detected by western blot.
4.5. Immunoblotting Assays
20–30
µg of whole cell lysates were separated by SDS-PAGE to avoid saturation and transferred
to PVDF membranes (Millipore, ISEQ00010, Burlington, MA, USA). After blocking, the membrane was

Cancers 2020, 12, 1523
15 of 19
incubated with primary antibodies and secondary antibodies. Specific proteins were detected using
enhanced chemiluminescence developing agent (Millipore, WBULS0500). Images were taken using
Kodak Image Station 4000 (Carestream Health, Rochester, NY, USA).
4.6. Immunostaining Assay
Immunostaining assay was performed as described previously [25]. Cells were fixed in 4%
paraformaldehyde for 15–20 min followed by permeabilization with 0.1% Triton X-100 for another 15
min. Then, PBS containing 5% bovine serum albumin was used for blocking. Primary antibodies (1:150)
was used at 4◦ for one night and then secondary antibodies (1:500) were applied at room temperature
for 1 h. EVOS FL Auto (Life Technologies) was used to get the fluorescence images. At least three
optical fields with at least 100 cells were analyzed for quantification.
4.7. Transmission Electron Microscopy
Electron microscopy was carried out as described [25]. Briefly, 2.5% glutaraldehyde in 0.1 M
phosphate buffer (pH 7.4) was used for fixed cell sample. After 2 h, cells were dehydrated in a graded
ethanol series and then embedded. Ultrathin sections of these cells were mounted on copper grids,
and then stained. Finally, electron microscope Tecnai G2 20 Twin (FEI, Fremont, CA, USA) was used
for visualizing.
4.8. Lysosomal Function Analysis
LTR assay: cells were incubated with LTR (25 nM) in HBSS medium at 37◦ for 30 min, and then
fluorescence microscopy was used for detecting fluorescence intensity.
DQ-BSA Red assay: cells were incubated with 10 µ
g/mL DQ-BSA Red in EBSS medium at 37◦ for
1.5 h, and then new medium with or without the indicated compounds were added for another 4 or 6
h, and then fluorescence microscopy was used for detecting the intensity of red fluorescent.
4.9. FRET-Based Assay
A FRET-based assay for detecting ATG4B activity was carried out as described [45]. ATG4A
(20
at 37◦ for 30 min. And then FRET-GABARAPL2 (50
50 L. After 30 min, the relative fluorescence units (RFUs) ratio of 527 nm/477 nm was tested. Finally,
µg/mL) or ATG4B (0.75
µg/mL) was incubated with different concentrations of 163N in 384-well plates
µg/mL) was added to the mixture to a total volume of
µ
Graphpad 7.0 (GraphPad Software, La Jolla, CA, USA) was used to calculate the IC50 value of 163N.
4.10. Pocket Identification and Molecular Docking
The molecular docking of ATG4B was performed as described [25]. Briefly, the crystal structure of
ATG4B was downloaded from the Protein Data Bank (PDB) (www.rcsb.org). Site finder model of MOE.2014
was applied for identifying small molecule-binding pockets. The energy-minimized 3D structure of 163N
was obtained by MOE.2014 conformations model. Then, 163N (minimized 3D structure) was docked into
the pocket site of 2CY7. The docking results were ranked and the best binding pattern of each compounds
were detected. PyMOL software (DeLano Scientific, Palo Alto, CA, USA) were used to obtain the structures
of the docking models.
4.11. Cell Viability Assay
Cells were seeded and incubated overnight in 96-well plates at a density of 5
Then, adherent cells were treated with a series of diluted concentrations of 163N for 48 h. A total of
10 L CCK-8 were added to each well for additional 1 h and cell viability was measured by CCK-8
×
103 cells/well.
µ
assay. Absorbance was measured at 450 nm. The IC50 values were calculated by GraphPad Prism 7
(GraphPad Software Inc., San Diego, CA, USA).

Cancers 2020, 12, 1523
16 of 19
4.12. Real-Time Cellular Analysis (RTCA)
An E-Plate 16 (ACEA Biosciences, Hangzhou, China) was prepared with 50
µL of DMEM
medium added to each well to do a background measurement in the xCELLigence instrument (ACEA
Biosciences, China). 100 L of passaged cell suspensions containing 2.5
103 cells were added to each
µ
×
well and then cells were settled on the base of the well for 30 min at room temperature. The plate was
inserted into the RTCA system (housed within the incubator) and cell index (CI) values were assessed
every 5 min over the following 72 h. After 24 h of cell seeding, the assay was paused and 2 µM 163N
was added to each well. Then, the plate was placed in the station again and the analysis was restarted.
After completing a total of 72 h of analysis, the data were analyzed with GraphPad 7.0 software.
4.13. Colony Formation Assay and Wound Healing Assay
Cells were seeded at a density of 500 cells/well in 6-well plates and incubated overnight. Then,
adherent cells were treated with a series of diluted concentrations of 163N. The culture medium was
changed every 3 d. After about 2 weeks, 4% paraformaldehyde was used to fix the clones and then
0.2% crystal violet (in 10% formalin) was used for dyeing. The stained cells were washed by PBS and
colonies over 1 mm were counted from 3 independent experiments.
Cells were seeded in 12-well plates. After the cells grew to confluence, wounds were made by
sterile pipette tips. The cells were photographed at the beginning of wound formation. Cells were
washed with PBS and refreshed with medium with or without 10 µM of 163N and photographed after
48 h of incubation at the same field of view. The distance of cell migration was calculated from three
independent experiments.
4.14. Tumor Xenograft Studies
The animal experimental procedures were approved by the Research Ethics Committee of Sun
Yat-sen University (Guangzhou, China), ethic code: SYSU-IACUC-2018-000134. Four-week-old
immunodeficient mice (nu/nu, female) were raised in a pathogen-free environment in the Experimental
Animal Center of Sun Yat-sen University. Human colorectal cancer HCT116 cells (3
×
106) were
injected subcutaneously into the right flank of the animals. Seven days after tumor cell implantation,
mice with palpable tumors were divided randomly into two groups and injected intraperitoneal on
Monday, Wednesday, and Friday of the following treatments: (1) vehicle control (corn oil); (2) 163N
(50 mg/kg body weight) dissolved in corn oil. Tumors were measured using calipers and the tumor
volume (mm3) was calculated as follows: V = (L
respectively. At the end of the experiment (5 weeks after tumor implantation), the mice were given
200 L of pentobarbital sodium (1%) by i.p. 30 min before sacrifice, tumors and organs were collected
×
W2)/2, L and W represents tumor length and width,
µ
and weighed.
4.15. Statistical Analysis
Data were reported as mean
specified. Statistical analyses were determined using the Student 2-tailed t test. Values of * p < 0.05
±
SEM from at least three independent experiments unless otherwise
were considered as being significant.
5. Conclusions
In summary, we have generated a novel dual-effective autophagy inhibitor 163N that targets
both ATG4B and lysosome to effectively inhibit tumor growth in vitro and in vivo. In addition,
the anti-cancer effect of 163N was consistent with its ability to suppress autophagy. Therefore, 163N
might be a promising lead compound for further druggability evaluation and anti-tumor application.
Furthermore, these studies open new venues for developing multi-target drugs to improve potential
cancer therapeutics and new strategy for future autophagy-based multi-functional drug discovery.

Cancers 2020, 12, 1523
17 of 19
Supplementary Materials: The following are available online at http://www.mdpi.com/2072-6694/12/6/1523/s1,
Figure S1: Compounds with a 6-methylpyrimidine-2,4-diamine structure could cause lysosome inhibition,
Figure S2: 163N could inhibit autophagy flux, Figure S3: Tumor cells HeLa, HCT116, A549, MGC803, U87,
KYSE150, MDA-MB-231, T98G, HL60, and normal cells HL60 and MRC-5 cells were treated with 0–40 µM of 163N
for 48 h, and CCK-8 assay was performed to assess cell viability, Figure S4: The identification of ATG4B knockout
HCT116 cells, Figure S5: 163N induces cell death through targeting autophagy, Figure S6: 163N could inhibit
tumor growth in vivo without obvious toxicity to organs, Figure S7: The uncropped Western blots and molecular
weight markers of the figure 3 in the main text.
Author Contributions: Conceptualization, M.L.; L.H.; and Z.H.; Methodology, Y.F.; L.L.; J.X.; Q.G.; and Y.L.;
formal analysis, all authors; investigation, all authors; resources, M.L.; L.H.; Z.H.; Q.G.; and X.-M.Y.; Data curation,
Y.F.; L.L.; J.X.; Q.G.; and Y.L.; Writing—original draft preparation, Y.F.; Writing—review and editing, all authors;
supervision, M.L.; L.H.; and Z.H.; Project administration, M.L.; and Z.H.; All authors have read and agreed to the
published version of the manuscript.
Funding: This work was supported by the National Natural Science Foundation of China (31970699, 31671437,
81773992, 81572925) and the Guangdong Basic and Applied Basic Research Foundation (2019A1515011030).
Acknowledgments: We thank Noboru Mizushima (University of Tokyo, Japan) for ATG5KO-MEFs.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
Rubinsztein, D.C.; Marino, G.; Kroemer, G. Autophagy and Aging. Cell 2011, 146, 682–695. [CrossRef]
[PubMed]
Kimura, T.; Takabatake, Y.; Takahashi, A.; Isaka, Y. Chloroquine in Cancer Therapy: A Double-Edged Sword
of Autophagy (vol 73, pg 3, 2013). Cancer Res. 2013, 73, 3–7. [CrossRef] [PubMed]
Amaravadi, R.; Kimmelman, A.C.; White, E. Recent insights into the function of autophagy in cancer.
Gene. Dev. 2016, 30, 1913–1930. [CrossRef] [PubMed]
White, E. Deconvoluting the context-dependent role for autophagy in cancer. Nat. Rev. Cancer 2012, 12,
401–410. [CrossRef] [PubMed]
Ozpolat, B.; Benbrook, D.M. Targeting autophagy in cancer management—Strategies and developments.
Cancer Manag. Res. 2015, 7, 291–299. [CrossRef] [PubMed]
Kung, C.P.; Budina, A.; Balaburski, G.; Bergenstock, M.K.; Murphy, M.E. Autophagy in Tumor Suppression
and Cancer Therapy. Crit. Rev. Eukar. Gene 2011, 21, 71–100. [CrossRef] [PubMed]
Hoyer-Hansen, M.; Jaattela, M. Autophagy—An emerging target for cancer therapy. Autophagy 2008, 4,
574–580. [CrossRef] [PubMed]
Chen, H.Y.; White, E. Role of Autophagy in Cancer Prevention. Cancer Prev. Res. 2011, 4, 973–983. [CrossRef]
[PubMed]
Maycotte, P.; Aryal, S.; Cummings, C.T.; Thorburn, J.; Morgan, M.J.; Thorburn, A. Chloroquine sensitizes
breast cancer cells to chemotherapy independent of autophagy. Autophagy 2012, 8, 200–212. [CrossRef]
[PubMed]
10. Wu, Z.; Chang, P.C.; Yang, J.C.; Chu, C.Y.; Wang, L.Y.; Chen, N.T.; Ma, A.H.; Desai, S.J.; Lo, S.H.;
Evans, C.P.; et al. Autophagy Blockade Sensitizes Prostate Cancer Cells towards Src Family Kinase
Inhibitors. Genes Cancer 2010, 1, 40–49. [CrossRef] [PubMed]
11. Sasaki, K.; Tsuno, N.H.; Sunami, E.; Tsurita, G.; Kawai, K.; Okaji, Y.; Nishikawa, T.; Shuno, Y.; Hongo, K.;
Hiyoshi, M.; et al. Chloroquine potentiates the anti-cancer effect of 5-fluorouracil on colon cancer cells.
BMC Cancer 2010, 10, 370. [CrossRef] [PubMed]
12. McAfee, Q.; Zhang, Z.H.; Samanta, A.; Levi, S.M.; Ma, X.H.; Piao, S.F.; Lynch, J.P.; Uehara, T.; Sepulveda, A.R.;
Davis, L.E.; et al. Autophagy inhibitor Lys05 has single-agent antitumor activity and reproduces the
phenotype of a genetic autophagy deficiency. PNAS 2012, 109, 8253–8258. [CrossRef] [PubMed]
13. Goodall, M.L.; Wang, T.; Martin, K.R.; Kortus, M.G.; Kauffman, A.L.; Trent, J.M.; Gately, S.; MacKeigan, J.P.
Development of potent autophagy inhibitors that sensitize oncogenic BRAF V600E mutant melanoma tumor
cells to vemurafenib. Autophagy 2014, 10, 1120–1136. [CrossRef] [PubMed]
14. Enzenmuller, S.; Gonzalez, P.; Debatin, K.M.; Fulda, S. Chloroquine overcomes resistance of lung carcinoma
cells to the dual PI3K/mTOR inhibitor PI103 by lysosome-mediated apoptosis. Anti Cancer Drug 2013, 24,
14–19. [CrossRef] [PubMed]

Cancers 2020, 12, 1523
18 of 19
15. Yu, Z.Q.; Ni, T.; Hong, B.; Wang, H.Y.; Jiang, F.J.; Zou, S.; Chen, Y.; Zheng, X.L.; Klionsky, D.J.; Liang, Y.; et al.
Dual roles of Atg8-PE deconjugation by Atg4 in autophagy. Autophagy 2012, 8, 883–892. [CrossRef] [PubMed]
16. Liu, P.F.; Leung, C.M.; Chang, Y.H.; Cheng, J.S.; Chen, J.J.; Weng, C.J.; Tsai, K.W.; Hsu, C.J.; Liu, Y.C.;
Hsu, P.C.; et al. ATG4B promotes colorectal cancer growth independent of autophagic flux. Autophagy 2014
10, 1454–1465. [CrossRef] [PubMed]
,
17. Akin, D.; Wang, S.K.; Habibzadegah-Tari, P.; Law, B.; Ostrov, D.; Li, M.; Yin, X.M.; Kim, J.S.; Horenstein, N.;
Dunn, W.A. A novel ATG4B antagonist inhibits autophagy and has a negative impact on osteosarcoma
tumors. Autophagy 2014, 10, 2021–2035. [CrossRef] [PubMed]
18. Rothe, K.; Lin, H.; Lin, K.B.L.; Leung, A.; Wang, H.M.; Malekesmaeili, M.; Brinkman, R.R.; Forrest, D.L.;
Gorski, S.M.; Jiang, X. The core autophagy protein ATG4B is a potential biomarker and therapeutic target in
CML stem/progenitor cells. Blood 2014, 123, 3622–3634. [CrossRef] [PubMed]
19. Bortnik, S.; Choutka, C.; Horlings, H.M.; Leung, S.; Baker, J.H.; Lebovitz, C.; Dragowska, W.H.; Go, N.E.;
Bally, M.B.; Minchinton, A.I.; et al. Identification of breast cancer cell subtypes sensitive to ATG4B inhibition.
Oncotarget 2016, 7, 66970–66988. [CrossRef]
20. Hopkins, A.L. Network pharmacology: The next paradigm in drug discovery. Nat. Chem. Biol. 2008, 4,
682–690. [CrossRef] [PubMed]
21. Chen, Z.; Digiacomo, M.; Tu, Y.; Gu, Q.; Wang, S.; Yang, X.; Chu, J.; Chen, Q.; Han, Y.; Chen, J.; et al. Discovery
of novel rivastigmine-hydroxycinnamic acid hybrids as multi-targeted agents for Alzheimer’s disease. Eur.
J. Med. Chem. 2017, 125, 784–792. [CrossRef] [PubMed]
22. Prati, F.; Cavalli, A.; Bolognesi, M.L. Navigating the Chemical Space of Multitarget-Directed Ligands: From
Hybrids to Fragments in Alzheimer’s Disease. Molecules 2016, 21, 466. [CrossRef] [PubMed]
23. Dar, A.C.; Das, T.K.; Shokat, K.M.; Cagan, R.L. Chemical genetic discovery of targets and anti-targets for
cancer polypharmacology. Nature 2012, 486, 80–84. [CrossRef] [PubMed]
24. Fu, Y.; Xu, J.; Hong, L.; Li, M. Sun Yat-sen University,(compounds with a 6-methyl pyrimidine-2,4-diamine
structure cause lysosome dysfunction). unpublished work.
25. Satoo, K.; Noda, N.N.; Kumeta, H.; Fujioka, Y.; Mizushima, N.; Ohsumi, Y.; Inagaki, F. The structure of
Atg4B-LC3 complex reveals the mechanism of LC3 processing and delipidation during autophagy. EMBO J.
2009, 28, 1341–1350. [CrossRef] [PubMed]
26. Kimura, S.; Noda, T.; Yoshimori, T. Dissection of the autophagosome maturation process by a novel reporter
protein, tandem fluorescent-tagged LC3. Autophagy 2007, 3, 452–460. [CrossRef] [PubMed]
27. Vazquez, C.L.; Colombo, M.I. Assays to assess autophagy induction and fusion of autophagic vacuoles with
a degradative compartment, using monodansylcadaverine (MDC) and DQ-BSA. Method Emzyml. 2009, 452,
85–95. [CrossRef]
28. Kanzawa, T.; Germano, I.M.; Komata, T.; Ito, H.; Kondo, Y.; Kondo, S. Role of autophagy in
temozolomide-induced cytotoxicity for malignant glioma cells. Cell Death Differ. 2004, 11, 448–457.
[CrossRef] [PubMed]
29. Boya, P.; Gonzalez-Polo, R.A.; Casares, N.; Perfettini, J.L.; Dessen, P.; Larochette, N.; Metivier, D.; Meley, D.;
Souquere, S.; Yoshimori, T.; et al. Inhibition of macroautophagy triggers apoptosis. Mol. Cell Biol. 2005, 25,
1025–1040. [CrossRef] [PubMed]
30. Liu, P.F.; Hsu, C.J.; Tsai, W.L.; Cheng, J.S.; Chen, J.J.; Huang, I.F.; Tseng, H.H.; Chang, H.W.; Shu, C.W.
Ablation of ATG4B Suppressed Autophagy and Activated AMPK for Cell Cycle Arrest in Cancer Cells.
Cellular physiology and biochemistry: International journal of experimental cellular physiology. Biochem.
Pharmacol. 2017, 44, 728–740. [CrossRef]
31. Degenhardt, K.; Mathew, R.; Beaudoin, B.; Bray, K.; Anderson, D.; Chen, G.H.; Mukherjee, C.; Shi, Y.F.;
Gelinas, C.; Fan, Y.J.; et al. Autophagy promotes tumor cell survival and restricts necrosis, inflammation,
and tumorigenesis. Cancer Cell 2006, 10, 51–64. [CrossRef] [PubMed]
32. Luo, T.; Fu, J.; Xu, A.; Su, B.; Ren, Y.B.; Li, N.; Zhu, J.J.; Zhao, X.F.; Dai, R.Y.; Cao, J.; et al. PSMD10/gankyrin
induces autophagy to promote tumor progression through cytoplasmic interaction with ATG7 and nuclear
transactivation of ATG7 expression. Autophagy 2016, 12, 1355–1371. [CrossRef] [PubMed]
33. Liu, M.J.; Jiang, L.L.; Fu, X.; Wang, W.J.; Ma, J.Q.; Tian, T.; Nan, K.J.; Liang, X. Cytoplasmic liver kinase
B1 promotes the growth of human lung adenocarcinoma by enhancing autophagy. Cancer Sci. 2018, 109,
3055–3067. [CrossRef] [PubMed]

Cancers 2020, 12, 1523
19 of 19
34. Martin, K.R.; Celano, S.L.; Solitro, A.R.; Gunaydin, H.; Scott, M.; O’Hagan, R.C.; Shumway, S.D.; Fuller, P.;
MacKeigan, J.P. A Potent and Selective ULK1 Inhibitor Suppresses Autophagy and Sensitizes Cancer Cells to
Nutrient Stress. Iscience 2018, 8, 74–84. [CrossRef] [PubMed]
35. Goodall, M.L.; Fitzwalter, B.E.; Zahedi, S.; Wu, M.; Rodriguez, D.; Mulcahy-Levy, J.M.; Green, D.R.;
Morgan, M.; Cramer, S.D.; Thorburn, A. The Autophagy Machinery Controls Cell Death Switching between
Apoptosis and Necroptosis. Dev. Cell 2016, 37, 337–349. [CrossRef] [PubMed]
36. Katheder, N.S.; Khezri, R.; O’Farrell, F.; Schultz, S.W.; Jain, A.; Rahman, M.M.; Schink, K.O.; Theodossiou, T.A.;
Johansen, T.; Juhasz, G.; et al. Microenvironmental autophagy promotes tumour growth. Nature 2017, 541,
417–420. [CrossRef] [PubMed]
37. Li, M.; Hou, Y.; Wang, J.; Chen, X.; Shao, Z.-M.; Yin, X.-M. Kinetics Comparisons of Mammalian Atg4
Homologues Indicate Selective Preferences toward Diverse Atg8 Substrates. J. Biol. 2011, 286, 7327–7338.
[CrossRef] [PubMed]
38. Mizushima, N.; Yoshimori, T.; Ohsumi, Y. The role of Atg proteins in autophagosome formation. Annu. Rev.
Cell Dev. Biol. 2011, 27, 107–132. [CrossRef] [PubMed]
39. Fujita, N.; Hayashi-Nishino, M.; Fukumoto, H.; Omori, H.; Yamamoto, A.; Noda, T.; Yoshimori, T. An Atg4B
Mutant Hampers the Lipidation of LC3 Paralogues and Causes Defects in Autophagosome Closure.
Mol. Biol. Cell 2008, 19, 4651–4659. [CrossRef] [PubMed]
40. Vacante, M.; Borzi, A.M.; Basile, F.; Biondi, A. Biomarkers in colorectal cancer: Current clinical utility and
future perspectives. World J. Clin. Cases 2018, 6, 869–881. [CrossRef] [PubMed]
41. Liu, P.F.; Tsai, K.L.; Hsu, C.J.; Tsai, W.L.; Cheng, J.S.; Chang, H.W.; Shiau, C.W.; Goan, Y.G.; Tseng, H.H.;
Wu, C.H.; et al. Drug Repurposing Screening Identifies Tioconazole as an ATG4 Inhibitor that Suppresses
Autophagy and Sensitizes Cancer Cells to Chemotherapy. Theranostics 2018, 8, 830–845. [CrossRef] [PubMed]
42. Huang, T.; Kim, C.K.; Alvarez, A.A.; Pangeni, R.P.; Wan, X.; Song, X.; Shi, T.; Yang, Y.; Sastry, N.;
Horbinski, C.M.; et al. MST4 Phosphorylation of ATG4B Regulates Autophagic Activity, Tumorigenicity,
and Radioresistance in Glioblastoma. Cancer Cell 2017, 32, 840–855. [CrossRef] [PubMed]
43. Chu, J.; Fu, Y.; Xu, J.; Zheng, X.; Gu, Q.; Luo, X.; Dai, Q.; Zhang, S.; Liu, P.; Hong, L.; et al. ATG4B
inhibitor FMK-9a induces autophagy independent on its enzyme inhibition. Arch. Biochem. 2018, 644, 29–36.
[CrossRef] [PubMed]
44. Qiu, Z.X.; Kuhn, B.; Aebi, J.; Lin, X.F.; Ding, H.Y.; Zhou, Z.; Xu, Z.H.; Xu, D.Q.; Han, L.; Liu, C.; et al.
Discovery of Fluoromethylketone-Based Peptidomimetics as Covalent ATG4B (Autophagin-1) Inhibitors.
ACS Med. Chem. Lett. 2016, 7, 802–806. [CrossRef] [PubMed]
45. Li, M.; Chen, X.; Ye, Q.Z.; Vogt, A.; Yin, X.M. A high-throughput FRET-based assay for determination of Atg4
activity. Autophagy 2012, 8, 401–412. [CrossRef] [PubMed]
©
2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).