Characterization of LipN (Rv2970c) of Mycobacterium Tuberculosis H37Rv and its Probable Role in Xenobiotic Degradation

Article abstract of DOI:10.1002/jcb.25285

LipN (Rv2970c) belongs to the Lip family of M. tuberculosis H37Rv and is homologous to the human Hormone Sensitive Lipase. The enzyme demonstrated preference for short carbon chain substrates with optimal activity at 45C/pH 8.0 and stability between pH 6.0-9.0. The specific activity of the enzyme was 217 U/mg protein with pNP-butyrate as substrate. It hydrolyzed tributyrin to di- and monobutyrin. The active-site residues of the enzyme were confirmed to be Ser216, Asp316, and His346. Tetrahydrolipstatin, RHC-80267 and N-bromosuccinimide inhibited LipN enzyme activity completely. Interestingly, Trp145, a non active-site residue, demonstrated functional role to retain enzyme activity. The enzyme was localized in cytosolic fraction of M. tuberculosis H37Rv. The enzyme was able to synthesize ester of butyric acid, methyl butyrate, in presence of methanol. LipN was able to hydrolyze 4-hydroxyphenylacetate to hydroquinone. The gene was not expressed in in-vitro growth conditions while the expression of rv2970c gene was observed post 6h of macrophage infection by M. tuberculosis H37Ra. Under individual in-vitro stress conditions, the gene was expressed during acidic stress condition only. These findings suggested that LipN is a cytosolic, acid inducible carboxylesterase with no positional specificity in demonstrating activity with short carbon chain substrates. It requires Trp145, a non active site residue, for it's enzyme activity. J. Cell. Biochem.

Full text of DOI:10.1002/jcb.25285

ARTICLE
Journal of Cellular Biochemistry 117:390–401 (2016)
Characterization of LipN (Rv2970c) of Mycobacterium
tuberculosis H37Rv and its Probable Role in Xenobiotic
Degradation
Dipendrasinh Jadeja, Nandita Dogra, Stuti Arya, Gurpreet Singh, Gurdyal Singh,
and Jagdeep Kaur*
Department of Biotechnology, Panjab University, Chandigarh, India
ABSTRACT
LipN (Rv2970c) belongs to the Lip family of M. tuberculosis H37Rv and is homologous to the human Hormone Sensitive Lipase. The enzyme
demonstrated preference for short carbon chain substrates with optimal activity at 45°C/pH 8.0 and stability between pH 6.0–9.0. The specific
activity of the enzyme was 217 U/mg protein with pNP-butyrate as substrate. It hydrolyzed tributyrin to di- and monobutyrin. The active-site
residues of the enzyme were confirmed to be Ser216, Asp316, and His346. Tetrahydrolipstatin, RHC-80267 and N-bromosuccinimide inhibited
LipN enzyme activity completely. Interestingly, Trp145, a non active-site residue, demonstrated functional role to retain enzyme activity. The
enzyme was localized in cytosolic fraction of M. tuberculosis H37Rv. The enzyme was able to synthesize ester of butyric acid, methyl butyrate,
in presence of methanol. LipN was able to hydrolyze 4-hydroxyphenylacetate to hydroquinone. The gene was not expressed in in-vitro growth
conditions while the expression of rv2970c gene was observed post 6h of macrophage infection by M. tuberculosis H37Ra. Under individual
in-vitro stress conditions, the gene was expressed during acidic stress condition only. These findings suggested that LipN is a cytosolic, acid
inducible carboxylesterase with no positional specificity in demonstrating activity with short carbon chain substrates. It requires Trp145, a non
0
active site residue, for it s enzyme activity. J. Cell. Biochem. 117: 390–401, 2016. © 2015 Wiley Periodicals, Inc.
KEY WORDS: 4-HYDROXY PHENYLACETATE HYDROLASE; ESTERASE; LipN; mycobacterium tuberculosis; rv2970c; XENOBIOTIC
uberculosis is a deadly infectious disease caused by M.
tuberculosis [Bloom and Murray, 1992]. From the genome
sequence of M. tuberculosis H37Rv, a group of 24 genes were
annotated as Lip family genes. Out of these, twelve proteins were
found to be homologous to the human Hormone Sensitive Lipase
or pathways involving short-chain substrates, such as signaling,
membrane support, regulation and xenobiotic degradation [Delmore
et al., 2012]. Recently the involvement of mycobacterium esterases
in hydrolysis of xenobiotic esters for activation of prodrugs was also
reported [Valente et al., 2011]. It suggested the importance of this
metabolism in survival of a successful pathogen. The bioinformatic
analysis using various tools revealed that many of these HSL like
esterases could be involved in xenobiotic degradations.
Out of these 12 mHSL, LipN protein sequence demonstrated
maximum identity with hHSL (38%). It contains all conserved motifs
present in human HSL (Fig. S1). In KEGG orthology database,
Rv2970c was predicted to be involved in xenobiotic degradation,
particularly in bisphenol degradation pathway (KEGG pathway ID:
mtu00363) (Fig. S2). An intermediate step of this pathway is
hydrolysis of 4-hydroxyphenyl acetate (4-HPA) ester to hydro-
quinone (1.4-dihydroxybenzene). Bisphenol A degradation pathway
has an arylesterase (EC 3.1.1.2) involved in conversion of 4-HPA to
hydroquinone and acetate. We hypothesized that if LipN was
T
(
HSL) [Cole et al., 1998; Camus et al., 2002; Dedieu et al., 2013].
Amongst these, only LipY (Rv3097c) was identified as a lipase and
has been reported to participate in the degradation of intra-or
extracellular triacylglycerols (TAGs), thus releasing fatty acids as
substrates to fuel the glyoxylate cycle [Deb et al., 2006; Mishra et al.,
2
008]. LipF (Rv3487c) and LipH (Rv1399c) were identified as
cytosolic esterases, while LipC (Rv0220), a membrane bound/
extracellular esterase interacted with host immune system to play an
important role in infection and virulence [Zhang et al., 2005; Canaan
et al., 2004; Shen et al., 2011]. In 2012, Delmore and colleagues
showed that eight out of twelve M. tuberculosis Lip-HSL (mHSL)
candidates were esterases and were inhibited by MmPPOX inhibitor.
These Lip-HSL members might take part in metabolic processes and/
Grant sponsor: Council of Scientific and Industrial Research, Human Resource Development Group, CSIR Complex,
Library Avenue, Pusa, New Delhi - 110 012, INDIA; Grant number: 37(1388)/09/EMR-II.
*Correspondence to: Dr. Jagdeep Kaur, Department of Biotechnology, Panjab University, Chandigarh, India
E-mail: jagsekhon@yahoo.com
Manuscript Received: 3 March 2015; Manuscript Accepted: 20 July 2015
Accepted manuscript online in Wiley Online Library (wileyonlinelibrary.com): 24 July 2015
DOI 10.1002/jcb.25285 ꢀ © 2015 Wiley Periodicals, Inc.
390

involved in bisphenol A degradation then that arylesterase (EC
.1.1.2) could possibly be LipN (Fig. S3). This hypothesis was based
on the fact that LipN demonstrated high similarity with HapB 4-
hydroxyphenyl acetate hydrolase of P. fluorescens involved in
hydrolysis of 4-HPA to hydroquinone [Kamerbeek et al., 2001,
obtained from the NCCS Pune, India. The cells were cultured in 10 cm
tissue culture dishes in RPMI medium supplemented with 10%
charcoal-treated FBS, 2% non-essential amino acids and 50 mg/ml
3
2
penicillin/streptomycin at 37°C in 5% CO .
Infection of THP-1 macrophages with Mycobacterium tuberculosis
H37Ra. Mycobacterium tuberculosis H37Ra was grown to log phase
in small volumes of 7H9 broth supplemented with 10% (v/v) OADC
(BBL). Prior to infection, M. tuberculosis cells were washed three
times with sterile phosphate buffer saline, pH 7.4 (PBS) dispersed by
vortexing followed by sonication (15 s, 500 W) in a sonicator
[Tanigawa et al., 2008] and then passed through 30-gauge needle
several times to get single cell-suspension. For infection experi-
ments, the THP-1 cells were procured from the ATCC and maintained
in RPMI-1640 supplemented with 10% FBS, 1% HEPES, 1% L-
glutamine, 100 mg/ml streptomycin, 100 IU/ml penicillin. The cells
2
003a, 2003b].
Therefore, in the present study an attempt has been made to
elucidate the biological activity of Lip N as a 4-HPA hydrolase and in
ester hydrolysis/synthesis. The enzyme was characterized in detail.
The expression pattern of the gene in ex vivo and in vitro conditions
(
normal growth and in vitro stress conditions) might give insight to
0
it s importance during stress conditions.
MATERIALS AND METHODS
2
were maintained at 37°C in humidified atmosphere of 5% CO . Media
MATERIALS
was changed after every 3–4 days. THP-1 cells were plated in 6 well
flat bottom plates at 3 ꢁ 10 cells per well. After 24 h cells were
5
All the synthetic substrates (pNP-esters), RPMI-1640, fetal bovine
serum (FBS), Phorbol 12-myristate 13- acetate, (PMA) and Tri
reagent were purchased from Sigma Chemical Co, St. Louis, MO.
Isopropyl D-thiogalactopyranoside (IPTG) was purchased from
Golden Biotech (GBT), Taiwan. Ni–NTA His binding resin was
purchased from Qiagen, Germany. Ampicillin, kanamycin, rifampi-
cin, LB media, Middlebrook 7H9 broth base, Urea, Lipase from
Aspergillus niger were purchased from Himedia, India. OADC
supplement was purchased from BBL(BD bioscience, Fraklin Lakes,
NJ), Analytical standard 4-HPA and hydroquinone were purchased
from TCI Japan and Sigma Chemical Co., respectively. pQE30 UA
vector was purchased from Invitrogen. All primers used in study are
given in Table I.
incubated with fresh media with 10 mg/ml PMA for differentiation.
After 48 h PMA treatment, cells were washed with PBS and
incubated with fresh RPMI media for 8 h. Later the cells were
infected with diluted and dispersed preparations of M. tuberculosis at
multiplicity of infection (MOI) of 20:1 (20 bacilli per macrophage).
After 4 h, the cells were washed four times with PBS to remove
extracellular bacteria following treatment with gentamycin (200 mg/
ml) for 4 h and then incubated again with fresh RPMI-1640 medium
supplemented with 10% fetal calf serum L-glutamine (2 mM), HEPES
(2.38 mg/ml), sodium bicarbonate (2.2 mg/ml), 2-mercaptoethanol
(0.05 mM) and gentamycin (20 mg/ml). Bacteria were isolated from
macrophage at specific time points (0 h, 6 h) after treatment of
infected cells with 0.1% Triton X 100 in PBS followed by RNA
isolation. Cells initially incubated with mycobacterium for 4 h were
taken as 0 h sample.
METHODS
Growth of M. tuberculosis H37Ra and THP-1 cell line. M.
tuberculosis H37Ra was procured from Microbial Type Culture
Collection and Gene Bank (MTCC) Chandigarh, India. It was grown in
middlebrook 7H9 broth base supplemented with 1% glycerol and
rv2970c expression analysis under different stress conditions.
Sequence analysis of rv2970c gene and 1000 bp upstream region
showed 100% identity in M. tuberculosis H37Ra and M. tuberculosis
H37Rv. Also rv2970c was not predicted to be regulated by Phop
regulon reported to be responsible for attenuation of M. tuberculosis
0
.05% Tween-80. An additional 10% (v/v) growth supplement OADC
was added. The human leukemic monocytic cell line THP-1 was
TABLE I. Primers Used in Entire Study
Primer for cloning
Name of gene
Forward primer
Reverse primer
0
0
0
0
0
rv2970c
5 ATGACCAAAGAGTCTGCCAGG 3
5 TCAAACCCGGCTAAGGTG 3
Primers used in Stress induced expression study
Name of genes
Forward primer
Reverse primer
0
0
0
0
0
rv2970c
5 CGACGTGACCGACCTGTCAT 3
5 TGGGCCCACCCTCGTAGC 3
0
0
1
1
6S rRNA (semi quantitative RT PCR)
6S rRNA (real time)
5 AGAGTGTGATCCTGGCTCAG 3
5 TACGGYTACCTTGTTACGACTT3
0
0
0
0
5 GAGGAAGGTGGGGATGACGT 3
5 AGGCCCGGGAACGTATTCAC 3
Primers used for site directed mutagenesis
Position where point mutation created
Forward primer
Reverse primer
0
0
0
0
S216A
D316A
D320A
H346A
W145A
5 TGGGCGGGGACGCTGCGGGCGGCAACCTGT 3
5 ACAGGTTGCCGCCCGCAGCGTCCCCGCCCA 3
0
0
0
0
5 TCGCCGGCTTCGCCCCATTGCGCGAC 3
5 GTCGCGCAATGGGGCGAAGCCGGCGA 3
0
0
0
0
5 TCGACCCATTGCGCGCCGAAGGAGAAAGC 3
5 GCTTTCTCCTTCGGCGCGCAATGGGTCGA 3
0
0
0
0
5 TGGGTTCGCTGACGGCTGGCTTCCTCAACC 3
5 GGTTGAGGAAGCCAGCCGTCAGCGAACCCA 3
0
0
0
0
5 CACGGTGGCGGCGCGACGCTCGGGGAC 3
5 GTCCCCGAGCGTCGCGCCGCCACCGTG 3
JOURNAL OF CELLULAR BIOCHEMISTRY
CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv 391

H37Ra strain [Gonzalo Asensio et al., 2006]. Many studies reporting
gene expression profile difference between Mycobacterium tuber-
culosis H37Rv and Mycobacterium tuberculosis H37Ra were taken in
to consideration [Zheng et al., 2008; Gao et al., 2004]. To the best of
our knowledge there was not a single report suggesting difference in
expression of rv2970c in Mycobacterium tuberculosis H37Rv and
Mycobacterium tuberculosis H37Ra. Therefore we used M. tuber-
culosis H37Ra for expression studies.
The bacterial cells were grown to mid log phase (A600 0.7–0.8) and
harvested by centrifugation. The bacterial pellet was washed with
PBS and resuspended in different media for exposure to stress
conditions such as oxidative stress (7H9 growth media with 5 mM
M15 colonies with correct ORF were confirmed by colony PCR
followed by sequencing of the positive clones Overnight grown
culture with cloned gene was used to inoculate (1%) 250 ml Luria
Bertanii (LB) media containing 30 mg/ml kanamycin and 100 mg/ml
ampicillin. The cultures were grown till OD600 reached ꢂ0.5–0.6 and
recombinant protein expression was induced by addition of 0.1 mM
IPTG. Cells were incubated at 37°C, harvested after 3 h of induction
and the pellet was resuspended in lysis buffer (50 mM Tris-HCl pH-
8.0, 50 mM NaCl, 1 mM EDTA, 0.5% Triton-X, 0.25 mg/ml lysozyme)
and stored at ꢃ80°C. Cells were disrupted by ultrasonication (10ꢁ
with 15 s cycle) followed by centrifugation. LipN protein was
exclusively present in inclusion bodies. Inclusion body pellet was
H
2
O
2
) [Springer et al., 2001], acidic stress (7H9 growth media at pH
2 4
dissolved in solubilizing buffer (100 mM NaH PO buffer pH 8.0,
4
.5 (adjusted with 0.2 N HCl) [Richter and Saviola, 2009] and nutrient
10 mM Tris/HCl buffer pH 8.0, 8 M Urea) and kept on a rocker for
30 min at room temperature. Cell debris was removed by
centrifugation at 10,000 rpm for 10 min. Supernatant was loaded
stress (1X phosphate buffer saline) [Geiman et al., 2006]. These three
stressed cultures were incubated for 6 h, alongwith control culture in
middlebrook 7H9 broth base (normal pH, without any additive).
RNA samples of Mycobacterium tuberculosis H37Ra was isolated
using TRI reagent as per company s instruction manual. The
integrity, quantity and quality of RNA samples were checked by
agarose gel electrophoresis and spectrophotometry. All the RNA
samples were given Ambion TURBO DNA-free DNase Treatment
as per company s instruction manual before being converted into
complementary DNA (cDNA) using RevertAid cDNA kit (Fermen-
tas). The cDNA was used as a template to check the relative
expression of the rv2970c gene. 16S-rRNA was used as an internal
control to normalize the expression and then it was normalized to the
control/untreated condition for the target gene. cDNA was diluted to
half for the expression work of 16S rRNA. a) Semi quantitative PCR:
It was performed with cDNA corresponding to 50 ng RNA using
Fermentas Taq polymerase. Separate sets of reaction master mix
were prepared by adding the following components for a 25 ml
reaction each: 1 ml each of forward and reverse primers from 10 mM
solution, 1 ml cDNA, 2.5 ml of 10X enzyme buffer, 1.5 ml of 25 mM
þ
on previously equilibrated Ni -NTA affinity column with buffer
(100 mM NaH PO buffer pH 8.0, 10 mM Tris/HCl buffer pH 8.0,
2
4
0
8.0 M Urea). Washing of unbound proteins and elution of protein was
in pH dependent manner. The column was washed with 10 column
volume washing buffer (100 mM NaH PO buffer pH 6.8, 10 mM Tris/
2
4
1
TM
HCl buffer pH 6.8, 8 M Urea), and the protein was eluted with elution
buffer (100 mM NaH PO buffer pH 5.8, 10 mM Tris/HCl buffer pH
0
2
4
TM
5.8, 8 M Urea). Eluted fractions containing purified LipN were
analyzed by denaturing polyacrylamide gel electrophoresis (SDS
PAGE).
For refolding of LipN, step wise dialysis was carried out with
decreasing concentration of urea ranging from 6.0 to 1.0 M and at
2 4
last in buffer (50 mM NaH PO buffer pH 8.0) for overnight at 4°C.
Protein concentration was calculated after purification of LipN and
0
before dialysis. It s concentration was considered as a 100% protein.
After dialysis insoluble aggregates (misfolded /unfolded proteins)
were removed by centrifugation and soluble aggregates were
removed by 50 kd cut-off concentrator. Remaining protein was
considered as a refolded protein and its concentration was calculated
2
MgCl , 1 ml of 25 mM dNTPs, 0.5 ml Taq enzyme (5 U/ml) and rest
0
double distilled water to complete 25 ml reaction mix. The products
of RT PCR were checked on 1.2% agarose gel. b) Real time PCR-
analysis: Real time PCR was performed with cDNA corresponding to
by Lowry s method. This concentration was considered as % refolded
protein. Nearly 35% of protein was refolded through this procedure.
Protein was concentrated to final concentration of 1 mg/ml of
protein. Enzyme activity of the protein was determined.
TM
1
5
0 ng RNA using DyNAmo ColorFlash SYBR 1Green qPCR Kit
from Thermo-scientific in Mastercycler ep realplex Real-Time PCR
System (Eppendorf). Reaction mix (20 ml) was prepared by adding
the following components: 10 ml of master mix (containing enzyme,
Standard enzyme assay. Enzyme activity was determined by the
modified method of Dosanjh and Kaur [2002]. To 750 mL of 50 mM
NaH PO buffer pH 8.0, 100 mL of pNP-butyrate/substrate (2mM,
2
4
1
0
mM dNTPs, enzyme buffer, 2.5 mM MgCl
.4 ml of 25 mM ROX dye, 1 ml each of forward and reverse primer
2
and SYBR Green dye),
dissolved in ethanol), 100 ml of 10 mM sodium deoxycholate and
50 ml of enzyme was added and mixed. Reaction mixture was
incubated at 45°C for 10 min followed by addition of 250 ml of 0.1 M
and double distilled water to make up the volume. In case of
mycobacterium infected cell line, relative expression values of
rv2970c were calculated w.r.t expression value of 16S rRNA, taken
as 1. For relative expression of LipN in different stresses w.r.t control,
determination of fold change in expression level of the gene was
2 3
Na CO . Enzyme activity was determined by measuring absorption
at A420 and specific enzyme activity was calculated. One unit of
enzyme activity is defined as the amount of enzyme, which librates
1 m mole of pNP from pNP-ester per minute under standard assay
conditions.
-DDCt
carried out by using the 2
001].
Method [Livak and Schmittgen,
2
Sub-cellular localization of LipN in M. tuberculosis H37Ra.
Rabbits were bled before immunization. Thick emulsion of LipN
Cloning, expression, and purification of LipN. rv2970c ORF was
amplified by standard PCR procedure from M. tuberculosis H37Rv
genomic DNA (kind gift from Dr. U.D Gupta). Primers used were as
described in Table I. Amplified gene was cloned in pQE30 UA vector
and it was used to transform E. coli M15 cells. Transformed E. coli
0
(0.50 mg) mixed with Freund s adjuvant (was injected subcuta-
neously to immunize two rabbits (Approved by Institutional animals
ethics committee/ IAEC/127) on day 0. Three booster doses were
given at the intervals of 15 days with emulsified LipN (0.25 mg) in
392 CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv
JOURNAL OF CELLULAR BIOCHEMISTRY

0
incomplete Freund s adjuvant. Five days after last booster dose,
of pNP-butyrate) using standard assay method. The Michaelis–
Menten constant (K ), maximum velocity for the reaction (Vmax) and
catalytic constant (kcat) were calculated.
blood was collected and serum was isolated. Immunoglobin G (IgG)
was purified from the immunized rabbit s serum by A-Sepharose 4B
m
0
columns (Amersham Biosciences). Presence of antibodies in serum
was checked by Ouchterlony double immunodiffusion and used for
western blot analysis.
Time dependent reaction progress curve of hydrolysis of pNP-
butyrate. Effect of time on conversion of substrate into product by
LipN and lid domain containing lipase from Aspergillus niger were
analyzed in a time dependent manner. The enzymes were incubated
with pNP-butyrate (200 mM) at their optimum temperatures i.e. 45°C
for LipN and 37°C for lipase from Aspergillus niger in different vials.
The vials were taken out after every min of incubation and
Theculture ofacidstressedM. tuberculosis H37Ra (at midlogphase,
A600–0.8) was used to isolate various sub-cellular functions as
described in Rezwana et al. [2007]. For western blot analysis,
equivalent amount of each fraction were loaded on 12% SDS-PAGE
along with purified recombinant LipN and transferred to PVDF
membrane. After blocking the PVDF membrane with 5% skimmed
milk in TBS, the PVDF membrane was incubated with polyclonal
antibodies against LipN (final dilution 1:500) for 2 h. After three
washes with tris buffer saline (50 mM Tris-Cl, pH 7.5, 150mM NaCl
TBS), the membrane was incubated with HRP-tagged anti rabbit
secondary antibodies for 2 h at room temperature, (final dilution
absorption was measured at A420
.
Effect of different additives and effectors on enzyme activity. The
effect of various reagents on LipN enzyme activity was determined.
Purified LipN protein was incubated for 1 h at 25°C with reagents
(5 mM) such as N-Bromosuccinimide (NBS, oxidizes tryptophan and
transforms it into an oxindole residue), 1-ethyl-3-(3-dimethylami-
nopropyl) carbodiimide (EDAC, modifies/inactivates acidic amino
acid residues), Iodoacetae (IA, cysteine alklytaing agent), citraconic
anhydride (CA, lysine modifier), phenylglyoxal monohydrate (PG,
1
:10000). Theblot was thoroughly washed with TBS and developed by
developing solution (TAB, Tri ammonium benzoate along with H
Fermentas).
2 2
O )
(
2
phospholipase A inhibitor), phenylmethanesulfonylflouride (PMSF,
Serine modifier) and Diethylpyrocarbonate (DEPC, Histidine modi-
fier), N-acetyl imidazole (NAI, tyrosine modifier), RHC 80267 and
tetrahydrolipstatin (THL), a known DAG and TAG lipase/esterase
inhibitor respectively [Sutherland and Amin, 1982; Yang et al.,
2010]. After incubation the relative enzyme activity was determined
by standard assay method. The enzyme without any additive was
taken as control (100% enzyme activity).
BIOCHEMICAL PROPERTIES
Substratespecificity. To investigate the substrate specificity of LipN,
the enzyme activity was measured with various substrates like pNP-
acetate (C-2), pNPbutyrate (C-4), pNP-octonate (C-8), pNP-decanoate
(C-10), pNP-laurate (C-12), pNP-myristate (C-14), pNP-palmitate (C-
1
6), pNP-stearate(C-18). Standard enzyme assay was performed as
described above. Emulsified tributyrin and triolein were also used to
check its degradation by LipN on substrate plates by well assay
method.
Thin layer chromatography. Tributyrin, emulsified in 50 mM
phosphate buffer (1% V/V), was incubated with 50 ml of enzyme
Site directed mutagenesis. Site directed mutagenesis was carried
out by substituting conserved putative active site residues Ser216,
Asp316, Asp320 and His346 with alanine by using site directed
mutagenesis kit (Stratagene, Santa Clara, CA). A conserved
tryptophan (Trp145) in the vicinity of active site was also mutated
to alanine. The primers are listed in Table I. E. coli M15 cells were
transformed with plasmids having confirmed mutant gene. Mutant
proteins were purified, checked for enzymatic activity and compared
with the wild type enzyme.
Esterification of butyric acid by immobilized LipN. Purified LipN
was immobilized on HP 20 beads (Diaion) as described by Dosanjh
and Kaur [2002]. Thermal inactivation of aqueous and immobilized
enzyme was studied by incubating enzyme at 60°C for different time
points with an interval of 10 minutes each and assayed for enzyme
activity by standard assay method. Both type of enzymes without
any pretreatment were taken as control (100%). HP20 beads (200 mg)
with immobilized LipN enzyme were used as biocatalyst for the
esterification of butyric acid (0.25 M) and methanol (0.4 M) in
hexane in 10 ml reaction mix for different time points in duplicate at
37°C with heat inactivated enzyme as a control. To the 10 ml reaction
mixture, 20 ml acetone: methanol 1:1(v/v) was added. The ester
content was quantified by using alkalimetric method of titrating
unreacted acid with 0.1 N NaOH with phenolphthalein as an
indicator. The conversion (%) in ester synthesis was determined
based on acid consumed [Bovara et al., 1993].
(40 U/ml) in 1 ml of reaction mix for 16 h. The samples were taken out
at different time interval. Lipids were extracted with 2:1 chloroform:
methanol followed by gentle mixing and centrifugation at 10000 rpm
for 5 min. Four microliters of extracted products were run on silica
coated TLC plate along with tributyrin, dibutyrin and monobutyrin as
a control. Chloroform: acetic acid (95:5) was used as a mobile phase
and iodine fumes were used to visualize the products on TLC.
Effect of pH and temperature on enzyme activity and stability. To
find out pH optima for esterase activity, enzyme assay was performed
in buffers (50mM) of different pH from pH 4.0–10.0. Acetate buffer
(pH 4-5) phosphate buffer (pH 6.0–8.0), Tris-HCl buffer (pH 8.0–9.0)
and carbonate-bicarbonate buffer (pH 11.0) were used. To determine
optimum temperature of enzyme activity, enzyme assay was
performed at various temperatures (25–75°C) for 10 min. Enzyme
activity was determined as per standard enzyme assay protocol.
For pH stability 50 ml of enzyme was incubated with 100ml of
buffers at different pH (pH 4.0–10.0) for 30 min at 25°C. Afterwards
enzyme assay was performed at optimum pH and temperature. To
obtain temperature stability profile, 50 ml of enzyme was incubated at
various temperatures (25–70°C) for 30 min followed by incubation at
4
°C for 20 min. Enzyme assay was performed as per standard assay
LC MS analysis. 4-hydroxyphenyl acetate hydrolase activity of
LipN was checked by using 4-HPA as substrate by LC-MS. Two
hundred microliter of 4-HPA (45 mM) prepared in ethanol was added
to 800 ml of 50 mM phosphate buffer with HP20 immobilized LipN
conditions.
Enzyme kinetics. Enzyme activity of the purified LipN was
determined as a function of substrate concentration (0.01–1.0 mM
JOURNAL OF CELLULAR BIOCHEMISTRY
CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv 393

(
40 U/20 mg of HP20 beads) and incubated for 2 h at 45°C on shaker
denatured protein was purified to homogeneity (Fig. 2A). After step
wise dialysis, the misfolded/unfolded proteins were removed by
centrifugation. Nearly 35% of total protein was refolded to active
protein. Purified protein was of 42 kDa as observed in SDS-PAGE.
The size of protein was little higher due to the presence of His tag
encoded by vector sequence. The specific activity for rv2970c gene
product was 217 U/mg with pNP butyrate as substrate. Anti-LipN
polyclonal antibodies were raised in rabbits and were used to
determine the sub cellular distribution of LipN in M. tuberculosis.
The antibody titer for LipN was low (data not given). Therefore
purified IgG was used for western blot analysis. The polyclonal
antibodies recognized both, purified as well as native LipN present in
the cytosolic fraction of acid induced M. tuberculosis H37Ra
(Fig. 2B).
in dark followed by LCMS analysis. One ml of 4-HPA and
hydroquinone (10 mM) in 50 mM phosphate buffer without enzyme
were incubated for 2 h at 45°C on shaker and were taken as a
standard for LC MS experiment. Waters Micromass Q-TOF Micro
LCMS available at Sophisticated Analytical Instrumentation Facility
(SAIF), CIL and UCIM at Panjab University was used for analysis. For
liquid chromatography separation was achieved by using 5 m
Supelco LC-18-DB, 2.1 ꢁ 100 mm column. Mobile phase (0.1:25:75
phosphoric acid: methanol: water) in 100% isocratic mode with flow
rate of 0.15 ml/min was used. Ten microliter sample was injected.
Hydroquinone and 4-HPA were detected at 219 nm and 280 nm
respectively. For TOF MS (ES-) negative ionization mode, analysis
was performed in the negative atmospheric pressure. Chemical
ionization mode was attained using a vaporizer temperature of 450°
C and a capillary temperature of 150°C. Nitrogen was used as a
sheath gas (20%) and auxiliary gas (5%). Capillary voltage was
BIOCHEMICAL CHARACTERIZATION OF LipN
Amongst the pNP substrates, LipN protein showed preference for
short carbon chain substrates. Though the enzyme showed highest
activity with pNP-acetate, we chose to use pNP- butyrate as substrate
because of the self hydrolysis of pNP-acetate. Preference over wide
range of substrates having smaller acyl chain was evident in the
results (Fig. 3A). It showed a zone of clearance on emulsified
tributyrin plate but no activity on emulsified trioline plate (data not
shown). LipN hydrolyzed tributyrin to dibutyrin and monobutyrin
(Fig. 3B).
The optimum enzyme activity was observed at pH 8.0 and
temperature 45°C (Figs. 3C, D). The enzyme was stable in the range
from pH 6.0 to pH 9.0 (Fig. 3 D). About 80% of enzyme activity was
retained after incubation of protein at 45°C for 30 min (Fig. 3C). The
2
823 V. and sample cone for fragmentation was 30 V.
RESULTS
BIOINFORMATICS ANALYSIS
Bioinformatics analysis revealed that LipN belongs to bacterial
family IV carboxylesterases (Fig. S1) and shows sequence similarity
to the human HSL [Arpigny and Jaeger, 1999] which is produced
during nutritional stress i.e. fasting in presence of epinephrine
[
Lampidonis et al., 2011]. All four conserved sequences of HSL
(consensus pentapetide GDSAG motif which contains active site
serine residue, conserved HGGG/GGGX motif containing oxyanion
region and two C-terminus located conserved motifs, DPLR and
HGF) were present in LipN (Fig. S1). Protein BLAST result with PDB
showed LipN to be 41% identical to thermophilic carboxylesterase
Est2 from Alicyclobacillus acidocaldarius with 83% query coverage
and 39% identical with HSL-like carboxylesterase from Sulfolobus
tokodaii with query coverage 78% (data not shown).
apparent K and Vmax were found to be 303 mM and 75.75 mmol
m
ꢃ1
min respectively. The apparent k and k /K for LipN were
cat
cat
ꢃ1
m
ꢃ1
ꢃ1
determined as 7283 min and 24.03 mM min respectively. The
time course of reaction progress of hydrolysis of pNP-butyrate by
LipN showed progressive increase in hydrolytic rate, a steady state
reaction did not reach saturation in 8 min. It did not show latency
phase as observed in lid containing lipase from Aspergillus niger
(Fig. 4A,B). To investigate the role of conserved amino acid in
structural and functional attributes of LipN, effect of various amino
acid modifiers were investigated. NBS, THL and RHC, PMSF and
DEPC inhibited LipN enzyme activity completely whereas citraconic
anhydride, acetyl imidazol, phenylglyoxal, iodoacetate EDAC
showed no effect on enzyme activity (Table II).
rv2970c GENE EXPRESSION ANALYSIS
No expression of rv2970c gene was observed in mid log phase of in-
vitro grown culture of M. tuberculosis H37Ra. In THP-1 cells
infected with M. tuberculosis H37Ra, the gene was expressed after
6
h of infection (Fig. 1A). The mycobacterium is exposed to several
stress conditions inside the macrophages. Therefore expression
pattern of rv2970c was studied in individual stress conditions such
as oxidative, acidic and nutritive stress. Semi quantitative PCR
analysis demonstrated that the rv2970c gene was expressed only in
acidic stress condition (Fig. 1B). No expression was observed in
control oxidative and nutritive stress conditions. The normalized
values of expression (rv2970c/16S RNA) as demonstrated by real
time PCR showed 22 fold higher expression of rv2970c in acidic
condition when compared to control (Fig. 1C).
Tryptophan 145 and Active Site Residues are Indispensible for
Esterase Activity of LipN
Bioinformatics study illustrates LipN as
a protein with
conserved pentapeptide GDSAG (G-X-S-X-G), a characteristic of
a/b hydrolases, spanning between 214 to 218 amino acids. Other
conserved active site residues included, Asp316, Asp320 and
His346. The individual single substitution mutations for predicted
active site residues Ser216, His346 and Asp316 to Ala led the loss
in the enzyme activity of LipN while Asp320 substitution did not
affect the enzyme activity (Fig. 4C). Trp145, another conserved
PURIFICATION, REFOLDING, AND CELLULAR LOCALIZATION OF LipN
Attempts to express recombinant LipN protein in soluble fraction at
different induction time and temperatures as well as concentrations
of IPTG were unsuccessful. Consequently, protocol to isolate
recombinant protein from inclusion bodies was standardized. The
0
residue, was mutated due to it s proximity and geometry with
active site residues observed through structure modeling (Fig. S5).
On substituting Trp145 to Ala, this mutant protein also lost
enzymatic activity completely (Fig. 4C).
394 CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv
JOURNAL OF CELLULAR BIOCHEMISTRY

Fig. 1. Ex-vivo and in-vitro stress induced expression of rv2970c A: Expression of rv2970c after infecting macrophages (THP-1) with M. tuberculosis H37Ra. The samples were
collected after 6 h. B: Semi quantitative PCR based rv2970c mRNA expression under various stress conditions. The mycobacterium culture in mid log phase was exposed to acidic
(
A), oxidative (O), nutritive (N) along with control (C) for 6 h. C: Real time PCR based Rv2970c (LipN) mRNA expression.
Fig. 2. Expression and Purification of LipN (Rv2970c) A: SDS-PAGE analysis: Lane M: Protein MW Marker, 1: Uninduced LipN, 2: IPTG induced LipN culture pellet. 3: lysate after
sonication of induced LipN sample. 4: Induced LipN pellet/ inclusion bodies 5: Purified LipN. B: Subcellular localization of LipN in acid induced Mycobacterial cell fractions.
Polyclonal antibodies were raised in rabbits against LipN. lane 1: Purified recombinant LipN, Lane 2: Culture filtrate protein fraction, Lane 3: Cytosolic protein fraction, Lane 4:
Cell wall fraction.
JOURNAL OF CELLULAR BIOCHEMISTRY
CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv 395

Fig. 3. Studies on biochemical characteristics of LipN. A: Substrate specificity of LipN with different pNP esters by standard enzyme assay as described previously: where, C2-
pNP-acetate, C4- pNP-butyrate, C8- pNP-caprylate, C10- pNP-capricate, C12- pNP-laurate, C14- pNP- myristate, C16- pNP-palmitate, C18- pNP- sterate. B: Analysis of
tributyrin hydrolysis by LipN on thin layer chromatography. 1: Tributyrin 2: Tributyrin and its hydrolyzed products after incubating with LipN. 3: Dibutyrin 4: Monobutyrin. C:
Effect of temperature on enzyme activity and stability of LipN. D: Effect of pH on enzyme activity and stability of LipN. (Each experiment was conducted independently three
times in triplicate. Error bars indicate the standard deviation).
IMMOBILIZED LipN SYNTHESIZES METHYL BUTYRATE THROUGH
ESTERIFICATION
Activity of the enzyme immobilized on HP20 beads was determined
to be 2Uþ-0.4/mg of beads. Immobilization increased thermal
stability of enzyme activity to 60°C. The half life of aqueous and
immobilized LipN was nearly 5 min and 35 min respectively at 60°C
detected with same retention time (Fig. 6D). In TOF MS (ES-),
analytical standard 4-HPA base peak was detected at 151 m/z with
ion intensity 9446 and fragments of 4-HPA (unknown chemical
formula) were m/z 107 and 106 (Fig. 7A). However, fragment pattern
of 4-HPA was same as observed in HMDB (http://www.hmdb.ca/
spectra/ms_ms/2558)
(http://www.hmdb.ca/spectra/ms_ms/33).
(
Fig. 5A). Esterification studies of enzyme illustrated that 50% of
Analytical standard hydroquinone base peak was detected at
109 m/z with 2487 ion intensity (Fig.7B) and fragment pattern
was as observed earlier (http://foodb.ca/spectra/ei_ms/338). In case
of test sample both 4-HPA and hydroquinone peaks were detected at
m/z 151 and m/z 109, respectively. A significant 4-HPA hydrolysis
was detected (Fig. 7C)
butyric acids present in the reaction mix were converted to methyl
butyrate in the presence of methanol after 12 h incubation with LipN
enzyme. After 16 h incubation 58% esters were produced (Fig. 5B).
LC MS ANALYSIS OF 4-HYDROXYPHENYL ACETATE HYDROLASE
ACTIVITY OF LipN
The conversion of 4-HPA to hydroquinone by LipN was studied
DISCUSSION
(
Fig. 6A). An analytical standard 10 mM 4-HPA peak was detected at
80 nm with retention time 2.10 min (Fig. 6B) and standard 10 mM
hydroquinone was detected at 219 nm with retention time 3.43 min
Fig. 6C). However, upon oxidation it might have been converted to
p-benzoquinone which was detected with retention time 2.08
Fig. 6C). In test sample after incubation of 4-HPA with LipN for 2 h,
both hydroquinone, substrate 4-HPA and p-benzoquinone were
2
For better treatment of TB, it is prerequisite to understand the growth
conditions and physiological environments experienced by bacteria
inside the host. Under stress conditions, M. tuberculosis shifts to
alternative carbon sources for it s persistence. Many microbes use 4-
hydroxyphenylacetate as a sole carbon source. 4-HPA is a common
catabolic product of L-tyrosine, aromatic biogenic amine and
(
0
(
396 CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv
JOURNAL OF CELLULAR BIOCHEMISTRY

Fig. 4. Time dependent kinetics of LipN and Active site residue determination. A: The time dependent reaction progress curve of hydrolysis of pNP-butyrate (200 mM) by the
LipN. B: The time dependent reaction progress curve of hydrolysis of pNP-butyrate (200 mM) by the Lipase from Aspergillus niger (Lid domain containing true lipase) enzyme.
Latency period for Lipase was calculated from the intercept between asymptote of the progress curve and X axis which is 1.2 min. C: Relative enzyme activity of various mutants
(
Ser216Ala, Asp316Ala, Asp320Ala, His346Ala, Trp145Ala) in comparison to native LipN protein. (Each experiment was conducted independently three times in triplicate. Error
bars indicate the standard deviation).
phenolic compounds like 4-hydoxyacetophenone and bisphenol
degradation [Diaz et al., 2001].
(a repressor of phenolic acid stress response) from HTH-XRE (helix
turn helix-xenobiotic response element) super family which
regulates the xenobiotic response. Also LipN was predicted to
have strong functional association with 7 Cytochrome p450
́
As per our hypothesis, through LC-MS TOF analysis, we could
identify the hydrolysis of 4-HPA to hydroquinone in the presence
of LipN which might be acting as an arylesterase (EC 3.1.1.2).
Though almost same retention time of 4-HPA and hydroquinone
was observed in LC for reason unknown, hydroquinone formation
was clearly evident in MS TOF analysis. Promoter analysis of LipN
gene revealed Rv0047c binding site located 267 bp upstream of its
start codon (http://genome.tbdb.org/cgi-bin/get_binding.cgi).
Rv0047c has conserved domain of PadR transcription regulator,
0
proteins suggesting it s role in xenobiotic degradation (STRING
9.1, Fig. S4). The enzymes metabolizing xenobiotics are pharma-
ceutically important as these might be responsible for the
breakdown of medications also.
Carboxylic ester hydrolases (EC 3.1.1._) are a diverse group of
enzymes that hydrolyze carboxylic esters. Since LipN hydrolyzed
tributyrin it can be designated as a carboxylesterases (EC 3.1.1.1) too.
TABLE II. Effect of Additives and Effectors on Enzyme Activity
Modifier/additives/effecters
Concentration
Relative enzyme activity (in %)
Control (no treatment)
Tetrahydrolipstatin (THL)
RHC -80267
—
100
Not detectable
Not detectable
Not detectable
100 ꢄ 6
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
5 mM
10 mM
10 mM
N- Bromosuccinimide
Iodoacetic acid
Acetyl imidazole
100 ꢄ 4
1
-ethyl-3-(3- dimethylaminopropyl) carbodiimide (EDAC)
100 ꢄ 6
Phenylglyoxal monohydrate
100 ꢄ 2
Citraconic anhydride
PMSF
DEPC
100 ꢄ 2
10 ꢄ 6
18 ꢄ 2
JOURNAL OF CELLULAR BIOCHEMISTRY
CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv 397

Fig. 5. Esterification studies with LipN. A: Comparison of thermostability between aqueous (32 U/ml) and 20 mg of immobilized LipN (2U/ mg of beads) enzyme at 60°C. B:
Comparison of ester production between butyric acid and oleic acid with methanol directed by 200 mg of immobilized LipN (420 U) at different time intervals. (Each experiment
was conducted independently three times in triplicate. Error bars indicate the standard deviation).
The enzyme did not show any positional specificity as it converted
tributyrin into both mono and dibutyrin that is correlated with
observation of inhibition of Lip N enzyme activity by both THL (a
triacylglycerol lipase inhibitor) and RHC-80267 (a Diacylglycerol
lipase inhibitor). Progress reaction curve (time dependent kinetic)
study implies that LipN follow nonlipolytic carboxyl esterase like
kinetic behavior while hydrolyzing small subtrates like pNP-
oxidative, acidic, nutritive, nitrosative, hypoxic) have been
reported to regulate the expression of several mycobacterial
proteins with their subsequent involvement in the induction of
nonreplicating persistence of M. tuberculosis during phagosome
maturation arrest [Manganelliet al., 2004]. The up regulation of
rv2970c gene expression under acidic condition intrigued us to
seek a parallelism of rv2970c expression from the lipF, a well
studied acid inducible Lip family member, which is not expressed
under aerobic growth condition but showed acid induced response
[Saviola et al., 2003; Richter et al., 2007]. We could locate in the
upstream region of rv2970c, the -10 motif for SigA binding [sigma
factor of LipF (TGTGAT)], with 2 base pair difference (TaTGcT) and
a 68 bp putative promoter region [Rangannan and Bansal, 2011].
Regulatory networks (Chip-seq TbDtb) showed the presence of
putative binding site of transcriptional regulator, Rv3736 of AraC/
XylS-family, in the rv2970c gene. This family of genes is
associated with multidrug resistance, acidic stress and organic
solvent tolerance. Further, BLASTP analysis revealed that Rv3736
has significant homology with YdeO, GadW regulators of AraC/
XylS family of E. coli. YdeO activated genes enable the E. coli to
colonize animal intestines by contributing to adaptation to acidic
conditions in the stomach [Yamanaka et al., 2014]. Moreover, the
0
butyrate and it doesn t show latency phase demonstrated by lid
containing lipases.
The conserved Ser216, Asp316 and His346 were confirmed as
catalytic residues by site directed mutagenesis. Treatment of
enzyme with NBS, a Trp modifier, resulted in complete loss of
enzymatic activity. Structure analysis revealed that out of six Trp
residues present in protein, Trp145 is less than 10 A° away from
enzymatic catalytic cleft geometrically and is located in loop
region, and could effectively influence substrate binding. In
addition, it may serve as a contributor to both H-bond and
aromatic–aromatic interaction in maintaining the cross-link
within the interweaving framework of protein (Fig. S2). On
substituting Trp145 to Ala, the mutant protein lost enzymatic
activity completely which confirmed the involvement of Trp145, a
non active site residue, to retain enzymatic activity. Similar role of
non active site tryptophan present near catalytic triad helping in
substrate binding to retain thioesterase-I enzyme activity was
reported in E. coli [Lee et al., 2009]. This is the first report
demonstrating the requirement of Trp residue for catalytic activity
in enzyme belonging to HSL family in mycobacterium.
The cytosolic localization of LipN intrigued us to explore if LipN
is able to carry out the esterfication reaction. The production of
methyl butyrate esters of butyric acid and methanol by the
immobilized LipN enzyme suggested the possible involvement of
LipN in esterification processes in cell using short carbon chain
fatty acids.
Expression of rv2970c gene was not observed during in-vitro
growth conditions, but the gene was expressed in M. tuberculosis
H37Ra infected macrophages. A multitude of stresses (i.e.
0
0
hexa-nucleotide repeat 5 -ATTTCA-3 (the YdeO box), a YdeO
binding site, is conserved in LipN gene sequence in the vicinity of
binding site of Rv3736. YdeO-regulated targets encode a hydro-
genase and a quinone oxidase and stimulates acidic stress
response. Therefore it puts forward a possibility that the expression
of rv2970c might be induced under acidic conditions by YdeO
regulon as acidic stress and quinone pool were reported to have
direct correlations [Yamanaka et al., 2014]. GadW is also involved
in regulation of the genes for glutamate-dependent acid resistance
0
system. It s expression is induced by YdeO [Yamanaka et al., 2014].
So the presence of binding sites of these acid stress responsive
regulators could be instrumental in acid stress induction of LipN as
well. Further detail studies are needed to confirm these
bioinformatic analysis.
398 CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv
JOURNAL OF CELLULAR BIOCHEMISTRY

Fig. 6. LC analysis of 4-hydroxyphenylacetate hydrolase activity of LipN. A: Chemical reaction showing 4-hydroxyphenylacetate hydrolase activity of LipN. LC analysis of 4-
hydroxyphenylacetate hydrolase activity of LipN at 280 nm and 219 nm. B: Analytical standard peak of 4-HPA with retention time 2.10 min, (C) Analytical standard LC analysis
shows peak of hydroquinone showing retention time of 2.08 min and elbow formation of parabenzoquinone with retention time 3.43. D: 4-HPA reaction mix LC analysis after 2 h
treatment with immobilized LipN (40U/20mg beads). Peaks for 4-HPA at 2.10 and product formed hydroquinone showing retention time of 2.08 min and elbow formation of
parabenzoquinone with retention time 3.43 were observed. (Experiment was conducted independently three times).
In E. coli, it is reported that presence of phenolic acids confers acid
stress. Activated universal stress response protein -1 (USP-1)
dependent inactivation of padR, regulates padA to degrade phenolic
acids in response to acid stress in E. coli [Gury et al., 2009]. Also in E.
coli, 4-HPA degradation in particular is regulated by HpaA (p-
hydroxyphenylacetic acid) regulator belonging to Arac/Xyls family
which is induced under stress response in order to control carbon
metabolism [Gallegos et al., 1997]. Similar kind of regulation might
be operational in case of acid stress dependent induction of LipN (a
rifampicin (RIF) and isoniazid (INH) drug resistant Mycobacterium
tuberculosis clinical isolates from MDR patient and has suggested
the possible use of LipN as a drug resistance marker [Singh et al.,
2015] which is in corroboration to our observation of acid
inducible expression of LipN and it s role in xenobiotic
degradation.
In conclusion we demonstrated that LipN is an acid inducible
protein localized in cytosolic fraction. It converted 4-hydroxyphe-
nylacetate to hydroquinone. It is a non specific carboxyl ester
hydrolase belonging to family IV carboxylesterases. In addition to
Ser, Asp and His catalytic residues, it requires a Trp for enzyme
activity. The 4-hydroxyphenylacetate hydrolase activity of Rv2970c
might be instrumental in imparting resistance to the phagosomal
acidic stress by regulating the quinone pool.
0
4
-HPA hydrolase). However, further study is required to investigate
the regulation mechanism behind acid stress induced expression of
LipN.
A recent study showed LipN as one of the most prominent and
consistently overexpressed protein in the proteomic analysis of
JOURNAL OF CELLULAR BIOCHEMISTRY
CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv 399

Fig. 7. TOF MS (ES-) analysis of 4-hydroxyphenylacetate hydrolase activity of LipN. A: Fragmentation pattern of Analytical standard 4-HPA with base peak at 151 m/z with ion
intensity 9446 at 30V collision energy. B: Fragmentation pattern of analytical standard hydroquinone base peak was detected at 109 m/z with 2487 ion intensity at 30 V collision
energy. C: 4-HPA reaction mix fragmentation pattern after 2 h treatment with immobilized LipN at 30 V collision energy.
ACKNOWLEDGMENTS
Canaan S, Maurin D, Chahinian H, Pouilly B, Durousseau C, Frassinetti F,
Scappuccini-Calvo L, Cambillau C, Bourne Y. 2004. Expression and
characterization of the protein Rv1399c from Mycobacterium tuberculosis.
A novel carboxyl esterase structurally related to the HSL family. Eur J
Biochem 271:3953–3961.
We thank CSIR New Delhi, India for financial assistance.LCMS was
carriedoutatSophisticatedAnalyticalInstrumentationFacility(SAIF),
CILandUCIMatPanjabUniversity.MycobacteriumtuberculosisH37Rv
genomic DNA was kind gift from Dr. U.D. Gupta, National jalma
institute of leprosy and other Mycobacterial diseases, Agra.
Cole ST, Brosch R, Parkhil J, Garnier LT, Churcher C, Harris D, Gordon SV,
Eiglmeier K, Gas S, Barry CE 3rd, Tekaia F, Badcock K, Basham D, Brown D,
Chillingworth T, Connor R, Davies R, Devlin K, Feltwell T, Gentles
S, Hamlin N, Holroyd S, Hornsby T, Jagels K, Krogh A, McLean J,
Moule S, Murphy L, Oliver K, Osborne J, Quail MA, Rajandream MA, Rogers
J, Rutter S, Seeger K, Skelton J, Squares R, Squares S, Sulston JE, Taylor K,
Whitehead S, Barrell BG. 1998. Deciphering the biology of Mycobacterium
tuberculosis from the complete genome sequence. Nature 393:537–544.
REFERENCES
Arpigny KL, Jaeger KE. 1999. Bacterial lipolytic enzymes: Classification and
properties. J Biochem 343:177–183.
Bloom BR, Murray CJL. 1992. Tuberculosis: Commentary on a reemergent
killer. Science 257:1055–1064.
Deb C, Daniel J, Sirakova TD, Abomoelak B, Dubey VS, Pappachan E,
Kolattukudy PE. 2006. A novel lipase belonging to the hormone-sensitive
lipase family induced under starvation to utilize stored triacylglycerol in
Mycobacterium tuberculosis. J Biol Chem 281:3866–3875.
Bovara R, Carrea G, Ottolina G, Riva S. 1993. Effects of water activity on
Vmax and Km of lipase catalyzed transesterification in organic media.
Biotechnol Lett 15:937–942.
Dedieu L, Serveau-Avesque C, Kremer L, Canaan S. 2013. Mycobacterial
lipolytic enzymes: A gold mine for tuberculosis research. Biochimie 95:66–73.
Camus JC, Pryor MJ, Medigue C, Cole ST. 2002. Re-annotation of the genome
sequence of Mycobacterium tuberculosis H37Rv. Microbiol-Sgm 148:
Delorme V, Diomand ꢀe SV, Dedieu L, Cavalier JF, Carri ꢁe re F, Kremer L,
Leclaire J, Fotiadu F, Canaan S. 2012. MmPPOX inhibits Mycobacterium
2967–2973.
400 CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv
JOURNAL OF CELLULAR BIOCHEMISTRY

tuberculosis lipolytic enzymes belonging to the hormone-Sensitive Lipase
family and alters mycobacterial growth. PLoS ONE 7:e46493.
Rezwana M, Lan ꢀe elle MA, Sander P, Daff ꢀe M. 2007. Breaking down the wall:
Fractionation of mycobacteria. J Microbiol Methods 68:32–39.
́
́
Diaz E, Ferrandez A, Prieto MA, Garcia JL. 2001. Biodegradation of aromatic
́
Richter L, Tai W, Felton J, Saviola B. 2007. Determination of the minimal
acid-inducible promoter region of the lip F gene from Mycobacterium
tuberculosis. Gene 395:22-28.
compounds by Escherichia coli. Microbiol Mol Biol Rev 65:523–569.
Dosanjh NS, Kaur J. 2002. Immobilization, stability and esterification studies
of a lipase from a Bacillus sp. Biotechnol Appl Biochem 36:7–12.
Richter L, Saviola B. 2009. The lipF promoter of Mycobacterium tuberculosis
upregulated specifically by acidic pH but not by other stress conditions.
Microbiol Res 164:228–232.
Gallegos MT, Schleif R, Bairoch A, Hofmann K, Ramos JL. 1997. AraC/XylS
family of transcriptional regulators. Microbiol Mol Biol Rev 61:393–410.
Gao Q, Kripke K, Arinc Z, Voskuil M, Small P. 2004. Comparative expression
studies of a complex phenotype: cord formation in Mycobacterium tuber-
culosis. Tuberculosis (Edinb) 84:188–196.
Saviola B, Woolwine S, Bishai WR. 2003. Isolation of acid-inducible genes of
Mycobacterium tuberculosis with the use of recombinase-based in vivo
expression technology. Infect Immun 71:1379–1388.
Geiman DE, Raghunand TR, Agarwal N, Bishai WR. 2006. Differential gene
expression in response to exposure to antimycobacterial agents and other
stress conditions among seven Mycobacterium tuberculosis whiB-like genes.
Antimicrob Agents Chemother 50:2836–2841.
Shen G, Singh K, Chandra D, Serveau-Avesque C, Maurin D, Canaan S,
Singla R, Behera D, Laala S. 2011. LipC (Rv0220) is an immunogenic cell
surface esterase of Mycobacterium tuberculosis. Infect Immun 80:243–253.
Singh A, Gopinath K, Sharma P, Bisht D, Sharma P, Singh N, Singh S. 2015.
Comparative proteomic analysis of sequential isolates of Mycobacterium
tuberculosis from a patient with pulmonary tuberculosis turning from drug
sensitive to multidrug resistant. Indian J Med Res. 141:27–45.
Gonzalo Asensio J, Maia C, Ferrer NL, Barilone N, Laval F, Soto CY,
Winter N, Daffe M, Gicquel B, Martin C, Jackson M. 2006. The virulence-
associated two-component PhoP-PhoR system controls the biosynthesis of
polyketide-derived lipids in Mycobacterium tuberculosis. J Biol Chem
Springer B, Master S, Sander P, Zahrt T, Mcfalone M, Song J,
Papavinasasundaram KG, Colston MJ, Boettger E, Deretic V. 2001. Silencing
of oxidative stress response in Mycobacterium tuberculosis: expression
patterns of ahpC in virulent and avirulent strains and effect of ahpC
inactivation. Infect Immun 69:5967–5597.
2
81:1313–1316.
Gury J, Seraut H, Tran NP, Barthelmebs L, Weidmann S, Gervais P, Cavin JF.
009. Inactivation of PadR, the repressor of the phenolic acid stress response,
2
by molecular interaction with Usp1, a universal stress protein from
Lactobacillus plantarum, in Escherichia coli. Appl Environ Microbiol
Sutherland CA, Amin D. 1982. Relative activities of rat and dog platelet
phospholipase A2 and diglyceride lipase. Selective inhibition of diglyceride
lipase by RHC 80267. J Biol Chem 257:14006–14010.
75:5273–5283.
Kamerbeek NM, Janssen DB, Van Berkel WJH, Fraaije MW. 2003a. Baeyer-
Villiger monooxygenases, an emerging family of flavin-dependent bio-
catalysts. Adv Synth Catal 345:667–678.
Tanigawa K, Suzuki K, Nakamura K, Akama T, Kawashima A, Wu H,
Hayashi M, Takahashi S, Ikuyama S, Ito T, Ishii N. 2008. Expression of adipose
differentiation-related protein (ADRP) and perilipin in macrophages infected
with Mycobacterium leprae. FEMS Microbiol Lett 289:72–79.
Kamerbeek NM, Moonen MJH, Van der Ven JGM, Van Berkel WJH,
Fraaije MW, Janssen DB. 2001. 4-Hydroxyacetophenone monooxygenase
from Pseudomonas fluorescens ACB. Eur J Biochem 268:2547–2557.
Valente E, Sim o~ es MF, Testa B, Constantino L. 2011. Development of a
method to investigate the hydrolysis of xenobiotic esters by a Mycobacterium
smegmatis homogenate. J Microbiol Methods 85:98–102.
Kamerbeek NM, Olsthoorn JJ, Fraaije MW, Janssen DB. 2003b. Substrate
specificity and enantioselectivity of 4-hydroxyacetophenone monooxyge-
nase. Appl Environ Microbiol 69:419–426.
Yamanaka Y, Oshima T, Ishihama A, Yamamoto K. 2014. Characterization of
Lee LC, Chou YL, Chen HH, Lee YL, Shaw JF. 2009. Functional role of a non-
active site residue Trp (23) on the enzyme activity of Escherichia coli
thioesterase I/protease I/lysophospholipase L1. Biochim Biophys Acta
the Y deO regulon in Escherichia coli. PLoS ONE 9:e111962.
Yang PY, Liu KP, Ngai MH, Lear MJ, Wenk MR, Yao SQ. 2010. Activity-based
proteome profiling of potential cellular targets of Orlistat an FDA—approved
drug with anti-tumor activities. J Am Chem Soc 132:656–659.
1794:1467–1473.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data
Zhang M, Wang JD, Li ZF, Xie J, Yang YP, Zhong Y, Wang HH. 2005.
Expression and characterization of the carboxyl esterase Rv3487c from
Mycobacterium tuberculosis. Protein Expr Purif 42:59–66.
-
DDC
using real time quantitative PCR and the 2
5:402–408.
Manganelli R, Proveddi R, Rodrigue S, Beaucher J, Gaudreau L, Smith I, .
004. Sigma factors and global gene regulation in Mycobacterium tuber-
T method. Methods
2
Zheng H, Lu L, Wang B, Pu S, Zhang X, Zhu G, Shi W, Zhang L, Wang H,
Wang S, Zhao G, Zhang Y. 2008. Genetic basis of virulence attenuation
revealed by comparative genomic analysis of Mycobacterium tuberculosis
strain H37Ra versus H37Rv. PLoS ONE 3:e2375.
2
culosis. J Bacteriol 186:895–902.
Mishra KC, Chastellier CD, Narayana Y, Bifani P, Brown AK, Besra GS,
Katoch VM, Joshi B, Balaji KN, Kremer L. 2008. Functional role of the PE
domain and immunogenicity of the Mycobacterium tuberculosis triacylgly-
cerol hydrolase LipY. Infect Immun 76:127–140.
SUPPORTING INFORMATION
Rangannan V, Bansal M. 2011. PromBase: A web resource for various
genomic features and predicted promoters in prokaryotic genomes. BMC Res
Notes 4:257.
Additional supporting information may be found in the online
version of this article at the publisher s web-site.
0
JOURNAL OF CELLULAR BIOCHEMISTRY
CHARACTERIZATION OF LipN (Rv2970c) OF H37Rv 401