?8(14)-Ergostenol Glycoside Derivatives Inhibit the Expression of Inflammatory Mediators and Matrix Metalloproteinase

Article abstract of DOI:10.3390/molecules26154547

Arthritis is a chronic inflammatory disease accompanied by pathological reactions such as swelling, redness, fever, and pain in various joint areas. The drugs currently available to treat arthritis are associated with diverse side-effects. Therefore, ther

Full text of DOI:10.3390/molecules26154547

molecules
Communication
∆
8(14)-Ergostenol Glycoside Derivatives Inhibit the Expression
of Inflammatory Mediators and Matrix Metalloproteinase
Hyejin Moon 1,†, Myoungsil Ko 1,†, Yujin Park 2,†, Jeonguk Kim 1, Dowon Yoon 1, Eunjoohwang Lee 2,
Taehoon Lee 1,* and Hakwon Kim 1,
*
1
Global Center for Pharmaceutical Ingredient Materials, Department of Applied Chemistry,
Kyung Hee University, Yongin 17104, Korea; hjm6719@naver.com (H.M.); kakddugy@gmail.com (M.K.);
jungwoogi93@naver.com (J.K.); alslznls3152@naver.com (D.Y.)
Graduate School of East-West Medicinal Science, Kyung Hee University, Yongin 17104, Korea;
pyj2386@hanmail.net (Y.P.); ehwang@khu.ac.kr (E.L.)
2
*
Correspondence: thlee@khu.ac.kr (T.L.); hwkim@khu.ac.kr (H.K.);
Tel.: +823-1201-5317 (T.L.); +823-1201-2459 (H.K.)
†
These authors equally contribute to this work.
Abstract: Arthritis is a chronic inflammatory disease accompanied by pathological reactions such
as swelling, redness, fever, and pain in various joint areas. The drugs currently available to treat
arthritis are associated with diverse side-effects. Therefore, there is a need for safer and more effective
treatments to alleviate the inflammation of arthritis with fewer side-effects. In this study, a new sterol,
∆
8(14)-ergostenol, was discovered, and its glycosides were synthesized and found to be more efficient
in terms of synthesis or anti-inflammatory activity than either spinasterol or 5,6-dihydroergosterol is.
Among these synthetic glycosides, galactosyl ergostenol inhibited the expression of inflammatory
mediators in TNF-α-stimulated FLS and TNF-α-induced MMPs and collagen type II A1 degradation
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
in human chondrocytes. These results suggest the new galactosyl ergostenol as a treatment candidate
for arthritis.
Citation: Moon, H.; Ko, M.; Park, Y.;
Kim, J.; Yoon, D.; Lee, E.; Lee, T.;
Kim, H. ∆8(14)-Ergostenol Glycoside
Derivatives Inhibit the Expression of
Inflammatory Mediators and Matrix
Metalloproteinase. Molecules 2021, 26,
4547. https://doi.org/10.3390/
molecules26154547
Keywords: ergostenol; ergostenol glycosides; arthritis; matrix metalloproteinase; collagen type II A1
1. Introduction
Arthritis is a chronic inflammatory disease accompanied by pathological reactions
Academic Editor: Michael John Plater
such as swelling, redness, fever, and pain in various joint areas [
1–
4]. Joints are areas where
two or more bones meet, and most of them are responsible for helping the body move [
In terms of anatomy, the structure of a joint is composed of cartilage, which protects the
end of the bone, and a synovial membrane that secretes a clear sticky fluid around the
2
].
Received: 1 July 2021
Accepted: 23 July 2021
Published: 28 July 2021
joint [3]. Joint tissue inflammation is classified as either degenerative osteoarthritis (OA) or
rheumatoid arthritis (RA) according to the loss of cartilage and autoimmune dysfunction
of the synovial membrane [4].
The major cause of OA is age-related damage to chondrocytes. The primary patho-
logical mechanism of OA is the reduced formation of the extracellular matrix of articular
cartilage cells and the alteration of the extracellular matrix components of cartilage due to
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
cellular aging [5]. Normal chondrocytes play an important role in cartilage homeostasis.
Abnormal chondrocytes exposed to inflammatory cytokines and chemokines cause the
excessive secretion of several types of matrix-degrading enzymes such as matrix metal-
loproteinases (MMPs). These MMPs break down collagen type II A1 (COL2A1), a major
collagen component of the cartilage matrix. In particular, MMP-1, MMP-3, and MMP-13
Copyright:
© 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
play a major role in arthritis [6–8]. Rheumatoid arthritis is a chronic inflammatory condi-
tion that arises in the synovial membrane surrounding the joints. The major pathogenic
mechanism of RA is the excessive secretion of inflammatory cytokines and chemokines
due to immune abnormalities, leading to the gradual destruction of cartilage tissue with an
increased production of matrix degradation enzymes such as MMPs [9].
Molecules 2021, 26, 4547. https://doi.org/10.3390/molecules26154547
https://www.mdpi.com/journal/molecules

Molecules 2021, 26, 4547
2 of 12
The major constituents of the cartilage matrix are COL2A1 and proteoglycans. Degen-
erative osteoarthritis and rheumatoid arthritis are caused by the degradation of COL2A1,
which is primarily mediated by MMP-1, MMP-3, and MMP-13. These MMPs are secreted
mainly by human chondrocytes (HCs) and human fibroblast-like synoviocytes (FLSs) [4].
The over-expression of MMPs such as MMP-1, MMP-3, and MMP-13 leads to a vicious cycle
of the activation of inflammatory cytokines and chemokines [10]. Regulating these inflam-
matory mediators can alleviate symptoms of arthritis. Currently, various drugs, including
steroidal, nonsteroidal, and biological materials with analgesic or anti-inflammatory prop-
erties, are used to treat arthritis [11]. These drugs generally have a short duration of
effect and low efficacy, and they can cause many side effects when used long term [12,13].
Thus, there is a need for safer and more effective arthritis treatments to alleviate joint
inflammation and inhibit COL2A1 degradation through inhibition of MMPs.
Previously, we reported the potent anti-inflammatory activity of 5,6-dihydroergosterol
glucose (DHE-Glu, 2a), a synthetic compound derived from a natural product, spinas-
terol glucose (Spin-Glu, 1a) [14]. In HaCaT cells, DHE-Glu (2a) produced strong anti-
inflammatory activity through the inhibition of TNF-α/IFN-γ-induced expressions of
CCL17 and CCL22, and also inhibited DNCB-induced contact dermatitis in an animal
model of chronic inflammation [15]. As a follow-up to this study, we tried to find a
new synthetic sterol that could be synthesized more efficiently and/or had a greater
bioactivity than spinasterol (Spin,
1) or 5,6-dihydroergosterol (DHE, 2) did. As a result,
∆
8(14)-ergostenol (Ergn,
3), a sterol having a double bond at carbon position 8(14) of the
steroid skeleton, was identified as a candidate compound. This sterol can be synthesized
from ergosterol by selective hydrogenation followed by double bond migration [16]. We
synthesized ergostenol glycosides containing a sugar, such as glucose, galactose, or xylose,
by Schmidt glycosylation of Ergn (
3
) with a glycosyl imidate. Spin (
), and ergostenol glycosides including Ergn-Glu (3a), Ergn-Gal
3b), and Ergn-Xyl (3c) are shown in Figure 1. In this study, newly synthesized ergostenol
1), Spin-Glu (1a), DHE
(
(
2), DHE-Glu (2a), Ergn (3
glycosides were tested for anti-inflammatory properties in FLSs and the suppression of
MMPs expression in HCs. These results may suggest the possibility of being developed as
a treatment for arthritis.
Figure 1. Structures of spinasterol (Spin,
1), Spin-Glu (1a), 5,6-dihydroergosterol (DHE, 2), DHE-
Glu (2a), ), and ergostenol glycoside (Ergn-Glu, 3a; Ergn-Gal, 3b; and
∆
8(14)-ergostenol (Ergn,
3
Ergn-Xyl, 3c).
2. Materials and Methods
2.1. Chemicals and Instruments
The 1H NMR and 13C NMR spectra were recorded on a Jeol 300 MHz spectrometer
and Jeol 75 MHz spectrometer, respectively. Chemical shifts ( ) were reported in parts-
δ
per-million (ppm), and coupling constants (J) were reported in Hertz (Hz). The following
abbreviations were used to describe multiplicities: s = singlet, d = doublet, t = triplet,

Molecules 2021, 26, 4547
3 of 12
q = quartet, m = multiplet, and br s = broad singlet. Melting points (m.p.) were determined
on a Barnstead Electrothermal 9100 instrument. The IR spectra were recorded on a Jasco
FT/IR-4700 type instrument, while HR-FAB+-MS was recorded on a Jeol JMS-700 instru-
ment. All chemicals were purchased from Sigma-Aldrich, Alfa Aesar, Acros Organics, and
Tokyo Chemical Industry and used without further purification. Reaction progress was
monitored by thin-layer chromatography (TLC, Merck kieselgel 60 F254), and column chro-
matography was performed using Merck silica gel 60 (particle size 0.040–0.063 mm). Extra
pure-grade solvents for column chromatography were purchased through Samchun Chem-
icals and Duksan Chemicals. The 2,3,4,6-tetra-O-benzoyl-glucopyranosyl trichloroacetimi-
date (glucosyl imidate, 4a), 2,3,4,6-tetra-O-benzoyl-galactopyranosyl trichloroacetimidate
(galactosyl imidate, 4b), and 2,3,4-tri-O-benzoyl-xylopyranosyl trichloroacetimidate (xylo-
syl imidate, 4c) were prepared as described previously [17].
2.2. Synthesis of 5α-Ergost-8(14)-en-3β-ol (Ergn, 3)
Ergosterol (5 g, 12.61 mmol) in a mixture of methylene chloride (126 mL) and methanol
(118 mL) was hydrogenated under H2 for 3 h in the presence of Pd/C (10% wt) catalyst
(0.50 g, 0.4666 mmol). The mixture was filtered through celite, concentrated in vacuo, and
purified by flash column chromatography (ethyl acetate/hexane) to produce Ergn
white solid.
3 as a
Yield: 93 % m.p.: 131.2–132.4 C (Lit.ref m.p. 130–131 C). H NMR (300 MHz,
◦
◦
1
chloroform-d)
3 H), 0.93 (d, J = 6.4 Hz, 3 H), 3.63 (br s, 1 H). 13C NMR (75 MHz, chloroform-d)
12.9, 15.5, 17.7, 18.2, 19.3, 20.0, 20.6, 25.9, 27.1, 28.9, 29.7, 30.4, 31.6, 31.7, 33.6, 34.9, 36.6, 36.9,
37.3, 38.4, 39.2, 42.8, 44.4, 49.4, 56.8, 71.4, 126.5, 142.9. IR: OH peak at 3662 cm−1
δ
(ppm): 0.69 (s, 3 H), 0.78 (d, J = 6.6 Hz, 6 H), 0.84 (s, 3H), 0.86 (d, J = 6.7 Hz,
δ
(ppm):
.
2.3. Synthesis of Ergostenol Glycosides (3a, 3b, and 3c) through Glycosylation and Hydrolysis
2.3.1. Synthesis of 5α-Ergost-8(14)-en-3β-yl-β-D-Glucopyranoside (Ergn-Glu 3a)
2,3,4,6-Tetrabenzoyl-
0.3993 mmol), Ergn ( ; 0.080 g, 0.1997 mmol), and a 4Å molecular sieve in anhydrous
methylene chloride (3.99 mL) were stirred at 0 ◦C. After addition of trimethylsilyl trifluo-
romethanesulfonate (TMSOTf, 3.6
L, 0.01997 mmol) at 0 ◦C, the mixture was stirred at
β-glucopyranosyl ergostenol (5a): Glucosyl imidate (4a; 0.30 g,
3
µ
room temperature for 1 h under an argon atmosphere. After neutralization by Et3N, the
mixture was filtered to remove the molecular sieve, concentrated in vacuo, and purified
by flash column chromatography (ethyl acetate/hexane) to produce a benzoyl-protected
◦
1
Ergn-Glu (5a) as a white solid. Yield: 80% m.p.: 185.6–187.3 C. H NMR (300 MHz,
chloroform-d) (ppm): 0.56 (s, 3 H), 0.76–0.82 (m, 9 H), 0.85 (d, J = 6.8 Hz, 3 H), 0.93 (d,
δ
J = 6.2 Hz, 3 H), 3.56–3.68 (m, 1 H), 4.13–4.20 (m, 1 H), 4.51 (dd, J = 11.9, 5.9 Hz, 1 H), 4.60
(dd, J = 12.1, 3.5 Hz, 1 H), 4.94 (d, J = 8.1 Hz, 1 H), 5.49 (dd, J = 9.7, 7.9 Hz, 1 H), 5.61 (t,
J = 9.7 Hz, 1 H), 5.89 (t, J = 9.5 Hz, 1 H), 7.27–7.59 (m, 12 H), 7.82–7.84 (m, 2H), 7.89–7.92 (m,
2H), 7.94–7.97 (m, 2H), 8.00–8.03 (m, 2H).
Ergn-Glu (3a): Benzoyl-protected Ergn-Glu (5a; 3.31 g, 3.380 mmol) in a mixed solvent
(CH2Cl2:MeOH = 67.6 mL:67.6 mL) was added to NaOMe (4.37 M in MeOH, 5.41 mL,
23.66 mmol). The mixture was stirred at room temperature for 5 h. After neutralization by
Dowex Mac-3, it was filtered and concentrated in vacuo. The white residue was purified by
flash column chromatography (CH2Cl2/MeOH) to recover Ergn-Glu (3a) as a white solid.
Yield: 87% m.p.: 231.2–234.2 ◦C. 1H NMR (300 MHz, pyridine-d5)
δ (ppm): 0.63 (s, 3 H),
0.82 (d, J = 3.9 Hz, 3 H), 0.84 (d, J = 3.9 Hz, 3 H), 0.87–0.91 (m, 6 H), 1.00 (d, J = 6.6 Hz, 3 H),
3.95–4.06 (m, 1 H), 4.06–4.14 (m, 2 H), 4.26–4.41 (m, 2 H), 4.47 (dd, J = 11.8, 5.4 Hz, 1 H), 4.67
(dd, J = 11.7, 2.0 Hz, 1 H), 5.11 (d, J = 7.7 Hz, 1 H). 13C NMR (75 MHz, pyridine-d5)
δ (ppm):
12.9, 15.7, 17.8, 18.6, 19.6, 20.3, 20.7, 26.2, 27.4, 29.3, 30.0, 30.2, 30.8, 31.8, 33.9, 34.9, 35.2, 36.8,
37.2, 37.7, 39.5, 43.1, 44.2, 49.7, 57.1, 63.1, 72.0, 75.6, 77.1, 78.8, 78.8, 102.3, 127.1, 142.9 IR: OH
peak at 3673 cm−1. HR-FAB+-MS m/z: 563.4316(M + 1) (Calcd for C34H59O6: 563.4312).

Molecules 2021, 26, 4547
4 of 12
2.3.2. Synthesis of 5α-Ergost-8(14)-en-3β-yl-β-D-Galactopyranoside (Ergn-Gal, 3b)
2,3,4,6-Tetrabenzoyl- -galactopyranosyl ergostenol (5b): Following the procedure
described above for the preparation of 5a, a benzoyl-protected Ergn-Gal (5b) was obtained
β
◦
1
as a white solid from galactosyl imidate (4a). Yield: 77% m.p.: 93.7–95.4 C. H NMR
(300 MHz, Chloroform-d) (ppm): 0.58 (s, 3 H), 0.77 (s, 3 H), 0.80 (d, J = 6.4 Hz, 6 H), 0.85 (d,
δ
J = 6.8 Hz, 3 H), 0.93 (d, J = 6.4 Hz, 3 H), 3.55–3.73 (m, 1 H), 4.27–4.36 (m, 1 H), 4.43 (dd,
J = 11.1, 6.5 Hz, 1 H), 4.68 (dd, J = 11.2, 7.0 Hz, 1 H), 4.91 (d, J = 7.9 Hz, 1 H), 5.59 (dd,
J = 10.4, 3.4 Hz, 1 H), 5.77 (dd, J = 10.3, 7.9 Hz, 1 H), 5.97–5.98 (m, 1 H), 7.34–7.53 (m, 10 H),
7.53–7.66 (m, 2 H), 7.74–7.82 (m, 2 H), 7.91–7.99 (m, 2 H), 7.99–8.06 (m, 2 H), 8.07–8.15 (m,
2 H).
Ergn-Gal (3b): Following the deprotection procedure described above for the prepa-
ration of 3a, Ergn-Gal (3b) was obtained as a white solid from 4b. Yield: 85%. m.p.:
241.8–245.2 ◦C. 1H NMR (300 MHz, pyridine-d5)
δ (ppm): 0.62 (s, 3 H), 0.82 (d, J = 3.9 Hz,
3 H), 0.84 (d, J = 3.9 Hz, 3 H), 0.87–0.92 (m, 6 H), 1.00 (d, J = 6.6 Hz, 3 H), 3.95–4.10 (m, 1 H),
4.20 (t, J = 6.2 Hz, 1 H), 4.27 (dd, J = 9.2, 3.3 Hz, 1 H), 4.45–4.59 (m, 3 H), 4.64 (br. s., 1 H),
5.02 (d, J = 7.5 Hz, 1 H). 13C NMR (75 MHz, pyridine-d5)
δ (ppm): 12.9, 15.7, 17.8, 18.6, 19.5,
20.3, 20.7, 26.2, 27.4, 29.3, 30.0, 30.2, 30.8, 31.8, 33.9, 35.0, 35.2, 36.8, 37.2, 37.7, 39.4, 43.1, 44.2,
49.7, 57.1, 62.8, 70.6, 72.9, 75.6, 76.9, 77.3, 102.9, 127.1, 142.8. IR: OH peak at 3673 cm−1
HR-FAB+-MS m/z: 563.4315(M + 1) (Calcd for C34H59O6: 563.4312).
.
2.3.3. Synthesis of 5α-Ergost-8(14)-en-3β-yl-β-D-Xylopyranoside (Ergn-Xyl, 3c)
2,3,4-Tribenzoyl-β-xylopyranosyl ergostenol (5c): Following the procedure described
above for the preparation of 5a, a benzoyl-protected Ergn-Xyl (5c) was obtained from
xylosyl imidate (4c) as a white solid. Yield: 84% m.p.: 157.6–159.9 ◦C. 1H NMR (300 MHz,
chloroform-d) δ (ppm): 0.62 (s, 3 H), 0.78 (d, J = 6.8 Hz, 6 H), 0.82 (s, 3 H), 0.85 (d, J = 7.0 Hz,
3 H), 0.93 (d, J = 6.4 Hz, 3 H), 3.69 (dd, J = 12.0, 7.1 Hz, 2 H), 4.45 (dd, J = 12.0, 4.3 Hz, 1 H),
4.97 (d, J = 5.5 Hz, 1 H), 5.25–5.37 (m, 2 H), 5.76 (t, J = 7.2 Hz, 1 H), 7.32–7.43 (m, 6 H),
7.47–7.58 (m, 3 H), 7.97–8.03 (m, 6 H).
Ergn-Xyl (3c): Following the deprotection procedure described above for the prepara-
tion of 3a, Ergn-Gal (3c) was obtained as a white solid from 4c. Yield: Quantitative m.p.:
204.2–207.2 ◦C. 1H NMR (300 MHz, pyridine-d5)
δ (ppm): 0.64 (s, 3 H), 0.82 (d, J = 3.9 Hz,
3 H), 0.84 (d, J = 3.9 Hz, 3 H), 0.87–0.92 (m, 6 H), 1.00 (d, J = 6.4 Hz, 3 H), 3.83 (t, J = 10.3 Hz,
1 H), 3.89–4.01 (m, 1 H), 4.06 (t, J = 8.0 Hz, 1 H), 4.20–4.36 (m, 2 H), 4.45 (dd, J = 11.0, 4.8 Hz,
1 H), 4.95 (d, J = 7.5 Hz, 1 H). 13C NMR (75 MHz, pyridine-d5)
δ (ppm): 13.0, 15.8, 18.0, 18.7,
19.7, 20.5, 20.9, 26.3, 27.6, 29.5, 30.1, 30.4, 31.0, 32.0, 34.0, 35.2, 35.3, 37.1, 37.4, 37.8, 39−.61,
43.2, 44.5, 49.8, 57.3, 67.5, 71.6, 75.5, 77.6, 78.9, 103.4, 127.2, 143.0. IR: OH peak at 3673 cm
HR-FAB+-MS m/z: 533.4208(M + 1) (Calcd for C33H57O5: 533.4206).
2.4. Biological Evaluation of Materials
Chondrocyte growth media were purchased from Cell Signaling Technology (411–500,
Beverly, MA, USA). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum
(FBS), and antibiotics (penicillin/streptomycin) were purchased from Welgene (Kyungsan,
Korea). Anti-human MMP-1 (SC 58377) and anti-MMP-13 (SC 515284), anti-INOS (SC 650),
anti-COX-2 (SC 1746), anti-IL-1β (SC 7884), and anti-GAPDH (SC 166574) antibodies were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-MMP-3 antibody
was purchased from R&D Systems (Minneapolis, MN, USA). The primers used in PCR
analyses were obtained from Bioneer (Daejeon, Korea).
2.5. Cell Culture
Human chondrocytes (HCs) and fibroblast-like synoviocytes (FLSs) were purchased
from the ATCC. HCs were cultured in chondrocyte growth medium. The FLSs were
cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine
◦
serum, 100 units/mL of penicillin, and 100
µ
g/mL of streptomycin at 37 C in a humidified
95% and 5% (v/v) mixture of air and CO2.

Molecules 2021, 26, 4547
5 of 12
2.6. Cell Viability Assay
Cell viability was measured using an Ez Cytox (Do Gen, Inc., Seoul, Korea) assay.
Cells were seeded into 96-well plates, and the medium was replaced with 100
medium containing ergostenol glycosides. The cells were incubated for 24 h at 37 C in 5%
µ
L of fresh
◦
CO2. Next, 10
µ
L of Ez Cytox reagent was added to each well, and the plate was incubated
◦
at 37 C for 1 h. The absorbance was measured at 570 nm using a spectrophotometer
(Thermo Fisher Scientific, Waltham, MA, USA).
2.7. Reverse Transcription-Polymerase Chain Reaction (PCR)
RNA was harvested using RNA Bee (Friendswood, TX, USA) according to the man-
ufacturer’s instructions. Total RNA (5 µg) was used for cDNA synthesis. The PCR was
performed using a PTC-100 Peltier thermal cycler (MJ Research, Hercules, CA, USA) in
accordance with the general protocol. The cycle profile used for PCR was as follows: initial
denaturation◦step at 95 ◦C for 10 min, followed by 40 cycles at 95 ◦C for 20 s, 60 ◦C for
15 s, and 72 C for 20 s. GAPDH was used as a loading control. PCR products were
electrophoretically separated on 1% agarose gel containing 0.5 µg/mL of ethidium bromide
and were visualized with an ultraviolet light transilluminator. The primer sequences used
are shown in Table 1.
Table 1. Specific primer sequences.
0
0
Gene
Sequence (5 -3 )
Size (bp)
sense
antisense
CTGTTCAGGACAGAATGTG
TTGGACTCACACCATGTGTT
MMP-1
395
sense
antisense
TGCGTGGCAGTTTGCTCAGC
GAATGTGAGTGGAGTCACCT
MMP-3
MMP-13
COL2A1
IL-1β
573
273
380
264
497
292
496
226
sense
antisense
GGCTCCGAGAAATGCAGTCT
ATCAAATGGGTAGAAGTCGC
sense
antisense
AATCCAGCAAACGTTCCCAA
CGGTACTCGATAACAGTCAA
sense
antisense
ATGTACCAGTTGGGGAACTG
GGATATGGAGCAACAAGTGG
sense
antisense
TGACAAACAAATTCGGTACATCC
ATCTGAGGTGCCCATGCTAC
IL-6
sense
antisense
ATGACTTCCAAGCTGGCCGTGGCT
TCTCAGCCCTCTTCAAAAACTTCTC
gIL-8
sense
antisense
GGCCTCTCAGCTCACCCCGA
CCAGGCGCACTGTCTGGTGG
INOS
sense
antisense
AGGTCGGAGTCAACGGATTTGG
ACAGTCTTCTGGGTGGCAGT
GAPDH
2.8. Western Blotting
The cell extracts from each cell were prepared in RIPA buffer (Pierce Biotechnology,
Rockford, IL, USA). Protein concentrations were measured using the Bradford protein
assay, and the proteins were fractionated by electrophoresis in 10% gel and transferred to
a nitrocellulose membrane. To prevent nonspecific binding, the membrane was soaked
in buffer containing 5% dry skim milk for 1 h. Membranes were incubated with anti-
MMP-1, anti-MMP-3, anti-MMP-13, anti-iNOS, anti-COX-2, anti-IL-1β, and anti-GAPDH.
Antibodies were incubated overnight at 4 ◦C. Membranes were washed and incubated
with secondary antibody (goat-anti-mouse and goat-anti-rabbit IgG; 7074P2, 7074P6; Cell
signaling biotechnology, Danvers, MA, USA) for 1 h at room temperature. Membranes
were visualized with standard ECL reagent and measured using a chemiluminescence
detection system (Thermo Fisher Scientific, Waltham, MA, USA).

Molecules 2021, 26, 4547
6 of 12
2.9. Enzyme-Linked Immunosorbent Assay
Human chondrocytes (HCs) and fibroblast-like synoviocytes (FLSs) were pre-incubated
in 6-well cell culture plates and treated with TNF- (10 ng/mL) in the presence or absence
of Ergn-Gal (3b) for 18 h. We collected the cell culture supernatants by centrifugation at
1500 g for 10 min to obtain cell-free supernatants and analyzed them using enzyme-linked
α
×
immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN, USA) according to
the manufacturer’s instructions.
2.10. Statistical Analysis
Unless otherwise stated, all experiments were performed with triplicate samples
and repeated at least three times. Data are presented as means
comparisons between groups were performed using one-way ANOVA followed by a
±
S.D. and statistical
Student’s t-test.
3. Results
3.1. Synthesis of ∆8(14)-Ergostenol Glycosides (Ergn-Gly, 3a, 3b, and 3c)
In our previous work, DHE (2), prepared using the DIBAL-H (diisobutylaluminium hy-
dride) reduction of ergosterol, was used as a substitute for natural spinasterol (Spin,
1) [18].
During the course of this project, we tried to synthesize a sterol without double bonds in
the steroid backbone to see how the double bonds affected the physiological activity of Spin
(
1) and DHE (
2). Therefore, to prepare sterols with reduced double bonds in the steroid
backbone, as has occurred in stigmastanol, Pd-catalyzed hydrogenation of DHE (
2) was
performed. However, while the double bond in the side chain was broken, another double
bond in the steroid backbone moved from position C-7 to position C-8(14). The presence of
double bonds was not confirmed in the 1H NMR spectrum, but the presence and migration
of a double bond were confirmed in the 13C NMR spectrum (
δ
126.5, 142.9). Finally, we
confirmed that the structure of the Pd-catalyzed hydrogenation product of DHE ( ) was
Ergn ( ) from our spectral data and the literature [19]. It was assumed that the mechanism
by which DHE ( ) was converted to Ergn ( ) involved isomerization of the double bond at
position C-7 instead of hydrogenation. Therefore, as DHE ( ) was produced by reducing
2
3
2
3
2
the C-5 double bond of ergosterol by a selective hydrogenation reaction, it was assumed
that if direct Pd-catalyzed hydrogenation of ergosterol was carried out, the hydrogenation
reaction and the subsequent isomerization reaction would occur successively, resulting in
Ergn (
synthesis and bioactivity of sterol and can be efficiently synthesized from commercially
available ergosterol in one step [20]. We decided to use Ergn ( ) as a novel sterol for the
development of new anti-inflammatory drugs. Glycosides were prepared from Ergn (
using the Schmidt glycosylation method, as previously described [21]. The Schmitt glycosy-
lation reaction for Ergn ( ) was carried out using the corresponding glycosyl imidate as the
glycosyl donor in the presence of TMSOTf as Lewis acid catalyst [22]. In this reaction, the
-anomer of sterol glycosides is the major product of neighboring group participation [23].
The TMSOTf-catalyzed glycosylation of Ergn ( ) by glycosyl imidate (glucosyl imidate 4a
galactosyl imidate 4b, and xylosyl imidate 4c) yielded -linked glycosyl ergostenol inter-
mediates (5a 5b, and 5c). The subsequent deprotection yielded Ergn-Glu (3a), Ergn-Gal
(3b), and Ergn-Xly (3c), respectively (Scheme 1).
3). Compared to Spin (1) or DHE (2), Ergn (3) has been shown to support the good
3
3)
3
β
3
,
β
,

Molecules 2021, 26, 4547
7 of 12
R
2 HO
HO
R2
b
X
H
O
a
R1
HO
8(14)-Ergostenol 3
O
O
Δ
R1
O
BzO
+
HO
BzO
H
R2
X
5a
5b
R1=OBz, R2=H, X=CH2OBz,
R1=H, R2=OBz, X=CH2OBz,
R1=OBz,R2=H, X=H, 5c
3a
3b
R1=OH, R2=H, X=CH2OH, Ergn-Glu
R1=H, R2=OH, X=CH2OH, Ergn-Gal
R1=OH,R2=H, X=H, Ergn-Xyl 3c
R1
BzO
O
O
CCl3
NH
BzO
4a
4b
R1=OBz, R2=H, X=CH2OBz, Glucosyl imidate,
R1=H, R2=OBz, X=CH2OBz, Galactosyl imidate,
R1=OBz,R2=H, X=H, Xylosyl imidate, 4c
Scheme 1. Synthesis of ergostenol glycosides: Ergn-Glu (3a), Ergn-Gal (3b), and Ergn-Xly (3c);
reagents and conditions: (
) TMSOTf (0.10 eq), CH2Cl2, 0 ◦C to room temperature for 1 h, and
a
(b) NaOMe (4.37 M in MeOH, 7.0 eq), CH2Cl2, MeOH at room temperature for 5 h.
3.2. Comparison of the Structures of DHE (2) and Ergn (3) and Biological Activities of their
Glycosides
Next, we verified the structural stability of DHE (
2) and Ergn (
3) according to density
functional theory (DFT). The optimized structures of Ergn (
3
) and DHE (
2) obtained with
the Gaussian 09 program [B3LYP, 6-311+G(d, p)] are shown in Figure 2A and found to be
similar to each other [24].
Figure 2.
(
A
) Optimized structures of DHE (2, left) and Ergn (
3, right) by DFT calculation (Gaussian
B3LYP, 6331[d,p]). Grey (carbon), white (hydrogen), and red (oxygen) bonds. (
B
) RT-PCR assay was
performed to compare the effects of Spin-Glu (1a), DHE-Glu (2a), and Ergn-Glu (3a) on CCL17 and
CCL22 mRNA expressions.
Therefore, the two compounds with similar backbone structures were expected to
have similar biological activities. Figure 2B presents the comparisons of the inhibition
of the TNF-
synthetic compounds with different backbones, including Spin-Glu (1a), DHE-Glu (2a),
and Ergn-Glu (3a). As a result, as we have reported, Spin-Glu (1a) and DHE-Glu (2a
inhibited the expressions of CCL17 and CCL22 mRNA in HaCaT cells induced by TNF-
α-induced CCL17 and CCL22 mRNA expression in human keratinocytes by
)
α
.
Furthermore, we confirmed that the newly synthesized Ergn-Glu (3a) produced similar
inhibitions of CCL17 and CCL22 mRNA expressions in TNF-α-induced HaCaT cells.
3.3. Effect of Ergostenol Glycosides on the Viability of Human Chondrocytes (HCs) and Human
Fibroblast-Like Synoviocytes (FLSs)
We used the MTT assay to verify the effect of ergostenol glycosides on cell viability in
HCs and FLSs. As Ergn (3) has a structural similarity to DHE (2), the treatment concentra-

Molecules 2021, 26, 4547
8 of 12
tions of their glycosides were determined to be 0.5 to 20
µM. The viability of cell cultures
incubated with only the medium without growth supplement was expressed as 100%, and
cell viability was measured after ergostenol glycosides were applied under the same condi-
tions. The ergostenol glycosides affected cell survival slightly in a concentration-dependent
manner in both cell types, as shown in Figure 3, but approximately 80% cell survival was
maintained even at the highest treatment concentration of 20 µM.
Figure 3. Effects of newly synthesized ergostenol glucosides on cell viability in FLSs and HCs.
(A
) Human fibroblat like synoviocytes (FLSs) (
B
) Human chondrocytes (HCs). Cell viability assays
were performed using a concentration up to 20
µM ergostenol glycoside. Cell survival was confirmed
using the MTT assay, and the results were measured based on OD value. The viability tests were
performed in triplicate and repeated at least three times. * p < 0.05 and ** p < 0.01 compared with the
negative control.
3.4. Ergostenol Glycosides Inhibited TNF-
α-Induced Expression of the Pro-Inflammatory Cytokines
in Human Fibroblast-Like Synoviocytes (FLSs)
Both IL-1 and IL-8 have been identified as inflammatory mediators associated with
OA and RA, and iNOS is considered a signaling mediator. In addition, COX-2 is a pro-
inflammatory enzyme in arthritis [25 28]. Thus, we examined the effects of ergostenol
glycosides on pro-inflammatory mediators in cell culture models of arthritis. Each cell
type was stimulated with 10 ng/mL of TNF- , and the cell cultures were incubated with
ergostenol glycosides at various concentrations. The expression of pro-inflammatory
cytokine (IL-6, IL-1 , IL-8, and iNOS) mRNA was measured in the TNF- -induced FLSs
to evaluate the effects of the ergostenol glycosides. At concentrations of 1 or 10 µM, Ergn-
Gal (3b) strongly inhibited the expression of TNF- -induced pro-inflammatory cytokine
mRNA in a concentration-dependent manner. However, we confirmed that the iNOS
mRNA expression was strongly inhibited by all tested compounds except Ergn ( ), unlike
β
–
α
β
α
α
3
the effects of other pro-inflammatory cytokines on mRNA expression levels (Figure 4A).
Next, the effects of Ergn-Gal (3b) on pro-inflammatory cytokine protein expression were
investigated in the TNF-
expression of pro-inflammatory cytokine proteins. IL-1
the mRNA results, and COX-2 was selected as an important biomarker of arthritis. Similar
to the mRNA results, Ergn-Gal (3b) strongly inhibited TNF- -induced IL-1 and iNOS
α
-stimulated FLSs. We assessed the effects of Ergn-Gal (3b) on the
β
and iNOS were selected to verify
α
β
protein expressions, and the COX-2 protein expression was inhibited in a concentration-
dependent manner (Figure 4B).

Molecules 2021, 26, 4547
9 of 12
Figure 4. Effects of Ergn-Gal (3b) on mRNA and protein expression of pro-inflammatory cytokine and
immune-modulating factors in TNF-α-induced FLSs. (A) RT-PCR assay was performed to compare
the mRNA expression of pro-inflammatory cytokine and immune-modulating factors. (
B) Western
blotting was performed to compare IL-1 , iNOS, and COX-2 expressions. ( ) TNF- , iNOS, and
β
C
α
COX-2 amounts of protein in cell culture supernatant detected using ELISA. * p < 0.05 compared
with the only TNF-α-treated cell supernatant.
3.5. Matrix-Protective Effects of Ergostenol Glycosides in TNF-α-Induced HCs
The release of TNF-
contribute to cartilage damage and synovitis. Thus, each cell was incubated with TNF-
for 24 h and then with ergostenol glycosides at various concentrations. Subsequent
RT-PCR analyses indicated that Ergn-Gal (3b) inhibited the expression of TNF-α-induced
MMP-1, MMP-3, and MMP-13 mRNA in HCs, while Ergn ( ), Ergn-Glu (3a), and Ergn-
Gal (3b) increased the expression of COL2A1 mRNA (Figure 5A). Western blot analyses
indicated that the expression of TNF- -induced MMPs in HCs was inhibited by Ergn-
Gal (3b Figure 5B), consistent with the RT-PCR results. Overall, these data suggest that
α induces an inflammatory response, and TNF-stimulated cells
α
3
α
;
Ergn-Gal (3b) exerts matrix-protective effects in cell culture models of arthritis.
Figure 5. Effects of Ergn-Gal (3b) on MMPs and COL2A1 mRNA and protein expression in TNF-α-
induced HCs. (
A
) RT-PCR assay was performed to compare MMPs and COL2A1 mRNA expressions.
) MMP-1, MMP-3,
(B
) Western blotting was performed to compare the expression of the MMPs. (C
and MMP13 amounts of protein in cell culture supernatant detected using ELISA. * p < 0.05 compared
with the only TNF-α-treated cell supernatant.

Molecules 2021, 26, 4547
10 of 12
4. Discussion
The most common types of arthritis are osteoarthritis (OA) and rheumatoid arthritis
(RA). The major pathologic feature of OA is cartilage destruction, while RA is characterized
by synovitis. In OA, chondrocytes are exposed to inflammatory cytokines and are activated.
These activated chondrocytes produce MMPs, which induce cartilage damage and joint
destruction [29,30]. The stimulation of FLSs in RA induces inflammatory mediators and
MMPs, indicating the importance of FLSs in the propagation of inflammation and joint
damage [31]. The drugs currently used to treat arthritis include nonsteroidal analgesic and
anti-inflammatory drugs, such as azathioprine and prednisolone. However, these drugs
are associated with diverse side-effects, including gastrointestinal symptoms, leucopenia,
liver toxicity, pancreatitis, and spinal bone loss, depending on the dose and duration of
drug use [12
alleviate the inflammation of arthritis with fewer side-effects.
In this study, we found that the sterol Ergn ( ), having a double bond at carbon position
,13]. Therefore, there is a need for safer and more effective treatments that can
3
8(14) of the steroid skeleton, could be used for the synthesis of novel sterol glycosides.
As shown in Figure 2A, the energy calculations (Gaussian B3LYP, 6-311 [d, p]) for the
predicted Ergn (
was 3.43 kcal/mol greater than that for DHE (
difference between the two isomers underlies the differences in biological activity and the
difference in the ease of synthesis, suggesting Ergn ( ) as a suitable substitute for DHE ( ).
Furthermore, a highly efficient method for Ergn ( ) synthesis was developed, and
ergostenol glycosides (3a 3b, and 3c) containing a sugar, such as glucose, galactose, or
xylose, were prepared via Schmidt glycosylation with a glycosyl imidate (4a 4b, or 4c).
We confirmed that ergostenol glycosides (3a 3b, and 3c) have anti-inflammatory and
3
) and DHE (2) structures were very similar, and the stability of Ergn (
3)
2). These findings suggest that the energy
3
2
3
,
,
,
matrix-protective effects in cell culture models of arthritis. Previous studies have shown
that collagen type II is a major component of the cartilage matrix, and MMPs are the
major enzymes responsible for the degradation of cartilage matrix components [32]. As
shown in Figures 4 and 5, among ergostenol glycosides, Ergn-Gal (3b) was the most
potent inhibitor of TNF-
results demonstrate Ergn-Gal (3b) as a promising matrix-protective agent. In addition,
previous reports have shown that the prime etiologic agent of RA is TNF- . In RA,
FLSs produce or respond to inflammatory mediators, including IL-1 , IL-6, IL-8, iNOS,
α-induced MMPs and collagen type II degradation in HCs. These
α
β
and COX-2. Therefore, RA FLSs have been reported to play a direct role in escalating
inflammation [25–28].
We found that the assessed inflammatory mediators were inhibited by Ergn-Gal (3b
in TNF- -stimulated FLSs. Curcumin, resveratrol, guggulsterone, withanolide, 6-shogaol,
and boswellic acid are natural active ingredients known to alleviate arthritis through
anti-inflammatory effects or inhibition of MMPs expression [33 38]. In this study, Ergn-
)
α
–
Gal (3b) prevented collagen type II degradation, inhibited inflammatory cytokines, and
down-regulated MMPs expression, indicating its applicability as a superior candidate for
treatment of arthritis. Pro-inflammatory cytokines, pro-inflammatory enzymes, and MMPs
are regulated by the NF-κB signaling pathway, and the inhibition of NF-κB activation has
been reported to be a potential target in the treatment of arthritis [39]. Therefore, further
studies are needed to determine the function of Ergn-Gal (3b) as an anti-inflammatory
agent that inhibits NF-κB in in vitro and in vivo experiments.
5. Conclusions
In conclusion, of the newly synthesized ergostenol glycosides in this study, Ergn-Gal
(
3b) exhibited the most potent anti-inflammatory activity. These results suggest that Ergn-
Gal (3b) should be included in the list of new compounds in development for treating
arthritis and other inflammatory diseases.
Supplementary Materials: The following are available online: NMR of all compounds.

Molecules 2021, 26, 4547
11 of 12
Author Contributions: H.K. and T.L. designed the study; H.M., M.K., D.Y. and J.K. performed the
chemical syntheses; Y.P. performed the biological experiments; T.L., E.L. and H.K. analyzed the
data and wrote the manuscript. All authors have read and agreed to the published version of the
manuscript.
Funding: This research was funded by the GRRC Program of Gyeonggi province (GRRC
-KyungHee2018(B01)), Korea.
Institutional Review Board Statement: Not applicable.
Informed Consent Statement: Not applicable.
Data Availability Statement: The data presented in this study are available in this article or Supple-
mentary Materials.
Acknowledgments: The authors express their gratitude for Kwang-Hyun Ahn’s DFT calcula-
tion work.
Conflicts of Interest: The authors declare no conflict of interest.
Sample Availability: Samples of the all compounds are available from the authors.
References
1.
Robinson, W.H.; Lepus, C.M.; Wang, Q.; Raghu, H.; Mao, R.; Lindstrom, T.M.; Sokolove, J. Low-grade inflammation as a key
mediator of the pathogenesis of osteoarthritis. Nat. Rev. Rheumatol. 2016, 12, 580–592. [CrossRef] [PubMed]
Loeser, R.F. Aging processes and the development of osteoarthritis. Curr. Opin. Rheumatol. 2013, 25, 108–113. [CrossRef] [PubMed]
Mathiessen, A.; Conaghan, P.G. Synovitis in osteoarthritis: Current understanding with therapeutic implications. Arthritis Res.
Ther. 2017, 19, 18. [CrossRef] [PubMed]
2.
3.
4.
5.
Malemud, C.J. Matrix Metalloproteinases and Synovial Joint Pathology. Prog. Mol. Biol. Transl. Sci. 2017, 148, 305–325. [PubMed]
Mehana, E.E.; Khafaga, A.F.; El-Blehi, S.S. The role of matrix metalloproteinases in osteoarthritis pathogenesis: An updated
review. Life Sci. 2019, 234, 116786. [CrossRef]
6.
7.
8.
9.
Zeng, G.Q.; Chen, A.B.; Li, W.; Song, J.H.; Gao, C.Y. High MMP-1, MMP-2, and MMP-9 protein levels in osteoarthritis. Genet. Mol.
Res. 2015, 23, 14811–14822. [CrossRef]
Fei, J.; Liang, B.; Jiang, C.; Ni, H.; Wang, L. Luteolin inhibits IL-1β-induced inflammation in rat chondrocytes and attenuates
osteoarthritis progression in a rat model. Biomed. Pharmacother. 2019, 109, 1586–1592. [CrossRef] [PubMed]
Arosarena, O.A.; Barr, E.W.; Thorpe, R.; Yankey, H.; Tarr, J.T.; Safadi, F.F. Osteoactivin regulates head and neck squamous cell
carcinoma invasion by modulating matrix metalloproteases. J. Cell Physiol. 2018, 23, 409–421. [CrossRef]
Radziejewska, I.; Supruniuk, K.; Nazaruk, J.; Karna, E.; Popławska, B.; Bielawska, A.; Galicka, A. Rosmarinic acid influences
collagen, MMPs, TIMPs, glycosylation and MUC1 in CRL-1739 gastric cancer cell line. Biomed. Pharmacother. 2018, 107, 397–407.
[CrossRef]
10. Tetlow, L.C.; Woolley, D.E. Comparative immunolocalization studies of collagenase 1 and collagenase 3 production in the
rheumatoid lesion, and by human chondrocytes and synoviocytes in vitro. Br. J. Rheumatol. 1998, 37, 64–70. [CrossRef]
11. Fernandes, J.C.; Martel-Pelletier, J.; Pelletier, J.P. The role of cytokines in osteoarthritis pathophysiology. Biorheology 2002, 39,
237–246.
12. Rubbert-Roth, A.; Szabó, M.Z.; Kedves, M.; Nagy, G.; Atzeni, F.; Sarzi-Puttini, P. Failure of anti-TNF treatment in patients with
rheumatoid arthritis: The pros and cons of the early use of alternative biological agents. Autoimmun. Rev. 2019, 18, 102398.
[CrossRef]
13. Tavakolpour, S.; Alesaeidi, S.; Darvishi, M.; GhasemiAdl, M.; Darabi-Monadi, S.; Akhlaghdoust, M.; Elikaei Behjati, S.; Jafarieh, A.
A comprehensive review of rituximab therapy in rheumatoid arthritis patients. Clin. Rheumatol. 2019, 38, 2977–2994. [CrossRef]
14. Park, H.; Lee, T.H.; Chang, F.; Kwon, H.J.; Kim, J.Y.; Kim, H. Synthesis of ergosterol and 5,6-dihydroergosterol glycosides and
their inhibitory activities on lipopolysaccharide-induced nitric oxide production. Bull. Korean Chem. Soc. 2013, 34, 1330–1344.
[CrossRef]
15. Jung, M.; Lee, T.H.; Oh, H.J.; Kim, H.; Son, Y.; Lee, E.H.; Kim, J. Inhibitory effect of 5,6-dihydroergosteol-glucoside on atopic
dermatitis-like skin lesions via suppression of NF-κB and STAT activation. J. Dermatol. Sci. 2015, 79, 252–261. [CrossRef]
16. Ku, Y.; Palmer, J.; Siegel, S. Stereochemistry of the palladium catalyzed exchange of deuterium with allylic hydrogens. J. Catal.
1976, 44, 449–459. [CrossRef]
17. Mbadugha, B.N.S.; Menger, F.M. Sugar/Steroid/Sugar conjugates: Sensitivity of lipid binding to sugar structure. Org. Lett. 2003
5, 4041–4044. [CrossRef]
,
18. Sara, M.S.; Leticia, Q.C.; Jesus, S.R. Regioselective reductions of steroidal conjugated dienes by DIBAH. Tetrahedron Lett. 1995, 36,
8359–8362.

Molecules 2021, 26, 4547
12 of 12
19. Sepe, V.; di Leva, F.S.; D’Amore, C.; Festa, C.; de Marino, S.; Renga, B.; D’Auria, M.V.; Novellino, E.; Limongelli, V.; D’Souza, L.;
et al. Marine and Semi-Synthetic Hydroxysteroids as New Scaffolds for Pregnane X Receptor Modulation. Mar. Drugs 2014, 12,
3091–3114. [CrossRef] [PubMed]
20. Kim, H.; Lee, T.H.; Park, H.; Oh, H. Novel Ergostenol Glycoside Derivative. U.S. Patent 2019/0337976 A1, 7 November 2019.
21. Yu, B.; Xie, J.; Deng, S.; Hui, Y. First synthesis of a bidesmosidic triterpene saponin by a highly efficient procedure. J. Am. Chem.
Soc. 1999, 121, 12196–12197. [CrossRef]
22. Zhu, Z.Y.; Yao, Q.; Liu, Y.; Si, C.L.; Chen, J.; Jiu, N.; Lian, H.Y.; Ding, L.N.; Zhang, Y.M. Highly efficient synthesis and antitumor
activity of monosaccharide saponins mimicking components of Chinese folk medicine Cordyceps sinensis. J. Asian Nat. Pro. Res.
2012, 14, 429–435. [CrossRef] [PubMed]
23. Kim, T.K.; Cho, Y.K.; Park, H.; Lee, T.H.; Kim, H. Comparison of the inhibitory activities of 5,6-dihydroergosterol Glycoside α-
and β-anomers on skin inflammation. Molecules 2019, 24, 371. [CrossRef]
24. Frisch, M.J.; Trucks, G.W.; Schlegel, H.B.; Scuseria, G.E.; Robb, M.A.; Cheeseman, J.R.; Scalmani, G.; Barone, V.; Mennucci, B.;
Petersson, G.A.; et al. Gaussian 09, Revision C.01 ed.; Gaussian, Inc.: Wallingford, CT, USA, 2009.
25. Harrison, P.; Pointon, J.J.; Chapman, K.; Roddam, A.; Wordsworth, B.P. Interleukin-1 promoter region polymorphism role in
rheumatoid arthritis: A meta-analysis of IL-1B-511A/G variant reveals association with rheumatoid arthritis. Rheumatology 2008
47, 1768–1770. [CrossRef] [PubMed]
,
26. An, Q.; Yan, W.; Zhao, Y.; Yu, K. Enhanced neutrophil autophagy and increased concentrations of IL-6, IL-8, IL-10 and MCP-1 in
rheumatoid arthritis. Int. Immunopharmacol. 2018, 65, 119–128. [CrossRef]
27. Spiller, F.; Oliveira Formiga, R.; Fernandes da Silva Coimbra, J.; Alves-Filho, J.C.; Cunha, T.M.; Cunha, F.Q. Targeting nitric oxide
as a key modulator of sepsis, arthritis and pain. Nitric Oxide 2019, 89, 32–40. [CrossRef] [PubMed]
28. Jackson, C.G. Therapeutic potential of COX-2 inhibitors in arthritis. Expert Opin. Investig. Drugs 2001, 10, 1317–1325. [CrossRef]
29. Burrage, P.S.; Mix, K.S. Brinckerhoff CE Matrix metalloproteinases: Role in arthritis. Front. Biosci. 2006, 11, 529–543. [CrossRef]
30. Yoshihara, Y.; Nakamura, H.; Obata, K.; Yamada, H.; Hayakawa, T.; Fujikawa, K.; Okada, Y. Matrix metalloproteinases and tissue
inhibitors of metalloproteinases in synovial fluids from patients with rheumatoid arthritis or osteoarthritis. Ann. Rheum. Dis.
2000, 59, 455–461. [CrossRef]
31. Tolboom, T.C.; Pieterman, E.; van der Laan, W.H.; Toes, R.E.; Huidekoper, A.L.; Nelissen, R.G.; Breedveld, F.C.; Huizinga, T.W.
Invasive properties of fibroblast-like synoviocytes: Correlation with growth characteristics and expression of MMP-1, MMP-3,
and MMP-10. Ann. Rheum. Dis. 2002, 61, 975–980. [CrossRef] [PubMed]
32. Tsuji, M.; Hirakawa, K.; Kato, A.; Fujii, K. The possible role of c-fos expression in rheumatoid cartilage destruction. J. Rheumatol.
2000, 27, 1606–1621.
33. Dai, Q.; Zhou, D.; Xu, L.; Song, X. Curcumin alleviates rheumatoid arthritis-induced inflammation and synovial hyperplasia by
targeting mTOR pathway in rats. Drug Des. Devel. Ther. 2018, 12, 4095–4105. [CrossRef] [PubMed]
34. Yang, G.; Chang, C.C.; Yang, Y.; Yuan, L.; Xu, L.; Ho, C.T.; Li, S. Resveratrol Alleviates Rheumatoid Arthritis via Reducing
ROS and Inflammation, Inhibiting MAPK Signaling Pathways, and Suppressing Angiogenesis. J. Agric. Food Chem. 2018, 66,
12953–12960. [CrossRef]
35. Lee, Y.R.; Lee, J.H.; Noh, E.M.; Kim, E.K.; Song, M.Y.; Jung, W.S.; Park, S.J.; Kim, J.S.; Park, J.W.; Kwon, K.B.; et al. Guggulsterone
blocks IL-1beta-mediated inflammatory responses by suppressing NF-kappaB activation in fibroblast-like synoviocytes. Life Sci.
2008, 82, 1203–1209. [CrossRef]
36. Yan, X.; Huang, G.; Liu, Q.; Zheng, J.; Chen, H.; Huang, Q.; Chen, J.; Huang, H. Withaferin A protects against spinal cord injury
by inhibiting apoptosis and inflammation in mice. Pharm. Biol. 2017, 55, 1171–1176. [CrossRef]
37. Villalvilla, A.; da Silva, J.A.; Largo, R.; Gualillo, O.; Vieira, P.C.; Herrero-Beaumont, G.; Gómez, R. 6-Shogaol inhibits chondrocytes’
innate immune responses and cathepsin-K activity. Mol. Nutr. Food Res. 2014, 58, 256–266. [CrossRef]
38. Wang, Q.; Pan, X.; Wong, H.H.; Wagner, C.A.; Lahey, L.J.; Robinson, W.H.; Sokolove, J. Oral and topical boswellic acid attenuates
mouse osteoarthritis. Osteoarthr. Cartil. 2014, 22, 128–132. [CrossRef]
39. Deng, Y.; Lu, J.; Li, W.; Wu, A.; Zhang, X.; Tong, W.; Ho, K.K.; Qin, L.; Song, H.; Mak, K.K. Reciprocal inhibition of YAP/TAZ and
NF-kappaB regulates osteoarthritic cartilage degradation. Nat. Commun. 2018, 9, 4564. [CrossRef]