A tryptamine-paeonol hybridization compound inhibits LPS-mediated inflammation in BV2 cells

Article abstract of DOI:10.1016/j.neuint.2016.08.010

In the present study, we synthesized and evaluated the anti-inflammatory effects of three tryptamine (Trm) hybrid compounds, HBU-375, HBU-376 and HBU-379. The Click reaction between the azido-Trm and 2- or 4-propazylated paeonol moiety resulted in HBU-376

Full text of DOI:10.1016/j.neuint.2016.08.010

Accepted Manuscript
A tryptamine-paeonol hybridization compound inhibits LPS-mediated inflammation in
BV2 cells
Eun-Hye Jung, Ji-Sun Hwang, Mi-Youn Kwon, Kyung-Hong Kim, Hyeongjin Cho, In
Kyoon Lyoo, Sujeong Shin, Jeong-Ho Park, Inn-Oc Han
PII:
S0197-0186(16)30270-4
10.1016/j.neuint.2016.08.010
NCI 3909
DOI:
Reference:
To appear in: Neurochemistry International
Received Date: 28 March 2016
Revised Date: 2 August 2016
Accepted Date: 23 August 2016
Please cite this article as: Jung, E.-H., Hwang, J.-S., Kwon, M.-Y., Kim, K.-H., Cho, H., Lyoo, I.K.,
Shin, S., Park, J.-H., Han, I.-O., A tryptamine-paeonol hybridization compound inhibits LPS-mediated
inflammation in BV2 cells, Neurochemistry International (2016), doi: 10.1016/j.neuint.2016.08.010.
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT
A Tryptamine-paeonol Hybridization Compound Inhibits LPS-mediated Inflammation
in BV2 Cells
Eun-Hye Jung1, Ji-Sun Hwang1, Mi-Youn Kwon1, Kyung-Hong Kim1, Hyeongjin Cho2,
In Kyoon Lyoo3, Sujeong Shin4, Jeong-Ho Park4*, Inn-Oc Han1*
2
1Department of Physiology and Biophysics, College of Medicine, Department of
Chemistry, Inha University, Incheon, Korea, 3Ewha Brain Institute, Department of Brain
and Cognitive Sciences, College of Pharmacy, Ewha Womans University, Seoul, Korea,
4Department of Chemical & Biological Engineering, Hanbat National University,
Daejeon, Korea
Running title: Anti-inflammatory effects of tryptamine-paeonol hybridization
compounds
There is no potential conflict of interest in this paper.
*To whom correspondence should be addressed.
Inn-Oc Han, Ph.D.
Departmentof Physiology and Biophysics, College of Medicine,
Inha University, 100 Inha Ro, Nam-Gu, Incheon, 22212 Korea.
Tel: (82) 32-890-0924, Fax: (82) 32-890-0647
1

ACCEPTED MANUSCRIPT
E-mail: iohan@inha.ac.kr
2

ACCEPTED MANUSCRIPT
ABSTRACT
In the present study, we synthesized and evaluated the anti-inflammatory effects of
three tryptamine (Trm) hybrid compounds, HBU-375, HBU-376 and HBU-379. The Click
reaction between the azido-Trm and 2- or 4-propazylated paeonol moiety resulted in HBU-
376 and HBU-375, respectively. HBU-379 was generated by hybridizing Trm with
propazylated acetyl-syringic acid. HBU-376 and HBU-375 dose-dependently inhibited LPS
and caused nitric oxide (NO) generation in BV2 cells, whereas HBU-379 minimally inhibited
NO generation, indicating that the paeonol unit plays an important role in the anti-
inflammatory effect of Trm hybrid compounds. Although HBU-375 and HBU-376
demonstrated a similar inhibitory effect on LPS-induced NO generation, HBU-376 resulted in
less cellular toxicity presumably due to the free phenolic hydroxyl group of paeonol.
Therefore, HBU-376 may be a promising anti-inflamamtory agent conferring minimal
cytotoxicity. HBU-376 significantly and dose-dependently inhibited LPS-induced NO
products, NO synthase (iNOS), cyclooxygenase-2 (COX-2), interleukin-6, MCP-1 and
interleukin-1β mRNA expressions and iNOS and COX-2 protein expressions. However, at
the same concentrations, Trm or paeonol individually did not inhibit LPS-mediated
production of inflammatory molecules. HBU-376 inhibited both LPS-induced STAT-3
phosphorylation and nuclear factor-kappa B (NF-κB) activation. Furthermore, LPS-mediated
DNA binding of c-Rel, p50 and p52 to the NF-κB binding site of the iNOS promoter was
inhibited by HBU-376, whereas Trm and paeonol did not inhibit LPS-induced NF-κB
activation and DNA binding of c-Rel, p50 and p52. Overall, our data suggest that the Trm-
paeonol hybrid compound down-regulates inflammatory responses by inhibiting NF-κB and
3

ACCEPTED MANUSCRIPT
NF-κB-dependent gene expression. This suggests that it is a potential therapeutic agent for
inflammatory diseases of the central nervous system.
INTRODUCTION
Two chemical entities, when joined covalently, could have properties other than or
more prominent than those expected from each of the individual components. This concept
has been successfully employed in drug development in the creation of hybrid drugs (Decker,
2011) (Meunier, 2008). Two chemically distinct pharmacophores being combined into one
molecule by a linker results in the hybrid molecules potential behaving in two ways. When
combined in a metabolically labile way, the pharmacophores can act as mutual prodrugs (Noh
et al., 2015). The pharmacophores combined through a metabolically stable linker suggests
the hybridization can be a mutual derivatization including pharmacologically significant
chemical entities rather than just structural diversification (Fortin et al., 2013). In these
regards, hybridization can potentially synergize and amplify the effects of the individual drug
components.
Tryptamine (Trm) is an indole alkaloid widely distributed in fungi, plants, and
animals. Endogenous tryptamines include serotonin (5-hydroxytryptamine) and melatonin
(N-acetyl-5-methoxytryptamine) and are believed to play neuromodulator or neurotransmitter
roles. Furthermore, tryptamines are known to confer a wide variety of biological effects,
including anticancer, antimicrobial to anti-inflammatory effects (Kaushik et al., 2013;
Mollica et al., 2012). Several studies reported that melatonin exhibits a neuroprotective effect
and an anti-inflammatory effect of the brain through the anti-inflammatory function on the
microglia (Tsai et al., 2011; Ding et al., 2014). Furthermore, melatonin attenuates
lipopolysaccharide (LPS)-stimulated inflammation of astrocytes (Niranjan et al., 2012),
4

ACCEPTED MANUSCRIPT
demonstrating its anti-neuroinflammatory function. However, few studies have been focused
on the direct effect of melatonin or Trm on LPS-induced regulation of pro-inflammatory
genes in cultured microglial cells.
Paeonol (2’-hydroxy-4’-methoxyacetophenone) is an important component of herbs
of the Paeonia genus. These herbs have been used as drugs in traditional oriental medicine for
a long time. Paeonol has a wide range of pharmacological functions, including anti-oxidative,
anti-inflammatory and neuroprotective activities (Hsieh et al., 2006; Lin et al., 2015). In
particular, the anti-inflammatory properties of paeonol have been well demonstrated in
macrophages and endothelial cells (Nizamutdinova et al., 2007; Huang et al., 2008). More
recently, it has been described that paeonol attenuates LPS-stimulated microglial
inflammation in the BV2 cell line (Himaya et al., 2012; Nam et al., 2014).
Inflammation in the central nervous system is immensely consequential in the
pathogenesis of neurodegenerative disorders such as stroke, traumatic injury, Parkinson’s
disease, and Alzheimer’s disease. The aim of this study was to determine the anti-
inflammatory effect of Trm-paeonol hybrid compounds on LPS-induced inflammation in
BV2 microglia with minimum cytotoxicity. The potential benefits of the hybrid drug
approach were pursued by combining the two chemical units, Trm and paeonol, which
possess potent anti-inflammatory activities. Collectively, the current results suggest that
paeonol may be a potential neuroprotective agent which inhibits microglia-mediated
inflammation and oxidative stress.
5

ACCEPTED MANUSCRIPT
MATERIALS AND METHODS
Reagents
Except where otherwise noted, all reagents were purchased from Sigma Chemical
Company (St. Louis, MO).
Synthesis of HBU-375, HBU-376 and HBU-379
3-(2-azidoethyl)-1H-indole (1). Tryptamine (600 mg, 3.75 mmol) was dissolved in
MeOH (10 mL). Then imidazole sulfonyl azide (648 mg, 3.75 mmol) and K2CO3 (518 mg,
3.75 mmol) were added to the solution. The mixture was stirred at room temperature for 12hr.
After the reaction was completed, 10 mL H2O was added to the reaction mixture. The
mixture was extracted with DCM (10 mL x 3). The combined organic layer were washed
with brine, dried over MgSO4, and concentrated under reduced pressure. The crude product
was purified by silica gel column chromatography (Ethyl acetate : Hexane = 3 : 1) to give
compound 1 (240 mg, 40% yield).
1
IR (KBr, v, cm-1): 3413 (amine), 2091 (azide); H NMR (CDCl3, 400 MHz) δ 3.05 (t, J=7.6
Hz, 2H), 3.55 (t, J=7.2 Hz, 2H), 7.04 (s, 1H), 7.12 (t, J=8.8 Hz, 1H), 7.20 (t, J=8.2 Hz, 1H),
7.34 (d, J=7.6 Hz, 1H), 7.57 (d, J=8 Hz, 1H), 7.98 (s, 1H)
1-(2-hydroxy-4-(prop-2-yn-1-yloxy)phenyl)ethanone (2). A 25mL round-bottomed
flask was charged with 2,4-dihydroxy acetophenone (1.15 g, 7.57 mmol), cesium carbonate
(0.82 g, 2.52 mmol) and acetone (10 mL). Propargyl bromide (0.22 mL, 2.52 mmol) was then
added to the reaction mixture. The mixture was stirred at room temperature for 24hr. After
the reaction was completed, 10 mL H2O was added to the reaction mixture. The mixture was
extracted with DCM (10 mL x 3). The combined organic layer were washed with brine, dried
6

ACCEPTED MANUSCRIPT
over MgSO4, and concentrated under reduced pressure. The crude product was purified by
silica gel column chromatography (Ethyl acetate : Hexane = 1 : 6) to give compound 2 (860
mg, 50% yield).
1H NMR (CDCl3, 400 MHz) δ 2.52 (s, 1H), 2.53 (s, 3H), 4.68 (s, 2H), 6.47 (dd, J=9.6 Hz,
J=2.4 Hz, 1H), 6.48 (d, J=2.4 Hz, 1H), 7.62 (d, J=2.4 Hz, 1H), 7.62 (d, J=9.6 Hz, 1H), 12.66
13
(s, 1H); C NMR (CDCl3, 100 MHz) δ 26.19, 55.89, 76.50, 77.61, 102.01, 107.68, 114.42,
132.42, 163.73, 164.83, 202.76
1-(4-methoxy-2-(prop-2-yn-1-yloxy)phenyl)ethanone (3). To the solution of
paeonol (2.0 g, 12.04 mmol) and cesium carbonate (7.85 g, 24.08 mmol) in acetone (15 mL),
propargyl bromide (1.04 mL, 14.45 mmol) was then added to the reaction mixture. The
mixture was stirred at room temperature for 24hr. After the reaction was completed, 10 mL
H2O was added to the reaction mixture. The mixture was extracted with DCM (10 mL x 3).
The combined organic layer were washed with brine, dried over MgSO4, and concentrated
under reduced pressure. The crude product was purified by silica gel column chromatography
(Ethyl acetate : Hexane = 1 : 4) to give compound 3 (2.33 g, 95% yield).
1H NMR (CDCl3, 400 MHz) δ 2.53 (s, 1H), 2.59 (s, 3H), 3.86 (s, 3H), 3.86 (s, 3H), 4.79 (s,
13
2H), 6.41 (d, J=2.4 Hz, 1H), 6.51 (dd, J=8.8 Hz, J=2.2 Hz, 1H), 7.80 (d, J=8.8 Hz, 1H); C
NMR (CDCl3, 100 MHz) δ 31.97, 55.60, 56.25, 76.28, 77.77, 99.74, 106.16, 121.76, 132.77.
158.86. 164.26. 197.54
2,6-Dimethoxy-4-(prop-2-yn-1-ylcarbamoyl)phenyl acetate (4). Acetyl syringic
acid (900 mg, 1.26 mmol), DMAP (225 mg, 0.13 mmol) and EDC (255 mg, 1.39 mmol) were
7

ACCEPTED MANUSCRIPT
dissolved in DCM (5 mL). The reaction mixture was cooled to 0oC. Propargyl amine (81 µL,
1.26 mmol) was then added to the reaction mixture. After the reaction was completed, 10 mL
H2O was added to the reaction mixture. The mixture was extracted with DCM (10 mL x 3).
The combined organic layer were washed with brine, dried over MgSO4, and concentrated
under reduced pressure. The crude product was purified by silica gel column chromatography
(DCM : MeOH = 19 : 1) to give compound 4 (280 mg, 80% yield).
1H NMR (CDCl3, 400 MHz) δ 2.27 (t, J=2.4 Hz, 1H), 2.33 (s, 3H), 3.84 (s, 6H), 4.21 (q,
J=2.4 Hz, 2H), 6.32 (bs, 1H), 6.98 (s, 2H)
1-(4-((1-(2-(1H-indol-3-yl)ethyl)-1H-1,2,3-triazol-4-yl)methoxy)-2-
hydroxyphenyl)ethanone (HBU-375). Compound 1 (160 mg, 0.87 mmol) and Compound 2
(150 mg, 0.79 mmol) was dissolved in acetone (5 mL). To the reaction mixture Cu(PPh3)3Br
(73 mg, 0.079 mmol) was added. The reaction mixture was carried out the Click reaction by
using Microwave Synthesizer Biotage® at 65℃ for 30min. After the reaction was completed,
the solvent was evaporated. The crude product was purified by silica gel column
chromatography (DCM : MeOH = 19 : 1) to give compound HBU-375 (287 mg, 79% yield).
1
Melting point: 117℃; H NMR (DMSO, 400 MHz) δ 2.52 (s, 3H), 3.22 (t, J=6.8 Hz, 2H),
4.60 (t, J=8 Hz, 2H), 5.15 (s, 2H), 6.54 (d, J=11.6 Hz, 1H), 6.57 (s, 1H), 6.93(t, J=8 Hz, 1H),
7.02 (t, J=8 Hz, 1H), 7.04 (s 1H), 7.28 (d, J=8 Hz, 1H), 7.48 (d, J=7.6 Hz, 1H), 7.80 (d, J=8.8
Hz, 1H), 8.20 (s, 1H), 10.81 (s, 1H), 12.57 (s, 1H); 13C NMR (DMSO, 100 MHz) δ 26.4, 27.1,
50.5, 62.0, 102.1, 180.1, 110.4, 111.9, 114.4, 118.6, 118.9, 121.5, 123.6, 125.2, 127.3, 133.8,
136.6, 152.2, 164.4, 164.9, 203.7; ESI-HRMS: [MH]+ 377.0 (calcd 377.41).
8

ACCEPTED MANUSCRIPT
1-(2-((1-(2-(1H-indol-3-yl)ethyl)-1H-1,2,3-triazol-4-yl)
methoxy)-4-
methoxyphenyl) ethanone (HBU-376). HUB-376 (340 mg, 92% yield) was synthesized by
using compound 1 (220 mg, 1.08mmol) and 3 (200 mg, 0.98 mmol) by the same procedure as
the synthesis of HBU-375.
1
Melting point: 108℃; H NMR (DMSO, 400 MHz) δ 2.35 (s, 3H), 3.26 (t, J=7.6 Hz, 2H),
3.81 (s, 3H), 4.65 (t, J=6.8 Hz, 2H), 5.26 (s, 1H), 6.59 (d, J=8.4 Hz, 1H), 6.85 (s, 1H), 6.94 (t,
J=2.4 Hz, 1H), 7.01 (s, 1H), 7.02 (t, J=2.4 Hz, 1H), 7.31 (d, J=4 Hz, 1H), 7.50 (d, J=8 Hz,
13
1H), 7.60 (d, J=4 Hz, 1H), 7.62 (d, J=8.8 Hz, 1H), 8.21 (s, 1H), 10.82 (s, 1H) ; C NMR
(CDCl3, 100 MHz) δ 26.62, 32.00, 50.89, 55.67, 62.21, 99.50, 106.14, 110.53, 111.71,
118.08, 119.53, 121.36, 122.18, 123.00, 123.72, 126.67, 132.57(2C), 136.42, 159.61, 164.50,
198.11; ESI-HRMS: [MH]+377.41 (calcd 377.2).
N-((1-(2-(1H-indol-3-yl)ethyl)-1H-1,2,3-triazol-4-yl)methyl)-4-hydroxy-3,5-
dimethoxybenzamide (HBU-379). HUB-379 (226 mg, 70% yield) was synthesized by using
compound 1 (220 mg, 1.08mmol) and 4 (170 mg, 0.72 mmol) by the same procedure as the
synthesis of HBU-375.
Melting point: 170 ℃; 1H NMR (DMSO, 400 MHz) δ 2.20 (s, 3H), 3.19 (s, 2H), 3.75 (s, 6H),
4.45 (s, 2H), 4.54 (s, 2H), 6.90 (s, 1H), 7.00 (s, 1H), 7.05 (s, 1H), 7.21 (s, 1H), 7.26 (s, 2H),
7.46 (s, 1H), 7.97 (s, 1H), 9.01 (s, 1H), 10.79 (s, 1H) ; 13C NMR (DMSO, 100 MHz) δ 20.59,
26.46, 35.44, 50.44, 56.56(2C), 104.68(2C), 104.76, 110.48, 111.83, 118.91, 121.50, 123.56,
127.32, 130.66, 132.61, 136.56, 151.95(2C), 165.72, 168.21(2C); ESI-HRMS: [MH]+ 421.5
(calcd 421.5)
LogD values for HBU-375, HBU-376 and HBU-379 were calculated by using
9

ACCEPTED MANUSCRIPT
Discovery Studio program (Accelrys, San Diego, CA).
Cell Cultures
Murine BV2 microglial cell line has been used as a suitable model for in vitro studies
of activated microglia (Kim et al., 2004) cells. BV2 microglia, RAW264.7 macrophage, and
N2a neuroblastoma cells were maintained at 37°C at 5% CO2 in Dulbecco’s modified Eagle’s
medium (DMEM) supplemented with 10% FBS (Hyclone, Logan, Utah), streptomycin and
penicillin.
Cell Viability
Cell viability was measured by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrasolium
bromide (MTT) as described previously (Hwang et al., 2010). In brief, BV2 or N2a cells
were seeded to each well of 24-well plates at the density of 5 x 104 cells/well. After 24 h,
cells were stimulated with LPS (100 ng/ml) and/or HBU-375, HBU-376 and HBU-379 for 24
or 48 h. MTT solution (50 ꢀl) was added to each well, and the plates were incubated in the
dark for 4 h at 37ºC. Formazan crystals were dissolved by of solution of DMSO:EtOH=1:1.
Absorbance at 595 nm was read on a microplate reader, and the results were expressed as a %
of control (untreated).
Nitrite Measurement
Nitrite level, an index for NO production, was measured in the supernatant of BV2
cells by the Griess method (Hwang et al., 2010). Cells were seeded to each well of 24-well
plates at the density of 5x 104 cells/well. After 24 h, cells were stimulated with LPS (100
10

ACCEPTED MANUSCRIPT
ng/ml) and/or HBU compounds. Nitrite accumulation in the culture medium was measured at
various time points by adding equal volumes of Griess reagent (1% sulphanilamide, 0.1%
naphthylenediamine 5% phosphoric acid) and samples of medium. The optical density at 550
nm (OD 550) was measured with a microplate reader. Sodium nitrite, diluted in culture
medium at concentrations of 10–100 ꢀM, was used to generate a standard curve.
RT-PCR and quantitative real-time PCR
Total RNA from BV2 cells was extracted with TRIzolTM (Invitrogen, Carlsbad, CA).
RNA samples were reverse-transcribed into cDNA using SuperScript II. PCR was performed
using specific primers of mouse described below. Gene expression values were compared
with the housekeeping gene GAPDH. PCR reaction contained a total volume of 15 µl
containing 1.5 mM magnesium chloride (MgCl2), 250 µM deoxy-nucleoside triphosphate,
1.25 units Taq DNA polymerase, 10 picomoles of primer, and 25 ng cellular DNA templates.
The PCR products were electrophoresed in 1 % agarose gel in Tris/Borate/EDTA (TBE)
buffer. The gels were observed and taken pictures using UV imaging equipment.
The expressions of mRNAs were quantitatively determined by measuring
incorporation of fluorescent SYBR green into double-stranded DNA (iCycleriQ, Bio-Rad).
Relative mRNA levels were calculated from the PCR profiles of each sample using the
threshold cycle (Ct), corresponding to the cycle at which a statistically significant increase in
fluorescence occurred. Ct is considered the amount of template present in the starting reaction.
To correct for differences in the amount of total cDNA in the starting reaction, Ct values for
an endogenous control (input DNA) were subtracted from those of the corresponding sample.
11

ACCEPTED MANUSCRIPT
All real-time PCR data presented are the results of two independent DNA preparations and
amplifications.
PCR primers used in this study (mouse)
Forward Primer
Reverse Primer
iNOS
ACTTCCGAGTGTGGAACTCG
GCTGTACAAGCAGTGGCAAA
GGAGAAGCTGT GGCAGCTA
CCGGAGAGGAGACTTCACAG
GACCCTCACACTCAGATCAT
GTCCCTGTCATGCTTCTGGG
TGGCTACTTCCTCCAGGATG
GTCTGGAGTGGGAGGCACT
GCTGATGTACCAGTTGGGGA
TGGTCTTGGTCCTTAGCCAC
TTGAAGAGAACCTGGGAGTA
GAAGACCTTAGGGCAGATGCAG
COX-2
IL-1β
IL-6
TNF-α
MCP-1
GAPDH
TCATTGACCTCAACTACATGGT CTAAG CAGTTGGTGGTGCAG
Immunoblotting
Total cell protein was prepared by lysing the cells in buffer (10 mM Tris, 140 mM
NaCl, 1% Triton, 0.5 % SDS and protease inhibitors, pH 8.0). Prepared protein samples (20
ꢀg protein each) were separated by SDS-PAGE and transferred to HybondTM-ECLTM
nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ). All of the antibodies
used were from Santa Cruz Biotechnology (Santa Cruz, CA), except antibodies against iNOS
(BD Biosciences, San Jose, CA), Cox-2 (Cayman Chemicals, Ann Arbor, Mi),
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Cell Signaling Technology, Danvers,
MA), ERK1/2 (Cell Signaling Technology), p-JNK (Invitrogen), JNK (Cell Signaling
Technology), p-P38 (Cell Signaling Technology), and α-tubulin (Calbiochem, Darmstadt,
12

ACCEPTED MANUSCRIPT
Germany). The membrane was incubated with antibodies for overnight at 4°C. After washing
with TBST (50 mM Tris, 150 mM NaCl and 0.05% Tween 20, pH 7.6), the membrane was
incubated in a buffer containing HRP-conjugated secondary antibodies (1:10,000 dilution in
TBST) for 1 h at room temperature. The protein bands were detected using an ECL detection
reagent (Amersham Biosciences).
Streptavidin-agarose pull-down assay
Biotin pull-down assays were performed as described previously, with minor
modifications (Hwang et al., 2010). The procedure allows for quantitative binding of
transactivators or molecules of interest to a specific probe: a 20-nucleotide sequence
containing the NF-κB binding site (5'-GCTAGGGGGATTTTCCCTCT-3') at position -957/-
977 of the iNOS promoter. Two complementary DNAs were synthesized and biotinylated by
Bioneer Corporation (Korea) and annealed to generate a double-stranded probe. Binding
assays were performed by incubating 500 µg nuclear protein extracts with 2 µg biotinylated
DNA probe and 25 µl streptavidin-conjugated agarose beads for 1 h. DNA-protein
complexes were analyzed by Western blotting using the indicated antibodies.
Transfection and NF-κB reporter gene assay
The NF-κB reporter (Clontech, Mountain View, CA) contained three copies of the
κB-binding sequence fused to the firefly luciferase gene. RAW 264.7 cells in 12 well culture
plate (5 x 105/well) were transfected with Lipofectamine Plus. Luciferase activity was
assayed 24 h after transfection and normalized to transfection efficiency using a
cotransfected β-galactosidase plasmid. Bioluminescence was measured using
a
13

ACCEPTED MANUSCRIPT
TurnerDesigns luminometer (TD-20/20).
Electrophoretic Mobility Shift Assay (EMSA)
Nuclear protein extracts were prepared as described previously (Hwang et al., 2013)
The double-stranded DNA oligonucleotide probe containing the consensus NF-κB binding
site (Promega, Madison, WI) was labeled by polynucleotide kinase (New England Biolabs,
Beverly, MA) and purified through Sephadex G-25 spin columns. Aliquots of nuclear protein
(20 ꢀg) were incubated with labeled oligonucleotides in binding buffer (50 mM KCl, 12.5
mM HEPES pH 7.6, 6.25 mM MgCl2, 0.05 mM EDTA, 0.5 % Nonidet P-40, 0.5 mM DTT, 5%
glycerol and 2 ꢀg poly-[dI-dC]) for 30 min on ice. The reaction samples were separated on
4.5% polyacrylamide gel containing 2% glycerol, and the gel was electrophoresed at 200 V at
room temperature for 1.5 h. The gel was then dried and exposed to x-ray film (Kodak,
Rochester, NY) with an intensifying screen at -80°C.
Statistical Analysis
Data are expressed as the mean ± standard deviation (S.D., error bars) of 3
independent experiments. Statistical comparison of the re results was carried out using one-
way analysis of variance (ANOVA), followed by Tukey’s post hoc test for data analysis. A
p value <0.05 was considered as statistically significant.
14

ACCEPTED MANUSCRIPT
RESULTS
Synthesis of a hybrid compound HBU-375, HBU-376 and HBU-379
Molecular hybridization employed the Click reaction which gave rise to a triazole
moiety as a linker between tryptamine and paeonol (Kolb et al., 2001). We prepared azido
tryptamine (1), a 4-propazylated paeonol derivative (2), a 2-propazylated paeonol derivative
(3), and acetyl propazyl syringic amide (4), as described in ‘Materials and Methods’ (Fig. 1A).
Next, we synthesized HBU-375, -376 and -379 by the Click reaction (Fig. 1B).
Structures of the prepared compounds were verified by nuclear magnetic resonance
(NMR) and mass spectrometry (MS) analyses. Lipophilicity is an important factor controlling
the interaction of drugs with biological membranes. Generally, sufficient absorption of an
orally administered drug can be obtained when the logD value is greater than 2; the logD
values (aqueous solubility at pH 7.4) of HBU-375, -376 and -379 are 3.489, 3.716 and 2.952,
respectively (data not shown). Therefore HBU-375, -376 and -379 are potentially highly
permeable to cells.
Cell cytotoxicity of HBU-376, -375 and -379 was compared
We examined the cell cytotoxicity of HBU-375, -376 and -379 in BV2 cells utilizing
MTT assays. HBU-376 did not significantly change cell viability up to 20 ꢀM but induced
cytotoxicity in higher than 30 ꢀM concentrations at 24 h (Fig. 2A, upper panels). The
propazylated paeonol-compound, HBU-375, was more toxic; it induced significant cell death
at 10 ꢀM at 24 h. The propazylated syringic acid-compound, HBU-379, did not induce cell
death up to concentrations of 50 ꢀM. Control compounds, Trm, paeonol, dihydroxy
acetonphenone or syringic acid did not influence cell viability up to 50 ꢀM (Fig. 2A, lower
15

ACCEPTED MANUSCRIPT
panels). Cytotoxic effects of HBU-375, -376 and -379 were also examined in N2a murine
neuroblastoma cells and demonstrated no significant toxic effect up to 30 ꢀM.
Anti-inflammatory effects of HBU-375, HBU-376 and HBU-379 were compared
We compared the anti-inflammatory effects of the three different Trm hybrid
compounds with propazylated paeonol, paeonol or propazylated syringic amide, HBU-375,
HBU-376 and HBU-379, respectively. BV2 cells were treated with the indicated
concentrations of HBU-376, -375 or -379 or their control compounds, Trm, paeonol,
dihydroxy acetonphenone or syringic acid for 2 h prior to stimulation with LPS (100 ng/ml)
for 24 h. LPS-induced nitrite production was specifically suppressed by HBU-376 and -375,
but not by other compounds (Fig. 3). Accordingly, hybridization between Trm with a paeonol
unit specifically inhibits LPS-induced NO generation. Same concentrations of melatonin, an
endogenous Trm-based compound, did not effect on LPS-induced NO generation in BV2
cells (data not shown).
Anti-inflammatory effect of HBU-376, Trm and paeonol were examined
The effect of HBU-376, Trm and paeonol on LPS-induced nitrite production was
assessed. BV2 cells were treated with the indicated concentrations of HBU-376, Trm or
paeonol for 2 h prior to stimulation with LPS (100 ng/mL). LPS robustly induced nitrite
release at 24 h and further increased at 48 h as previously described (Hwang et al., 2013).
This increase was suppressed by HBU-376 in a dose-dependent manner (Fig. 4A). However,
the same concentrations of Trm or paeonol did not inhibit LPS-induced nitrite production in
BV2 cells. Morphological examinations under a microscope indicated that LPS caused
16

ACCEPTED MANUSCRIPT
activation-induced cell death at 48 h. HBU-376 significantly protected against activation-
induced cell death (Fig. 4B) whereas Trm or paeonol yielded no protection.
HBU-376 inhibits the upregulation of pro-inflammatory molecules at the mRNA and
protein levels
We examined the effects of HBU-376 on LPS-induced expression of inflammatory
genes that have been reported to be induced by the LPS-induced inflammatory response in
microglia. Stimulation of BV2 cells with LPS (100 ng/ml) induced the expression of iNOS
and COX-2 at 24 h. HBU-376 inhibited the expression of iNOS and COX-2 protein to a
lesser extent in a dose-dependent manner in BV2 cells (Fig. 5A), while the same doses of
Trm or paeonol were ineffective. Furthermore, 25 ꢀM HBU-376, inhibited LPS-induced
iNOS, COX-2, IL-6, TNF-α, IL-1β and MCP-1 mRNA expression were measured by RT-
PCR (Fig. 5B) and quantitative real time PCR for iNOS COX-2 and IL-6 (Fig. 5C) in BV2
cells at 24 h. However, the same dose of Trm or paeonol did not inhibit the mRNA levels of
inflammatory molecules.
HBU-376 suppresses LPS-induced STAT-3 phosphorylation and NF-κB activation
We next examined the effect of HBU-376 on the activation of MAPKs, STAT and
NF-κB, the major signaling proteins involved in the regulation of the expression of the
inflammatory mediators in response to LPS in microglia. 376, Trm or paeonol did not
influence LPS-induced phosphorylation of ERK1/2, p38 or JNK at 30 min and 6 h. However,
HBU-376, but not Trm or paeonol, significantly inhibited basal and LPS-induced STAT-3
phosphorylation at 6 h (Fig. 6A). Next, we examined the effect of HBU-376, Trm or paeonol
17

ACCEPTED MANUSCRIPT
on NF-κB activation. LPS-induced IκB-α phosphorylation and IκB-α degradation were not
significantly changed by HBU-376, Trm or paeonol (Fig. 6A). Instead, LPS-mediated
activation of NF-κB luciferase reporter activity was markedly suppressed by HBU-H376 but
not by Trm or paeonol (Fig. 6B). The inhibitory regulation of NF-κB by HBU-376 was
confirmed by electrophoretic mobility shift assays (EMSAs); HBU-376 significantly reduced
LPS-induced DNA binding of NF-κB (Fig. 6C). Trm slightly inhibited NF-κB activation
whereas paeonol yielded no such inhibitory effect. Between the two NF-κB sites in the mouse
iNOS promoter, the distal NF-κB site (-957/-977) is important for a LPS response. To
determine whether HBU-376 influences LPS-induced binding of NF-κB/Rel family proteins
(p65, p50 and c-Rel) to this site, we assayed the ability of these proteins to bind to a
biotinylated oligonucleotide corresponding to the distal NF-κB site in the iNOS promoter.
LPS increased the DNA bindings of p65 and c-Rel at 30 min and bindings of p65, c-Rel,
p105/50 and p100/p52 at 6 h. HBU-376 inhibited the DNA-binding properties of c-Rel, p50
and p52, whereas Trm or paeonol resulted in no effect (Fig. 6D).
18

ACCEPTED MANUSCRIPT
DISCUSSION
In this study, we compared the effects of three different tryptamine (Trm) hybrid
compounds, HBU-375, -376, and -379, on the inflammatory responses of BV-2 microglial
cells activated by lipopolysaccharide (LPS). We further explored the underlying working
mechanisms HBU-376. Although HBU-375 demonstrated a similar anti-inflammatory effect
compared to HBU-376 for LPS-induced NO generation, it was more cytotoxic than HBU-376
in BV2 cells. A hydroxyl group (—OH) in paeonol of HBU-375 which bonds directly to an
aromatic hydrocarbon group is called a phenol and phenolic compounds normally act as
antioxidants. However, the product generated after the anti-oxidation reaction or the
autoxidation of phenolic compounds has sometimes resulted in cell death. Therefore, HBU-
376 may qualify as a better compound employed an anti-inflammatory drug. In addition, in
order to access the importance of the paeonol group for anti-inflammatory activity, HBU-379
was generated and evaluated for its anti-inflammatory effect. HBU-379 was clearly
ineffective. HBU-379 is synthesized by hybridizing Trm with syringic acid instead of paeonol
or its derivative in HBU-376 or HBU-375. Paeonol has been considered a promising
neuroprotective or anti-neurodegenerative compound due to its anti-inflammatory and free-
radical scavenging properties (Ruimi et al., 2010; Lin et al., 2015). In particular, a recent
report indicates that paeonol inhibits LPS plus interferon-gamma (IFN-γ)-mediated iNOS/NO
generation in BV2 microglial cells. However, in our experiment, paeonol did not inhibit LPS-
induced iNOS/NO generation up to 50 ꢀM. This inconsistent result may reflect that the
characteristics of stimulation, which is LPS instead of LPS plus IFN-γ, may stimulate a
distinct signaling pathway to be inhibited by paeonol. Otherwise, minor differences in
compound preparation or the culture condition might result in a different effect of paeonol for
NO/iNOS induction in BV2 cells. Discrepancies in responses between LPS and LPS plus
19

ACCEPTED MANUSCRIPT
IFN-γ on the inhibitory effect of paeonol remain to be elucidated. However, the importance of
our work implies that the hybrid compound presented a potent anti-inflammatory effect in
concentration ranges where paeonol itself was ineffective. Since tryptamine derivatives, such
as N-acetyl-5-methoxytryptamine (melatonin) or 5-hydroxytryptamine (serotonin) exhibited
anti-inflammatory function in the brain, hybridization between tryptamine and paeonol to
generate a novel anti-inflammatory compound may be considered as a valuable
neuroprotective agent.
LPS stimulation includes the phosphorylation of p38 mitogen-activated protein
kinases (MAPKs), extracellular signal-regulated kinase (ERK)-1/2, and c-Jun NH2-terminal
kinase (JNK), leading to the activation of NF-κB in macrophages. MAPKs and NF-κB are
important regulators of various genes involved in immune and inflammatory responses,
including iNOS and COX-2 (Xie et al., 1994). HBU-376 exhibited a suppressive effect on
LPS-induced NF-κB activation but was ineffective on LPS-induced MAPKs activation,
suggesting that the inhibition of NF-κB activity is independent of MAPKs. HBU-376
inhibited LPS-induced DNA binding of c-Rel, p52 and p50 to NF-κB sites in the iNOS
promoter at 24 h. HBU-376 may inhibit protein interactions of c-Rel with p50 or p52 in order
to recruit them onto the iNOS promoter. Otherwise, HBU-376 may reduce the DNA binding
affinity of NF-κBs by either activation of inhibitory factors or changed posttranslational
modifications. The detailed inhibitory mechanism remains elusive yet HBU-376 represents
an excellent candidate for agents of various inflammatory diseases including
neurodegenerative diseases, arthritis, sepsis, cancer, obesity, and diabetes all through the
inhibition of NF-κB associated gene products.
20

ACCEPTED MANUSCRIPT
HBU-376 inhibited LPS-mediated activation of the STAT-3 phosphorylation. The
JAK-STAT signal pathway plays myriad pivotal roles in immune and inflammatory responses
(Kim et al., 2006), suggesting that NF-κB regulates the STAT activation. In has been shown
that cytokine mixture treatment activates STAT3 and STAT1 and this activation is dependent
on MAPKs and NFκB signaling (Tyagi et al., 2012). Therefore, HBU-376 potentially
inhibited LPS-stimulated NF-κB activation and subsequently reduced downstream STAT3
activation. We observed that inhibition of JAK/STAT signaling moderately reduced iNOS
expression, whereas inhibition of NF-κB in turn, inhibited STAT3 activation and completely
suppressed iNOS induction in response to LPS in BV2 cells (data not shown). These results
indicate that STAT3 might be one of several downstream targets of NF-κB which regulates
iNOS transcription.
This report asserts a potential drug for inflammatory diseases through the design of
novel combinations of natural compounds for functional, therapeutic objectives. The
combination of appropriate pharmacophores into one compound has been developed to
efficiently discover promising drug candidates. The well-described anti-oxidant nature of
paeonol and the immunomodulatory effect of Trm derivatives led us to design a new anti-
inflammatory compound by combining these molecules. We found that Trm or paeonol
demonstrated little inhibitory activity against LPS-induced iNOS/NO production in BV2 cells,
while HBU-376 and HBU-375 potently inhibited LPS-mediated NO production (> 90%
reduction compared to the LPS-treated control). HBU-376 yielded no significant toxic effects
up to 20 ꢀM whereas HBU-375 demonstrated significant cytotoxicity at higher than 10 ꢀM.
Accordingly, HBU-376 could potentially be used to treat neurodegenerative or other
21

ACCEPTED MANUSCRIPT
inflammation-related diseases, either alone or as an adjunct to enhance the efficacy and/or
reduce the required doses of other disease-modifying immunotherapies.
22

ACCEPTED MANUSCRIPT
AKNOWLEDGEMENT
This research was supported by the Brain Research Program through the National
Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT & Future
Planning (2015M3C7A1028373).
23

ACCEPTED MANUSCRIPT
REFERENCES
Decker M (2011). Hybrid molecules incorporating natural products: applications in cancer
therapy, neurodegenerative disorders and beyond. Curr Med Chem 18: 1464-1475.
Ding K, Wang H, Xu J, Lu X, Zhang L, Zhu L (2014). Melatonin reduced microglial
activation and alleviated neuroinflammation induced neuron degeneration in
experimental traumatic brain injury: Possible involvement of mTOR pathway.
Neurochem Int 76: 23-31.
Fortin S, Berube G (2013). Advances in the development of hybrid anticancer drugs. Expert
Opin Drug Discov 8: 1029-1047.
Himaya SW, Ryu B, Qian ZJ, Kim SK (2012). Paeonol from Hippocampus kuda Bleeler
suppressed the neuro-inflammatory responses in vitro via NF-kappaB and MAPK
signaling pathways. Toxicol In Vitro 26: 878-887.
Hsieh CL, Cheng CY, Tsai TH, Lin IH, Liu CH, Chiang SY, et al. (2006). Paeonol reduced
cerebral infarction involving the superoxide anion and microglia activation in ischemia-
reperfusion injured rats. J Ethnopharmacol 106: 208-215.
Huang H, Chang EJ, Lee Y, Kim JS, Kang SS, Kim HH (2008). A genome-wide microarray
analysis reveals anti-inflammatory target genes of paeonol in macrophages. Inflamm Res
24

ACCEPTED MANUSCRIPT
57: 189-198.
Hwang SY, Hwang JS, Kim SY, Han IO (2013). Glucosamine inhibits lipopolysaccharide-
stimulated inducible nitric oxide synthase induction by inhibiting expression of NF-
kappaB/Rel proteins at the mRNA and protein levels. Nitric Oxide 31: 1-8.
Hwang SY, Shin JH, Hwang JS, Kim SY, Shin JA, Oh ES, et al. (2010). Glucosamine exerts a
neuroprotective effect via suppression of inflammation in rat brain ischemia/reperfusion
injury. Glia 58: 1881-1892.
Kim HS, Ye SK, Cho IH, Jung JE, Kim DH, Choi S, et al. (2006). 8-hydroxydeoxyguanosine
suppresses NO production and COX-2 activity via Rac1/STATs signaling in LPS-induced
brain microglia. Free Radic Biol Med 41: 1392-1403.
Kim WK, Hwang SY, Oh ES, Piao HZ, Kim KW, Han IO (2004). TGF-beta1 represses
activation and resultant death of microglia via inhibition of phosphatidylinositol 3-kinase
activity. J Immunol 172: 7015-7023.
Kolb HC, Finn MG, Sharpless KB (2001). Click Chemistry: Diverse Chemical Function from
a Few Good Reactions. Angew Chem Int Ed Engl 40: 2004-2021.
25

ACCEPTED MANUSCRIPT
Lin C, Lin HY, Chen JH, Tseng WP, Ko PY, Liu YS, et al. (2015). Effects of paeonol on anti-
neuroinflammatory responses in microglial cells. Int J Mol Sci 16: 8844-8860.
Meunier B (2008). Hybrid molecules with a dual mode of action: dream or reality? Acc Chem
Res 41: 69-77.
Nam KN, Woo BC, Moon SK, Park SU, Park JY, Hwang JW, et al. (2014). Paeonol
attenuates inflammation-mediated neurotoxicity and microglial activation. Neural Regen
Res 8: 1637-1643.
Niranjan R, Nath C, Shukla R (2012). Melatonin attenuated mediators of neuroinflammation
and alpha-7 nicotinic acetylcholine receptor mRNA expression in lipopolysaccharide
(LPS) stimulated rat astrocytoma cells, C6. Free Radic Res 46: 1167-1177.
Nizamutdinova IT, Oh HM, Min YN, Park SH, Lee MJ, Kim JS, et al. (2007). Paeonol
suppresses intercellular adhesion molecule-1 expression in tumor necrosis factor-alpha-
stimulated human umbilical vein endothelial cells by blocking p38, ERK and nuclear
factor-kappaB signaling pathways. Int Immunopharmacol 7: 343-350.
Noh J, Kwon B, Han E, Park M, Yang W, Cho W, et al. (2015). Amplification of oxidative
stress by a dual stimuli-responsive hybrid drug enhances cancer cell death. Nat Commun
6: 6907.
26

ACCEPTED MANUSCRIPT
Su SY, Cheng CY, Tsai TH, Hsiang CY, Ho TY, Hsieh CL (2010). Paeonol attenuates
H(2)O(2)-induced NF-kappaB-associated amyloid precursor protein expression. Am J
Chin Med 38: 1171-1192.
Tsai MC, Chen WJ, Tsai MS, Ching CH, Chuang JI (2011). Melatonin attenuates brain
contusion-induced oxidative insult, inactivation of signal transducers and activators of
transcription 1, and upregulation of suppressor of cytokine signaling-3 in rats. J Pineal
Res 51: 233-245.
Tyagi A, Agarwal C, Dwyer-Nield LD, Singh RP, Malkinson AM, Agarwal R (2012).
Silibinin modulates TNF-alpha and IFN-gamma mediated signaling to regulate COX2
and iNOS expression in tumorigenic mouse lung epithelial LM2 cells. Mol Carcinog 51:
832-842.
Xie QW, Kashiwabara Y, Nathan C (1994). Role of transcription factor NF-kappa B/Rel in
induction of nitric oxide synthase. J Biol Chem 269: 4705-4708.
27

ACCEPTED MANUSCRIPT
FIGURE LEGENDS
Figure 1. The chemical structure of tryptamine (Trm), paeonol, propazylated paeonol,
propazylated syringic acid, HBU-375, HBU-376 and HBU-379
HBU-375, -376, -and -379 were synthesized from Trm and paeonol or propazylated paeonol
as described in Materials and Methods.
Figure 2. Cytotoxic effects of HBU-376, -375 and -379 on BV2 cells
BV2 microglia (A) or N2a (B) cells were treated with the indicated concentrations of HBU-
376, -375 and -379 for 24 h. The same concentrations of control compounds, Trm, paeonol,
dihydroxyacetophenone or syringic acid, were treated on BV2 cells for 24 h. Cell viability
was determined using MTT assays, and the results are expressed as percentages compared to
the untreated control. * represents significant differences from untreated control.
Figure 3. Examination of LPS-induced nitrite production by HBU-376, -375 and -379 in
BV2 cells
BV2 cells were pre-treated with the indicated concentrations of dopamine, HBU-376, -375, -
379, Trm, paeonol, dihydroxyacetophenone or syringic acid for 2 h and stimulated with 0.1
µg/ml LPS. Nitrite levels in the culture medium were measured at 24 h. * represents
significant differences from the LPS-treated control.
Figure 4. Suppression of LPS-induced nitrite production and cell death by HBU-376
BV2 cells were pre-treated with the indicated concentrations of HBU-376, Trm, or paeonol
(25 ꢀM) for 2 h and stimulated with 0.1 µg/ml LPS. (A) Nitrite levels in culture medium
28

ACCEPTED MANUSCRIPT
were measured at 24 h. (B) The phenotypes of control, HBU-376, Trm, or paeonol (25 ꢀM
each) treated cells, with or without LPS, were observed using a phase-contrast microscope at
48 h. * represents significant differences from the LPS-treated control at 24 h and ** denotes
significant difference from the LPS-treated control at 48 h. Cell phenotypes are representative
of 3 independent experiments.
Figure 5. Inhibition of LPS-induced pro-inflammatory molecules by HBU-376
BV2 cells were pre-treated with the indicated concentrations of HBU-376, Trm, or paeonol
(25 ꢀM) for 2 h and then treated with 0.1 µg/mL LPS for 24 h. (A) iNOS, COX-2 and
GAPDH protein levels were measured by Western blotting. (B) Total RNA was prepared,
and the mRNA levels of iNOS, COX-2, IL-6, TNF-α, IL-1β and MCP-1 were determined
using RT-PCR. GAPDH mRNA served as a control. (C) mRNA levels for iNOS, COX-2 and
IL-6 were measured by quantitative real-time PCR. * represents significant differences from
the LPS-treated control. Western blots and RT-PCR results are representative of 3
independent experiments.
Figure 6. Inhibition of LPS-induced activation of NF-κB and STAT-3 phosphorylation
by HBU-376
(A) BV2 cells were pretreated with HBU-376, Trm, or paeonol (25 ꢀM) for 2 h and then
treated with 0.1 µg/mL LPS. Total cell lysates were prepared at 30 min or 6 h, and the levels
of phosphorylated-ERK1/2, -p38, -JNK, -STAT3, -IκB-α, and their total proteins levels along
with α-tubulin levels were evaluated by Western blotting using specific antibodies. (B)
RAW264.7 cells were transfected with a NF-κB-luciferase reporter plasmid. Cells were
29