Hydroxypyridonecarboxylic Acids as Inhibitors of Human Cytomegalovirus pUL89 Endonuclease

Article abstract of DOI:10.1002/cmdc.201800283

Human cytomegalovirus (HCMV) infection poses a major health threat to immunocompromised individuals. Until recently, treatment of HCMV infection has relied solely on polymerase inhibitors that have safety and resistance issues. pUL89 provides the enzymatic functions for the HCMV terminase complex in viral DNA packaging and is an attractive target for developing a new class of HCMV drugs. However, inhibitors of the endonuclease activity of the C terminus of pUL89 (pUL89-C) were unknown before our recently characterized hydroxypyridonecarboxylic acid (HPCA) hit 7 r (1-(3-chloro-4-fluorobenzyl)-5-hydroxy-4-oxo-1,4-dihydropyridine-3-carboxylic acid; numbered as 10 k in our previous publication: Y. Wang, L. Mao, J. Kankanala, Z. Wang, R. J. Geraghty, J. Virol. 2017, 91, e02152-16). Herein, we explored the structure–activity relationship (SAR) of the HPCA chemotype mainly with regard to the N1 site through the synthesis of 35 analogues. The SAR studies, along with molecular modeling, identified a possible pharmacophore model minimally consisting of a chelating triad and a hydrophobic phenyl or biphenyl methyl substituent at N1. Lastly, our best compounds consistently inhibited pUL89-C in the low micromolar range in biochemical assays and exhibited strong antiviral activity without cytotoxicity, laying a solid medicinal chemistry foundation for further HCMV drug discovery efforts targeting pUL89-C.

Full text of DOI:10.1002/cmdc.201800283

Accepted Article
Title: Hydroxypyridonecarboxylic acids as inhibitors of human
cytomegalovirus pUL89 endonuclease
Authors: Jayakanth Kankanala, Yan Wang, Robert J. Geraghty, and
Zhengqiang Wang
This manuscript has been accepted after peer review and appears as an
Accepted Article online prior to editing, proofing, and formal publication
of the final Version of Record (VoR). This work is currently citable by
using the Digital Object Identifier (DOI) given below. The VoR will be
published online in Early View as soon as possible and may be different
to this Accepted Article as a result of editing. Readers should obtain
the VoR from the journal website shown below when it is published
to ensure accuracy of information. The authors are responsible for the
content of this Accepted Article.
To be cited as: ChemMedChem 10.1002/cmdc.201800283
Link to VoR: http://dx.doi.org/10.1002/cmdc.201800283
A Journal of
www.chemmedchem.org

10.1002/cmdc.201800283
ChemMedChem
FULL PAPER
Hydroxypyridonecarboxylic acids as inhibitors of human
cytomegalovirus pUL89 endonuclease
Jayakanth Kankanala, Yan Wang, Robert J. Geraghty and Zhengqiang Wang[a]
[a]
Dr. Jayakanth Kankanala, Dr. Yan Wang, Prof. Robert J. Geraghty and Prof. Zhengqiang Wang
Center for Drug Design
Academic Health Center, University of Minnesota
Minneapolis, Minnesota. USA 55455
 Corresponding author. Tel.: +1 (612) 626-7025; e-mail: wangx472@umn.edu
Abstract: Human cytomegalovirus (HCMV) infection poses a major
health threat for immuno-compromised individuals. Until very recently
treatment of HCMV infection has relied solely on polymerase inhibitors
which suffer from safety and resistance issues. pUL89 provides the
enzymatic functions for HCMV terminase complex in viral DNA
packaging and represents an attractive target for developing a new
class of HCMV drugs. However, inhibitors of the endonuclease activity
of the C terminus of pUL89 (pUL89-C) were unknown prior to our
recently characterized hydroxypyridonecarboxylic acid (HPCA) hit 7r
(numbered as 10k in the original publication; Wang et al.; J Virol., 2017).
We report herein the structure-activity relationship (SAR) of the HPCA
chemotype concerning mainly the N-1 site through the synthesis of 35
analogues. These SAR studies, along with molecular modeling,
revealed a possible pharmacophore model consisting of minimally a
chelating triad and a hydrophobic phenyl or biphenyl methyl substituent
at N-1. In the end, our best compounds consistently inhibited pUL89-C
in low µM range in biochemical assays, and exhibited strong antiviral
pUL89 cleaves the viral genome with its C-terminal endonuclease
activity and produces energy for genome transportation into
assembling capsids with its N-terminal ATPase.[9] Recent FDA
approval of letermovir (4)[10] provides a strong clinical validation of
targeting terminase complex for antiviral development.[11] Studies
have demonstrated that 4 most likely targets the terminase
noncatalytic protein, pUL56.[12] In addition, mutation of HSV-1 UL15,
the homologue of HCMV UL89, results in a replication-incompetent
virus unable to cleave genomes,[9] suggesting that inhibition of
pUL89 genome-cleavage activity should confer antiviral activity
against HCMV. Although chemotypes such as nucleoside analog 2-
bromo-5,6-dichloro-1-β-d-ribofuranosyl-1H-benzimidazole
(BDCRB, 5) [13] and non-nucleoside BAY 38-4766 (6) [14] have been
reported to inhibit HCMV pUL89, neither target the endonuclease
domain at C terminus. Interestingly, pUL89-C has an RNase
H/integrase (IN)-like active site fold,[15] and its function is dependent
on divalent metal ions and can be inhibited by the HIV IN inhibitor
raltegravir,[15] suggesting that active site inhibition of pUL89-C may
entail a metal-chelating pharmacophore similar to inhibitors of
RNase H and IN. We have previously studied extensively the
inhibition of HIV RNase H and IN with various chemotypes featuring
a chelating triad.[16-23] Recent screening of our in-house synthetic
analogues of chelating compounds identified a compound (7r) of
the hydroxypyridonecarboxylic acids (HPCA) chemotype inhibiting
pUL89-C in biochemical assay and HCMV in antiviral assay (Figure
1, c).[24] Further characterizations revealed an antiviral mechanism
of action consistent with targeting pUL89-C.[24] To our best
knowledge, 7r (numbered as 10k in the original publication; Wang
et al.; J Virol., 2017) [24] was the very first inhibitor of pUL89-C. We
report herein the SAR of 7r concerning the carboxylic acid
functionality and mainly the N-1 substituent.
activity without cytotoxicity, laying
a solid medicinal chemistry
foundation for further HCMV drug discovery efforts targeting pUL89-C.
Introduction
Human cytomegalovirus (HCMV) infection is widespread with a
seroprevalence of 60% in developed countries and nearly 100% in
developing countries.[1] While generally asymptomatic in individuals
with a mature and healthy immune system, HCMV infection can
cause significant morbidity and mortality in immunocompromised
individuals, such as organ transplant recipients and AIDS
patients.[2] HCMV infection is a particular concern in newborns as
it remains a leading cause of neurodevelopmental issues and
hearing loss.[3] Current treatment for HCMV infection relies primarily
on FDA-approved viral polymerase inhibitors (Figure 1, a), including
ganciclovir (GCV, 1), cidofovir (2), and foscarnet (3).[4-5] These
drugs all suffer from dose related toxicities and drug resistance.
Therefore, there is a pressing need to develop new therapies with
novel molecular targets.
HCMV terminase complex has become an increasingly attractive
target. Many double-strand DNA viruses including herpesviruses,[6]
adenoviruses[7] and certain bacteriophage[8] replicate their genome
as a linear concatemeric DNA which needs to be cleaved to
genome length for proper viral packaging. Cleavage is carried out
by a viral terminase complex which minimally comprises a catalytic
terminase subunit and a noncatalytic terminase protein. For HCMV
 Corresponding author. Tel.: +1 (612) 626-7025; e-mail: wangx472@umn.edu
1
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800283
ChemMedChem
FULL PAPER
30-40 min, MW, 40-85%; e) 2N NaOH, EtOH, 90 oC, 4-6 h, 65- 95%; f) ArB(OH)2,
K2CO3, Pd(PPh3)4, DME/H2O (4:1), 150 oC, 30-40 min, MW, 60-80%; g) TFA, 80
oC, 20 min, MW, 40-87%.
The ester analogue (15) was produced from intermediate 13g via a
debenzylation, whereas the carboxamide analogue (17) was
prepared also from 13g via a direct amination and the subsequent
debenzylation (Scheme 2).
Scheme 2. Reagents and conditions: a) 7N NH3/ MeOH, r.t, 48 h, 70%; b) TFA,
80 oC, 20 min, MW, 65-78%.
Biological results and discussion
Figure 1. Structures of known HCMV inhibitors. (a) FDA-approved HCMV drugs
targeting polymerase; (b) Reported compounds targeting HCMV terminase.
Compound 4 was recently approved by FDA; (c) our reported first inhibitor hit of
pUL89-C.
All 35 analogues were tested in dose response fashion in a
biochemical assay measuring the endonuclease activity of pUL89-
C. The biochemical inhibitory potency was reported as IC50 and
three HCMV inhibitors not targeting pUL89-C were used as
negative controls: polymerase inhibitor 1, pUL56 inhibitor 4 and
pUL89 inhibitor 5. In parallel, all analogues were also tested in a
cell-based antiviral assay under single concentration (10 µM).
Results from these assays (Table 1) revealed a few SAR trends: 1)
alkyl or phenyl substitution at the N-1 position is typically not
tolerated as compounds 7b-e did not significantly inhibit pUL89-C
at concentrations up to 25 µM. In antiviral assay, these compounds
showed no or marginal activity at 10 µM; 2) most analogues with a
benzyl substitution at N-1 (7f-t), including half of the analogues with
a mono-substituted phenyl ring (7g-o) and all those with a di-
substituted phenyl ring (7p-t), demonstrated significant biochemical
inhibition against pUL89-C in low µM range (IC50 = 3.5-24 µM). The
low µM biochemical inhibition is generally correlated with the
substantial antiviral activity observed (28-85% inhibition at 10 µM);
3) replacing the phenyl ring with a pyridine or naphthalene
completely abrogated the biochemical inhibition (7u-w), suggesting
that phenyl ring should be preserved for effectively targeting pUL89-
C with the HPCA chemotype; 4) biphenyl methyl substitution at N-
1 (7x-ee) generally conferred potent biochemical inhibition with
significant antiviral activity. However, when the second phenyl ring
is replaced by a pyridine (7ff) or a quinoline (7gg), the biochemical
inhibition was completely abolished, indicating that a hydrophobic
moiety is preferred; 5) the ester analogue of 7g showed
considerably reduced biochemical inhibition (15 vs 7g), and the
amide analogue was inactive (17 vs 7g), implying that the
carboxylic acid functionality is important for binding the divalent
metal ions; 6) bulkiness around the N-1 site significantly hampered
target binding, resulting in reduced biochemical inhibition (7h vs 7g,
7x vs 7y, Table 1). The SAR results highlight the importance of N-
1 substituents and also its sensitivity to the steric and electronic
requirements on activity. Taken together, these data corroborate a
possible pharmacophore model which entails a chelating triad
comprising a hydroxyl group, a carbonyl group and a carboxylic acid,
and a mono- or di- substituted hydrophobic phenyl or biphenyl
methyl substituent at N-1. Such a pharmacophore model closely
resembles those for the inhibitors of similar enzymes such as HIV
RNase H and integrase.[25]
Results and Discussion
Chemistry
All 33 HPCA analogues (7a-gg) as well as an ester analogue (15)
and a carboxamide analogues (17) in this study were synthesized
according to our reported procedures.[16] Briefly, the synthesis
began with the preparation of benzyl ether intermediate (10) via
benzylating the commercially available ethyl chloroacetoacetate (9).
10 was then condensed with DMF to yield enamine 11 which was
subjected to Claisen condensation followed by an immediate
cyclization to produce the pyrone intermediate 12. Amination of
pyrone 12 with various amines (RNH2) generated pyridone
analogues (13), which upon saponification afforded pyridone
carboxylic acids 14. Debenzylation of 14 directly yielded HPCA
analogues with an alkyl, aryl or benzyl substituent at the N-1 (7a-
w). For HPCA analogues with a biaryl methyl substituent at N-1
(7x–gg), the synthesis involved a Suzuki coupling reaction between
an N-1 bromobenzyl analogue of 14 (14j or 14k) and various aryl
boronic acids, followed by a debenzylation (Scheme 1).
Scheme 1. Reagents and conditions: a) NaH, THF, r.t, 16h, 95% ; b) DMF DMA,
toluene, r.t, 30%; c) Ethyl formate, KOtBu, THF, r.t, 75%; d) R-NH2, EtOH, 100 oC,
2
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800283
ChemMedChem
FULL PAPER
Table 1. Biochemical and antiviral screening results for all synthetic HPCA
analogues.
3
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800283
ChemMedChem
FULL PAPER
Antiviral
activity
Antiviral
activity
Anti UL89
activity
IC50 (µM)
Anti UL89
activity
IC50 (µM)
Compd
R
Compd
R
% inhibition
@ 10 µM
% inhibition
@ 10 µM
7a
7b
H
14±3.5
>25
13
14
7t
24±2.3
>25
28
7
Et
7u
7c
>25
2
7v
>25
47
7d
7e
>25
>25
15
8
7w
7x
>25
>25
12
15
7f
>25
38
39
7y
7z
13±2.6
25±0.1
23
30
7g
8.0±5.0
7h
7i
>25
25
85
55
15
9
7aa
7bb
7cc
7dd
7ee
7ff
7gg
15
20±0.4
14±3.7
5.6±2.0
13±0.5
>25
17
28
43
20
0
19±1.4
3.5±0.8
4.2±1.1
>25
7j
7k
7l
7m
7n
7o
7p
7q
7r
7s
7.5±3.6
>25
35
12
32
47
32
53
86
>25
26
23
50
40
-
>25
>25
--
--
--
--
--
25
6.2±4.5
5.8±0.3
6.2±1.2
4.2±0.5
17
>25
1
>50
4
>50
-
5
>50
-
4
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800283
ChemMedChem
FULL PAPER
With these screening results, we then selected analogues (9
compounds) with single digit IC50 (<10 µM) from the biochemical
assay for dose response antiviral evaluation and cell viability
assay (Table 2). The dose response antiviral assay was
conducted in HFF cells and the HCMV replication was measured
using a GFP-expressing reporter virus, ADCREGFP.[26] Three
HCMV inhibitors including polymerase inhibitor 1, pUL56 inhibitor
4 and pUL89 inhibitor 5 were used as positive controls. Notably,
with the single exception of 7q which did not significantly inhibit
HCMV replication at concentrations up to 25 µM, all selected
pUL89-C inhibitors strongly inhibited HCMV replication in cell
culture in low µM range (EC50 = 1.9-14 µM), indicating a strong
correlation between the antiviral potency and biochemical
inhibition against pUL89-C. In addition, none of the selected
compounds showed significant cytotoxicity at concentrations up
to 100 or 200 M in the MTS assay also in HFF cells. Although
our compounds were not nearly as active as 4 in the antiviral
assay, our most active compound 7cc was only 2 fold less active
than 1 and 5 (Table 2). In contrast, inhibiting pUL89-C
endonuclease activity requires that small molecules effectively
out compete large DNA substrates, and hence, is more
challenging. Nevertheless, the data described herein represent
the first medicinal chemistry efforts toward discovering pUL89-C
inhibitors which were unknown prior to our recent report of 7r. The
current SAR, along with reported mechanistic characterization of
7r,[24] supports HPCA as a valid pUL89-C inhibitor chemotype.
Figure 2. (A) Crystal structure of HCMV pUL89 nuclease domain (pdb code:
3N4Q). Mn2+ ions was shown as green spheres. (B) Predicted binding mode of
compound 7s within the active site of nuclease domain of HCMV. Key residues
are represented in green sticks.
Conclusions
Through analogue synthesis we explored the SAR of our recently
characterized HPCA analogue 7r as the first pUL89-C inhibitor.
Concerning both the carboxylic acid functionality (15, 17 vs 7g)
and the N-1 substituent (7a-gg), these SAR studies demonstrated
that carboxylic acid is preferred over ester and amide as part of
the chelating triad, and that a hydrophobic benzyl or biphenyl
methyl substituent at N-1 is also required for potent inhibition.
Such a pharmacophore model is corroborated by molecular
modeling. In the end, numerous compounds consistently inhibited
both the enzymatic activity of pUL89-C and HCMV replication in
low M range as shown in Table 2. In addition, no appreciable
cytotoxicity was observed with any of our inhibitors in cell viability
assay. These results lay a solid medicinal chemistry foundation
for further HCMV drug discovery efforts targeting pUL89-C.
Table 2. Biochemical and antiviral activity profile of selected compounds.
Anti UL89
activity
Antiviral
activity
Compd
CC50 (µM)
IC50 (µM)
6.2±1.2
8.0±5.0
3.5±0.8
4.2±1.1
7.5±3.6
6.2±4.5
5.8±0.3
4.2±0.5
5.6±2.0
>50
EC50 (µM)
4.9±0.5
10±0.9
7r
7g
7j
>200
>100
>200
>200
>100
>100
>100
>200
>200
>20
Experimental Section
Chemistry
7.2±1.7
3.6±0.6
14±3.0
7k
7m
7p
7q
7s
7cc
1
General procedures
6.7±1.9
>25
All commercial chemicals were used as supplied unless otherwise
indicated. Flash chromatography was performed on a Teledyne
Combiflash RF-200 with RediSep columns (silica) and indicated
mobile phase. All moisture sensitive reactions were performed
under an inert atmosphere of ultra-pure argon with oven-dried
3.0±1.4
1.9±0.1
0.9±0.1
0.01±0.007
0.8±0.1
1
glassware. H and 13C NMR spectra were recorded on a Varian
4
>50
>20
600 and Bruker 400 MHz spectrometer. Mass data were acquired
on an Agilent TOF II TOF/MS spectrometer capable of ESI and
APCI ion sources. Analysis of sample purity was performed on a
Varian Prepstar SD-1 HPLC system with a Phenomenex Gemini,
5 micron C18 column (250mm x 4.6 mm). HPLC conditions:
solvent A = H2O, solvent B = MeCN; flow rate = 1.0 mL/min;
compounds were eluted with a gradient of 5% MeCN/H2O for 0-5
min and to 95% MeCN/ H2O from 5-30 min followed by 100%
MeCN from 35-40 min. Purity was determined by total absorbance
at 254 nm. All tested compounds have a purity ≥ 98%. All 33
HPCA analogues (7a-gg) as well as an ester analogue (15) and
a carboxamide analogues (17) in this study were synthesized
according to our reported procedures.[16]
5
>50
>100
Molecular modeling
Docking analysis was performed with Glide XP (version 6.4)[27-29]
using two metal sites as a constraint. Compound 7s was docked
into the active site of HCMV pUL89 nuclease domain (pdb code:
3N4Q).[15, 30] The predicted binding mode features the interaction
of chelating triad of HPCA core (7s) with the two metal ions (Mn2+)
which in turn binds to the acidic residues (D463, E534 and D651)
and the N-benzyl group is located into the small hydrophobic
groove (Figure 2).
5
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800283
ChemMedChem
FULL PAPER
General procedure for O-debenzylation (7a-gg, 15, 17).[16]
5-Hydroxy-4-oxo-1-((4'-sulfamoyl-[1,1'-biphenyl]-3-yl)methyl)-1,4-
dihydropyridine-3-carboxylic acid (7ee).
A mixture of 14 (1.0 eq) in TFA (2 mL) was irradiated at 80 °C for
20 min under microwave conditions. The solvent was removed in
vacuo to produce the crude product as pale yellow solid which
was triturated in methanol and ether to produce the titled
compound as colorless solid (7a-gg, 15, 17).
1H NMR (600 MHz, DMSO-d6) δ 10.06 (s, 1H), 8.75 (s, 1H), 7.93 – 7.85
(m, 5H), 7.75 (d, J = 7.5 Hz, 1H), 7.54-7.52 (m, 1H), 7.50 – 7.44 (m, 1H),
7.41 (s, 2H), 5.41 (s, 2H). 13C NMR (150 MHz, DMSO-d6) δ 171.2, 166.3,
148.7, 143.4, 142.8, 140.3, 139.5, 136.6, 130.0, 128.3, 127.5, 127.4, 126.5,
125.8, 113.4, 60.2. HRMS-APCI (+) m/z calculated for C19H17N2O6S
401.0802 [M+H], found: 401.0806.
1-Ethyl-5-hydroxy-4-oxo-1,4-dihydropyridine-3-carboxylic acid (7b).
In vitro pUL89 nuclease ELISA
1H NMR (600 MHz, DMSO-d6) δ 9.97 (s, 1H), 8.50 (d, J = 1.8 Hz, 1H),
7.85 (d, J = 1.8 Hz, 1H), 4.15 (q, J = 7.2 Hz, 2H), 1.36 (t, J = 7.2 Hz, 3H).
13C NMR (150 MHz, DMSO-d6) δ 170.7, 166.2, 148.5, 139.6, 125.5, 113.1,
52.9, 16.0. HRMS-APCI (+) m/z calculated for C8H10NO4 184.0604 [M+H],
found: 184.0607.
pUL89-C was expressed and purified as described by others.[15]
The pUL89-C bacterial expression plasmid was generated as
described.[24]
The
60-bp
ssDNA
(5'-
1-Cyclopropyl-5-hydroxy-4-oxo-1,4-dihydropyridine-3-carboxylic acid (7c).
taatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgca
c) was labeled with digoxigenin (DIG) tag at 5’ end; and its
1H NMR (400 MHz, DMSO-d6) δ 10.01 (s, 1H), 8.33 (d, J = 2.0 Hz, 1H),
7.78 (d, J = 2.0 Hz, 1H), 3.89-3.86 (m, 1H), 1.21 – 1.13 (m, 2H), 1.04 (t, J
= 6.4 Hz, 2H). 13C NMR (100 MHz, DMSO-d6) δ 171.2, 165.9, 148.0, 140.2,
126.1, 112.8, 40.1, 6.6. HRMS-APCI (+) m/z calculated for C9H10NO4
196.0610 [M+H], found: 196.0614.
complementary
ssDNA
(5’-
tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcg
a) was labeled with biotin at 5’ end. Equal moles of ssDNAs were
mixed and annealed to obtain the 60-bp dsDNA substrate.
Purified pUL89-C (final concentration 2 μM) was incubated with
10 ng of dsDNA in a reaction buffer (3mM MnCl2, 30 mM Tris pH
8 and 50 mM NaCl) for 1 h at 37 °C. Compounds were
preincubated with pUL89-C and reaction buffer for 15 min. To
start the reaction, dsDNA substrate was added and the reaction
incubated for 1 h at 37 °C. The reaction was terminated by adding
EDTA (final concentration 30 mM). The samples were transferred
to streptavidin coated plates (Pierce Biotechnology, Rockford, IL),
incubated with gentle shaking at room temperature for 30 min and
washed three times with 200 µL of wash buffer (25mM Tris,
150mM NaCl, 0.1% BSA, and 0.05% Tween-20; pH 7.2). One
hundred µL of the anti-DIG- alkaline phosphatase (AP) conjugate
(Roche Applied Sciences, Germany) was added to each well for
30 min at room temperature, washed three times with 200 µL of
wash buffer, incubated with 100 µL of p-nitrophenylphosphate
(pNPP), Sigma-Aldrich, Saint Louis, MO) for 30 min and the
absorbance determined at 405 nm.
1-(3-Bromobenzyl)-5-hydroxy-4-oxo-1,4-dihydropyridine-3-carboxylic acid
(7k).
1H NMR (600 MHz, DMSO-d6) δ 10.08 (s, 1H), 8.71 (s, 1H), 7.87 (d, J =
1.0 Hz, 1H), 7.72 (s, 1H), 7.58 (d, J = 7.8 Hz, 1H), 7.43 (d, J = 7.5 Hz, 1H),
7.37 (t, J = 7.8 Hz, 1H), 5.33 (s, 2H). 13C NMR (150 MHz, DMSO-d6) 171.2,
166.2, 148.7, 140.4, 138.3, 131.7, 131.3, 131.2, 127.4, 125.7, 122.2, 113.4,
59.3. HRMS-APCI (+) m/z calculated for C13H11BrNO4 323.9866 [M+H],
found: 323.9865.
1-((4'-(Aminomethyl)-[1,1'-biphenyl]-3-yl)methyl)-5-hydroxy-4-oxo-1,4-
dihydropyridine-3-carboxylic acid (7aa).
1H NMR (600 MHz, DMSO-d6) δ 10.09 (s, 1H), 8.74 (s, 1H), 8.21 (s, 3H),
7.93 (s, 1H), 7.82-7.70 (m, 4H), 7.56 (d, J = 6.4 Hz, 2H), 7.52-7.44 (m, 2H),
5.40 (s, 2H), 4.09 (s, 2H). 13C NMR (150 MHz, DMSO-d6) δ 171.3, 166.4,
158.0, 148.8, 140.5, 140.4, 140.3, 139.9, 136.6, 133.8, 129.9, 129.7, 127.2,
113.5, 98.6, 65.2, 42.5. HRMS-APCI (+) m/z calculated for C20H19N2O4
351.1339 [M+H], found: 351.1349.
HCMV replication assay
5-Hydroxy-1-((4'-(methylsulfonamidomethyl)-[1,1'-biphenyl]-4-yl)methyl)-
HFF cells (ATCC CRL-2088) were plated in white-bottom 96-well
tissue culture plates at approximately 3.6 x 104 cells/well and the
next day inoculated with ADCREGFP virus (obtained from Wade
Bresnahan, University of Minnesota) at a MOI of 0.001 in DMEM
containing 5% fetal bovine serum for 2 h. The inoculated cells
were washed with phosphate-buffered saline (PBS) and
incubated with 100 μl of DMEM containing 5% fetal bovine serum
with test compounds or DMSO at 37°C and 5% CO2 for 144 h.
After 144 hours, the infected cells were lysed to measure GFP
fluorescence as an indication of the extent of virus replication. For
lysis, 200 μl of lysis buffer (25 mM Tris [pH 7.8], 2 mM dithiothreitol
[DTT], 2 mM trans-1,2-diaminocyclohexane-N,N,N′,N′-tetraacetic
acid, 1% Triton X-100, 10% glycerol) was added to each well and
incubated for 10 min at 37°C, followed by a 30 min incubation at
room temperature on a shaker. GFP relative fluorescence units
4-oxo-1,4-dihydropyridine-3-carboxylic acid (7bb).
1H NMR (600 MHz, DMSO-d6) δ 10.08 (s, 1H), 8.72 (s, 1H), 7.88 (s, 1H),
7.71 (d, J = 7.5 Hz, 2H), 7.66 (d, J = 7.5 Hz, 2H), 7.58 (s, 1H), 7.51 (d, J =
7.6 Hz, 2H), 7.43 (d, J = 7.6 Hz, 2H), 5.39 (s, 2H), 4.19 (d, J = 6.0 Hz, 2H),
2.88 (s, 3H). 13C NMR (150 MHz, DMSO-d6) δ 171.1, 166.2, 148.7, 140.2,
138.4, 138.0, 134.9, 129.0, 128.4, 127.3, 126.8, 125.8, 113.4, 109.7, 59.9,
45.8, 40.2. HRMS-APCI (+) m/z calculated for C21H21N2O6S 429.1115
[M+H], found: 429.1123.
5-Hydroxy-1-((3'-(methylsulfonamidomethyl)-[1,1'-biphenyl]-4-yl)methyl)-
4-oxo-1,4-dihydropyridine-3-carboxylic acid (7cc).
1H NMR (600 MHz, DMSO-d6) δ 10.08 (s, 1H), 8.72 (s, 1H), 7.88 (s, 1H),
7.70 (d, J = 8.0 Hz, 2H), 7.64 (s, 1H), 7.62 – 7.56 (m, 2H), 7.53 (d, J = 8.0
Hz, 2H), 7.45 (t, J = 7.7 Hz, 1H), 7.36 (d, J = 7.3 Hz, 1H), 5.40 (s, 2H), 4.23
(d, J = 6.2 Hz, 2H), 2.87 (s, 3H). 13C NMR (150 MHz, DMSO-d6) δ 171.0,
166.1, 148.6, 140.3, 140.1, 139.5, 139.0, 134.8, 129.0, 128.8, 127.3, 127.0,
126.1, 125.7, 125.61, 113.2, 59.7, 46.1, 40.1. HRMS-APCI (+) m/z
calculated for C21H21N2O6S 429.1115 [M+H], found: 429.1119.
were determined at excitation/emission 495/515 nm in
Molecular Devices M5e plate reader.
a
6
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800283
ChemMedChem
FULL PAPER
Cell Viability Assay
[1]
S. A. S. Staras, S. C. Dollard, K. W. Radford, W. D.
Flanders, R. F. Pass, M. J. Cannon, Clin. Infect. Dis. 2006,
43, 1143-1151.
P. M. J. Beltran, I. M. Cristea, Expert Rev. Proteomic.
2014, 11, 697-711.
C. C. Morton, W. E. Nance, New Engl. J. Med. 2006, 354,
HFF cells were plated into 96-well plates at 3.6 × 104 cells/well
and the next day incubated in different compound doses at 37oC
for 144 h. Cellular viability was determined using the MTS-based
tetrazolium reduction assay CellTiter 96 Aqueous Non-
Radioactive cell proliferation assay (Promega) as per
manufacturer’s instructions. Compound doses were evaluated in
triplicate and mean values of triplicate wells were determined and
compared to the mean value for the wells that received DMSO
alone. The CC50 was determined by comparing cell viability for
eight serial dilutions of the compound and DMSO-treated cells
using GraphPad Prism software. The CC50 value was defined as
the compound concentration resulting in a 50% reduction in
viability compared with the DMSO.
[2]
[3]
[4]
[5]
2151-2164.
G. Harter, D. Michel, Expert Opin. Pharmacother. 2012,
13, 623-627.
A. Schreiber, G. Harter, A. Schubert, D. Bunjes, T.
Mertens, D. Michel, Expert Opin. Pharmacother. 2009, 10,
191-209.
S. S. Sigamani, H. Y. Zhao, Y. N. Kamau, J. D. Baines, L.
Tang, J. Virol. 2013, 87, 7140-7148.
P. Ostapchuk, M. Almond, P. Hearing, J. Virol. 2011, 85,
5524-5531.
S. Sun, S. Gao, K. Kondabagil, Y. Xiang, M. G.
Rossmann, V. B. Rao, Proc. Natl. Acad. Sci. U.S.A. 2012,
109, 817-822.
[6]
[7]
[8]
Modeling and docking analysis
[9]
E. Bogner, Rev. Med. Virol. 2002, 12, 115-127.
[10]
Molecular modeling was performed using the Schrödinger small
molecule drug discovery suite 2014-3.[31] The crystal structure of
human cytomegalovirus terminase nuclease domain was
reported by Nadal et.al (pdb code: 3N4Q).[15, 30] It reveals (a) two
metal ions (Mn2+) in the active site and its requirement for the
catalytic function of pUL89. The docking protocol involves several
steps which includes a) Protein preparation: Protein preparation
wizard (Schrꢀdinger Inc.)[31-32] was used in which missing
hydrogen atoms were added, zero-order bonds to metals were
created followed by the generation of metal binding states. The
structure of protein was minimized using OPLS 2005 force field[33]
to optimize hydrogen bonding network and converge heavy atoms
to an rmsd of 0.3 Å. b) Ligand preparation involving applying
protonation and tautomeric states to the compound library.
Compounds were drawn using Maestro and subjected to Lig
Prep[34] to generate conformers, possible protonation at pH of 7 ±
3, and metal binding states that serve as an input for docking
process. c) Grid generation: creating a grid around the metal ions
(Mn2+) in the catalytic site to cover all the residues within 12 Å
from it with both the metal cofactors (Mn2+) as a constraint to
identify the chelating triad during docking and d) Docking of
compound library to the prepared protein of interest. All the
dockings were performed using Glide XP (Glide, version 6.4)[27-29]
mode with both the Mn2+ metal cofactors as a constraint. The van
der Waals radii of nonpolar atoms for each of the ligands were
scaled by a factor of 0.8. All the ligands within the active site of
HCMV were further refined post docking by minimizing under
implicit solvent to account for the local protein flexibility.
https://www.accessdata.fda.gov/drugsatfda_docs/label/2
017/209939Orig1s000,209940Orig1s000lbl.pdf
G. Ligat, R. Cazal, S. Hantz, S. Alain, FEMS Microbiol.
Rev. 2018, 42, 137-145.
T. Goldner, G. Hewlett, N. Ettischer, H. Ruebsamen-
Schaeff, H. Zimmermann, P. Lischka, J. Virol. 2011, 85,
10884-10893.
M. R. Underwood, R. J. Harvey, S. C. Stanat, M. L.
Hemphill, T. Miller, J. C. Drach, L. B. Townsend, K. K.
Biron, J. Virol. 1998, 72, 717-725.
J. Reefschlaeger, W. Bender, S. Hallenberger, O. Weber,
P. Eckenberg, S. Goldmann, M. Haerter, I. Buerger, J.
Trappe, J. A. Herrington, D. Haebich, H. Ruebsamen-
Waigmann, J. Antimicrob. Chemother. 2001, 48, 757-767.
M. Nadal, P. J. Mas, A. G. Blanco, C. Arnan, M. Sola, D. J.
Hart, M. Coll, Proc. Natl. Acad. Sci. U.S.A. 2010, 107,
16078-16083.
J. Kankanala, K. A. Kirby, F. Liu, L. Miller, E. Nagy, D. J.
Wilson, M. A. Parniak, S. G. Sarafianos, Z. Q. Wang, J.
Med. Chem. 2016, 59, 5051-5062.
S. K. V. Vernekar, J. Tang, B. Wu, A. D. Huber, M. C.
Casey, N. Myshakina, D. J. Wilson, J. Kankanala, K. A.
Kirby, M. A. Parniak, S. G. Sarafianos, Z. Wang, J. Med.
Chem. 2017, 60, 5045-5056.
B. L. Wu, J. Tang, D. J. Wilson, A. D. Huber, M. C. Casey,
J. Ji, J. Kankanala, J. S. Xie, S. G. Sarafianos, Z. Q.
Wang, J. Med. Chem. 2016, 59, 6136-6148.
J. Tang, F. Liu, E. Nagy, L. Miller, K. A. Kirby, D. J.
Wilson, B. L. Wu, S. G. Sarafianos, M. A. Parniak, Z.
Wang, J. Med. Chem. 2016, 59, 2648-2659.
J. Tang, K. Maddali, M. Metifiot, Y. Y. Sham, R. Vince, Y.
Pommier, Z. Q. Wang, J. Med. Chem. 2011, 54, 2282-
2292.
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
[21]
J. Tang, K. Maddali, C. D. Dreis, Y. Y. Sham, R. Vince, Y.
Pommier, Z. Q. Wang, ACS Med. Chem. Lett. 2011, 2, 63-
67.
[22]
[23]
Z. Q. Wang, E. M. Bennett, D. J. Wilson, C. Salomon, R.
Vince, J. Med. Chem. 2007, 50, 3416-3419.
J. Kankanala, K. A. Kirby, A. D. Huber, M. C. Casey, D. J.
Wilson, S. G. Sarafianos, Z. Wang, Eur. J. Med. Chem.
2017, 141, 149-161.
Acknowledgements
This research was supported by the Research Development and
Seed Grant Program of the Center for Drug Design, University of
Minnesota.
[24]
Y. Wang, L. Mao, J. Kankanala, Z. Wang, R. J. Geraghty,
J. Virol. 2017, 91.
[25]
[26]
M. Nowotny, Embo Rep. 2009, 10, 144-151.
S. R. Cantrell, W. A. Bresnahan, J. Virol. 2005, 79, 7792-
7802.
Small-Molecule Drug Discovery Suite 2014-3: Glide,
version 6.4; Schrꢀdinger, LLC: New York, 2014.
R. A. Friesner, J. L. Banks, R. B. Murphy, T. A. Halgren, J.
J. Klicic, D. T. Mainz, M. P. Repasky, E. H. Knoll, M.
Shelley, J. K. Perry, D. E. Shaw, P. Francis, P. S.
Shenkin, J. Med. Chem. 2004, 47, 1739-1749.
Keywords: Human cytomegalovirus • Terminase complex •
Endonuclease • Hydroxypyridone carboxylic acid • Structure-
activity relationship
[27]
[28]
References
7
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800283
ChemMedChem
FULL PAPER
[29]
[30]
[31]
R. A. Friesner, R. B. Murphy, M. P. Repasky, L. L. Frye, J.
R. Greenwood, T. A. Halgren, P. C. Sanschagrin, D. T.
Mainz, J. Med. Chem. 2006, 49, 6177-6196.
https://www.rcsb.org/pdb/explore/explore.do?structureId
=3N4Q
Schrödinger Release 2014-3: Schrödinger Suite 2014-3.
(a) Protein Preparation Wizard. (b) Epik version 2.9;
Schrödinger, LLC: New York, NY, 2014. (c) Impact version
6.4; Schrödinger, LLC: New York, NY, 2014. (d) Prime
version 3.7; Schrödinger, LLC: New York, NY, 2014.
G. M. Sastry, M. Adzhigirey, T. Day, R. Annabhimoju, W.
Sherman, J. Comput. Aided Mol. Des. 2013, 27, 221-234.
W. L. Jorgensen, D. S. Maxwell, J. TiradoRives, J. Am.
Chem. Soc. 1996, 118, 11225-11236.
[32]
[33]
[34]
Schrödinger Release 2014-3: LigPrep, version 3.1,
Schrödinger, LLC, New York, NY, 2014.
8
This article is protected by copyright. All rights reserved.

10.1002/cmdc.201800283
ChemMedChem
FULL PAPER
Entry for the Table of Contents
HPCA analogues. In our previous study, a hydroxypyridonecarboxylic acid (HPCA) analogue was characterized as the first inhibitor
of HCMV pUL89-C. Herein we describe the structure−activity relationship (SAR) of the HPCA chemotype concerning mainly the
carboxylic acid functionality and the N-1 site. The SAR studies identified numerous analogues inhibiting both pUL89-C and HCMV in
low micromolar range with no observed cytotoxicity up to 200 µM. These results confirm HPCA as the first viable inhibitor type of HCMV
pUL89-C and lay a solid medicinal chemistry foundation for further HCMV drug discovery efforts targeting pUL89-C.
9
This article is protected by copyright. All rights reserved.