Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype

Article

Development of a Selective CDK7 Covalent Inhibitor

Reveals Predominant Cell-Cycle Phenotype

Graphical Abstract

Authors

Calla M. Olson, Yanke Liang,

Alan Leggett, ..., Charles Y. Lin,

Nicholas Kwiatkowski,

Nathanael S. Gray

Correspondence

nicholasp_kwiatkowski@

dfci.harvard.edu (N.K.),

nathanael_gray@

dfci.harvard.edu (N.S.G.)

In Brief

Olson et al. describe the development

and characterization of YKL-5-124, a

potent, selective, and covalent CDK7

inhibitor. YKL-5-124 displays

biochemical and cellular selectivity for

CDK7 over CDK12/13, structurally related

kinases. CDK7 inhibition by YKL-5-124

induces a strong cell-cycle arrest and a

surprisingly weak effect on RNA Pol II

phosphorylation.

Highlights

d

Development of YKL-5-124 a potent, selective and covalent

CDK7 inhibitor

Selective CDK7 inhibition results in cell-cycle inhibition rather

than apoptosis

YKL-5-124 exhibited little effect on RNA polymerase II

phosphorylation status

Olson et al., 2019, Cell Chemical Biology 26, 1–12

June 20, 2019 ª 2019 Elsevier Ltd.

https://doi.org/10.1016/j.chembiol.2019.02.012

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

Cell Chemical Biology

Article

Development of a Selective CDK7 Covalent Inhibitor

Reveals Predominant Cell-Cycle Phenotype

Calla M. Olson,¹

,2,3,4,12

Yanke Liang,

1,2,12

Alan Leggett, Woojun D. Park, Lianbo Li, Caitlin E. Mills, Selma Z. Elsarrag,

1,2

5

6

7

5

1

,2,8

1,2

9

10,11

1,2,8

Scott B. Ficarro,

Tinghu Zhang, Robert D u€ ster, Matthias Geyer, Taebo Sim,

Jarrod A. Marto,

7

6

3,4,5

Nicholas Kwiatkowski, * and Nathanael S. Gray¹^,²^,¹³^,*

1,2,

Peter K. Sorger, Ken D. Westover, Charles Y. Lin,

1

Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02215, USA

²Department of Biology Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02215, USA

³Therapeutic Innovation Center (THINC@BCM), Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA

⁴Verna & Marrs McLean Department of Biochemistry & Molecular Biology, Baylor College of Medicine, One Baylor Plaza, Houston,

TX 77030, USA

⁵Department of Molecular & Human Genetics, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA

⁶Departments of Biochemistry and Radiation Oncology, The University of Texas Southwestern Medical Center at Dallas, Dallas,

TX 75390, USA

⁷Laboratory of Systems Pharmacology, Harvard Medical School, Boston MA 02115, USA

⁸Blais Proteomics Center, Dana-Farber Cancer Institute, Boston, MA 02115, USA

⁹Institute of Structural Biology, University of Bonn, Sigmund-Freud-Strasse 25, 53127 Bonn, Germany

¹⁰Chemical Kinomics Research Center, Korea Institute of Science and Technology (KIST), Seoul 02792, Korea

¹¹KU-KIST Graduate School of Converging Science and Technology, Korea University, Seoul 136-701, Korea

¹²These authors contributed equally

¹³Lead Contact

*Correspondence: nicholasp_kwiatkowski@dfci.harvard.edu (N.K.), nathanael_gray@dfci.harvard.edu (N.S.G.)

https://doi.org/10.1016/j.chembiol.2019.02.012

SUMMARY

1994; Devault et al., 1995; Glover-Cutter et al., 2009; Kelso

et al., 2014). In the cytoplasm, CDK7 comprises the enzymatic

Cyclin-dependent kinase 7 (CDK7) regulates both cell core of the CDK-activating kinase (CAK), a trimeric complex

cycle and transcription, but its precise role remains that also includes CDK7’s obligate binding partners, cyclin H

and MAT1. CAK phosphorylates key cell-cycle CDKs (1, 2, and

elusive. We previously described THZ1, a CDK7 inhib-

4

) leading to their full activation (Larochelle et al., 2007, 2012;

Schachter et al., 2013; Bisteau et al., 2013; Gerber et al.,

008). Activation of CDKs by CAK plays an essential role in con-

itor, which dramatically inhibits superenhancer-asso-

ciated gene expression. However, potent CDK12/13

off-target activity obscured CDK7s contribution to

this phenotype. Here, we describe the discovery of

a highly selective covalent CDK7 inhibitor. YKL-5-

2

trol over cell-cycle progression: (1) activation of CDK4 results in

the phosphorylation of retinoblastoma protein and consequent

G

1

progression (Sherr and Roberts, 1999), (2) CDK2 activation

promotes progression from G₁into S phase (Furuno et al.,

999; Satyanarayana and Kaldis, 2009), and (3) phosphorylation

1

24 causes arrest at the G /S transition and inhibi-

1

tion of E2F-driven gene expression; these effects

1

are rescued by a CDK7 mutant unable to covalently of CDK1 positively regulates the G /M transition. These results

2

engage YKL-5-124, demonstrating on-target speci- have been demonstrated both genetically and through the use

ﬁcity. Unlike THZ1, treatment with YKL-5-124 resulted of the ‘‘bumped hole’’ chemical genetic approach, which has

enabled selective inhibition of a genetically engineered CDK7

mutant that is sensitive to a bulky ATP-like inhibitor (Larochelle

in no change to RNA polymerase II C-terminal domain

phosphorylation; however, inhibition could be recon-

stituted by combining YKL-5-124 and THZ531, a se-

lective CDK12/13 inhibitor, revealing potential redun-

et al., 2007). The predominant cell-cycle phenotype caused

by inhibition of CDK7 (and the kinases that depend on CDK7

1 2

for activity) is accumulation of G or G /M cells and a concomi-

dancies in CDK control of gene transcription. These

ﬁndings highlight the importance of CDK7/12/13

polypharmacology for anti-cancer activity of THZ1

and posit that selective inhibition of CDK7 may

be useful for treatment of cancers marked by E2F mis-

regulation.

tant reduction in the number of S-phase cells (Larochelle et al.,

2

007; Ali et al., 2009; Wang et al., 2016; Kwiatkowski et al.,

014), showing that cell proliferation requires CDK7 kinase

activity.

In the nucleus, the CAK module is a component of the general

transcription factor, TFIIH, a multi-protein complex that is essen-

tial for RNA polymerase II (Pol II)-mediated transcription (Adamc-

zewski et al., 1996; Glover-Cutter et al., 2009; Serizawa et al.,

1995; Shiekhattar et al., 1995; Chen et al., 2015; Feaver et al.,

INTRODUCTION

1994). Phosphorylation of the Pol II C-terminal domain (CTD) at

Cyclin-dependent kinase 7 (CDK7) is a master regulator of cell- S2/S5/S7 residues is tightly regulated as a means to coordinate

cycle progression and gene transcription (Fisher and Morgan, transcription initiation, elongation, and termination (Buratowski,

Cell Chemical Biology 26, 1–12, June 20, 2019 ª 2019 Elsevier Ltd.

1

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

A

B

C

D

E

Figure 1. Biochemical Characterization of YKL-5-124

(

A) Chemical structures of THZ1, THZ531, YKL-1-116, YKL-5-124, and YKL-5-167.

B) Analysis of time- and dose-dependent inhibition of CDK7/CycH/MAT1 enzymatic activity by YKL-05-124 or THZ1 reveals a leftward shift in IC50 values over

time. Kinetics parameters of enzyme inactivation were obtained using nonlinear least-squares regression. Error bars represent the standard deviation (SD) for

duplicate measurements.

(

legend continued on next page)

2

Cell Chemical Biology 26, 1–12, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

2

009; Egloff and Murphy, 2008). However, the conclusion that cell-based assays to validate a covalent mode of CDK7 inhibition

CDK7 kinase activity is required for Pol II CTD phosphorylation, by YKL-5-124 involving C312 modiﬁcation and determined the

and thus global gene transcription has been controversial. compound’s selectivity proﬁle. We also employed YKL-5-124

Several reports ﬁnd that CDK7 is non-essential in transcription as a tool compound to investigate the functions of CDK7 in regu-

both in vivo and in vitro (Kanin et al., 2007; Glover-Cutter et al., lating cell-cycle progression and gene transcription. Our data

2

009; Serizawa et al., 1993). In contrast, other reports show conﬁrm the reported CAK activities of CDK7 in regulating cell-

that CDK7 inhibition reduces serine (S5 and S7) phosphorylation cycle progression, but suggest a non-essential role for CDK7

across the 52 heptad repeats constituting the Pol II CTD (Kwiat- in regulating Pol II CTD phosphorylation and global basal gene

kowski et al., 2014; Akhtar et al., 2009; Glover-Cutter et al., 2009) expression.

with a concurrent reduction in global basal transcription (Kwiat-

kowski et al., 2014; Kelso et al., 2014; Poss et al., 2016); howev- RESULTS

er, these experiments were mostly conducted using in vitro

biochemical assays or with less selective chemical probes. YKL-5-124 Covalently Targets CDK7

Consistent with its role in transcription, CDK7 is also implicated Our initial efforts to develop a selective CDK7 inhibitor using

in mRNA processing through the recruitment of capping en- THZ1 (Figure 1A) as a lead compound were not productive. We

zymes, transcription activation through regulating the deposition turned our attention to PF-3758309, a PAK4 inhibitor (Murray

of histone marks associated with active transcription, pause in- et al., 2010), since molecules from the series of compounds

duction (Nilson et al., 2015, Ebmeier et al., 2017, Glover-Cutter that gave rise to PF-3758309 are reported to have strong

et al., 2009), and pause release through phosphorylation of CDK7 inhibitory activity (Rudolph et al., 2015). We envisioned

CDK9, the kinase subunit of the elongation complex pTEFb that the hybridization of the covalent warhead from THZ1 and

(

Shiekhattar et al., 1995; Serizawa et al., 1995; Marshall et al., the pyrrolidinopyrazole core from PF-3758309 could lead to

996). Together these results suggest a role for CDK7 in gene more selective CDK7 inhibitors. The ﬁrst compound in the new

1

transcription; however, it remains unclear how CDK7 kinase ac- series, YKL-1-116 (Figure 1A) (Kalan et al., 2017), showed

tivity ultimately affects steady-state mRNA levels (Marshall et al., good selectivity for CDK7 but only moderate potency, and had

1

996; Rodr ı´ guez-Molina et al., 2016; Larochelle et al., 2012).

minimal anti-proliferative effects on cancer cell lines (Kalan

Although the ‘‘bumped hole’’ approach to kinase inhibition has et al., 2017). Further iterative optimization has focused on tuning

yielded key insights into CDK7’s biological role, this approach the acidity of the aminopyrazole core, gaining additional hydro-

requires engineering mammalian cell lines and is difﬁcult to use phobic interactions with the side-chain residue, and optimizing

broadly; it also does not provide a route to developing new the length and trajectory of the covalent warhead that targets

drugs. Selective small molecules capable of selective inhibition C312. This focused medicinal chemistry campaign yielded

of endogenous CDK7 are therefore required to further delineate YKL-5-124, a potent and selective covalent CDK7 inhibitor,

CDK7 activities in cell-cycle progression and transcription. Pre- and YKL-5-167, an inactive analog lacking the acrylamide reac-

viously, we reported the discovery of THZ1, a small-molecule tive center and therefore incapable of forming a covalent bond

kinase inhibitor that targets CDK7 by covalently labeling a with CDK7- C312 (Figure 1A).

cysteine (C312) that lies in the CTD of CDK7 and is remote

Biochemical evaluation of YKL-5-124 using a ﬁxed time-point,

from the active site (Kwiatkowski et al., 2014). We also found in vitro kinase assay indicated that YKL-5-124 inhibited CDK7/

that THZ1 inhibited CDK12/13 via the same covalent mechanism Mat1/CycH with an IC50 of 9.7 nM, while the other CDKs tested

of action (Kwiatkowski et al., 2014; Zhang et al., 2016). To sepa- biochemically, CDK2 and CDK9, had IC50 values of 1,300 nM

rate these activities, we sought chemical probe molecules with a and 3,020 nM, respectively. To more precisely assay the contri-

narrower selectivity proﬁle. This has yielded THZ531, a derivative bution of covalent bond formation to compound inhibitory activ-

i

of THZ1 with the same phenylaminopyrimidine core scaffold, ity, we measured kinact/K using a kinetic assay that monitors the

which inhibits CDK12/13 approximately 20 times more potently shift in the electrophoretic mobility of a CDK7 peptide substrate

than CDK7 (Zhang et al., 2016; Gao et al., 2018). However, ef- following incubation with YKL-5-124 (Blackwell et al., 2009; Tan

forts to generate a CDK7-selective inhibitor using the THZ1 scaf- et al., 2017). YKL-5-124 and THZ1 displayed similar k

fold have not been successful. (1.9 nM and 2.1 nM, respectively) showing that they achieved

Here, we describe the development and mechanistic valida- nearly equivalent inhibition of CDK7 (Figures 1B, S1A, and

i

values

ꢀ

1

tion of a selective, covalent CDK7 inhibitor, YKL-5-124, based S1B). However, YKL-5-124 exhibited a faster kinact of 103 ms

ꢀ

1

ꢀ1

on a previously unexplored CDK-targeting scaffold that origi- nM as compared with kinact of 9 ms nM for of THZ1, demon-

nates from the PAK4 inhibitor PF-3758309 (Murray et al., strating that YKL-5-124 covalently modiﬁes CDK7 approximately

010). We performed a series of structured biochemical and 11-fold faster than THZ1 (Figures 1B, S1A, and S1B).

2

(C) Left: docking model of YKL-5-124 in the ATP-binding site of CDK7. CDK7 is shown as blue ribbons with key residues highlighted in yellow and YKL-5-124 is

modeled as a green structure. Expansion of the box on the left is shown to the right, and key residues that make contact with YKL-5-124 are labeled and

highlighted.

(D) Efﬁciency of labeling was estimated to be approximately 99% gauged by the reduction in signal of triply and quadruply charged

YFSNRPGPTPGCQLPRPNCPVETLK ions (residues 294–318). The peptides VPFLPGDSDLDQLTR (residues 180–194) and LDFLGEGQFATVYK (residues 15–28)

were used for normalization.

(E) In vitro kinase assays of exogenous tagged CDK7 protein immunoprecipitated with FLAG antibody after HeLa cells were treated with YKL-5-124 or YKL-5-167

as indicated. WT, wild-type; C312S, C312 to serine mutation.

Cell Chemical Biology 26, 1–12, June 20, 2019

3

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

Figure 2. Cellular Engagement of CDK7 by

A

YKL-5-124

A) In vitro biochemical dose curves of CDK7,

(

CDK12, and CDK13, with YKL-5-124 (left) and

THZ1 (right) treatments. Error bars represent SD of

triplicate experiments.

(

B) Competitive pull-down assays in HAP1 cells

treated with a concentration course of THZ1, YKL-

-124, or YKL-5-167 for 6 h. Western blots showthe

pull-down or input of CDK7, cyclin H, and cyclin K.

C) Competitive pull-down assays in HAP1 cells

treated for 6 h with a concentration course of YKL-

5

B

(

5

3

-124 or YKL-5-167 with or without washout after

-h treatment.

(

D) Competitive pull-down assays in HAP1 cells

treatedwithDMSO, THZ1, orYKL-5-124forthe time

indicated before lysing and treating with bioTHZ1 to

pull down all available CDK7. PD, pull-down.

(

E) KiNativ target engagement kinase tree showing

kinases engaged over 65% with 1 mM YKL-5-124

treatment (left) or YKL-5-167 treatment (right) in

Jurkat cells.

C

See also Table S1.

two additional contacts with CDK7 at K41

and Q141, which may contribute to bind-

ing afﬁnity and potency (Figure 1C). Mass

spectrometry analysis of recombinant

CDK7-cyclin H-MAT1 trimeric complex

incubated with YKL-5-124 demonstrated

covalent labeling of CDK7 with an efﬁ-

ciency of ꢁ99% (Figures 1D, S1C, and

S1D) and capillary electrophoresis-mass

spectrometry (CE-MS) conﬁrmed the

site of labeling to be C312 (Figure S1E).

To determine whether YKL-5-124 is

capable of inhibiting CDK7 in cells, we

immunoprecipitated HeLa cells with

wild-type (WT) or engineered CDK7 with

the C312S mutation from vehicle- or

YKL-5-124-treated cells and subjected

the precipitates to in vitro kinase assays.

YKL-5-124 blocked the in vitro phosphor-

ylation of RNA Pol II substrate by immu-

nopuriﬁed CDK7 at concentrations as

low as 62.5 nM, whereas the reversible

YKL-5-167 analog demonstrated little or

no inhibition of phosphorylation at 10 mM

D

E

(Figure 1E). Mutation of the reactive

cysteine to a less nucleophilic serine

Molecular docking studies place the reactive acrylamide of (C312S) abolished the inhibitory activity of YKL-5-124 in the

YKL-5-124 near residue CDK7-C312, the same cysteine tar- in vitro kinase assay (Figure 1E). Taken together, these data

geted by THZ1 (Figure 1C). These docking results are conﬁrmed show that YKL-5-124 is a nanomolar covalent inhibitor that

by X-ray structures of kinases other than CDK7 complexed with targets C312 on CDK7 with faster kinetics than THZ1 and 100-

inhibitors containing a tetrahydropyrrolopyrazole core such as fold greater selectivity for CDK7 than CDK9 and CDK2.

maternal embryonic leucine zipper kinase (MELK, PDB: 5MAG

and 4BKY) and serine/threonine-protein kinase PAK 4 (4APP) YKL-5-124 Speciﬁcally Targets CDK7

wherein the same binding mode is observed (Klaeger et al., To conﬁrm that YKL-5-124 does not inhibit CDKs 12 and 13, we

2

017; Canevari et al., 2013; Guo et al., 2012). The docking results performed in vitro kinase reactions with CDK7, CDK12, and

additionally highlighted the possibility that YKL-5-124 can make CDK13 at an ATP concentration of 1 mM (Figure 2A). We found

4

Cell Chemical Biology 26, 1–12, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

A

B

DMSO

YKL-5-124 2uM

YKL-5-124

pCDK1

tCDK1

pCDK2

tCDK2

pCDK1

tCDK1

%

Signal 100 35 43 65 77 70 86

100 80 116 108 115 116 102

100 95 104 98 107 117 110

pCDK2

tCDK2

PARP

%

Signal 100 70 84 86 89 80 87

Tubulin

PARP

Tubulin

WT

CDK7

C312S

WT

CDK7

C312S

WT

CDK7

C312S

C

YKL-5-124 Hap1 WT

YKL-5-167 Hap1 WT

THZ1 Hap1 WT

1

.0

.5

.0

1

.0

1.0

G1

S

G2

M

S dropout

other

0

0.5

0.0

0.5

0.0

0

7

0

3

0

00 0⁰²0⁰⁷0²⁰0⁶³2⁰⁰

00

3

0⁰⁰

0

02

0

63

0

3

0

6

0

33

0

02

07

20

63

0

33

3

00

0

.0⁰².0

0

2

6

3

0

0.⁰0.0 0.0 0.0 0.0 0.0 0.⁰0.²0.⁶2.⁰

.0⁰.0

0

2

6

.2⁰.6 ₂.00

.

0

.0

.0 ₀.20 .6

.0

.0 ₀.00 .0

.0

0

2

0

Dose (μM)

YKL-5-124 Hap1 C312S

Dose (μM)

THZ1 Hap1 C312S

YKL-5-167 Hap1 C312S

D

1

0

.0

.5

.0

1.0

0.5

0.0

1.0

0.5

0.0

2

7

0

3

0

3

0

7

0

3

0

2

7

0

3

0

3

0

2

6

0

3

0

02

0

20

63

00

3

0

2

6

0

00

3

0

00

0

.0².0

6

0

3

.0⁰⁰

.0⁰.0⁰₀.00 .0 ₀.00 .0²₀.06 .2⁰⁰ .6³ .0

0

.0⁰⁰.0⁰⁰₀.00₀.00 .0

0

2

.0⁶.2⁰⁰ .6³ .0

0

.

00 .0

.0

.2

.6

.0

0

2

0

2

0

2

Dose (μM)

YKL-5-124

Dose (μM)

THZ1

YKL-5-167

E

1

0

.00

.75

.50

.25

.00

1.00

0.75

0.50

0.25

0.00

-0.25

WT

C312S

0.75

0.50

0.25

0.00

-0.25

-3

-2

-1

0

1

-3

-2

-1

0

1

-3

-2

-1

0

1

-0.25

Dose (μM)

F

0

.3

.2

.1

.0

YKL-5-124

0.3

0.2

0.1

0.0

YKL-5-167

0.3

0.2

0.1

0.0

THZ1

-4

-3

-2

-1

0

1

-4

-3

-2

-1

0

1

-4

-3

-2

-1

0

1

Dose (μM)

(

legend on next page)

Cell Chemical Biology 26, 1–12, June 20, 2019

5

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

that YKL-5-124 had an IC50 of 53.5 nM for CDK7, yet displayed cell lines expressing either WT or CDK7-C312S (Figure S2D)

no inhibition of CDK12 or CDK13 at the concentrations tested. In and then used bioTHZ1 to perform pull-down experiments

comparison, we found that THZ1 was equipotent on CDKs 7, 12, from cell extracts. We found that the C312S mutation prevented

and 13. To determine the cellular selectivity of YKL-5-124 for binding of CDK7-cyclin H to beads but had no effect on binding

CDK7 versus CDK12/13, we used HAP1 and Jurkat cells. by CDK12/13-CycK (Figure S2E). Collectively, these data

HAP1 is a near-haploid human cell line derived from the male show that YKL-5-124 is a CDK7-selective agent, and provide

chronic myelogenous leukemia (CML) cell line KBM-7; Jurkat is additional support for the C312-dependent covalent mode of

a human T lymphocyte cell line previously used to characterize binding.

THZ1 (Essletzbichler et al., 2014; Andersson et al., 1995; Kwiat-

kowski et al., 2014). Lysates from cells treated with increasing YKL-5-124 Disrupts Cell-Cycle Progression through

concentrations of THZ1, YKL-5-124, or YKL-5-167 were treated Inhibition of CDK7 CAK Activity

with biotinylated THZ1 (bioTHZ1) to afﬁnity purify CDK com- CDK7 functions as the CAK for several CDKs, including CDK1

plexes, which were then analyzed by western blotting using and CDK2, activating them by phosphorylating key threonine

antibodies against CDK7, CycH, and CycK, the obligate binding residues in the T loops of each kinase (Larochelle et al., 2007;

partner of CDK12/13. THZ1 bound to both CDK7 and CDK12/13 Gerber et al., 2008). We therefore examined the effect of

based on its ability to block pull-down of all three proteins (Fig- exposing HAP1 cells for 24 h to 125 nM to 2 mM YKL-5-124 or

ures 2B and S2); treatment of cells with YKL-5-124 as a compet- 2 mM YKL-5-167 and then blotted cell extracts for the levels of

itor at a concentration of about 30 nM blocked pull-down of total and phospho-CDK1(T161) and CDK2(T160). Blotting for

CDK7-cyclin H but had no effect on the pull-down of cyclin poly(ADP-ribose) polymerase (PARP) cleavage was used to

K-CDK12/13 (Figures 2B and S2A). YKL-5-124 displayed monitor the extent of apoptosis. We found that YKL-5-124

engagement of CDK7 3 h after compound was washed out of inhibited CDK1 T-loop phosphorylation, and to a lesser extent

cells down to 125 nM, further conﬁrming that YKL-5-124 func- CDK2 T-loop phosphorylation (Figure 3A) in a concentration-

tions in an irreversible manner (Figures 2C and S2B). In contrast, dependent fashion while YKL-5-167 had no detectable effect.

YKL-5-167, which cannot react with CDK7-C312, was 100-fold Reduction in the phosphorylation of CDK1 and CDK2 T loops

less effective as a competitor for CDK7-cyclin H in bioTHZ1 was not observed in HAP1 cells expressing CDK7-C312S,

pull-down experiments and inactive following washout. To study implying that the effect of YKL-5-124 on T-loop phosphorylation

the kinetics of target engagement, we treated cells with drug for is mediated by CDK7 inhibition (Figure 3A). When HAP1 cells

3

1

3

0 min to 6 h prior to pull-down. Treatment with 100 nM YKL-5- were exposed to 2 mM YKL-5-124 for 6, 12, 24, and 48 h, inhibi-

24 reduced CDK7-cyclin H binding to bioTHZ1 by >50% at tion of T-loop phosphorylation was observed within 12 h (Fig-

0 min, whereas THZ1 required twice as long, consistent with ure 3B) The absence of PARP cleavage across all conditions

the faster kinact of YKL-5-124 (Figures 2D and S2C). YKL-5-167 showed that apoptosis was not induced by YKL-5-124 expo-

required 6 h to achieve equivalent engagement of CDK7 in sure. Similar data were obtained in Jurkat cells although the ef-

HAP1 cells and was even less active in Jurkat cells, requiring fect on CDK2 T-loop phosphorylation was greater than on the

1

competitor (Figures 2D and S2C).

0-fold higher concentrations and longer times to function as a CDK1 T loop (Figure S3A), suggesting variability among cell lines

in CAK-substrate modiﬁcation.

To monitor effects on cell-cycle progression, we exposed

To assess target selectivity, we performed KiNativ proﬁling, an

MS-based method that measures the ability of a test compound HAP1 cells to YKL-5-124 or THZ1 for 72 h and performed cell-

0

to block binding of kinases to a desthiobiotin-ATP probe. This cycle analysis by pulsing live cells for 1 h with 5-ethynyl-2 -deox-

showed that CDK7 is the only target bound by 1 mM YKL- yuridine (EdU), then ﬁxed cells and stained them with Hoechst

5

-124 at more than 65% in Jurkat extracts pretreated with and phospho-histone H3 (pHH3) antibodies, followed by ﬂuores-

YKL-5-124 for 6 h (Figure 2E and Table S1). Furthermore, YKL- cence microscopy. YKL-5-124 caused a dose-dependent in-

-167 exhibited an activity proﬁle similar to that of YKL-5-124 crease in G

- and G /M-phase cells and a corresponding loss

5

1

2

except that CDK7 was only weakly engaged (Figure 2E and of S-phase cells (Figure 3C, left panel). Concurrent with S-phase

Table S1). To further demonstrate covalent binding of YKL-5- loss, we observed a notable increase in ‘‘S dropout,’’ or cells that

1

24 for CDK7, we used CRISPR to create an isogenic pair of have intermediate DNA content, but no EdU stain indicating

Figure 3. Cell-Cycle Effects from YKL-5-124 Treatment

A) Western blot analysis of proteins shown after treatment of HAP1 WT and C312S cells with YKL-5-124 at concentrations indicated for 24 h (pCDK1, phospho

(

T161 CDK1; tCDK1, total CDK1; pCDK2, phospho T160 CDK2; tCDK2, total CDK2), with % Signal indicating percentage compared with DMSO treatment in the

relevant cell line.

(

B) Western blot analysis of proteins shown after treatment of HAP1 WT and C312S cells with 2 mM YKL-5-124 for time points indicated (pCDK1, phospho T161

CDK1; tCDK1, total CDK1; pCDK2, phosphor T160 CDK2; tCDK2, total CDK2).

C) Cell-cycle analysis using Hoechst, EdU, and pHH3 staining across concentrations of YKL-5-124 (left), YKL-5-167 (middle), or THZ1 (right) at 72 h in WT cells.

Error bars represent SD of technical duplicates.

D) Cell-cycle analysis using Hoechst, EdU, and pHH3 staining across concentrations of YKL-5-124 (left), YKL-5-167 (middle), or THZ1 (right) at 72 h in CDK7

C312S cells. Error bars represent SD of technical duplicates.

E) GR value across concentrations in WT (red) and C312S (blue) HAP1 cells with YKL-5-124 (left), YKL-5-167 (middle), or THZ1 (right). Error bars represent SD of

technical duplicates.

F) Percentage of LDR-positive cells across concentrations in WT (red) and C312S (blue) HAP1 cells with YKL-5-124 (left), YKL-5-167 (middle), or THZ1 (right).

Error bars represent SD of technical duplicates.

(

6

Cell Chemical Biology 26, 1–12, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

Figure 4. Transcriptional Effects from YKL-

A

B

5

-124 Treatment

A) Western blot analysis of proteins shown after

treatment of HAP1 WT and C312S cells with YKL-

-124 at concentrations indicated for 24 h and co-

treatment with 250 nM THZ531 (right).

B) Western blot analysis of proteins shown after

(

5

(

treatment of HAP1 WT and C312S cells with 2 mM

YKL-5-124 for time points indicated and co-treat-

ment with 250 nM THZ531 (right).

(

C) Scatterplot of FPKM (fragments per kilobase

per million reads) of genes comparing YKL-5-124

00 nM treatment in WT and C312S cells.

D) Jaccard plot comparing the genes down-

regulated by 500 nM YKL-5-124, 100 nM THZ1,

50 nM THZ531, or YKL-5-124 and THZ531 co-

treatment.

E) Radar plot comparing the effects of different

5

(

2

(

drug treatments on genes upregulated (left) or

downregulated (right) by treatment with YKL-5-124

at 500 nM on WT (red) and C312S (gray) cell lines.

C

D

unchanged. In contrast, for YKL-5-124

the GR50 value was at least 150-fold

higher in CDK7-C312S than in WT cells

and GRmax was too high to be estimated

accurately. Staining cells with LIVE/DEAD

dye (Hafner et al., 2016) conﬁrmed that

THZ1 induced substantially more cell

death than YKL-5-124 and that killing

was relatively unaffected by CDK7-

C312S mutation (whereas cell killing by

YKL-5-124 was substantially reduced in

CDK7-C312S cells). From these data we

conclude that YKL-5-124 primarily in-

E

1

duces G /S cell cycle and a low level of

cell killing in a CDK7-dependent manner,

whereas THZ1 is cytotoxic in a largely

CDK7-independent manner, as indicated

by the potent effect in CDK7-C312S cells

(

Figure 3F). Cell viability data based on

ATP content were obtained in Jurkat cells

where treatment with THZ1 was able to

inhibit proliferation to zero, indicating

inhibition of DNA synthesis. As a control we showed that cell- total loss of cell viability at the highest concentrations, while

cycle distribution was not affected by exposure of HAP1 cells ex- treatment with YKL-5-124 could only inhibit proliferation to within

pressing CDK7-C312S to YKL-5-124, further supporting the 20% of the original cell count as measured by cell titer Glo (Fig-

selectivity of YKL-5-124 and that CDK7 is mediating the effects ure S3C). Together, these data show that YKL-5-124 is primarily

1

of YKL-5-124 (Figures 3C and 3D, left panel). The reversible cytostatic at G /S and that arrest in CDK7 dependent; in contrast,

compound, YKL-5-167, also showed no effect on cell-cycle THZ1 is cytotoxic in a CDK7-independent manner.

distribution.

To quantify drug-induced phenotypes we used growth rate in- YKL-5-124 Treatment Has No Discernible Effect on RNA

hibition (GR) metrics, which measure the effect of a drug on viable Pol II CTD Phosphorylation

cell number corrected for the rate of cell division (Hafner et al., CDK7 is reported to be the kinase responsible for phosphory-

2

016, 2018); GR50 is a measure of potency and GRmax a measure lating S5 in the RNA Pol II CTD heptapeptide repeat; therefore,

of efﬁcacy at high concentration. The GRmax value for THZ1 was we asked whether exposure of cells to YKL-5-124 would reduce

negative, indicating cytotoxicity, whereas that of YKL-5-124 was Pol II CTD phosphorylation. Surprisingly, in both HAP1 (Figure 4A)

zero, indicating a cytostatic response (Figure 3E) (Hafner et al., and Jurkat (Figure S4A) cells we found that YKL-5-124 concen-

2

016). For THZ1, the GR50 value was 3.6-fold higher in CDK7- trations 100-fold above GRmax (up to 2 mM) had no effect on

C312S-expressing than in WT cells but the GRmax value was the phosphorylation of S5 and other Pol II CTD serine residues

Cell Chemical Biology 26, 1–12, June 20, 2019

7

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

Figure 5. Cell-Cycle Transcriptional Effects

A

B

from YKL-5-124 Treatment

(

A) GSEA of treatment with 500 nM YKL-5-124.

B) Bar plot quantitating the expression levels on

cell-cycle genes with DMSO, 500 nM YKL-5-124,

or 2 mM YKL-5-124 treatment in WT and C312S cell

lines, with error bars representing SD.

(

C) Bar plot quantitating PLK1 expression with

DMSO, 500 nM YKL-5-124, or 2 mM YKL-5-124

treatment in WT and C312S cell lines, with error

bars representing SD.

(

D) Bar plot quantitating CDCA3 expression with

DMSO, 500 nM YKL-5-124, or 2 mM YKL-5-124

treatment in WT and C312S cell lines, with error

bars representing SD.

YKL-5-124 were most similar to those of

a combination of 500 nM YKL-5-124

plus 250 nM THZ531 (Jaccard similarity

index = 0.45) somewhat less similar to

C

D

1

00 nM THZ1 (index = 0.23) and least

similar to 250 nM THZ531 alone (index =

.05; Figure 4D). Genes that were upregu-

0

lated or downregulated by YKL-5-124 are

shown as radar plots in Figure 4E and

were largely similar to those differentially

regulated by 100 nM THZ1. The number

of genes differentially regulated by YKL-

124 was substantially reduced to 583 in

CDK7-C312S cells, showing that the ef-

fect was mediated by inhibition of CDK7.

cells. However, inhibition of CTD phosphorylation by THZ1 has Moreover, the similarity between YKL-5-124 and the YKL-5-

previously been demonstrated at nanomolar doses (Kwiatkowski 124/THZ531 combination fell in CDK7-C312S relative to WT

et al., 2014). This inconsistency led us to ask whether loss of Pol II cells (index = 0.29 versus 0.45) and rose relative to THZ531 alone

CTD phosphorylation requires inhibition of CDK7 and CDK12/13 (index = 0.23 versus 0.05; Figure S4D). These data suggest that

by THZ1. To test this hypothesis, we combined YKL-5-124 with a CDK7 inhibition alone is not sufﬁcient to affect global basal tran-

previously described inhibitor of CDK12/13, THZ531, and found scription and that simultaneous inhibition of CDK12/13 is

that the combination was active as a concentration-dependent required. Interestingly, our data show that the converse is also

inhibitor of CTD S2/S5/S7 phosphorylation (Figures 4A, 4B, true: CDK12/13 inhibition without CDK7 inhibition is insufﬁcient

S4A, and S4B). Inhibition of CDK7 was required for this effect, to block global basal transcription.

since it was not observed in CDK7-C312S cells. We conclude

that the CTD of Pol II is modiﬁed by a combination of CDK7 and CDK7 Inhibition Leads to a Strong Cell-Cycle

Cdk12/13 (Figures 4A and 4B).

Transcriptional Proﬁle

Gene set enrichment analysis (GSEA) of expression data from

WT HAP1 cells treated with YKL-5-124 showed strong leading-

edge enrichment for downregulation of E2F expression pro-

Inhibition of CDK7 by YKL-5-124 Elicits a

Transcriptional Signature Distinct from that of THZ1

To measure the effects of CDK7 inhibition of YKL-5-124 on gene grams (Figure 5A) (Subramanian et al., 2005). For THZ531, we

transcription, we performed RNA sequencing. After 24 h of expo- observed no signiﬁcant enrichment for E2F gene expression

sure of WT HAP1 cells to 500 nM YKL-5-124, differential expres- and instead saw downregulation of genes normally repressed

2

sion of 1,452 genes was observed (a log fold change >1.5) by EZH2 (Lu et al., 2010) (Figure S4E). When we focused specif-

compared with 583 genes in CDK7-C312S cells (Figures 4C ically on a curated set of cell-cycle regulated genes (Chang et al.,

and S4D). Under DMSO-only control conditions the transcript 2004) (which includes the E2F program) differentially expressed

proﬁles of WT and CDK7-C312S were highly similar, demon- in WT and CDK7-C312S cells at 500 nM or 2 mM, we observed

strating that the mutation does not appreciably affect baseline a statistically signiﬁcant decrease in their expression (Figure 5B).

transcription (Figure S4C). Next, we compared differentially ex- Among genes in the E2F3 cell-cycle program, PLK1 and CDCA3

pressed genes in cells exposed to YKL-5-124, THZ1, THZ531, both exhibited dose-dependent decreases in transcription with

or a combined of YKL-5-124 and THZ531 by Jaccard analysis, YKL-5-124 treatment (Figures 5C and 5D).Taken together, we

a 0–1 bounded measure of gene set overlap (Levandowsky ﬁnd a strong inhibition of cell-cycle transcriptional program in

and Winter, 1971). In the WT HAP1 cells, the effects of 500 nM cells treated with YKL-5-124 for 24 h.

8

Cell Chemical Biology 26, 1–12, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

DISCUSSION

effects of THZ1. Similar results have been observed when the

CDK7 ‘‘bumped hole’’ inhibitor, 3MB-PP1, was combined with

Here we performed target deconvolution on the previously re- the pan-CDK inhibitor, ﬂavopiridol, which strongly inhibits

ported CDK7/12/13 inhibitor, THZ1, parsing the CDK7 and CDK9, another Ser2 CTD kinase (Larochelle et al., 2007).

CDK12/13 activities to (1) isolate and examine the relative This suggests that phosphorylation of the CTD by CDK7

contribution of CDK7 inhibition to the overall THZ1 phenotype, may be dispensable for basal global gene expression and

and (2) further explore the consequences of CDK7 pharmaco- that CDKs 9/12/13 or other kinases such as ERK1/2 (Bonnet

logical inhibition. To this end, we leveraged a covalent inhibitor et al., 1999) may largely compensate for loss of CDK7. Alter-

strategy to target CDK7 and other kinases with similarly posi- natively, CDK7’s role may become essential when Ser2 CTD

tioned cysteines to the exclusion of the broader kinome, fol- phosphorylation and corresponding Pol II elongation is ﬁrst

lowed by scaffold diversiﬁcation to gain further selectivity for perturbed. This does not exclude the possibility that: (1)

CDK7, an approach we previously deployed to selectively inhibit CDK7 inhibition leads to potent, but transient loss of Pol II

a diverse array of kinase targets (Zhang et al., 2012, 2016; CTD phosphorylation and gene expression, which is quickly

Kwiatkowski et al., 2014). This method culminated in the devel- reset following engagement of compensatory mechanisms;

opment of YKL-5-124, an irreversible CDK7 inhibitor derived (2) CDK7 is solely responsible for Ser5 or Ser7 phosphoryla-

from the previously reported pyrrolopyrazole-based PAK4 inhib- tion at speciﬁc genes whose expression changes following

itor, PF-3758309 (Murray et al., 2010). Covalent targeting of its inhibition; (3) CDK7 kinase activity is not required for basal

CDK7 at C312 is obligatory for YKL-5-124 activity as mutation expression of most genes, but may be involved in gene induc-

to the less nucleophilic serine completely rescued both CDK7 tion; and (4) CDK7 may regulate gene expression by other

activity and cellular proliferation, highlighting both a clear mech- means including by transcription factor phosphorylation.

anism of action and exceptional selectivity enabling YKL-5-124 These ﬁndings highlight the power of using selective kinase

use across cellular systems.

inhibitors in combination with complementary genetic tools

Unique among CDKs, CDK7 has been reported to play major and systems-level analyses to investigate complex signaling

roles in both the cell cycle and transcription regulation, through pathways.

its CAK- and TFIIH-related functions, respectively (Gerber et al.,

2

008, Ebmeier et al., 2017, Feaver et al., 1994; Adamczewski SIGNIFICANCE

et al., 1996; Glover-Cutter et al., 2009; Kelso et al., 2014; Rodr ı´ -

guez-Molina et al., 2016). However, many mechanistic details CDK7 has long been reported to act as both the CDK-

remain elusive and the range of CDK7 functions is incompletely activating kinase (CAK) and an RNA polymerase II (Pol II)

understood. In this study, we employed our newly developed C-terminal domain (CTD) kinase, thereby imparting top-

CDK7-selective chemical probe, YKL-5-124, to examine the down regulation of the cell cycle and gene transcription,

effects of CDK7 pharmacological inhibition on both the cell cy- respectively. However, results and interpretations thereof

cle and global transcription. Our treatment of HAP1 CML and have been complicated by the use of non-selective CDK-

Jurkat T cell acute lymphoblastic leukemia cells with YKL-5- targeting small molecules. Here we describe the develop-

1

24 reduced both the levels of activated CDK1/2 and the num- ment of YKL-5-124, a potent and selective covalent inhibi-

ber of cells in S phase, consistent with previous ﬁndings (Laro- tor of CDK7. Using YKL-5-124, we conﬁrmed a strong

chelle et al., 2007). Interestingly, whereas reduced CDK1/2 cell-cycle phenotype in cells following CDK7 inhibition

activation occurred at concentrations exceeding 1 mM YKL-5- with reduction in cycling cells, CAK activity, and cell-cy-

1

24, strong anti-proliferative effects were observed beginning cle-regulated gene expression. However, cells exhibited

at 100 nM, suggesting that additional substrates of CDK7 that little to no change in global Pol II CTD phosphorylation or

are important mediators of cell-cycle progression remain to general loss of transcription factor genes, which are hall-

be discovered. RNA-sequencing analysis following treatment marks of THZ1 treatment. Furthermore, while YKL-5-124

with YKL-5-124 revealed a strong cell-cycle signature enriched treatment of HAP1 and Jurkat cells led to a strong cell-

for E2F3 target genes, indicating that CDK7 may indeed cycle arrest, it did not induce cell death like THZ1. The

impinge on the cell cycle by various mechanisms. Expression ability to recapitulate THZ1 phenotypes using potent by

of the inhibitor-refractory C312S mutation rescued all these separate inhibitors of CDK7 and CDK12/13 signal the

phenotypes, indicating that these are on-target effects of importance of this polypharmacology to the transcriptional

CDK7 inhibition.

activity of THZ1 and derivative compounds. Therefore,

Surprisingly, YKL-5-124 treatment alone did not globally YKL-5-124 represents a compound that enables rapid inac-

downregulate RNA Pol II CTD phosphorylation or Pol II-medi- tivation of CDK7 to study the consequences of selective

ated gene expression. This stands in direct contrast to our CDK7 inhibition on both the cell cycle and gene transcrip-

previous inhibitor, THZ1, which elicited robust downregulation tion. As YKL-5-124 does not indiscriminately induce cell

of RNA Pol II CTD phosphorylation and gene expression death, it also presents a unique therapeutic opportunity

(

Kwiatkowski et al., 2014). However, we were able to recapit- to ﬁnd cancer cell states that are uniquely dependent on

ulate THZ1-mediated effects on gene expression and CTD CDK7 inhibition for survival. As YKL-5-124 demonstrated

phosphorylation when YKL-5-124 was combined with our suppression of the cell cycle at both the gene expression

previously characterized CDK12/13 inhibitor, THZ531 (Zhang and post-translational levels, therapeutic strategies aimed

et al., 2016). This indicates that combined inhibition of at targeting cancers that are driven by direct misregulation

CDK7, CDK12, and CDK13 is central to the anti-transcriptional of cell-cycle factors may show promise.

Cell Chemical Biology 26, 1–12, June 20, 2019

9

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

STAR+METHODS

Received: September 25, 2018

Revised: December 19, 2018

Accepted: February 18, 2019

Published: March 21, 2019

Detailed methods are provided in the online version of this paper

and include the following:

REFERENCES

d KEY RESOURCES TABLE

d CONTACT FOR REAGENT AND RESOURCE SHARING

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

B Cell Lines

Adamczewski, J.P., Rossignol, M., Tassan, J.P., Nigg, E.A., Moncollin, V., and

Egly, J.M. (1996). Mat1, cdk7 and cyclin H form a kinase complex which is UV

light-sensitive upon association with TFIIH. EMBO J. 15 , 1877–1884.

B Constructs

Akhtar, M.S., Heidemann, M., Tietjen, J.R., Zhang, D.W., Chapman, R.D., Eick,

D., and Ansari, A.Z. (2009). TFIIH kinase places bivalent marks on the carboxy-

terminal domain of RNA polymerase II. Mol. Cell 34 , 387–393.

d METHOD DETAILS

B Genome Editing

B Immunoblotting

Alexander, W.M., Ficarro, S.B., Adelmant, G., and Marto, J.A. (2017).

Multiplierz v2.0: a Python-based ecosystem for shared access and analysis

of native mass spectrometry data. Proteomics 17, https://doi.org/10.1002/

pmic.201700091.

B Commercial In Vitro Kinase Assays

B In Vitro Kinase Assays

B Radioactive In Vitro Kinase Assays from Cellular CDK7

B Pulldown Assays

Ali, S., Heathcote, D.A., Kroll, S.H.B., Jogalekar, A.S., Scheiper, B., Patel, H.,

Brackow, J., Siwicka, A., Fuchter, M.J., Periyasamy, M., et al. (2009). The

development of a selective cyclin-dependent kinase inhibitor that shows anti-

tumor activity. Cancer Res. 69 , 6208–6215.

B Covalent Inhibition Kinetics Using Mobility Shift Assay

B Mass Spectrometry Analysis

B Kinativ Sample Preparation and Analysis

B Proliferation Assays

Andersson, B., Collins, V., Kurzrock, R., Larkin, W.D., Childs, C., Ost, A., Cork,

A., Trujillo, J.M., et al. (1995). KBM-7, a human myeloid leukemia cell line with

double Philadelphia chromosomes lacking normal c-ABL and BCR transcripts.

Leukemia 9 , 2100–2108.

B Cell Cycle and Growth Rate Analysis

B RNA Sequencing

B RNA-seq Analysis

Askenazi, M., Parikh, J.R., and Marto, J.A. (2009). mzAPI: a new strategy for

B Chemical Synthesis

efﬁciently sharing mass spectrometry data. Nat. Methods 6 , 240–241.

d QUANTIFICATION AND STATISTICAL ANALYSIS

d DATA AND SOFTWARE AVAILABILITY

Bieniossek, C., Imasaki, T., Takagi, Y., and Berger, I. (2012). MultiBac: expand-

ing the research toolbox for multiprotein complexes. Trends Biochem. Sci.

3

7 , 49–57.

Bisteau, X., Paternot, S., Colleoni, B., Ecker, K., Coulonval, K., de Groote, P.,

Declercq, W., Hengst, L., and Roger, P.P. (2013). CDK4 T172 phosphorylation

is central in a CDK7-dependent bidirectional CDK4/CDK2 interplay mediated

by p21 phosphorylation at the restriction point. PLoS Genet. 9 , e1003546.

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at https://doi.org/10.1016/j.

chembiol.2019.02.012.

Blackwell, L.J., Birkos, S., Hallam, R., van de Carr, G., Arroway, J., Suto, C.M.,

and Janzen, W.P. (2009). High-throughput screening of the cyclic AMP-depen-

dent protein kinase (PKA) using the caliper microﬂuidic platform. Methods Mol.

Biol. 565, 225–237.

ACKNOWLEDGMENTS

We would like to thank Richard A. Young and Nancy M. Hannett for their

advice and support on the manuscript. C.Y.L., W.D.P., and S.Z.E. are sup-

ported by the Cancer Prevention Research Institute of Texas (RR150093).

C.Y.L. is also supported by NIH and NCI (1R01CA215452-01) and is a Pew-

Stewart Scholar for Cancer Research (Alexander and Margaret Stewart

Trust). P.K.S. and N.S.G. are supported by NIH U54-HL127365, and

C.M.O., Y.L., T.Z., N.K., and N.S.G. are supported by NIH R01 CA179483-

Bonnet, F., Vigneron, M., Bensaude, O., and Dubois, M.F. (1999). Transcription-

independentphosphorylationoftheRNApolymerase IIC-terminaldomain(CTD)

involves ERK kinases (MEK1/2). Nucleic Acids Res. 27 , 4399–4404.

B o¨ sken, C.A., Farnung, L., Hintermair, C., Merzel Schachter, M., Vogel-

Bachmayr, K., Blazek, D., Anand, K., Fisher, R.P., Eick, D., and Geyer, M.

(

2014). The structure and substrate speciﬁcity of human Cdk12/Cyclin K.

0

3, the Koch Institute-DF/HCC Bridge Project, and the Hale Center for

Nat. Commun. 5 , 3505.

Pancreatic Cancer. M.G. was supported by the Deutsche Forschungsge-

meinschaft (GE-976/9-2).

Buratowski, S. (2009). Progression through the RNA polymerase II CTD cycle.

Mol. Cell 36 , 541–546.

Canevari, G., Re Depaolini, S., Cucchi, U., Bertrand, J.A., Casale, E., Perrera,

C., Forte, B., Carpinelli, P., and Felder, E.R. (2013). Structural insight into

maternal embryonic leucine zipper kinase (MELK) conformation and inhibition

toward structure-based drug design. Biochemistry 52 , 6380–6387.

AUTHOR CONTRIBUTIONS

Conceptualization, C.M.O., Y.L., N.K., and N.S.G.; Investigation, C.M.O., Y.L.,

A.L., L.L., C.E.M., S.B.F., and R.D.; Formal Analysis, W.D.P. and S.Z.E.;

Writing – Original Draft, C.M.O., N.K, and N.S.G.; Writing – Review & Editing,

C.M.O., N.K., N.S.G., A.L., L.L., C.E.M., S.B.F., J.A.M., P.K.S., K.D.W., and

C.Y.L.,; Funding Acquisition, N.K., T.Z., and N.S.G.; Supervision, J.A.M.,

P.K.S., K.D.W., C.Y.L., and M.G.

Chang, H.Y., Sneddon, J.B., Alizadeh, A.A., Sood, R., West, R.B.,

Montgomery, K., Chi, J.T., van de Rijn, M., Botstein, D., and Brown, P.O.

(2004). Gene expression signature of ﬁbroblast serum response predicts

human cancer progression: similarities between tumors and wounds. PLoS

Biol. 2 , E7.

DECLARATION OF INTERESTS

Chen, F., Gao, X., and Shilatifard, A. (2015). Stably paused genes revealed

through inhibition of transcription initiation by the TFIIH inhibitor triptolide.

Genes Dev. 29 , 39–47.

C.Y.L. an equity holder and inventor of IP licensed to Syros Pharmaceuticals

and N.S.G. is a founder, science advisor, and equity holder in C4, Syros, Petra,

Soltego, B2S, and Gatekeeper Pharmaceuticals. The Gray lab receives or has

received research funding from Novartis, Takeda, Astellas, Taiho, Janssen,

Kinogen, Voronoi, Her2llc, Deerﬁeld, and Sanoﬁ. N.S.G., T.Z., and N.K. are

inventors on a patent application covering THZ1, which is licensed to a com-

pany co-founded by N.S.G. The other authors declare no competing interests.

Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X.,

Jiang, W., Marrafﬁni, L.A., and Zhang, F. (2013). Multiplex genome engineering

using CRISPR/Cas systems. Science 339 , 819–823.

Devault, A., Martinez, A.M., Fesquet, D., Labb e´ , J.C., Morin, N., Tassan, J.P.,

Nigg, E.A., Cavadore, J.C., and Dor e´ e, M. (1995). MAT1 (’menage a` trois’) a

10 Cell Chemical Biology 26, 1–12, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

new RING ﬁnger protein subunit stabilizing cyclin H-cdk7 complexes in star-

altered gene expression, cell cycle progression, and survival of tumor cells.

ﬁsh and Xenopus CAK. EMBO J. 14 , 5027–5036.

Mol. Cell. Biol. 34 , 3675–3688.

Ebmeier, C.C., Erickson, B., Allen, B.L., Allen, M.A., Kim, H., Fong, N.,

Jacobsen, J.R., Liang, K., Shilatifard, A., Dowell, R.D., et al. (2017). Human

TFIIH kinase CDK7 regulates transcription-associated chromatin modiﬁca-

tions. Cell Rep. 20 , 1173–1186.

Klaeger, S., Heinzlmeir, S., Wilhelm, M., Polzer, H., Vick, B., Koenig, P.A.,

Reinecke, M., Ruprecht, B., Petzoldt, S., Meng, C., et al. (2017). The target

landscape of clinical kinase drugs. Science 358, https://doi.org/10.1126/sci-

ence.aan4368.

Egloff, S., and Murphy, S. (2008). Cracking the RNA polymerase II CTD code.

Kuzmic, P. (1996). Program DYNAFIT for the analysis of enzyme kinetic data:

Trends Genet. 24 , 280–288.

application to HIV proteinase. Anal. Biochem. 237 , 260–273.

Essletzbichler, P., Konopka, T., Santoro, F., Chen, D., Gapp, B.V., Kralovics,

R., Brummelkamp, T.R., Nijman, S.M.B., and B u € rckst u € mmer, T. (2014).

Megabase-scale deletion using CRISPR/Cas9 to generate a fully haploid

human cell line. Genome Res. 24 , 2059–2065.

Kwiatkowski, N., Zhang, T., Rahl, P.B., Abraham, B.J., Reddy, J., Ficarro, S.B.,

Dastur, A., Amzallag, A., Ramaswamy, S., Tesar, B., et al. (2014). Targeting

transcription regulation in cancer with a covalent CDK7 inhibitor. Nature 511 ,

616–620.

Feaver, W.J., Svejstrup, J.Q., Henry, N.L., and Kornberg, R.D. (1994).

Relationship of CDK-activating kinase and RNA polymerase II CTD kinase

TFIIH/TFIIK. Cell 79 , 1103–1109.

Larochelle, S., Amat, R., Glover-Cutter, K., Sans o´ , M., Zhang, C., Allen, J.J.,

Shokat, K.M., Bentley, D.L., and Fisher, R.P. (2012). Cyclin-dependent kinase

control of the initiation-to-elongation switch of RNA polymerase II. Nat. Struct.

Mol. Biol. 19 , 1108–1115.

Ficarro, S.B., Alexander, W.M., and Marto, J.A. (2017). mzStudio: a dynamic

digital canvas for user-driven interrogation of mass spectrometry data.

Proteomes 5, https://doi.org/10.3390/proteomes5030020 .

Larochelle, S., Merrick, K.A., Terret, M.-E., Wohlbold, L., Barboza, N.M.,

Zhang, C., Shokat, K.M., Jallepalli, P.V., and Fisher, R.P. (2007).

Requirements for Cdk7 in the assembly of Cdk1/Cyclin B and activation

of Cdk2 revealed by chemical genetics in human cells. Mol. Cell 25 ,

Ficarro, S.B., Zhang, Y., Lu, Y., Moghimi, A.R., Askenazi, M., Hyatt, E., Smith,

E.D., Boyer, L., Schlaeger, T.M., Luckey, C.J., and Marto, J.A. (2009).

Improved electrospray ionization efﬁciency compensates for diminished chro-

matographic resolution and enables proteomics analysis of tyrosine signaling

in embryonic stem cells. Anal. Chem. 81 , 3440–3447.

8

39–850.

Levandowsky, M., and Winter, D. (1971). Distance between sets. Nature

234 , 34.

Fisher, R.P., and Morgan, D.O. (1994). A novel cyclin associates with M015/

Lu, C., Han, H.D., Mangala, L.S., Ali-Fehmi, R., Newton, C.S., Ozbun, L.,

Armaiz-Pena, G.N., Hu, W., Stone, R.L., Munkarah, A., et al. (2010).

Regulation of tumor angiogenesis by EZH2. Cancer Cell 18 , 185–197.

CDK7 to form the CDK-activating kinase. Cell 78 , 713–724.

Furuno, N., den Elzen, N., and Pines, J. (1999). Human cyclin A is required for

mitosis until mid prophase. J. Cell Biol. 147 , 295–306.

Marshall, N.F., Peng, J., Xie, Z., and Price, D.H. (1996). Control of RNA poly-

merase ii elongation potential by a novel carboxyl-terminal domain kinase.

J. Biol. Chem. 271 , 27176–27183.

Gao, Y., Zhang, T., Terai, H., Ficarro, S.B., Kwiatkowski, N., Hao, M.-F.,

Sharma, B., Christensen, C.L., Chipumuro, E., Wong, K.-K., and Marto, J.A.

(

2018). Overcoming resistance to the THZ series of covalent transcriptional

Murray, B.W., Guo, C., Piraino, J., Westwick, J.K., Zhang, C., Lamerdin, J.,

Dagostino, E., Knighton, D., Loi, C.-M., Zager, M., et al. (2010). Small-mole-

cule p21-activated kinase inhibitor PF-3758309 is a potent inhibitor of onco-

genic signaling and tumor growth. Proc. Natl. Acad. Sci. U S A 107 ,

CDK inhibitors. Cell Chem. Biol. 25 , 135–142.e5.

Gerber, H.B., Pikman, Y., and Fisher, R.P. (2008). The CDK-activating kinase

(CAK) Csk1 is required for normal levels of homologous recombination and

9

446–9451.

resistance to DNA damage in ﬁssion yeast. PLoS One 3 , e1492.

Nilson, Kyle A., Guo, J., Turek, M.E., Brogie, J.E., Delaney, E., Luse, D.S., and

Price, D.H. (2015). THZ1 reveals roles for Cdk7 in Co-transcriptional capping

and pausing. Mol. Cell 59 , 576–587.

Glover-Cutter, K., Larochelle, S., Erickson, B., Zhang, C., Shokat, K., Fisher,

R.P., and Bentley, D.L. (2009). TFIIH-associated Cdk7 kinase functions in

phosphorylation of C-terminal domain Ser7 residues, promoter-proximal

pausing, and termination by RNA polymerase II. Mol. Cell. Biol. 29 ,

Patricelli, M.P., Nomanbhoy, T.K., Wu, J., Brown, H., Zhou, D., Zhang, J.,

Jagannathan, S., Aban, A., Okerberg, E., Herring, C., et al. (2011). In situ kinase

proﬁling reveals functionally relevant properties of native kinases. Chem. Biol.

5455–5464.

Greifenberg, A.K., Honig, D., Pilarova, K., Duster, R., Bartholomeeusen, K.,

Bosken, C.A., Anand, K., Blazek, D., and Geyer, M. (2016). Structural and func-

tional analysis of the Cdk13/Cyclin K complex. Cell Rep. 14 , 320–331.

1

8 , 699–710.

Perkins, D.N., Pappin, D.J., Creasy, D.M., and Cottrell, J.S. (1999). Probability-

based protein identiﬁcation by searching sequence databases using mass

spectrometry data. Electrophoresis 20 , 3551–3567.

Guo, C., Mcalpine, I., Zhang, J., Knighton, D.D., Kephart, S., Johnson, M.C., Li,

H., Bouzida, D., Yang, A., Dong, L., et al. (2012). Discovery of pyrroloaminopyr-

azoles as novel PAK inhibitors. J. Med. Chem. 55 , 4728–4739.

Poss, Z.C., Ebmeier, C.C., Odell, A.T., Tangpeerachaikul, A., Lee, T., Pelish,

H.E., Shair, M.D., Dowell, R.D., Old, W.M., and Taatjes, D.J. (2016).

Identiﬁcation of mediator kinase substrates in human cells using cortistatin A

and quantitative phosphoproteomics. Cell Rep. 15 , 436–450.

Hafner, M., Mills, C.E., Gerosa, L., Chung, M., Niepel, M. & Sorger, P.K.,

DeepDyeDrop: an image-based approach to quantify the phenotypic

response of cancer cells to therapeutics (conference presentation). SPIE

BiOS, 2018. SPIE.

R Core Team (2014). R: A language and environment for statistical computing.

R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.

org/.

Hafner, M., Niepel, M., Chung, M., and Sorger, P.K. (2016). Growth rate inhibi-

tion metrics correct for confounders in measuring sensitivity to cancer drugs.

Nat. Methods 13 , 521–527.

Rodr ı´ guez-Molina, J.B., Tseng, S.C., Simonett, S.P., Taunton, J., and Ansari,

A.Z. (2016). Engineered covalent inactivation of TFIIH-kinase reveals an elon-

gation checkpoint and results in widespread mRNA stabilization. Mol. Cell 63 ,

Kalan, S., Amat, R., Schachter, M.M., Kwiatkowski, N., Abraham, B.J., Liang,

Y., Zhang, T., Olson, C.M., Larochelle, S., Young, R.A., et al. (2017). Activation

of the p53 transcriptional program sensitizes cancer cells to Cdk7 inhibitors.

Cell Rep. 21 , 467–481.

4

33–444.

Rudolph, J., Crawford, J.J., Hoeﬂich, K.P., and Wang, W. (2015). Inhibitors of

p21-activated kinases (PAKs). J. Med. Chem. 58 , 111–129.

Kanin, E.I., Kipp, R.T., Kung, C., Slattery, M., Viale, A., Hahn, S., Shokat, K.M.,

and Ansari, A.Z. (2007). Chemical inhibition of the TFIIH-associated kinase

Cdk7/Kin28 does not impair global mRNA synthesis. Proc. Natl. Acad. Sci.

U S A 104 , 5812–5817.

Satyanarayana, A., and Kaldis, P. (2009). Mammalian cell-cycle regulation:

several Cdks, numerous cyclins and diverse compensatory mechanisms.

Oncogene 28 , 2925–2939.

Kelso, T.W.R., Baumgart, K., Eickhoff, J., Albert, T., Antrecht, C., Lemcke, S.,

Klebl, B., and Meisterernst, M. (2014). Cyclin-dependent kinase 7 controls

mRNA synthesis by affecting stability of preinitiation complexes, leading to

Schachter, M.M., Merrick, K.A., Larochelle, S., Hirschi, A., Zhang, C., Shokat,

K.M., Rubin, S.M., and Fisher, R.P. (2013). A Cdk7-Cdk4 T-loop phosphoryla-

tion cascade promotes G1 progression. Mol. Cell 50 , 250–260.

Cell Chemical Biology 26, 1–12, June 20, 2019 11

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

Serizawa, H., Conaway, J.W., and Conaway, R.C. (1993). Phosphorylation of

C-terminal domain of RNA polymerase II is not required in basal transcription.

Nature 363 , 371–374.

Tan, L., Gurbani, D., Weisberg, E.L., Hunter, J.C., Li, L., Jones, D.S.,

Ficarro, S.B., Mowafy, S., Tam, C.-P., Rao, S., et al. (2017). Structure-

guided development of covalent TAK1 inhibitors. Bioorg. Med. Chem.

2

5 , 838–846.

Serizawa, H., Makela, T.P., Conaway, J.W., Conaway, R.C., Weinberg, R.A.,

and Young, R.A. (1995). Association of Cdk-activating kinase subunits with

transcription factor TFIIH. Nature 374 , 280–282.

Wang, B.-Y., Liu, Q.-Y., Cao, J., Chen, J.-W., and Liu, Z.-S. (2016). Selective

CDK7 inhibition with BS-181 suppresses cell proliferation and induces cell

cycle arrest and apoptosis in gastric cancer. Drug Des. Devel. Ther. 10 ,

Sherr, C.J., and Roberts, J.M. (1999). CDK inhibitors: positive and negative

regulators of G1-phase progression. Genes Dev. 13 , 1501–1512.

1

181–1189.

Shiekhattar, R., Mermelstein, F., Fisher, R.P., Drapkin, R., Dynlacht, B.,

Wessling, H.C., Morgan, D.O., and Reinberg, D. (1995). Cdk-activating kinase

complex is a component of human transcription factor TFIIH. Nature 374 ,

Zhang, T., Inesta-Vaquera, F., Niepel, M., Zhang, J., Ficarro, Scott B.,

Machleidt, T., Xie, T., Marto, Jarrod A., Kim, N., Sim, T., et al. (2012).

Discovery of potent and selective covalent inhibitors of JNK. Chem. Biol. 19 ,

283–287.

1

40–154.

Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L.,

Gillette, M.A., Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., and

Mesirov, J.P. (2005). Gene set enrichment analysis: a knowledge-based

approach for interpreting genome-wide expression proﬁles. Proc. Natl.

Acad. Sci. U S A 102 , 15545–15550.

Zhang, T., Kwiatkowski, N., Olson, C.M., Dixon-Clarke, S.E., Abraham, B.J.,

Greifenberg, A.K., Ficarro, S.B., Elkins, J.M., Liang, Y., Hannett, N.M., et al.

(2016). Covalent targeting of remote cysteine residues to develop CDK12

and CDK13 inhibitors. Nat. Chem. Biol. 12 , 876–884.

12 Cell Chemical Biology 26, 1–12, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE

Antibodies

SOURCE

IDENTIFIER

Anti-CDK7

Cell Signaling Technology

Bethyl Labs

Cat#2916; RRID: AB_2077142

Anti-Cyclin H

Cat#A301-674A; RRID: AB_1210922

Cat#A301-939A; RRID: AB_1547934

Cat#A301-812; RRID: AB_1233061

Cat#2561; RRID: AB_2078685

Anti-Cyclin K

Bethyl Labs

Anti-CDK2

Bethyl Labs

Anti-Phospho-CDK2 T160

Anti-CDK1

Cell Signaling Technology

Bethyl Labs

Cat#A303-663; RRID: AB_11205291

Cat#9114; RRID: AB_2074652

Anti-Phospho-cdc2 T161

Anti-Tubulin

Cell Signaling Technology

Millipore

Cat#3873; RRID: AB_1904178

Anti-PARP

Cat#9542; RRID: AB_2160739

Anti-Phospho-CTD Ser2

Anti-Phospho-CTD Ser5

Anti-Phospho-CTD Ser7

Anti-Total RNA Polymerase II

Anti-phospho-histone H3 Alexa 488 S10

Goat IRDye 680RD anti-Rat IgG (H+L)

Goat IRDye 680RD anti-Mouse IgG

Goat IRDye 800CW anti-Rabbit IgG

Chemicals, Peptides, and Recombinant Proteins

Biotinylated-THZ1

Cat#04-1571; RRID: AB_11212363

Cat#04-1572; RRID: AB_10615822

Cat#04-1570-I; RRID: AB_10618152

Cat#sc-899; RRID: AB_632359

Cat#3377; RRID: AB_1549592

Millipore

Santa Cruz Biotechnology

Cell Signaling Technology

LI-COR Biosciences

Cat#926-68076; RRID: AB_10956590

Cat#926-68070; RRID: AB_10956588

Cat#926-32211; RRID: AB_621843

Kwiatkowski et al., 2014

This paper

N/A

YKL-5-124

YKL-5-167

This paper

THZ1

Kwiatkowski et al., 2014

Zhang et al., 2016

Promega

N/A

THZ531

N/A

CellTiter-Glo Luminescent Cell Viability Assay

M2-Agarose Resin

Cat#G7571

Cat#A2220

Cat#11836153001

Cat#04906837001

Cat#LT07-318

Cat#PR6749B

Cat#NEG002A

N/A

Sigma

cOmplete, Mini Protease Inhibitor Cocktail

PhosSTOP Phosphotase Inhibitor Tablets

Mycoalert

Roche

Lonza

CDK7/Cyclin H/ MAT1

Thermo Fisher Scientiﬁc

Perkin-Elmer

[ɣ-32P] ATP

CDK12/Cyclin K

CDK13/Cyclin K

CDK7/CycH/Mat1

CTD3 peptide

B o¨ sken et al., 2014

Greifenberg et al., 2016

Carna Biosciences

Lumiprobe

N/A

Cat#04-108

Cat#04-108MS

Cat#10540

Cat#L10120

Cat#11030

Cat#ab81888

Cat#927-50100

Cat#B2261

Cat# 6365779001

EdU

LIVE/DEAD Far Red Dead Cell Stain

Cy3-azide

Thermo Fisher Scientiﬁc

Lumiprobe

RNAPII (RPB1)

abcam

Odyssey Blocking Buffer

Hoechst 33342

LI-COR Biosciences

Sigma Aldrich

X-tremeGENE 9

(Continued on next page)

Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019 e1

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

Continued

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Critical Commercial Assays

Selectscreen- Adapta Eu- CDK7/CycH/MNAT1

Selectscreen- Adapta Eu- CDK9/CycT1

Selectscreen- Z’LYTE- CDK2/CycA

Invitrogen

N/A

Deposited Data

RNA-Seq Data

This paper

Accession Number GEO: GSE124607

Experimental Models: Cell Lines

Human: Jurkat cells (male)

Laboratory of Thomas Looke

Horizon Discovery

N/A

Human: HAP1 cells (male)

C859

N/A

Human: Hela cells (female)

Kwiatkowski et al., 2014

Oligonucleotides

GCCAAGACCAAACTGTCCAG- sgRNA against CDK7

CCAAGACCAAACTGTCCAGTGG- WT speciﬁc ampliﬁcation

This paper

N/A

ACCAAACTCACCGGTAGAAAC- mutation speciﬁc

ampliﬁcation

TGGGTCAGATCTTCCAAATAACT- genomic CDK7 primer

This paper

N/A

Recombinant DNA

pX330

N/A

Addgene: 42230; Cong et al., 2013

N/A

pUC57-AMP

Laboratory of Richard Young

Software and Algorithms

DynaFit software

GraphPad Prism

mzStudio software

Mascot v 2.2

Kuzmic, 1996

http://www.biokin.com/dynaﬁt/

http://www.graphpad.com/

GraphPad Software, Inc

Ficarro et al., 2017

Perkins et al., 1999

Askenazi et al., 2009

R Core Team, 2014

PerkinElmer Informatics.

http://github.com/BlaisProteomics/mzStudio

http://www.matrixscience.com

Multiplierz scripts

R

https://github.com/MaxAlex/multiplierz/wiki

https://www.r-project.org/

Columbus image storage and analysis

http://www.perkinelmer.com/product/image-

data-storage-and-analysis-system-columbus

R scripts for RNAseq Analysis

This Paper

https://github.com/linlabcode/

olson_YKL5124

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for resources and reagents should be directed to and will be fulﬁlled by the Lead Contact, Nathanael

Gray (nathanael_gray@dfci.harvard.edu ).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell Lines

HAP1 (male) cells (Horizon Discovery) were cultured in IMDM media (Cat # 12440061, Thermo Fisher) supplemented with 10% FBS

and 1% penicillin/streptomycin (Cat # 10378016, Thermo Fisher) and Jurkat (male) cells (T. Looke Lab, DFCI) were cultured in RPMI

ꢂ

media (Cat# 11875093, Thermo Fisher) and incubated at 37 C with 5% CO

tion (Lonza, LT07-318). Cell lines were not authenticated.

2

. All cell lines were routinely tested for mycoplasma infec-

Constructs

For CRISPR studies, guide RNAs (sgRNA) targeting CDK7 were cloned into pX330 (Addgene: 42230) (Cong et al., 2013). pUC57-AMP

was used as storage vector for CDK7 genome reference sequence.

e2 Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

METHOD DETAILS

Genome Editing

The CRISPR/Cas9 system was used to mutate the endogenous CDK7 WT locus to encode for CDK7 C312S, a THZ1 and YKL-5-124

-

refractory mutant of CDK7. Target-speciﬁc oligonucleotides were cloned into pX330 (Addgene: 42230), which carries a codon-

optimized version of Cas9 and was further modiﬁed to express GFP for identifying transfectants. Cells were co-transfected (X-trem-

eGENE 9 (Roche)) with (1) pX330 expressing Cas9 and CDK7 targeting sgRNA and (2) a pUC57-AMP construct bearing 1500 bp of

modiﬁed CDK7 reference genome that is centered around the CRISPR targeting site in CDK7. Two days after transfection, cells were

sorted using GFP as a marker of transfected cells and cells were re-plated for ﬁve days. Cells were then re-plated at low density to

facilitate the isolation of individual clones. Individual clones were isolated, expanded, and PCR genotyped using mutant speciﬁc PCR

primers. Following initial PCR screening, individual clones were Sanger sequenced to conﬁrm the presence of the desired mutation.

Western blot conﬁrmed the presence of intact CDK7 kinase. Subsequent experiments were conducted using a CDK7 C312S clone

and a WT control clone that was carried through the entirety of the CRISPR protocol, but that was veriﬁed by Sanger sequencing to be

WT CDK7.

The genomic sequence complementary to the CDK7 -directed guide RNA that was cloned into pX330 and used in the genome

editing experiments is: GCCAAGACCAAACTGTCCAG.

The modiﬁed genomic sequence that was cloned into pUC57-AMP by Genewiz and used as the repair template for genome

editing is:

GCCATGAGGAGTCGACTTAATCTTGGCTTCCATCCCCAAGGTACGTCATGTATATGCAAATATTCCACAGTCCAAAATCTGAAGC

ACTTCTGGTCCCAAGCATTTTAGATAAGATATATTCAGCCTGTATAGGCTATTTAATTATGGAAAAATTAGAAGGGAGTCTTTTTTTCT

TTTCTTTTTTTGATACGGAGCCTTGCTCTGTCGCCCAGGCTGGAGTGCAGTGGTGCGATCTCGGCTCACTGCAACCTCTGCCTCT

GGGTTCAAGCGATTCTCCTACCTCAGCCTCCCGAGTAGTGGGGACTACAGACATGCACCACCACGCCCAGCTTATTTTTGTATTTT

TAGTAGAGATGGAGTTTCGCCACGTTGGCCAAGCTGATCTCGAACTTCTGACCTCATGTGATCCACCCGCCTCAGCCTCCCAAGG

TGCTGGGATTACAGGCATGAGCTACTGTGCCCGGCCAGTCTTTTAATGGAATTATCAGCCAATCTTAGGATCCTAGGTATTTATTTG

TAGTAATTTCCATTTGCAAATACTTGACATTAATTTTGTTTTGTTGGGAATGAGGGCATTCACATAGTATTTTTAATGCTCCCTATAAT

CTTGAAGGTAAGATTTTCCTTAACACATTTCAGATACTCACCTACCTTACTTTTGGTATCTTTTCTTTTAAAAGGCACTGAAAATGAAG

TATTTCAGTAATCGGCCAGGGCCAACACCTGGATGTCAGCTGCCAAGACCAAACTCACCGGTAGAAACCTTAAAGGAGCAATCAA

ATCCAGCTTTAGCAATAAAAAGGAAAAGAACAGAGGCCTTAGAACAAGGTAAGATTCCCACTTTTAAAAGAAATTAAATGAATTTAG

AAAACTCCAAATAGCTCGTGTATGGCTAGCGACTGAACAACAGCAAAGAAATGTAGCTTGCTAGCTATTTAATTTTTATAAATTTAAT

TGTATAAAGTAGAGAGACTGTGCCGTTTTAGGTATGTTTACTTTCATTGTGAATACTTCGGCAGCTTTTGTGTATACCTCAGAATTAT

GGGAACTATGTATGTGTACCTTGTTCCCTTCATAAATTCCTTCTGTAAACTACATGCTAAATGTTTAACAAGTGCTACTGGAAAAA

ATGTGTCAGTGAAATAATGTAGTTGGAATGCAGTGACTGGTTAAAATTGCTATGAGAATGTGAACTTTGTTAAATGTGAACAACTTT

TTTTTTTCTTGTTCTTTTTGCTTCCTAGGAGGATTGCCCAAGAAACTAATTTTTTAAAGAGAACACTGGACAACATTTTACTACTGAGG

GAAATAGCCAAAAAGGCAAATAATGGAAAAATAGTAAACATTAAGTAAATGCTGTAGAAGTGAGTTTGTAAATATTCTACACATGTA

AAATATGTAAAACTATGGGTTATTTTTATTAAATGTATTTTAAAATAAAAATTTAATTCTGGTTTTTCTGATTAGAGTGCAAAAGTGA

GAAAGAATTCTCGAGTACCG

1

2

3

4

. Green highlighting indicates the introduced desired TCA mutation, which codes for serine (C312S), replacing TGT which codes

for cysteine (C312, WT).

. Yellow highlighting indicates wobble mutations introduced to remove Cas9 –targeting sites, to prevent cutting of repair

template.

. Pink highlighting indicates Wobble mutations introduced for PCR-based screening to permit WT vs. mutated allele discrimi-

nation.

. Red highlighting indicates Sal I and EcoRI sites used for pUC57 cloning

Immunoblotting

HAP1 or Jurkat cells were lysed in RIPA buffer (50mM Tris-HCl, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, and 0.1%

SDS, pH 7.4 ± 0.2) with Protease Inhibitor (Roche), Phosstop Phosphatase Inhibitor (Roche), and 2.5 U/ml Universal Nuclease for

ꢂ

Cell Lysis (Pierce) by incubating on ice 30 min. The lysates were clariﬁed by spinning at 21,000 g for 30 min at 4 C and the con-

centration of the lysate was determined using BCA protocol (Pierce). Primary antibodies in this study include: CDK7 (Cell

Signaling Technology, 2916, 1:1,000), Cyclin H (Bethyl Labs, A301-674A , 1:1000), Cyclin K (Bethyl Labs, A301-939A, 1:1000),

CDK2 (Bethyl Labs, A301-812, 1:1,000), Phospho-CDK2 T160(Cell Signaling Technology, 2561, 1:1000) CDK1 (Bethyl Labs,

A303-663, 1:1,000), Phospho-CDK1 T161 (Cell Signaling Technology, 9114, 1:1000)Tubulin (Cell Signaling Technology, 3873

1

:5,000), PARP (Cell Signaling Technology, 9542, 1:2,000), Phospho-CTD Ser2 (Millipore, 04-1571, 1:2,000), Phospho-CTD

Ser5 (Millipore, 04-1572, 1:5,000), Phospho-CTD Ser7 (Millipore, 04-1570-I, 1:1000), Total Pol II (Santa Cruz Biotechnology,

sc-899, 1:200). Secondary antibodies were infra-red labeled antibodies (LI-COR, used at 1:10,000) and blots were imaged on

X

an Odyssey CL imager.

Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019 e3

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

Commercial In Vitro Kinase Assays

Adapta Eu kinase assays were conducted for CDK7/CycH/MNAT1 and CDK9/CycT1 at Life Technologies using Km ATP concentra-

tions. Z’LYTE kinase assays was conducted for CDK2/CycA at Life Technologies using Km ATP concentrations.

In Vitro Kinase Assays

Recombinant kinases GST-CDK12 (714-1063)/GST-Cyclin K (1-267) and GST-CDK13 (694-1093)/GST-Cyclin K (1-267) were co-

expressed with Cdk-Activating Kinase (CAK) from S. cerevisiae in Sf9 insect cells. The tripartite complex GST-CDK7 (2-346)/

Turbo

Cyclin H (1-323)/MAT1 (1-309) was co-expressed from a single vector in baculo-virus infected Sf9 insect cells using the MultiBac

system (Bieniossek et al., 2012).

Cells expressing the respective kinase complexes were harvested by centrifugation and resuspended in lysis buffer (50 mM

HEPES pH 7.6, 500 mM NaCl, 10% glycerol, 5 mM b-mercaptoethanol). Cells were lysed by sonication. All kinases were puriﬁed

via GST-afﬁnity puriﬁcation using pre-packed GSTrap 4FF columns (GE Healthcare). The lysate was cleared by centrifugation in a

ꢂ

Beckman Optima L-80 XP Ultracentrifuge with a Ti45 rotor (45,000 r.p.m. for 45 min at 4 C) and applied to GSTrap 4FF columns

¨

(GE Healthcare) equilibrated with lysis buffer using an AKTA PrimePlus chromatography system (GE Healthcare). Following extensive

washing with 10 column volumes (CV) of lysis buffer and 5 CV of wash buffer (50 mM HEPES pH 7.6, 1000 mM NaCl, 10% glycerol,

5 mM b-mercaptoethanol), the protein was eluted in elution buffer (50 mM HEPES pH 7.6, 500 mM NaCl, 10% glycerol and 5 mM

ꢂ

b-mercaptoethanol, 10 mM glutathione). GST-tags were removed by TEV-protease cleavage overnight at 4 C. Proteins were further

puriﬁed by size exclusion chromatography on a Superdex 200 PG column (GE Healthcare) equilibrated in 20 mM HEPES pH 7.6,

1

50 mM NaCl, 1 mM TCEP). Proteins were eluted from the column with the same buffer used for equilibration in 2 mL fractions.

Fractions were analyzed by Coomassie staining of SDS-PAGE and fractions containing stoichiometric complexes were pooled

and concentrated by ultraﬁltration in Amicon ﬁlters (Millipore). Kinases were aliquoted in single use aliquots, snap frozen, and stored

ꢂ

at -80 C until used.

Radioactive kinase activity measurements were performed at a concentration of 0.2 mM CDK/Cyclin complex. Kinase was

32

incubated with varying concentrations of inhibitory compounds in presence of 1 mM ATP containing 0.45 mCi P /mL (Perkin Elmer)

ꢂ

for 5 minutes at 30 C prior to starting the kinase reaction by addition of substrate. Reactions were incubated for 15 minutes at 30 C

and stopped by adding EDTA to a ﬁnal concentration of 50 mM. Reaction mixture was spotted onto ﬁlter sheets of Amersham Protran

nitrocellulose membrane (GE Healthcare). Filters were washed three times for 5 minutes with 0.75% (v/v) phosphoric acid. Radioac-

tivity was counted in a Beckman Liquid Scintillation Counter (Beckman-Coulter) for 1 minute. Data were obtained from three

independent experiments and normalized to DMSO control for comparison.

Radioactive In Vitro Kinase Assays from Cellular CDK7

For kinase assays Hela (female) cells with stable expression of wildtype or C312S ﬂag-tagged CDK7 were ﬁrst treated with DMSO,

YKL-5-124, or YKL-5-167 for 6 hours. Cells were then harvested by lysis in 50 mM TrisHCl pH 8.0, 150 mM NaCl, 1% NP-40, 5 mM

EDTA, Protease Inhibitor (Roche), and Phosstop Phosphatase Inhibitor (Roche). CDK7-FLAG was immunprecipitated from lysates

using M2-agarose resin (Sigma, A2220). Precipitated proteins were washed with lysis buffer 4 times, followed by 2 washes with

ꢂ

kinase buffer (40 mM Hepes pH 7.5, 150 mM NaCl, 10 mM MgCl2, 5% glycerol) and subjected to in vitro kinase assays at 30 C

for 45 minutes using 1 mg of the large subunit of RNAPII (RPB1) as substrate and 25 mM ATP and 10 mCi of 32P ATP. Reactions

were run on SDS-PAGE gel, ﬁxed and stained with coomassie reagent, and exposed to phospho-imager screen before being

scanned on a TYPHOON imager (GE Healthcare Life Sciences).

Pulldown Assays

HAP1 or Jurkat cells were treated with DMSO, YKL-5-124, YKL-5-167, or THZ1 for time and concentration indicated. Cells were

trypsinized (HAP1 only), pelleted, washed with 13 PBS and resuspended in 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1% Nonidet

P-40, 5 mM EDTA, 1 mM DTT and protease/phosphatase cocktails. Lysates were clariﬁed and input samples were taken before

ꢂ

1

with streptavidin resin for 3 h at 4 C. Beads were washed with lysis buffer ﬁve times and resuspended in 23 LDS load dye. Samples

mM biotinylated-THZ1 probe was added and samples were rotated overnight at 4 C. Lysates with probe were then incubated

ꢂ

were boiled at 95 C for 5 min before they were loaded onto SDS-PAGE gels and subjected to immunoblotting.

Covalent Inhibition Kinetics Using Mobility Shift Assay

k

i

inact/K measurements were determined using kinetic CDK7 enzyme activity data obtained from a peptide substrate mobility shift

assay (Blackwell et al., 2009). Recombinant CDK7/CycH/Mat1 and ﬂuorescent peptide substrate were obtained from Carna

Biosciences (CDK7/CycH/Mat1, Cat. 04-108; CTD3 peptide, Cat. 04-108MS). Reactions contained 3-5 nM CDK7 enzyme,

1

mM CTD3 peptide and 1 mM ATP in the assay buffer (20 mM HEPES pH7.5, 0.01% TritonX-100, 5 mM MgCl

Phosphorylated product and non-phosphorylated substrate were separated and detected using a LabChip EZ Readerꢀ

PerkinElmer) using the following settings: pressure 1.8 psi and voltage differentail -2400V to -500V with separation buffer consist-

ing of 100 mM Hepes pH 7.3, 0.015% Brij-35, 1 mM disodium EDTA, 0.1% coating reagent 3, 5% DMSO and 1X coating reagent

, similar to previous reports (Tan et al., 2017) . Nonlinear least-squares regression was performed using the DynaFit software

2

, 0.5 mM DTT).

(

8

e4 Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

package (Kuzmic, 1996) using with default settings for a 2-step inactivation model. Figures were generated with GraphPad Prism

software (version 6.07).

Mass Spectrometry Analysis

nanoLC/MS

Recombinant CAK complex (CDK7/Cyclin H/MNAT1, Thermo Fisher Scientiﬁc) was incubated with YKL-05-124 or DMSO for 4 hours

ꢂ

at 37 C, and reactions were resolved by SDS-PAGE. Bands corresponding to CDK7 were excised, digested in gel with trypsin ac-

cording to standard protocols, and analyzed by nanoLC-MS (Ficarro et al., 2009). Extracted peptides were loaded via autosampler

injection (NanoAcquity Sample Manager) onto a precolumn (4 cm POROS 10R2, Applied Biosystems, Framingham, MA) and eluted

with an HPLC gradient (NanoAcquity Binary Solvent Manager, Waters; 2-35% B in 60 minutes; A=0.1 M acetic acid in water, B=0.1M

acetic acid in acetonitrile). Peptides were resolved on a self-packed analytical column (50 cm Monitor C18, Column Engineering) and

introduced to a Q-Exactive HF mass spectrometer (ThermoFisher Scientiﬁc) at a ﬂow rate of ꢁ30 nL/min (ESI spray voltage = 2.2 kV).

The instrument was operated in data dependent mode such that the 10 most abundant precursors were subjected to MS/MS (HCD,

NCE=30%, resolution 15K). mzStudio software (Ficarro et al., 2017) was used to perform peak integrations for the triply and

quadruply charged precursors of the doubly carbamidomethylated C312 containing peptide. Two unlabeled, non-cysteine contain-

ing CDK7 peptides were used for normalization.

ZipChip CE-MS

Recombinant CAK complex was treated with YKL-05-124 as above, denatured with Rapigest (0.1% ﬁnal concentration; Waters,

Milford, MA), reduced (10 mM dithiothreitol), alkylated (22.5 mM iodoacetamide), and digested with trypsin (Promega) overnight

ꢂ

at 37 C. After cleaving Rapigest according to the manufacturer’s instructions, peptides were desalted using C18, dried by vacuum

centrifugation, and reconstituted in 1% formic acid/50% acetonitrile with 100 mM ammonium acetate. Peptides were then

analyzed by CE-MS using a ZipChip CE system and autosampler (908 Devices) interfaced to an Orbitrap Lumos mass spectrometer

(

ThermoFisher Scientiﬁc). Peptide solution was loaded for 30 seconds and separation performed at 500 V/cm on an HR chip for

0 minutes with a background electrolyte consisting of 1% formic acid in 50% acetonitrile. Pressure assist was utilized and started

at 1 minute. The mass spectrometer was operated in data dependent mode and subjected the 5 most abundant ions in each MS scan

60k resolution, 1E6 target, lock mass enabled) to MS/MS (15k resolution, 2E5 target, 100 ms max inject time). Dynamic exclusion

was enabled with a repeat count of 1 and an exclusion time of 6 seconds. MS/MS data was extracted to .mgf using multiplierz scripts

Alexander et al., 2017; Askenazi et al., 2009) and searched against a custom database containing the sequences of CDK7, Cyclin H,

1

(

and MAT1 using Mascot version 2.2 (Perkins et al., 1999). Search parameters speciﬁed ﬁxed carbamidomethylation of cysteine, and

variable oxidation (methionine) and variable YKL-05-124 modiﬁcation (cysteine). Precursor mass tolerance was set to 10 ppm and

product ion tolerance was 25 mmu. To conﬁrm the site of labeling, the mass spectrometer performed cycles of one MS scan (m/z

4

00-2000, electron multiplier detection, target = 5E4) followed by targeted ETD-MS/MS scans corresponding to the quadruply

and quintuply charged precursor ions of the YKL-05-124 modiﬁed C312 containing CDK7 peptide (image current detection, 15k res-

olution, 5E5 target, 250 ms max inject time).

Kinativ Sample Preparation and Analysis

Jurkat cells were treated with DMSO, YKL-5-124 (1mM), or YKL-5-167 (1mM) for 6 hours. Cells were washed with PBS 1X and

frozen in liquid nitrogen. Samples were processed by Kinativ (ActivX Biosciences Inc.) as previously described (Patricelli

et al., 2011). Brieﬂy, cells were lysed using sonication in lysis buffer (50 mM HEPES, pH 7.5, 150 mM NaCl, 0.1% Triton-

X-100, phosphatase inhibitors (Cocktail II AG Scientiﬁc #P-1518)) before being cleared by centrifugation. The supernantant is

labeled with 20 mM desthiobiotin-ATP acyl-nucleotide probe for 10 minutes to allow covalent engagement of the probe to pro-

ꢂ

teins with available active sites to identify target engagement. Lysates are then denatured (6 M urea, 10 mM DTT, 65 C, 15 min),

ꢂ

alkylated(40 mM iodoacetamide, 37 C, 30 min), and ﬁltered into 10 mM ammonium bicarbonate, 2 M urea, 5 mM methionine

ꢂ

before digestion with trypsin for 1 hour at 37 C and subjecting peptides to pulldown using high-capacity streptavidin resin

(

Thermo Scientiﬁc). Peptides were was in 50% CH

3

CN/water mixture containing 0.1% TFA at room temperature then subjected

to mass spectrometric analysis.

Proliferation Assays

4

Proliferation assays were performed in triplicate by plating Jurkat cells at 2 x 10 cells/mL in 50mLin a 384-well plate. Cells were

treated with 100nL of YKL-5-124 or THZ1 for ﬁnal concentrations ranging from 20mM to 600pM for 72 h. Anti-proliferative effects

of compounds were assessed by adding 25 mL of Cell Titer Glo (Promega) and luminescence was measured on an Envision plate

reader (PerkinElmer). IC50 values were determined using Graphpad Prism nonlinear regression curve ﬁt.

Cell Cycle and Growth Rate Analysis

HAP1 WT and C312S mutant cells were plated at a density of ranging 500 cells per well in 384-well Cell Carrier plates (Perkin

Elmer) using a Multidrop Combi Reagent Dispenser (Thermo Fisher Scientiﬁc) and allowed to adhere to for 24 hours prior to

drug treatment. Cells were treated with a dilution series of the indicated drugs using a D300 Digital Dispenser (Hewlett-Packard).

Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019 e5

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

Cells were stained and ﬁxed for analysis at the time of drug delivery and after 72 hours of incubation. Cells were pulsed for one

hour with EdU (Lumiprobe) and stained with 1:2000 LIVE/DEAD Far Red Dead Cell Stain (LDR) (Thermo Fisher Scientiﬁc). Cells

were then ﬁxed with 3.7% formaldehyde (Sigma Aldrich) for 30 minutes and permeabilized with 0.5% Triton X-100 in PBS. The

EdU was labeled with cy3-azide (Lumiprobe) for 30 min. The cells were then blocked for one hour with Odyssey blocking buffer

ꢂ

(

LI-COR), and stained overnight at 4 C with 2 mg/ml Hoechst 33342 (Sigma Aldrich) and a 1:1000 dilution of anti-phospho-histone

H3 (pHH3)Alexa 488 (Ser10, clone D2C8) conjugated antibody (Cell Signaling Technologies). Fixed cells were imaged with a

0x objective using an Operetta microscope and analyzed using the Columbus image data storage and analysis system (Perkin

1

Elmer). Nuclei were segmented using Columbus software (Perkin Elmer) based on their Hoechst signal. DNA content was deﬁned

by the total Hoechst intensity within the nuclear mask to identify cells in the G1 and G2 phases of the cell cycle. The average LDR,

EdU and phospho-histone H3 intensities within the nuclear masks were determined. The LDR signal was used to classify cells as

live or dead, the EdU and pHH3 signals to identify S and M phase cells respectively. Cells with intermediate DNA content and no

EdU signal were classiﬁed as S phase dropout cells. Live cell counts were normalized to DMSO-treated controls on the same

plates to yield normalized growth rate inhibition (GR) values as described previously (Hafner et al., 2016). Experiments were

performed as technical duplicates in biological triplicate.

RNA Sequencing

6

310 HAP1 Cells were treated for 24 h with 500nM or 2mM YKL-5-124, 100nM THZ1, 250nM THZ531, or the combination of 250nM

1

THZ531 and 500nM or 2mM YKL-5-124. Library preparation was performed using TruSeq Stranded mRNA Library Prep Kit.

RNA-seq Analysis

All RNA-seq analysis was performed using the human reference genome build HG19 with HG19/GRCh37 Refseq gene annotations.

Data were aligned using Hisat2 with default parameters to the UCSC Refseq transcriptome as provided by the Illumina iGenomes

project (https://support.illumina.com/sequencing/sequencing_software/igenome.html ). Raw and processed data are deposited

into the GEO: GSE124607.

DESeq Analysis

Differential Expression analysis was performed using the ‘‘DESeq2’’ package in R. Counts were ﬁrst generated from Hisat2 outputted

single-end bam ﬁles in R via ‘‘Rsamtools’’. These counts were then ﬁltered based on minimum count number (>10). DESeq datasets

were created using these ﬁltered counts to compare counts between the treatment and DMSO.

Jaccard Heatmap Analysis

Heatmapsweregeneratedbasedongenesetsimilarityscorestoshowtheamountofoverlapingenesdownregulatedbyeachtreatment.

Jaccard scores were calculated based on union and intersect of genes downregulated in the two treatments being compared. A table

consisting of these scores was imported into python. The ‘‘seaborn’’ and ‘‘matplotlib.pyplot’’ packages were used to generate the

heatmap.

Gene Set Enrichment Analysis

Gene set enrichment analysis was performed using the GSEA computational platform developed at the Broad Institute. This anal-

ysis required expression data, phenotype data, and a gene set database. Expression data was derived from FPKM data which

was used to create a Gene Cluster Text ﬁle (.gct). This ﬁle is comprised of FPKM averages across the treatment and the control.

The phenotype data was input in the form of a Categorical Class ﬁle (.cls). This ﬁle featured information regarding the number of

classes and samples in our analysis as well as classiﬁcation for each of the classes. Finally, we utilized the C2 all curated gene

set directly from the GSEA website for the gene set database in the form of a Gene Matrix Transposed ﬁle (.gmt). All other

parameters were kept at defaults with the exception of the metric for ranking genes which changed from ‘‘Signal2Noise’’ to

‘‘Ratio_of_Classes’’.

Radar Plot Generation

Radar plots were created via the ‘‘fmsb’’ package in R to examine differences in gene expression changes across different treat-

ments. This was performed both on a speciﬁc cell cycle related gene set derived from GSEA as well as speciﬁc gene examples.

Log

ditions. Calculation of these values was done in R for both the wildtype and YKL-5-124 refractory cell lines. Following compilation of

the log fold change values into a separate data frame, the ‘‘fmsb’’ package was used to create radar plots with overlapping plots for

2

fold change values were used to determine magnitudes of gene expression changes between the treatment and control con-

2

both cell lines.

Single Gene Expression Analysis

Speciﬁc genes from the GSEA derived cell cycle gene set were further analyzed for changes in expression across different dosages of

YKL-5-124 treatment in both the wildtype and mutant cell lines. To do this, FPKM averages were calculated across the triplicate for

the DMSO control and the two dosages of YKL-5-124. These averages were combined with standard deviation values in a single data

frame. Using ‘‘ggplot’’ in R, we generated a bar plot for expression of these speciﬁc genes across different dosages in both cell lines.

Signiﬁcance levels in changes of expression were calculated via the paired Student’s t-test.

e6 Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

Chemical Synthesis

Synthesis of (R)-3-(4-acrylamidobenzamido)-N-(2-(dimethylamino)-1-phenylethyl)-6,6-dimethyl-4,6-dihydropyrrolo

[

3,4-c]pyrazole-5(1H)-carboxamide (YKL-05-124)

5

-(tert-butyl) 1-ethyl 3-amino-6,6-dimethyl-4,6-dihydropyrrolo[3,4-c]pyrazole-1,5-dicarboxylate (1- and 2-protected

ethyl Formate was Obtained as an Inseparable Mixture, Which was Used Together Until The Last Step)

To a solution of tert-butyl 3-amino-6,6-dimethyl-4,6-dihydropyrrolo[3,4-c]pyrazole-5(1H)-carboxylate (1.0 g, 3.95 mmol) and TEA

ꢂ

(

0.6 g, 0.82 mL, 5.93 mmol) in THF (10 mL) was added ethyl chloroformate (0.43 g, 0.38 mL, 3.95 mmol) dropwise at 0 C. The mixture

ꢂ

was stirred at 0 C for 1 h. The solvent was removed and the residue was partitioned with EtOAc and sat. NaHCO

3

. The organic layer

. The solvent was then removed under vacuum to provide 5-(tert-butyl) 1-ethyl

-amino-6,6-dimethyl-4,6-dihydropyrrolo[3,4-c]pyrazole-1,5-dicarboxylate as an off white solid (1.28 g, 100 %). LC/MS (ESI)

2 4

was washed with water, brine and dried with Na SO

3

+

m/z = 325 (M + H) .

-(tert-butyl) 1-ethyl 6,6-dimethyl-3-(4-nitrobenzamido)-4,6-dihydropyrrolo[3,4-c]pyrazole-1,5-dicarboxylate

5

Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019 e7

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

To a solution of 5-(tert-butyl) 1-ethyl 3-amino-6,6-dimethyl-4,6-dihydropyrrolo[3,4-c]pyrazole-1,5-dicarboxylate (162 mg,

ꢂ

0

.5 mmol) and DIEA (98 mL, 1.0 mmol) in DCM (5 mL) was added 4-nitrobenzoyl chloride (110 mg, 0.6 mmol) at 0 C. The reaction

was stirred at room temperature for 2 h and concentrated. The crude was puriﬁed by ﬂash column chromatography on silica gel

EtOAc/hexanes, 0-70%) to provide 5-(tert-butyl) 1-ethyl 6,6-dimethyl-3-(4-nitrobenzamido)-4,6-dihydropyrrolo[3,4-c]pyrazole-

(

+

,5-dicarboxylate (177 mg, 75%). LC/MS (ESI) m/z = 474 (M + H) .

1

-Ethyl 6,6-dimethyl-3-(4-nitrobenzamido)-5,6-dihydropyrrolo[3,4-c]pyrazole-1(4H)-carboxylate

To a solution of 5-(tert-butyl) 1-ethyl 6,6-dimethyl-3-(4-nitrobenzamido)-4,6-dihydropyrrolo[3,4-c]pyrazole-1,5-dicarboxylate

177 mg, 0.23 mmol) in DCM (1 mL) was added TFA (1 mL). The reaction was stirred at room temperature for 1 h and concentrated

(

to provide 1-ethyl 6,6-dimethyl-3-(4-nitrobenzamido)-5,6-dihydropyrrolo[3,4-c]pyrazole-1(4H)-carboxylate as a TFA salt, which was

+

used directly in next step. LC/MS (ESI) m/z = 374 (M + H) .

1

-Ethyl (S)-5-((2-(dimethylamino)-1-phenylethyl)carbamoyl)-6,6-dimethyl-3-(4-nitrobenzamido)-5,6-dihydropyrrolo

[

3,4-c]pyrazole-1(4H)-carboxylate

To

.23 mmol) in DCM (2 mL) was added DIEA (148 mg, 0.2 mL, 1.15 mmol) at 0 C, followed by (S)-2-isocyanato-N,N-dimethyl-2-phe-

a

mixture of ethyl 6,6-dimethyl-3-(4-nitrobenzamido)-5,6-dihydropyrrolo[3,4-c]pyrazole-1(4H)-carboxylate (TFA salt,

ꢂ

0

ꢂ

nylethan-1-amine (62 mg, 0.27 mmol). The solution was stirred at 0 C for 1 h and diluted with CHCl

3

/i-PrOH (v/v = 4:1) and washed

3 2 4

with sat. NaHCO , brine and dried with Na SO . The solvent was then removed and the crude was puriﬁed by ﬂash column chroma-

tography on silica gel to provide 1-ethyl (S)-5-((2-(dimethylamino)-1-phenylethyl)carbamoyl)-6,6-dimethyl-3-(4-nitrobenzamido)-5,6-

+

dihydropyrrolo[3,4-c]pyrazole-1(4H)-carboxylate (113 mg, 85% over 2 steps). LC/MS (ESI) m/z = 564 (M + H) .

1

-Ethyl (S)-3-(4-aminobenzamido)-5-((2-(dimethylamino)-1-phenylethyl)carbamoyl)-6,6-dimethyl-5,6-dihydropyrrolo

[

3,4-c]pyrazole-1(4H)-carboxylate

e8 Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

To a solution of 1-ethyl (S)-5-((2-(dimethylamino)-1-phenylethyl)carbamoyl)-6,6-dimethyl-3-(4-nitrobenzamido)-5,6-dihydropyr-

.

rolo[3,4-c]pyrazole-1(4H)-carboxylate (113 mg, 0.20 mmol) in EtOAc (2 mL) was added SnCl

ꢂ

2

2H

/i-PrOH (v/v = 4:1) and washed with sat. NaHCO

2

O (226 mg, 1.0 mmol). The mixture

, brine and dried with Na SO4. The

was stirred at 70 C for 2 h and diluted with CHCl

3

2

crude was puriﬁed by ﬂash column chromatography on silica gel to provide 1-ethyl (S)-3-(4-aminobenzamido)-5-((2-(dimethylamino)-

-phenylethyl)carbamoyl)-6,6-dimethyl-5,6-dihydropyrrolo[3,4-c]pyrazole-1(4H)-carboxylate (193 mg, 88%). LC/MS (ESI) m/z = 534

1

+

(

M + H) .

S)-3-(4-acrylamidobenzamido)-N-(2-(dimethylamino)-1-phenylethyl)-6,6-dimethyl-4,6-dihydropyrrolo[3,4-c]

(

pyrazole-5(1H)-carboxamide (YKL-05-124)

To a mixture of 1-ethyl (S)-3-(4-aminobenzamido)-5-((2-(dimethylamino)-1-phenylethyl)carbamoyl)-6,6-dimethyl-5,6-dihydropyr-

rolo[3,4-c]pyrazole-1(4H)-carboxylate (20 mg, 0.032 mmol) in THF (1 mL) and sat. NaHCO

3

(1 mL) was added acryloyl choride

5.8 mg, 0.064 mmol) dropwise at 0 C. The mixture was stirred at 0 C for 10 min and diluted with CHCl /i-PrOH (v/v 4:1) and

washed with sat. NaHCO and brine, dried with Na SO and then concentrated. The crude was then dissolved in 1.0 mL of

i-PrOH. The solution was then treated with LiOH (1 M, 1 mL) and was stirred at room temperature for 10 min. The mixture was

diluted with CHCl /i-PrOH (v/v 4:1) and washed with sat. NaHCO and brine, dried (Na SO ), and concentrated. The crude was

puriﬁed by HPLC (MeOH/H O, 0-100%) to provide YKL-05-124 as TFA salt (8.1 mg, 40%). LC/MS (ESI) m/z = 516 (M + H) .

H NMR (500 MHz, DMSO-d ) d 10.89 (s, 1H), 10.72 (s, 1H), 9.49 (s, 1H), 8.03 (d, J = 8.8 Hz, 2H), 7.85 (d, J = 8.8 Hz, 2H),

.46 (d, J = 7.4 Hz, 2H), 7.40 (dd, J = 8.5, 6.8 Hz, 2H), 7.30 (td, J = 7.0, 1.4 Hz, 1H), 6.79 (d, J = 9.1 Hz, 1H), 6.57 (dd,

J = 16.9, 10.2 Hz, 1H), 6.31 (dd, J = 17.0, 1.9 Hz, 1H), 5.81 (dd, J = 10.1, 2.0 Hz, 1H), 5.37 (ddd, J = 12.4, 9.0, 3.8 Hz, 1H),

.82 (d, J = 11.9 Hz, 1H), 4.56 (d, J = 11.9 Hz, 1H), 3.57 (td, J = 12.5, 2.8 Hz, 1H), 2.87 (d, J = 4.8 Hz, 3H), 2.83

d, J = 4.8 Hz, 3H), 1.68 (s, 3H), 1.60 (s, 3H).

Synthesis of (S)-N-(2-(dimethylamino)-1-phenylethyl)-6,6-dimethyl-3-(4-propionamidobenzamido)-4,6-dihydropyrrolo

ꢂ

(

3

2

4

3

2

4

+

2

1

6

7

4

(

[

3,4-c]pyrazole-5(1H)-carboxamide (YKL-05-167)

To a mixture of 1-ethyl (S)-3-(4-aminobenzamido)-5-((2-(dimethylamino)-1-phenylethyl)carbamoyl)-6,6-dimethyl-5,6-dihydropyr-

rolo[3,4-c]pyrazole-1(4H)-carboxylate (20 mg, 0.032 mmol) in THF (1 mL) and sat. NaHCO

3

(1 mL) was added propionyl chloride

5.9 mg, 0.064 mmol) dropwise at 0 C. The mixture was stirred at 0 C for 10 min and diluted with CHCl /i-PrOH (v/v 4:1) and washed

with sat. NaHCO and brine, dried (Na SO ), and concentrated.

The crude was then dissolved in 1.0 mL of i-PrOH. The solution was then treated with LiOH (1 M, 1 mL) and was stirred at room

temperature for 10 min. The mixture was diluted with CHCl /i-PrOH (v/v 4:1) and washed with sat. NaHCO and brine, dried (Na SO ),

and concentrated. The crude was puriﬁed by HPLC (MeOH/H O, 0-100%) to provide YKL-05-167 as TFA salt (9.0 mg, 45%). LC/MS

) d 12.38 (s, 1H), 10.71 (s, 1H), 10.12 (s, 1H), 7.95 (m, 2H), 7.69 (m, 2H), 7.35 (d,

J = 7.0 Hz, 2H), 7.28 (t, J = 7.6 Hz, 2H), 7.18 (d, J = 7.6 Hz, 1H), 6.25 (m, 1H), 4.87 (m, 1H), 4.52 (m, 2H), 2.68 (m, 1H), 2.41 (m, 1H), 2.34

q, J = 7.6 Hz, 2H), 2.20 (m, 6H), 1.62 (m, 3H), 1.55 (s, 3H), 1.08 (t, J = 7.6 Hz, 1H).

ꢂ

(

3

2

4

3

2

4

2

+

(

ESI) m/z = 518 (M + H) . H NMR (600 MHz, DMSO-d

6

(

Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019 e9

Please cite this article in press as: Olson et al., Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype, Cell

Chemical Biology (2019), https://doi.org/10.1016/j.chembiol.2019.02.012

QUANTIFICATION AND STATISTICAL ANALYSIS

The method of determining error bars is indicated in the corresponding ﬁgure legend with the replicate number also indicated.

Statistical tests for RNA-seq data is outlined in the STAR Methods section under the relevant analysis. Data met the assumptions

for all tests used.

DATA AND SOFTWARE AVAILABILITY

The accession number for the raw RNA-seq data reported in this paper is GEO: GSE124607. Original data can be found at https://

www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE124607.

e10 Cell Chemical Biology 26, 1–12.e1–e10, June 20, 2019

Article Doi

Development of a Selective CDK7 Covalent Inhibitor Reveals Predominant Cell-Cycle Phenotype

DOI: 10.1016/j.chembiol.2019.02.012

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.chembiol.2019.02.012

Full text of DOI:10.1016/j.chembiol.2019.02.012

Products guided by the article

R&D Labs maybe for 718632-47-4

Relevant to this article

Hot Product