Welcome to LookChem.com Sign In|Join Free
  • or
(2R,3S,5R)-5-(6-AMINO-9H-PURIN-9-YL)-2-((BIS(4-METHOXYPHENYL)(PHENYL)METHOXY)METHYL)TETRAHYDROFURAN-3-YL 2-CYANOETHYL DIISOPROPYLPHOSPHORAMIDITE is an organic phosphoramidite compound utilized in the synthesis of oligonucleotides for molecular biology and biotechnology applications. It features a tetrahydrofuran ring, a purinyl group, and a cyanoethyl phosphoramidite moiety, which make it an ideal candidate for solid-phase synthesis of DNA and RNA.

140613-55-4

Post Buying Request

140613-55-4 Suppliers

Recommended suppliers

  • Product
  • FOB Price
  • Min.Order
  • Supply Ability
  • Supplier
  • Contact Supplier

140613-55-4 Usage

Uses

Used in Molecular Biology and Biotechnology Applications:
(2R,3S,5R)-5-(6-AMINO-9H-PURIN-9-YL)-2-((BIS(4-METHOXYPHENYL)(PHENYL)METHOXY)METHYL)TETRAHYDROFURAN-3-YL 2-CYANOETHYL DIISOPROPYLPHOSPHORAMIDITE is used as a key component in the synthesis of modified nucleotides and oligonucleotides for research and therapeutic purposes. Its unique structure allows for the creation of customized DNA and RNA sequences that can be employed in various molecular biology techniques and potential treatments.

Check Digit Verification of cas no

The CAS Registry Mumber 140613-55-4 includes 9 digits separated into 3 groups by hyphens. The first part of the number,starting from the left, has 6 digits, 1,4,0,6,1 and 3 respectively; the second part has 2 digits, 5 and 5 respectively.
Calculate Digit Verification of CAS Registry Number 140613-55:
(8*1)+(7*4)+(6*0)+(5*6)+(4*1)+(3*3)+(2*5)+(1*5)=94
94 % 10 = 4
So 140613-55-4 is a valid CAS Registry Number.

140613-55-4SDS

SAFETY DATA SHEETS

According to Globally Harmonized System of Classification and Labelling of Chemicals (GHS) - Sixth revised edition

Version: 1.0

Creation Date: Aug 13, 2017

Revision Date: Aug 13, 2017

1.Identification

1.1 GHS Product identifier

Product name 2-cyanoethyl 5'-O-(4,4'-dimethoxytrityl)-2'-deoxyadenosine 3'-(N,N-diisopropyl)phosphoramidite

1.2 Other means of identification

Product number -
Other names 5'-O-(4,4'-dimethoxytrityl)-2'-deoxyadenosine 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)

1.3 Recommended use of the chemical and restrictions on use

Identified uses For industry use only.
Uses advised against no data available

1.4 Supplier's details

1.5 Emergency phone number

Emergency phone number -
Service hours Monday to Friday, 9am-5pm (Standard time zone: UTC/GMT +8 hours).

More Details:140613-55-4 SDS

140613-55-4Relevant academic research and scientific papers

Convenient synthesis of N-unprotected deoxynucleoside 3′- phosphoramidite building blocks by selective deacylation of N-acylated species and their facile conversion to other N-functionalized derivatives

Ohkubo, Akihiro,Sakamoto, Kazushi,Miyata, Ken-Ichi,Taguchi, Haruhiko,Seio, Kohji,Sekine, Mitsuo

, p. 5389 - 5392 (2007/10/03)

(Chemical Equation Presented) A new route to N-unprotected deoxynucleoside 3′-phosphoramidite building blocks by use of highly selective N-deacylation of commercially available N-acylated deoxynucleoside 3′-phosphoramidites is described. These compounds could be readily converted to other types of N-protected species by facile N-acylations with acylating reagents.

Improved process for the preparation of nucleosidic phosphoramidites using a safer and cheaper activator

Sanghvi, Yogesh S.,Guo, Zhiqiang,Pfundheller, Henrik M.,Converso, Antonella

, p. 175 - 181 (2013/09/07)

A new, simplified commercial process for the preparation of nucleosidic phosphoramidites, key raw materials for the automated solid-supported synthesis of oligonucleotide-based drugs, was developed. Phosphitylation of a variety of protected nucleosidic derivatives (1-4) with a small excess of 2-cyanoethyl-N,N,N′,N′-tetraisopropyl phosphoramidite (5, bis-reagent) and pyridinium trifluoroacetate (Py·TFA) as the activator in an appropriate solvent at room temperature formed 75-96% of desired nucleosidic phosphoramidite products in less than 2 h. An efficient nonaqueous work-up has been developed to further streamline the isolation of moisture-sensitive P(III) nucleosidic compounds. The key finding is the use of Py·TFA, which is effective, inexpensive, stable, less acidic (pKa 5.2) than 1H-tetrazole, nontoxic, safe, and highly soluble in organic solvents. The reaction mechanism for phosphitylation with Py TFA as an activator has also been studied. An improved, robust, and versatile process for the preparation of nucleotide phosphoramidites under very concentrated reaction conditions was developed to support commercial manufacture of oligonucleotide-based drugs.

Facile synthesis of oligodeoxyribonucleotides via the phosphoramidite method without nucleoside base protection

Hayakawa, Yoshihiro,Kataoka, Masanori

, p. 12395 - 12401 (2007/10/03)

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in > 95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include (5')GTCACGACGTTGTAAAACGAC(3') (21mer), (5')CAGGAAACAG-CTATGACCATG(3') (21mer), (5')CAAGTTGATGAACAATACTTCATACCTAAACT(3') (32mer), and (5')TATGGGCCTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTATT(3') (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.

A new protected acyl protecting group for exocyclic amino functions of nucleobases

Dreef-Tromp,Hoogerhout,Van Der Marel,Van Boom

, p. 427 - 430 (2007/10/02)

2-(Tert-butyldiphenylsilyloxymethyl)benzoyl chloride (SiOMB-Cl) reacts with the per-O-trimethylsilylated d-nucleosides C,G and A to give, after removal of the Si(Me)3 groups and 5′-O-protection with 4,4′-dimethoxytrityl chloride (DMT-Cl), the corresponding N-SiOMB-5′-O-DMT derivates, the SiOMB groups of which can easily be removed by fluoride ion. The SiOMB protected nucleosides proved to be suitable building units for the preparation of DNA fragments in solution and on a solid support.

Post a RFQ

Enter 15 to 2000 letters.Word count: 0 letters

Attach files(File Format: Jpeg, Jpg, Gif, Png, PDF, PPT, Zip, Rar,Word or Excel Maximum File Size: 3MB)

1 Customer Service

What can I do for you?
Get Best Price

Get Best Price for 140613-55-4