140613-55-4Relevant academic research and scientific papers
Convenient synthesis of N-unprotected deoxynucleoside 3′- phosphoramidite building blocks by selective deacylation of N-acylated species and their facile conversion to other N-functionalized derivatives
Ohkubo, Akihiro,Sakamoto, Kazushi,Miyata, Ken-Ichi,Taguchi, Haruhiko,Seio, Kohji,Sekine, Mitsuo
, p. 5389 - 5392 (2007/10/03)
(Chemical Equation Presented) A new route to N-unprotected deoxynucleoside 3′-phosphoramidite building blocks by use of highly selective N-deacylation of commercially available N-acylated deoxynucleoside 3′-phosphoramidites is described. These compounds could be readily converted to other types of N-protected species by facile N-acylations with acylating reagents.
Improved process for the preparation of nucleosidic phosphoramidites using a safer and cheaper activator
Sanghvi, Yogesh S.,Guo, Zhiqiang,Pfundheller, Henrik M.,Converso, Antonella
, p. 175 - 181 (2013/09/07)
A new, simplified commercial process for the preparation of nucleosidic phosphoramidites, key raw materials for the automated solid-supported synthesis of oligonucleotide-based drugs, was developed. Phosphitylation of a variety of protected nucleosidic derivatives (1-4) with a small excess of 2-cyanoethyl-N,N,N′,N′-tetraisopropyl phosphoramidite (5, bis-reagent) and pyridinium trifluoroacetate (Py·TFA) as the activator in an appropriate solvent at room temperature formed 75-96% of desired nucleosidic phosphoramidite products in less than 2 h. An efficient nonaqueous work-up has been developed to further streamline the isolation of moisture-sensitive P(III) nucleosidic compounds. The key finding is the use of Py·TFA, which is effective, inexpensive, stable, less acidic (pKa 5.2) than 1H-tetrazole, nontoxic, safe, and highly soluble in organic solvents. The reaction mechanism for phosphitylation with Py TFA as an activator has also been studied. An improved, robust, and versatile process for the preparation of nucleotide phosphoramidites under very concentrated reaction conditions was developed to support commercial manufacture of oligonucleotide-based drugs.
Facile synthesis of oligodeoxyribonucleotides via the phosphoramidite method without nucleoside base protection
Hayakawa, Yoshihiro,Kataoka, Masanori
, p. 12395 - 12401 (2007/10/03)
A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in > 95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include (5')GTCACGACGTTGTAAAACGAC(3') (21mer), (5')CAGGAAACAG-CTATGACCATG(3') (21mer), (5')CAAGTTGATGAACAATACTTCATACCTAAACT(3') (32mer), and (5')TATGGGCCTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTATT(3') (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.
A new protected acyl protecting group for exocyclic amino functions of nucleobases
Dreef-Tromp,Hoogerhout,Van Der Marel,Van Boom
, p. 427 - 430 (2007/10/02)
2-(Tert-butyldiphenylsilyloxymethyl)benzoyl chloride (SiOMB-Cl) reacts with the per-O-trimethylsilylated d-nucleosides C,G and A to give, after removal of the Si(Me)3 groups and 5′-O-protection with 4,4′-dimethoxytrityl chloride (DMT-Cl), the corresponding N-SiOMB-5′-O-DMT derivates, the SiOMB groups of which can easily be removed by fluoride ion. The SiOMB protected nucleosides proved to be suitable building units for the preparation of DNA fragments in solution and on a solid support.
