Welcome to LookChem.com Sign In|Join Free
  • or
C49H60N9O11PSi is a chemical with a specific purpose. Lookchem provides you with multiple data and supplier information of this chemical.

219649-87-3

Post Buying Request

219649-87-3 Suppliers

Recommended suppliers

  • Product
  • FOB Price
  • Min.Order
  • Supply Ability
  • Supplier
  • Contact Supplier

219649-87-3 Usage

Check Digit Verification of cas no

The CAS Registry Mumber 219649-87-3 includes 9 digits separated into 3 groups by hyphens. The first part of the number,starting from the left, has 6 digits, 2,1,9,6,4 and 9 respectively; the second part has 2 digits, 8 and 7 respectively.
Calculate Digit Verification of CAS Registry Number 219649-87:
(8*2)+(7*1)+(6*9)+(5*6)+(4*4)+(3*9)+(2*8)+(1*7)=173
173 % 10 = 3
So 219649-87-3 is a valid CAS Registry Number.

219649-87-3Downstream Products

219649-87-3Relevant academic research and scientific papers

Facile synthesis of oligodeoxyribonucleotides via the phosphoramidite method without nucleoside base protection

Hayakawa, Yoshihiro,Kataoka, Masanori

, p. 12395 - 12401 (1998)

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in > 95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include (5')GTCACGACGTTGTAAAACGAC(3') (21mer), (5')CAGGAAACAG-CTATGACCATG(3') (21mer), (5')CAAGTTGATGAACAATACTTCATACCTAAACT(3') (32mer), and (5')TATGGGCCTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTATT(3') (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.

Post a RFQ

Enter 15 to 2000 letters.Word count: 0 letters

Attach files(File Format: Jpeg, Jpg, Gif, Png, PDF, PPT, Zip, Rar,Word or Excel Maximum File Size: 3MB)

1 Customer Service

What can I do for you?
Get Best Price

Get Best Price for 219649-87-3