Welcome to LookChem.com Sign In|Join Free
  • or
Butanoic acid, 4-[4-[5-(4-methyl-1-piperazinyl)[2,5'-bi-1H-benzimidazol]-2'-yl]phenoxy]- is a chemical with a specific purpose. Lookchem provides you with multiple data and supplier information of this chemical.

682809-60-5

Post Buying Request

682809-60-5 Suppliers

Recommended suppliers

  • Product
  • FOB Price
  • Min.Order
  • Supply Ability
  • Supplier
  • Contact Supplier

682809-60-5 Usage

Check Digit Verification of cas no

The CAS Registry Mumber 682809-60-5 includes 9 digits separated into 3 groups by hyphens. The first part of the number,starting from the left, has 6 digits, 6,8,2,8,0 and 9 respectively; the second part has 2 digits, 6 and 0 respectively.
Calculate Digit Verification of CAS Registry Number 682809-60:
(8*6)+(7*8)+(6*2)+(5*8)+(4*0)+(3*9)+(2*6)+(1*0)=195
195 % 10 = 5
So 682809-60-5 is a valid CAS Registry Number.

682809-60-5SDS

SAFETY DATA SHEETS

According to Globally Harmonized System of Classification and Labelling of Chemicals (GHS) - Sixth revised edition

Version: 1.0

Creation Date: Aug 18, 2017

Revision Date: Aug 18, 2017

1.Identification

1.1 GHS Product identifier

Product name Ho33258-O-butyric acid

1.2 Other means of identification

Product number -
Other names 4-{4-[5-(4-Methyl-piperazin-1-yl)-1H,1'H-[2,5']bibenzoimidazolyl-2'-yl]-phenoxy}-butyric acid

1.3 Recommended use of the chemical and restrictions on use

Identified uses For industry use only.
Uses advised against no data available

1.4 Supplier's details

1.5 Emergency phone number

Emergency phone number -
Service hours Monday to Friday, 9am-5pm (Standard time zone: UTC/GMT +8 hours).

More Details:682809-60-5 SDS

682809-60-5Downstream Products

682809-60-5Relevant academic research and scientific papers

Labelled compound capable of improving Tm value of oligonucleotide chain and application thereof

-

Paragraph 0027; 0028, (2018/03/26)

The invention relates to a labelled compound (I) capable of improving the Tm value of an oligonucleotide chain and an application thereof. The invention has the following main beneficial effects: thelabelled compound (HT succinate) capable of improving the Tm value of the oligonucleotide chain and the application thereof provided by the invention can effectively identify wild type and mutant typetemplates of DPYD * 9A loci by adopting a HT labelled probe, can be used for detecting tumors of a digestive system, and has important application prospects.

Solid-Phase Synthesis of Positively Charged Deoxynucleic Guanidine (DNG) Tethering a Hoechst 33258 Analogue: Triplex and Duplex Stabilization by Simultaneous Minor Groove Binding

Reddy, Putta Mallikarjuna,Bruice, Thomas C.

, p. 3736 - 3747 (2007/10/03)

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3′ → 5′ direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5′-terminus using PyBOP/HOBt chemistry. The stability of (DNA)2·DNG-H triplexes and DNA. DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5′-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3′, respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5′-terminus of the DNG enhances the (DNA)2·DNG-H triplex stability by a ΔTm of 13 °C. The fluorescence emission studies of (DNA)2·DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)2·DNG triplex stability by 11 °C, whereas (DNA)2·DNG-H triplex stability was decreased by 23 °C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 °C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA·DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA·DNG minor groove, and the duplex stability was enhanced by ΔTm of 7 °C. The stability of (DNA)2·DNG triplexes and DNA·DNG duplexes is independent of pH, whereas the stability of (DNA)2·DNG-H triplexes decreases with increase in pH.

Antitumor AHMA linked to DNA minor groove binding agents: Synthesis and biological evaluation

Rastogi, Kamesh,Chang, Jang-Yang,Pan, Wen-Yu,Chen, Ching-Huang,Chou, Ting-Chao,Chen, Li-Tzong,Su, Tsann-Long

, p. 4485 - 4493 (2007/10/03)

DNA minor groove binder hybrid molecules, netropsin derivatives such as N-[2-(dimethylamino)-ethyl]-1-methyl-4-aminopyrrolo-2-carboxamide (MePy) or its derivatives containing two units of N-methylpyrrolecarboxamide (diMePy) and bisbenzimidazole (Ho33258),

Post a RFQ

Enter 15 to 2000 letters.Word count: 0 letters

Attach files(File Format: Jpeg, Jpg, Gif, Png, PDF, PPT, Zip, Rar,Word or Excel Maximum File Size: 3MB)

1 Customer Service

What can I do for you?
Get Best Price

Get Best Price for 682809-60-5