Detection of triplet repeat sequences in the double-stranded DNA using pyrene-functionalized pyrrole-imidazole polyamides with rigid linkers

Article abstract of DOI:10.1016/j.bmc.2008.04.060

Methods for sequence-specific detection in double-stranded DNA (dsDNA) are becoming increasingly useful and important as diagnostic and imaging tools. Recently, we designed and synthesized pyrrole (Py)-imidazole (Im) polyamides possessing two pyrene moieties, 1, which showed an increased excimer emission in the presence of (CAG)₁₂-containing oligodeoxynucleotides (ODN) 1 and 2. In this study, we synthesized bis-pyrenyl Py-Im polyamides with rigid linkers 2, 3, and 4 to improve their fluorescence properties. Among the conjugates, 2 showed a marked increase in excimer emission, which was dependent on the concentration of the target ODN and the number of CAG repeats in the dsDNA. Unlike conjugate 1, which has flexible linkers, the excimer emission intensity of 2 was retained at over 85%, even after 4 h. Py-Im polyamides have the potential to be important diagnostic molecules for detecting genetic differences between individuals.

Full text of DOI:10.1016/j.bmc.2008.04.060

Available online at www.sciencedirect.com
Bioorganic & Medicinal Chemistry 16 (2008) 5899–5907
Detection of triplet repeat sequences in the double-stranded
DNA using pyrene-functionalized pyrrole–imidazole
polyamides with rigid linkers
Jun Fujimoto, Toshikazu Bando,* Masafumi Minoshima, Shinsuke Uchida,
Makoto Iwasaki, Ken-ichi Shinohara and Hiroshi Sugiyama*
Department of Chemistry, Graduate School of Science, Kyoto University, Kitashirakawa-Oiwakecho, Sakyo, Kyoto 606-8502, Japan
Received 15 March 2008; revised 23 April 2008; accepted 24 April 2008
Available online 27 April 2008
Abstract—Methods for sequence-specific detection in double-stranded DNA (dsDNA) are becoming increasingly useful and impor-
tant as diagnostic and imaging tools. Recently, we designed and synthesized pyrrole (Py)–imidazole (Im) polyamides possessing two
pyrene moieties, 1, which showed an increased excimer emission in the presence of (CAG)12-containing oligodeoxynucleotides
(ODN) 1 and 2. In this study, we synthesized bis-pyrenyl Py–Im polyamides with rigid linkers 2, 3, and 4 to improve their fluores-
cence properties. Among the conjugates, 2 showed a marked increase in excimer emission, which was dependent on the concentra-
tion of the target ODN and the number of CAG repeats in the dsDNA. Unlike conjugate 1, which has flexible linkers, the excimer
emission intensity of 2 was retained at over 85%, even after 4 h. Py–Im polyamides have the potential to be important diagnostic
molecules for detecting genetic differences between individuals.
ꢀ 2008 Elsevier Ltd. All rights reserved.
1. Introduction
of sequence-specific alkylating Py–Im polyamides and
have investigated their chemical and biological proper-
ties.7–9 Recently, it has been shown that the sequence-
specific binding properties of Py–Im polyamides are use-
ful for the detection of specific sequences in duplex
DNA. For example, Dervan and co-workers have fo-
cused on Py–Im polyamide–fluorophore conjugates10–
There is an ever-increasing clinical need to diagnose
hereditary diseases in their early stages. Therefore, diag-
nostic molecules that directly detect specific double-
stranded DNA (dsDNA) sequences without the need
for denaturation, hybridization, washing, or labeling
of the DNA samples are attractive research subjects.1,2
12
and novel fluorescent scaffolds of Py–Im polyamides
without dye molecules.13
Minor groove-binding N-methylpyrrole (Py) and N-
methylimidazole (Im) polyamides uniquely recognize
each of the four Watson–Crick base pairs. An antiparal-
lel pairing of imidazole opposite to pyrrole (Im/Py) rec-
ognizes a G–C base pair, whereas a Py/Py pair
recognizes A–T or T–A base pairs. A b-alanine/b-ala-
nine (b/b) pair reads T–A and A–T pairs in the same
way as a Py/Py pair does.3,4 Thus, Py–Im polyamides
can sequence-specifically recruit various functional
groups into DNA.5,6 We have developed various types
It is known that the continuous intergenerational expan-
sion of simple trinucleotide CAG repeats in genomic
DNA results in hereditary disorders, such as Hunting-
ton’s disease, spinobulbar muscular atrophy, and several
ataxias.14 Therefore, small molecular probes that can
detect the number of CAG repeat sequences have the
potential to be important diagnostic tools for such
hereditary neurological diseases.15 We have already
demonstrated that Py–Im polyamide 1 (Fig. 1), contain-
ing two pyrene moieties, shows a strong excimer fluores-
cence that depends on the number of CAG repeat
sequences in dsDNA samples.16 However, from the
viewpoint of future biological applications, a longer
excitation wavelength of pyrene-functionalized polya-
mides is desired. More importantly, the intensity of the
Keywords: DNA binder; Pyrrole–imidazole polyamide; Fluorescence
detection; CAG repeat.
*
Corresponding authors. Tel.: +81 75 753 4002; fax: +81 75 753
3670; e-mail addresses: bando@kuchem.kyoto-u.ac.jp; hs@kuchem.
kyoto-u.ac.jp
0968-0896/$ - see front matter ꢀ 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2008.04.060

5900
J. Fujimoto et al. / Bioorg. Med. Chem. 16 (2008) 5899–5907
Figure 2. Schematic presentation of pyrene-functionalized Py–Im
polyamide interactions with target dsDNA.
ene molecules to efficiently form an intramolecular
excimer near the minor groove.
Figure 1. The chemical structures of bis-pyrenyl Py–Im polyamides
with flexible butyl linkers 1, and rigid linkers 2, 3, and 4.
2.2. Monomer synthesis
We prepared 4-(9-fluorenylmethoxycarbonyl)amino-1-
(2-propynyl)pyrrole-2-carboxylic acid (8a) and 4-(9-flu-
orenylmethoxycarbonyl)amino-1-(4-iodobenzyl)pyrrole-
2-carboxylic acid (8b) according to the procedure shown
in Scheme 1. Methyl 4-(tert-butoxycarbonyl)aminopyr-
role-2-carboxylate (6) was synthesized from the starting
material 528,29 by subsequent reduction and protection
using palladium–carbon and (Boc)2O under hydrogen
gas. Although an amino pyrrole intermediate was
formed under these conditions, the addition of (Boc)2O
and TEA during the course of the reaction reduced any
unreacted amine and provided 5 in a high yield. By using
TEA in this reaction, the production of N1-Boc pro-
tected pyrrole was reduced to trace amount. Alkylation
of the resultant 6 with propargyl bromide or 4-iodoben-
zyl bromide followed by hydrolysis using LiOH pro-
excimer emission of conjugate 1 is unsustainable, and
decreases markedly within a period of several minutes
after the addition of oligodeoxynucleotides (ODN) 1
and 2.
Taking these points into consideration, we newly syn-
thesized and evaluated Py–Im polyamides with two pyr-
enes: 2, 3, and 4 (Fig. 1). The two pyrenes are attached
to an internal pyrrole ring by rigid linkers in these
molecular probes. Importantly, the excitation wave-
lengths of these conjugates are shifted to the red com-
pared with conjugate 1. In particular, conjugate 2
shows a stronger excimer signal than conjugate 1 does.
Moreover, the excimer emission intensity of 2 is retained
at over 85%, even after a period of 4 h.
2. Results and discussion
2.1. Molecular design
We have already reported Py–Im polyamide 1, which
recognizes a seven base pair sequence, 50-AGCAGCA-
30, and shows excimer fluorescence.16 Conjugate 1 was
designed based on the concept of the molecular bea-
con.17–23 As shown in Figure 2, we hypothesized a
molecular interaction model. When polyamide binds to
the target dsDNA, two pyrene moieties are located in
close proximity, and excimer formation occurs exhibit-
ing a consequent longer wavelength excimer emission.
To improve the emission properties, we chose both a
propynyl linker (for conjugates 2 and 3) and an ethy-
nylbenzyl linker (for conjugate 4) as the rigid linker
(Fig. 1). Recently, several researchers have shown the
improved photochemical properties of various
alkynylpyrenes or alkynylperylenes.24–27 In addition,
we expected that rigid linkers would restrict the geome-
try of the dye molecules, which could lead the two pyr-
Scheme 1. Preparation of two new monomers for Fmoc solid-phase
synthesis. Reagents: (i) H2, Pd/C, (Boc)2O, TEA, and DMF; (ii)
propargyl bromide or 4-iodobenzyl bromide, K2CO3, tetra-n-butyl-
ammonium iodide, and acetone; (iii) LiOH, H2O, and THF; (iv) 3 M
HCl and AcOEt, (v) FmocONSu, NaHCO3, H2O, and DMF.

J. Fujimoto et al. / Bioorg. Med. Chem. 16 (2008) 5899–5907
5901
vided 7a and 7b. The removal of the t-Boc protecting
group and subsequent Fmoc protection produced 8a
and 8b, respectively.
2.4. UV–visible absorption spectra, fluorescence spectra,
and photophysical data
Figure 3 shows the UV–visible absorption and fluores-
cence spectra of bis-pyrenyl polyamides 1–4 in a DMF
solution, and Table 1 lists the photophysical data for
1–4 (the absorption maxima, absorption coefficients,
and the monomer emission maxima). Compared with
conjugate 1, conjugates 2 and 3 revealed a bathochromic
shift of 20 nm in the absorption maximum derived from
pyrene moieties, and the absorption peak of conjugate 4
was shifted 24 nm further into the red (Fig. 3 and Table
1). Similarly, the monomeric fluorescence maxima of
conjugates 2–4 shifted to longer wavelengths as well
(Fig. 3 and Table 1). These changes in absorption and
fluorescence maxima indicate that the electronic proper-
ties of the bis-pyrenyl polyamides were improved by the
extension of p-orbital conjugation via alkynyl bridges.
Conversely, the absorption coefficients of the conjugates
decreased consecutively with p-orbital extension.
2.3. Synthesis of conjugates 2–4
The synthetic schemes for conjugates 2, 3, and 4 are
shown in Scheme 2. The polyamides were synthesized
using an Fmoc solid-phase chemical synthesis method
similar to a published procedure30,31 using HCTU as
the coupling reagent. After the completion of solid-
phase synthesis, the polyamides were cleaved from
the resins by aminolysis with N,N-dimethyl-1,3-pro-
panediamine to produce polyamides 9–11. Crude 9
was coupled with 1-bromopyrene using the Sonogash-
ira method to produce the desired polyamide 2 possess-
ing two pyrene moieties. From polyamide 10,
conjugate 3 was prepared using a synthetic procedure
similar to that of 2, and conjugate 4 was synthesized
from the Sonogashira coupling of polyamide 11 with
1-ethynylpyrene. The structures of conjugates 2–4 were
confirmed by electrospray ionization time-of-flight
mass spectrometry (ESI-TOF-MS) after purification
using reverse-phase HPLC. Purified polyamides were
used for evaluation of their steady-state emission
properties.
2.5. Fluorescence of conjugates 2–4 in the presence of
CAG repeat sequences
The fluorescence properties of the polyamides with two
pyrene cores 2, 3, and 4 in the presence and absence of
Scheme 2. Synthetic schemes for the preparation of bis-pyrenyl Py–Im polyamides 2, 3, and 4 with rigid linkers. Reagents: (i) Fmoc solid-phase
synthesis was followed by processing with N,N-dimethyl-1,3-propanediamine; (ii) 1-bromopyrene, [Pd(PPh3)]4, CuI, TEA, and DMF; (iii) 1-
ethynylpyrene, [Pd(PPh3)]4, CuI, TEA, and DMF.

5902
J. Fujimoto et al. / Bioorg. Med. Chem. 16 (2008) 5899–5907
Figure 3. UV–visible absorption spectra (black) and fluorescence spectra (red) of 1–4 in DMF ([1] = [2] = [3] = [4] = 100 lM), kem = 345, 365, 365,
and 363 nm for 1–4.
Table 1. Photophysical data
centration of ODN-1/2, the excimer emission of conju-
Polyamide kabs (nm) e (·104) (molꢀ1 dm3 cmꢀ1
)
kem (nm)
a
b
gate 3 was much weaker than that of 1 (Fig. 4C). The
monomer emission of 3 is quenched, even in the absence
of ODN, probably because the Py–Im polyamide scaffold
interacts with the pyrene moieties in the sample solution.
The difference in the spectra of 2 and 3 indicates that the
point of attachment of the pyrene molecules in the polya-
mides has a critical influence on the fluorescence proper-
ties, as observed in our previous study.16 In conjugate 4,
an excimer emission centered at 482 nm was observed
without ODN-1/2, and the excimer intensity of 4 corre-
lated weakly with the amount of target ODN (Fig. 4D).
Conjugate 4 has hydrophobic phenyl groups as rigid link-
ers, which led the pyrene molecules to form an excimer,
even in the absence of ODN. Of the conjugates that
showed an enhanced excimer emission depending on the
amount of the target DNA, we concluded that polyamide
2 was the most fascinating excimer-forming probe for the
detection of CAG repeat sequences. Conjugate 2 showed
optimal excimer fluorescence in the presence of target
DNA sequences, while the pyrene excimer did not form
in the absence of DNA. Furthermore, the excimer emis-
sion intensity of conjugate 2 at a DNA concentration of
5 lM was about two times higher than that of conjugate
1, and approximately four times higher than that of con-
jugate 3. We also noted that the ratio of the excimer inten-
sity to the monomer intensity (Iexcimer/Imonomer) in the
presence of 5 lM target DNA had a value of 4.8 for con-
jugate 1 and 1.8 for conjugate 3, while this increased to a
value of 12.1 for conjugate 2. These results suggest that
the two pyrene molecules in conjugate 2 can form an exci-
mer efficiently, which induces strong excimer emission.
1
2
3
4
345
365
365
389
9.4
9.1
9.1
7.1
398
409
409
417
[1] = [2] = [3] = [4] = 100 lM in DMF.
a kabs denotes the absorption maxima at the longest wavelength.
b kem denotes the fluorescence maxima at the longest wavelength.
the 41-mer (CAG)12-containing ODN-1/2 (Fig. 4A) were
examined. Initially, we confirmed that the excitation max-
ima of the hairpin polyamides with alkynylpyrenes 2–4
were longer than that of 1 (345 nm). Thus, the conjugates
were irradiated at their excitation maxima (365 nm for
conjugates 2 and 3, and 363 nm for conjugate 4), and
the steady-state fluorescence spectra were measured. As
a result, conjugate 2 showed a low background emission
around 490 nm in the absence of the target duplex
ODN-1/2, and a striking increase in emission centered
at 495 nm with increasing concentration of ODN-1/2
(Fig. 4B). In contrast, the intensity of the corresponding
bands for the pyrene monomer decreased, depending on
the concentration of the target ODN-1/2. It is likely that
the marked increase in long wavelength emission is de-
rived from a pyrene excimer formed on binding of the
polyamides to the minor groove of the dsDNA. More-
over, conjugate 2 revealed a bathochromic shift of
20 nm in the excimer emission maxima because of p-orbi-
tal extension via alkynyl linkers. While conjugate 3 also
showed excimer fluorescence that depended on the con-

J. Fujimoto et al. / Bioorg. Med. Chem. 16 (2008) 5899–5907
5903
Figure 4. (A) Sequences of ODN-1 and ODN-2. (B) Fluorescence titration spectra of conjugate 2 (10 lM) in a 5 mM sodium phosphate buffer (pH 7,
with 7% v/v DMF) in the presence of the target repeat sequence ODN-1/2 (0–5 lM). (C) Fluorescence titration spectra of conjugates 3 (10 lM) and
(D) 4 (10 lM) in a 5 mM sodium phosphate buffer (pH 7, with 7% v/v DMF) in the presence of the target repeat sequence ODN-1/2 (0–5 lM),
kex = 365 nm for conjugates 2 and 3 or 363 nm for conjugate 4.
2.6. Direct detection of the number of CAG repeat
sequences in dsDNA using conjugate 2
Therefore, we examined the change in excimer fluores-
cence of conjugate 2 with time. Figure 6 shows that
the excimer intensity of conjugate 2, with propynyl link-
ers (blue), was retained at over 85%, even after 4 h, while
that of 1, with butyl linkers (red), decreased to less than
half within a period of 30 min. Although the reason why
the excimer intensity of conjugate 2 is maintained is un-
clear, as far as we are aware, this is the first report dem-
onstrating that a decrease in the excimer emission
intensity may be prevented via the introduction of a ri-
gid linker.
Because it was found that conjugate 2 was a promising
excimer-forming probe for dsDNA that contains CAG
repeat sequences, we further investigated whether this
excimer emission could be used to quantify the number
of CAG repeat sequences. Four types of dsDNA con-
sisting of different numbers of CAG repeats (Fig. 5A)
were prepared, and the fluorescence properties of poly-
amide 2 in the presence of these sample DNAs were
examined. A strong excimer emission of conjugate 2
was observed that depended on the number of CAG re-
peat sequences (4–12), as shown in Figure 5B
([DNA] = 5 lM). Conversely, the excimer emission was
extremely weak using ODN-7/8 or ꢀ9/10, without
CAG repeats. This weak background signal would re-
sult in a higher signal-to-noise ratio (S/N). Unexpect-
edly, the monomer emission quenched in the presence
of the mismatched ODN-7/8 or ꢀ9/10. In addition, it
is worth noting that conjugate 2 could also distinguish
the number of CAG repeats at DNA concentrations of
1–4 lM as well (Fig. 5C). These results indicate the pos-
sible application of conjugate 2 to the quantification of
CAG repeat sequences in duplex DNA.
2.8. Surface plasmon resonance assay
To obtain further insight into the interactions of conju-
gate 2 with target sequences, the binding affinity of poly-
amide
2 and the parent Py–Im polyamide was
investigated using surface plasmon resonance (SPR)
methods and biotinylated hairpin DNA. The dissocia-
tion equilibrium constant (KD) was obtained by fitting
the resulting sensorgrams (Fig. 7A and B) to a theoret-
ical model. The value of KD for 2 was determined to be
8.37 · 10ꢀ7 M, which represents approximately a 60
times lower binding affinity of 2 than that of the parent
(KD = 1.39 · 10ꢀ8 M). A similar retardation of binding
has also been observed by Dervan and co-workers,
where they observed using quantitative footprinting
titration that the binding affinity of polyamides with
TMR at DNA match sites was reduced by a factor of
10–50 from the parent polyamides (R = CH3).10
Although the introduction of bulky pyrenyl groups
weakens binding to the DNA minor groove, the rigid
2.7. Thermal stability of the excimer formation of
conjugate 2
conjugate 1 as a biological tool to detect CAG triplet re-
peat sequences, there is a serious problem in that the
excimer intensity of 1 decreases markedly with time.

5904
J. Fujimoto et al. / Bioorg. Med. Chem. 16 (2008) 5899–5907
Figure 5. (A) Sequences of ODN 1–10. (B) Fluorescence titration spectra of conjugate 2 (10 lM) in a 5 mM sodium phosphate buffer (pH 7, with 7%
v/v DMF) in the presence of each ODN (5 lM). The black line shows the spectrum in the absence of ODN. (C) Fluorescence titration graph of
conjugate 2 ([2] = 10 lM, [sodium phosphate] = 5 mM, 7% v/v DMF, at pH 7, kem = 495 nm) in the presence of each ODN (1–5 lM). The relative
intensity was obtained by subtracting the background level of emission of 2 in the absence of ODN at 495 nm. The error bars denote the standard
deviation of the mean of triplicate samples, kex = 365 nm.
propynyl linker of conjugate 2 adjusts the binding loca-
tion, allowing the formation of excimer fluorescence.
amino)methylene]-5-chloro-1H-benzotriazolium 3-oxide-
hexafluorophosphate; (Boc)2O, di-tert-butyl dicarbon-
ate; TEA, triethylamine; FmocONSu, 9-fluorenylmethyl
succinimidyl carbonate; DMF, N,N-dimethylformam-
ide; DCM, dichloromethane; AcOEt, ethyl acetate;
Et2O, diethylether; THF, tetrahydrofuran. NMR
spectra were recorded with a JEOL JNM-FX 400 nucle-
ar magnetic resonance spectrometer, and tetramethylsil-
ane was used as the internal standard. Proton NMR
spectra were recorded in parts per million (ppm) down-
field relative to tetramethylsilane. The following abbre-
viations apply to spin multiplicity: s (singlet), d
(doublet), t (triplet), m (multiplet), br (broad). Electro-
spray ionization mass spectrometry (ESI-MS) and elec-
trospray ionization time-of-flight mass spectrometry
(ESI-TOF-MS) were performed on API150 (PE SCIEX)
and BioTOF II (Bruker Daltonics) mass spectrometers.
DNA oligonucleotides were purchased from Sigma–Al-
drich Co. Fluorescence measurements were performed
on Spectrofluorometer FP-6300 (JASCO). All ma-
chine-assisted polyamide syntheses were performed
on Liberty Microwave Peptide Synthesizer (CEM
Co.) with a computer-assisted operation system at a
0.10 mmol scale (200 mg of CLEAR resin, 0.52 meq/
g) by using Fmoc solid-phase chemistry. HPLC purifi-
cation was performed with a Chemcobond 5-ODS-H
reversed-phase column (10 · 150 mm) in 0.1% AcOH
with acetonitrile as eluent at a flow rate of 6.0 mL/
min, appropriate gradient elution conditions, and
detection at 254 or 365 nm.
3. Conclusions
We have successfully synthesized bis-pyrenyl Py–Im
polyamides with rigid linkers 2, 3, and 4 using Fmoc
solid-phase synthesis and a subsequent Sonogashira
coupling reaction. The steady-state fluorescence spectra
of the conjugates were measured to evaluate their fluo-
rescence properties. Among the conjugates studied,
pyrene-functionalized conjugate 2, with propynyl link-
ers, showed a clear increase in excimer emission that
depended on the concentration of the target ODN
and the number of CAG repeats in the target dsDNA.
Importantly, the excimer emission intensity of conju-
gate 2 was retained at over 85% even after 4 h. These
findings pave the way for the development of diagnos-
tic tools for detecting genetic differences between
individuals.
4. Experimental
4.1. Materials
Reagents and solvents were purchased from standard
suppliers and used without further purification. Abbre-
viations of some reagents: HCTU, 1-[bis(dimethyl-

J. Fujimoto et al. / Bioorg. Med. Chem. 16 (2008) 5899–5907
5905
29.5 mmol) in DMF (90 mL) was slowly added 10%
Pd/C (280 mg). After TEA (6.20 mL, 44.2 mmol) and
(Boc)2O (7.70 g, 35.3 mmol) were added dropwise, the
reaction mixture was stirred for 17 h at room tempera-
ture under hydrogen gas pressure. Then, TEA
(4.10 mL, 29.5 mmol) and (Boc)2O (6.80 g, 29.5 mmol)
were added again, and the reaction mixture was stirred
for another 3 h. The catalyst was removed by filtration
through Celite using AcOEt/hexane (1:1, 500 mL). The
organic phase was separated, washed with water (3·
200 mL), and saturated NaCl (200 mL), then dried over
anhydrous Na2SO4. After filtration, the solvent was
evaporated in vacuo to produce compound 6 (6.48 g,
92% yield) as a red powder. 1H NMR (400 MHz,
DMSO-d6) d = 11.54 (br s, 1H), 9.08 (s, 1H), 6.94 (s,
1H), 6.58 (s, 1H), 3.71 (s, 3H), 1.42 (s, 9H); ESI-TOF-
MS: m/z calcd for C11H17N2O4: [M+H]+ 241.12. Found:
241.18.
Figure 6. Time-course measurements of the fluorescence intensity of
conjugates (red) and (blue) ([2] = 10 lM, [sodium phos-
1
2
phate] = 5 mM, 7% v/v DMF, at pH 7, kem = 475 nm for 1 and
495 nm for 2) in the presence of ODN-1/2 (5 lM). The relative
intensity was obtained by subtracting the background level of the
emission of 1 and 2 in the absence of ODN at 475 nm (1) and 495 nm
(2), kex = 345 nm (1) and 365 nm (2).
4.1.2. 4-(tert -Butoxycarbonyl)amino-1-(2-propynyl)pyr-
role-2-carboxylic acid (7a). To a solution of compound
6 (2.41 g, 10.0 mmol) in toluene/H2O (3:1, 40 mL) were
added K2CO3 (4.15 g, 30.0 mmol) and Bu4NI (0.74 g,
2.00 mmol). After propargyl bromide (5.57 mL,
50.0 mmol) was added, the reaction mixture was stirred
for 14 h at 40 ꢁC. After adding water (50 mL) and
AcOEt (50 mL), the solution was partitioned between
the organic solution and water. The organic phase was
separated, washed with water (3· 50 mL), and saturated
NaCl (50 mL), then dried over anhydrous Na2SO4.
After filtration, the solution was concentrated to a
brown residue, which was used in the next step without
further purification. To a solution of crude product in
water/MeOH (1:2, 30 mL) was added LiOH monohy-
drate (8.40 g, 200 mmol). The reaction mixture was stir-
red for 4 h at 50 ꢁC, quenched by acetic acid (1.5 mL),
and then AcOEt (200 mL) was added. The organic
phase was separated, washed with water (3· 100 mL),
saturated NaCl (100 mL), dried over anhydrous
Na2SO4. After the filtration, the solution was concen-
trated to a residue, which was subjected to column chro-
matography (silica gel, 50% AcOEt in hexane) to
produce compound 7a (1.75 g, 66% yield for two steps)
as a white powder. 1H NMR (400 MHz, CDCl3)
d = 8.08 (br s, 1H), 7.46 (s, 1H), 6.77 (s, 1H), 6.26 (s,
1H), 5.10 (d, J = 2.8 Hz, 2H), 2.40 (s, 1H), 1.48 (s,
9H); ESI-TOF-MS: m/z calcd for C13H17N2O4:
[M+H]+ 265.12. Found: 265.18.
4.1.3. 4-(tert-Butoxycarbonyl)amino-1-(4-iodobenzyl)pyr-
role-2-carboxylic acid (7b). To a solution of compound 6
(2.20 g, 9.16 mmol) in acetone (80 mL) were added
K2CO3 (3.80 g, 27.5 mmol) and Bu4NI (0.68 g,
1.83 mmol). After 4-iodobenzyl bromide (3.00 g,
9.62 mmol) was added, the reaction mixture was stirred
for 15 h at 50 ꢁC. Evaporation of the solvent gave a
brown residue, which was collected by filtration, washed
with water, then dried to produce a yellow powder,
which was used in the next step without further purifica-
tion. To a solution of crude product in water/THF (1:2,
30 mL) was added LiOH monohydrate (7.69 g,
183 mmol). The reaction mixture was stirred for 2 days
at 50 ꢁC, quenched by acetic acid (1.8 mL), and then
Figure 7. SPR sensorgrams for the interaction of: (A) conjugate 2, and
(B) parent Py–Im polyamide with hairpin DNAs immobilized on the
surface of a sensor chip SA. All the experiments were performed in
HBS-EP buffer (0.01 M HEPES, pH 7, 0.15 M NaCl, 3 mM EDTA,
0.005% surfactant P20) with 7.0% DMSO (v/v) at 25 ꢁC, [2] = 625 nM
(lowest curve)–10 lM (highest curve), [parent] = 112 nM (lowest
curve)–894 nM (highest curve).
4.1.1. Methyl-4-(tert-butoxycarbonyl)aminopyrrole-2-
carboxylate (6). To a solution of compound 5 (5.01 g,

5906
J. Fujimoto et al. / Bioorg. Med. Chem. 16 (2008) 5899–5907
AcOEt (200 mL) was added. The organic phase was sep-
arated, washed with water (3· 100 mL), and saturated
NH4Cl (100 mL), then dried over anhydrous Na2SO4.
After filtration, the solution was evaporated in vacuo
board of a microwave synthesizer. DMF, DCM, 20%
piperidine in DMF, 20% acetic anhydride in DMF,
0.45 M HCTU in DMF, 2 M -Pr2NEt in DMF were
i
placed in the external bottles. Amino acids were weighed
to give 4 molar excess amounts, and DMF was added to
give standard 0.2 M amino acid solutions for use on the
instrument. Each monomer in DMF solution was
placed, respectively, in the loading position of the micro-
wave synthesizer. The synthesis was then started, con-
trolled by computer using the established program.
The reactions were performed using deprotection steps
of 180 s at 30 W (Tmax = 75 ꢁC) and coupling steps of
300 s at 25 W (Tmax = 75 ꢁC) and a final capping step
of 120 s at 50 W (Tmax = 75 ꢁC). All couplings were car-
ried out with single-couple cycles. After the completion
of the synthesis on the peptide synthesizer, the resin
was washed four times with DMF, methanol, and
DCM, respectively, and dried in a desiccator at room
temperature in vacuo. The resin (137 mg 57.0 lmol)
was then placed in a 10-mL glass scintillation vial,
2 mL of N,N-(dimethylamino)propylamine was added,
and the solution was stirred at 55 ꢁC overnight. The re-
sin was removed by filtration through a pad of Celite
and washed thoroughly with DCM. The solvent of the
filtrates was removed in vacuo, and the residue was used
in the next step without further purification. ESI-TOF-
MS: m/z calcd for C68H83N26O13: [M+H]+ 1471.66.
Found: 1471.90.
1
to produce compound 7b as a red-brown powder. H
NMR (400 MHz, CDCl3) d = 7.41 (d, J = 3.9 Hz, 2H),
7.00 (br s, 1H), 6.79 (d, J = 3.9 Hz, 2H), 6.61 (s, 1H),
6.35 (br s, 1H), 5.29 (br s, 2H), 1.44 (s, 9H); ESI-
TOF-MS: m/z calcd for C17H20IN2O4: [M+H]+ 443.05.
Found: 443.14.
4.1.4. 4-(9-Fluorenylmethoxycarbonyl)amino-1-(2-propy-
nyl)pyrrole-2-carboxylic acid (8a). The reaction mixture
of compound 7a (2.50 g, 9.46 mmol) in 12 M HCl/
AcOEt (1:3, 60 mL) was stirred for 4 h at room temper-
ature. Evaporation of the solvent gave a brown residue,
which was used in the next step without further purifica-
tion. To a solution of crude product in water/DMF (2:3,
130 mL) was added NaHCO3 (4.20 g, 50.0 mmol) and
FmocONSu (3.51 g, 10.4 mmol). The reaction mixture
was stirred for 14 h at room temperature under Argon
gas. After the quenching by 5% aq HCl, the precipitate
was collected by filtration, and then dried to produce 8a
(2.46 g, 67% yield for two steps) as a brown powder. 1H
NMR (400 MHz, CDCl3) d = 7.77 (d, J = 3.7 Hz, 2H),
7.60 (d, J = 3.7 Hz, 2H), 7.47 (s, 1H), 7.40 (t,
J = 7.4 Hz, 2H), 7.31 (t, J = 7.4 Hz, 2H), 6.82 (s, 1H),
6.47 (s, 1H), 5.11 (s, 2H), 4.50 (d, J = 3.2 Hz, 2H),
4.25 (t, J = 6.4 Hz, 1H), 2.41 (s, 1H); ESI-TOF-MS:
m/z calcd for C23H19N2O4: [M+H]+ 387.13. Found:
387.27.
4.1.7. AcImPypropynyl -b-ImPy-c-ImPypropynyl-b-ImPy-b-
Dp (10). A synthetic procedure similar to that used for
the preparation of compound 9 was followed to prepare
compound 10, using monomer 8a. ESI-MS: m/z calcd
for C68H83N26O13: [M+H]+ 1471.66. Found: 1472.0.
4.1.5. 4-(9-Fluorenylmethoxycarbonyl)amino-1-(4-iodob-
enzyl)pyrrole-2-carboxylic acid (8b). The reaction mix-
ture of compound 7b (3.98 g, 9.00 mmol) in 12 M HCl/
AcOEt (1:3, 100 mL) was stirred for 8 h at room temper-
ature. The precipitate was collected by filtration and
dried to produce a brown powder (2.00 g). To a solution
of crude product in water/DMF (1:3, 40 mL) were
added NaHCO3 (1.77 g, 21.1 mmol) and FmocONSu
(1.78 g, 5.28 mmol). The reaction mixture was stirred
for 18 h at room temperature under Argon gas. After
the quenching by 5% aq HCl, DCM (300 mL) and water
(300 mL) were added. The organic phase was separated,
and washed with water (3· 300 mL), then saturated
NH4Cl (20 mL), dried over anhydrous Na2SO4. After
the filtration, the solution was concentrated to a residue,
which was subjected to column chromatography (silica
gel, 25% AcOEt in hexane) to produce compound 8b
(1.92 g, 37% yield for four steps) as a brown powder.
1H NMR (400 MHz, DMSO-d6) d = 12.20 (br s, 1H),
9.49 (s, 1H), 7.89 (d, J = 3.8 Hz, 2H), 7.70 (d,
J = 3.8 Hz, 2H), 7.65 (d, J = 4.0 Hz, 2H), 7.41 (t,
J = 7.4 Hz, 2H), 7.33 (t, J = 7.4 Hz, 2H), 7.18 (s, 1H),
6.85 (d, J = 4.0 Hz, 2H), 5.44 (s, 2H), 4.43 (d,
J = 3.4 Hz, 2H), 4.26 (t, J = 6.4 Hz, 1H); ESI-TOF-
MS: m/z calcd for C27H22IN2O4: [M+H]+ 565.06.
Found: 565.18.
4.1.8. AcImPy-b-ImPyiodoBn -c-ImPyiodoBn-b-ImPy-b-Dp
(11). A synthetic procedure similar to that used for the
preparation of compound 9 was followed to prepare
compound 11, using monomer 8b. ESI-MS: m/z calcd
for C76H89I2N26O13: [M+H]+ 1827.52. Found: 1828.0.
4.1.9. AcImPy-b-ImPyPyB -c-ImPyPyB-b-ImPy-b-Dp (1).
Compound 1 was prepared by the reported procedure.16
4.1.10. AcImPy-b-ImPyPyP-c-ImPyPyP-b-ImPy-b-Dp (2).
To a solution of polyamide 9 in TEA/DMF (2:1,
1.8 mL), 1-bromopyrene (52.0 mg, 180 lmol), Pd(PPh3)4
(6.7 mg, 6.0 lmol), and CuI (1.1 mg, 6.0 lmol) were
added. The reaction mixture was refluxed for 14 h under
Argon gas. The solvent was removed in vacuo. The res-
idue was washed with Et2O and dissolved in approxi-
mately 0.5 mL of DMF. The polyamide solution was
analyzed and purified by preparatory HPLC at
365 nm. Appropriate fractions were washed with Et2O
to give the final desired polyamide 2 (7.2 mg, 6.6% yield
for 14 steps) as a yellow powder. ESI-TOF-MS: m/z
calcd for C100H100N26O13: [M+2H]2+ 936.61. Found:
936.66.
4.1.6. AcImPy-b-ImPypropynyl -c-ImPypropynyl-b-ImPy-b-
Dp (9). Fmoc-b-Ala-CLEAR-acid resin (200 mg,
0.10 mmol) was swollen in 3 mL of DMF in a 50-mL
plastic centrifuge tube for 30 min and placed on the
4.1.11. AcImPyPyP-b-ImPy-c-ImPyPyP-b-ImPy-b-Dp (3).
Compound 3 was prepared using a synthetic procedure
similar to that used for the preparation of compound
2, starting from Py–Im polyamide 10 (0.6 mg, 2.5% yield

J. Fujimoto et al. / Bioorg. Med. Chem. 16 (2008) 5899–5907
5907
for 14 steps). ESI-TOF-MS m/e calcd for
References and notes
C100H100N26O13: [M+2H]2+ 936.61. Found: 936.47.
1. Ihara, T.; Mukae, M. Anal. Sci. 2007, 23, 625–629.
2. Ghosh, I.; Stains, C. I.; Ooi, A. K.; Segal, S. J. Mol.
Biosyst. 2006, 2, 551–560.
3. Wemmer, D. E.; Dervan, P. B. Curr. Opin. Struct. Biol.
1997, 7, 355–361.
4.1.12. AcImPy-b-ImPyPyEB -c-ImPyPyEB-b-ImPy-b-Dp
(4). To a solution of polyamide 11 in TEA/DMF (2:1,
1.5 mL),
1-ethynylpyrene
(24.9 mg,
110 lmol),
Pd(PPh3)4 (5.6 mg, 5.0 lmol), and CuI (1.0 mg,
5.0 lmol) were added. The reaction mixture was stirred
at 80 ꢁC for 11 h under Argon gas. The solvent was re-
moved in vacuo. The residue was washed with Et2O
and dissolved in about 0.5 mL of DMF. The polyamide
solution was analyzed and purified by preparatory
HPLC at 385 nm. Appropriate fractions were washed
with Et2O to give the final desired polyamide 4
(4.0 mg, 4.0% yield for 14 steps) as a yellow powder.
ESI-TOF-MS: m/z calcd for C112H108N26O13:
[M+2H]2+ 1012.43. Found: 1012.53.
4. Dervan, P. B.; Edelson, B. S. Curr. Opin. Struct. Biol.
2003, 13, 284–299.
5. Dervan, P. B. Bioorg. Med. Chem. 2001, 9, 2215–2235.
6. Murty, M. S. R. C.; Sugiyama, H. Biol. Pharm. Bull. 2004,
27, 468–474.
7. Bando, T.; Sugiyama, H. Acc. Chem. Res. 2006, 39, 935–
944.
8. Sasaki, S.; Bando, T.; Minoshima, M.; Shimizu, T.;
Shinohara, K.; Takaoka, T.; Sugiyama, H. J. Am. Chem.
Soc 2006, 128, 12162–12168.
9. Minoshima, M.; Bando, T.; Sasaki, S.; Shinohara, K.;
Shimizu, T.; Fujimoto, J.; Sugiyama, H. J. Am. Chem.
Soc. 2007, 129, 5384–5390.
10. Rucker, V. C.; Foister, S.; Melander, C.; Dervan, P. B.
J. Am. Chem. Soc. 2003, 125, 1195–1202.
11. Rucker, V. C.; Dunn, A. R.; Sharma, S.; Dervan, P. B.;
Gray, H. B. . H. B. J. Phys. Chem. B 2004, 108, 7490–
7494.
12. Fechter, E. J.; Olenyuk, B.; Dervan, P. B. J. Am. Chem.
Soc 2005, 127, 16685–16691.
13. Chenoweth, D. M.; Viger, A.; Dervan, P. B. J. Am. Chem.
Soc 2007, 129, 2216–2217.
4.2. Steady-state fluorescence spectroscopy experiments
Steady-state fluorescence spectra were obtained using a
FP-6300 Spectrofluorometer (JASCO) with an excita-
tion wavelength of 365 nm (for conjugates 2 and 3) or
363 nm (for conjugate 4) in hybridization buffer, and oli-
gonucleotides at corresponding concentrations of conju-
gates 2–4. No special efforts were made to remove
oxygen from the reaction solution at room temperature.
14. Mirkin, S. M. Nature 2007, 447, 932–940.
15. Nakatani, K.; Hagihara, S.; Goto, Y.; Kobori, A.;
Hagihara, M.; Hayashi, G.; Kyo, M.; Nomura, M.;
Mishima, M.; Kojima, C. Nat. Chem. Biol. 2005, 1, 39–
43.
4.3. SPR assays
SPR experiments were performed on a Biacore X instru-
ment at 25 ꢁC. iotinylated hairpin DNA: 50-biotin- la-
beled GGCCAGCAGCAGCGTATACGCTGCTGC
TGGCC-30 was obtained from Sigma–Aldrich Co.
Streptavidin-functionalized SA sensor chips were pur-
chased from Biacore. After immobilization of hairpin
DNAs onto the sensor chips, measurements of binding
curves of polyamides to the hairpin DNA, and data pro-
cessing were performed according to following proce-
dure: different concentrations of polyamide solutions in
HBS-EP buffer with 7.0% DMSO were prepared by dilu-
tion from 10 mM stock solutions in DMSO. All binding
experiments were carried out using HBS-EP buffer with
7.0% DMSO as running buffer, and the running buffer
or 10 mM glycine–HCl (pH 1.5) was used as the regener-
ation solution. Typically, the buffer was injected at a flow
rate of 5 lL/min as a blank control after a stable baseline
was obtained, and then samples were injected under con-
ditions identical to those of buffer injection at concentra-
tions ranging from 625 nM to 10 lM for 2 and from 112
to 894 nM for parent Py–Im polyamide. Kinetic infor-
mation was obtained by global fitting of the response
units versus time using a model with mass transport ef-
fects using the BIA evaluation 4.1 program.
16. Bando, T.; Fujimoto, J.; Minoshima, M.; Shinohara, K.;
Sasaki, S.; Kashiwazaki, G.; Mizumura, M.; Sugiyama, H.
Bioorg. Med. Chem. 2007, 15, 6937–6942.
17. Yamanaka, K.; Iwai, T.; Ohtani, Y.; Sato, S.; Nakamura,
M.; Nakano, H. Bioconjug. Chem. 2002, 13, 1266–1273.
18. Fujimoto, K.; Shimizu, H.; Inoue, M. . M. J. Org. Chem.
2004, 69, 3271–3275.
19. Okamoto, A.; Ichiba, T.; Saito, I. J. Am. Chem. Soc. 2004,
126, 8364–8365.
20. Yang, C. J.; Jockusch, S.; Vicens, M.; Turro, N. J.; Tan,
W. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 17278–
17283.
21. Seo, Y. J.; Hwang, G. T.; Kim, B. H. Tetrahedron Lett.
2006, 47, 4037–4039.
22. Oh, K. J.; Cash, K. J.; Plaxco, K. W. . K. W. J. Am. Chem.
Soc. 2006, 128, 14018–14019.
23. Trkulja, I.; Biner, S. M.; Langenegger, S. M.; Ha¨ner, R.
ChemBioChem 2007, 8, 25–27.
24. Yang, S. W.; Elangovan, A.; Hwang, K. C.; Ho, T. I.
J. Phys. Chem. B 2005, 109, 16628–16635.
`
25. Geci, I.; Filichev, V. V.; Pedersen, E. B. Bioconjug. Chem.
2006, 17, 950–957.
26. Maeda, H.; Maeda, T.; Mizuno, K.; Fujimoto, K.;
Shimizu, H.; Inoue, M. Chem. Eur. J. 2006, 12, 824–831.
27. Astakhova, I. V.; Malakhov, A. D.; Stepanova, I. A.;
Ustinov, A. V.; Bondarev, S. L.; Paramonov, A. S.;
Korshun, V. A. Bioconjug. Chem. 2007, 18, 1972–1980.
28. Bremer, R. E.; Szewczyk, J. W.; Baird, E. E.; Dervan, P.
B. Bioorg. Med. Chem. 2000, 8, 1947–1955.
Acknowledgments
29. Kumar, R.; Lown, J. W. Org. Biomol. Chem. 2003, 1,
3327–3342.
30. Wurtz, N. R.; Turner, J. M.; Baird, E. E.; Dervan, P. B.
Org. Lett. 2001, 3, 1201–1203.
31. Belitsky, J. M.; Nguyen, D. H.; Wurtz, N. R.; Dervan, P.
B. Bioorg. Med. Chem. 2002, 10, 2767–2774.
This work was supported by a Grant-in-Aid for Priority
Research from the Ministry of Education, Culture,
Sports, Science, and Technology, Japan. The authors
acknowledge the support by the Global COE Program
‘Integrated Materials Science’ (#B-09).