Diarylethynyl amides that recognize the parallel conformation of genomic promoter DNA G-quadruplexes

Article abstract of DOI:10.1021/ja8046552

We report bis-phenylethynyl amide derivatives as a potent G-quadruplex binding small molecule scaffold. The amide derivatives were efficiently prepared in 3 steps by employing Sonogashira coupling, ester hydrolysis and a chemoselective amide coupling. Ligand-quadruplex recognition has been evaluated using a fluorescence resonance energy transfer (FRET) melting assay, surface plasmon resonance (SPR), circular dichroism (CD) and ¹H nuclear magnetic resonance (NMR) spectroscopy. While most of the G-quadruplex ligands reported so far comprise a planar, aromatic core designed to stack on the terminal tetrads of a G-quadruplex, these compounds are neither polycyclic, nor macrocyclic and have free rotation around the triple bond enabling conformational flexibility. Such molecules show very good binding affinity, excellent quadruplex:duplex selectivity and also promising discrimination between intramolecular promoter quadruplexes. Our results indicate that the recognition of the c-kit2 quadruplex by these ligands is achieved through groove binding, which favors the formation of a parallel conformation.

Full text of DOI:10.1021/ja8046552

Published on Web 11/04/2008
Diarylethynyl Amides That Recognize the Parallel
Conformation of Genomic Promoter DNA G-Quadruplexes
Jyotirmayee Dash, Pravin S. Shirude, Shang-Te Danny Hsu, and
Shankar Balasubramanian*
The UniVersity Chemical Laboratory, UniVersity of Cambridge, Lensfield Road, Cambridge,
CB2 1EW, U.K.
Received June 26, 2008; E-mail: sb10031@cam.ac.uk
Abstract: We report bis-phenylethynyl amide derivatives as a potent G-quadruplex binding small molecule
scaffold. The amide derivatives were efficiently prepared in 3 steps by employing Sonogashira coupling,
ester hydrolysis and a chemoselective amide coupling. Ligand-quadruplex recognition has been evaluated
using a fluorescence resonance energy transfer (FRET) melting assay, surface plasmon resonance (SPR),
circular dichroism (CD) and 1H nuclear magnetic resonance (NMR) spectroscopy. While most of the
G-quadruplex ligands reported so far comprise a planar, aromatic core designed to stack on the terminal
tetrads of a G-quadruplex, these compounds are neither polycyclic, nor macrocyclic and have free rotation
around the triple bond enabling conformational flexibility. Such molecules show very good binding affinity,
excellent quadruplex:duplex selectivity and also promising discrimination between intramolecular promoter
quadruplexes. Our results indicate that the recognition of the c-kit2 quadruplex by these ligands is achieved
through groove binding, which favors the formation of a parallel conformation.
and KRAS,9a and for each of these cases there is evidence that
the binding of small molecules to the associated G-quadruplex
Introduction
Genomic G-quadruplex forming nucleic acids have generated
considerable recent interest as prospective targets for chemical
intervention of biological function.1 G-rich sequences are found
in the telomeres at the chromosome ends,2 and telomere binding
proteins can control the G-quadruplex formation in ViVo.3 Small
molecules that selectively bind G-quadruplex DNA can inhibit
the enzymatic action of telomerase4 and interfere with telomere
function.5 G-quadruplex sequence motifs are widespread through-
out the genome6 and are particularly enriched in gene
promoters.7-9 Promoter quadruplexes associated with proto-
oncogenes that have been characterized include c-myc,7a c-kit,8
can modulate transcription.7,9
Furthermore, small molecule-G-quadruplex recognition is
currently being explored for creating nanomolecular devices10
and developing nucleic acid based catalysis.11 Most G-quadru-
plex ligands reported so far comprise a planar, aromatic core
designed to stack on the terminal tetrads of a G-quadruplex.12
Examples include polyaromatic hydrocarbons and conforma-
tionally constrained macrocyclic frameworks.12 Given that many
(8) (a) Rankin, S.; Reszka, A. P.; Huppert, J.; Zloh, M.; Parkinson, G. N.;
Todd, A. K.; Ladame, S.; Balasubramanian, S.; Neidle, S. J. Am. Chem.
Soc. 2005, 127, 10584. (b) Fernando, H.; Reszka, A. P.; Huppert, J.;
Ladame, S.; Rankin, S.; Venkitaraman, A. R.; Neidle, S.; Balasubra-
manian, S. Biochemistry 2006, 45, 7854.
(1) (a) Davis, J. Angew. Chem., Int. Ed. 2004, 43, 668. (b) Burger, A. M.;
Dai, F.; Schultes, C. M.; Reszka, A. P.; Moore, M. J. B.; Double,
J. A.; Neidle, S. Cancer Res. 2005, 65, 1489. (c) Mandine, E.; Riou,
J.-F.; Mergny, J.-L.; Mailliet, P.; Boussin, F. Oncogene 2005, 24, 2917.
(d) Han, H.; Hurley, L. H. TiPS 2000, 21, 136. (e) Qin, Y.; Hurley,
L. H. Biochimie 2008, 90, 1149.
(9) (a) Ou, T. M.; Lu, Y. J.; Huang, Z. S.; Wang, X. D.; Tan, J. H.; Chen,
Y.; Ma, D. L.; Wong, K. Y.; Tang, J. C.; Chan, A. S.; Gu, L. Q.
J. Med. Chem. 2007, 50, 1465. (b) Qin, Y.; Rezler, E. M.; Gokhale,
V.; Sun, D.; Hurley, L. H. Nucleic Acids Res. 2007, 35, 1. (c) Bejugam,
M.; Sewitz, S.; Shirude, P. S.; Rodriguez, R.; Shahid, R.; Balasubra-
manian, S. J. Am. Chem. Soc. 2007, 129, 12926. (d) Sun, D.; Liu,
W.-J.; Guo, K.; Rusche, J. J.; Ebbinghaus, S.; Gokhale, V.; Hurley,
L. H. Mol. Cancer Ther. 2008, 7, 880.
(2) Sen, D.; Gilbert, W. Nature 1990, 344, 410.
(3) Paeschke, K.; Simonsson, T.; Postberg, J.; Rhodes, D.; Lipps, H. J.
Nat. Struct. Mol. Biol. 2005, 12, 847.
(4) (a) Cerone, M. A.; Londono-Vallejo, J. A.; Autexier, C. Oncogene
2006, 25, 7411. (b) Gomez, D.; Paterski, R.; Lemarteleur, T.; Shin-
ya, K.; Mergny, J.-L.; Riou, J.-F. J. Biol. Chem. 2004, 279, 41487.
(5) (a) Gomez, D.; Wenner, T.; Brassart, B.; Douarre, C.; O’Donohue,
M.-F.; Khoury, V. E.; Shin-ya, K.; Morjani, H.; Trentesaux, C.; Riou,
J.-F. J. Biol. Chem. 2006, 281, 38721. (b) Gomez, D.; O’Donohue,
M.-F.; Wenner, T.; Douarre, C.; Macadre´, J.; Koebel, P.; Giraud-Panis,
M. J.; Kaplan, H.; Kolkes, A.; Shin-ya, K.; Riou, J.-F. Cancer Res.
2006, 66, 6908.
(10) (a) Alberti, P.; Bourdoncle, A.; Sacca`, B.; Lacroix, L.; Mergny, J.-L.
Org. Biomol. Chem. 2006, 4, 3383. (b) Xu, Y.; Hirao, Y.; Nishimura,
Y.; Sugiyama, H. Bioorg. Med. Chem. 2007, 1275.
(11) Tang, Z.; Gonc¸alves, D. P. N.; Wieland, M.; Marx, A.; Hartig, J. S.
ChemBioChem 2008, 9, 1061.
(12) For a recent review, see: (a) Monchaud, D.; Teulade-Fichou, M.-P.
Org. Biomol. Chem 2008, 6, 627. For few specific examples, see: (b)
Dash, J.; Shirude, P. S.; Balasubramanian, S. Chem. Commun. 2008,
3055. (c) Shirude, P. S.; Gilles, E. R.; Ladame, S.; Godde, F.; Shin-
ya, K.; Huc, I.; Balasubramanian, S. J. Am. Chem. Soc. 2007, 129,
11890. (d) Cian, A. D.; DeLemos, E.; Mergny, J.-L.; Teulade-Fichou,
M.-P.; Monchaud, D. J. Am. Chem. Soc. 2007, 129, 1856. (e) Dixon,
I. M.; Lopez, F.; Tejera, A. M.; Este`ve, J.-P.; Blasco, M. A.; Pratviel,
G.; Meunier, B. J. Am. Chem. Soc. 2007, 129, 1502. (f) Reed, J. E.;
Arnal, A. A.; Neidle, S.; Vilar, R. J. Am. Chem. Soc. 2006, 128, 5992.
(6) (a) Huppert, J. L.; Balasubramanian, S. Nucleic Acids Res. 2007, 35,
406. (b) Huppert, J. L.; Balasubramanian, S. Nucleic Acids Res. 2005,
33, 2908. (c) Todd, A. K.; Johnston, M.; Neidle, S. Nucleic Acids
Res. 2005, 33, 2901.
(7) (a) Siddiqui-Jain, A.; Grand, C. L.; Bearss, D.; Hurley, L. H. Proc.
Natl. Acad. Sci. U.S.A. 2002, 99, 11593. (b) Cogoi, S.; Xodo, L. E.
Nucleic Acids Res. 2006, 34, 2536.
9
15950 J. AM. CHEM. SOC. 2008, 130, 15950–15956
10.1021/ja8046552 CCC: $40.75
2008 American Chemical Society

Genomic Promoter DNA G-Quadruplexes
A R T I C L E S
Scheme 1. Synthesis of Water Soluble Bis-phenylethynyl Derivatives
G-quadruplex sequences may exist within a genome,6 it is now
a necessary challenge for chemists to engineer discrimination
between G-quadruplexes by small molecules. In principle, there
are opportunities to design small molecules that bind through
distinct sites, other than the G-tetrad, involving the G-quadruplex
loops and grooves, but this has been largely unexplored.13
Here we present bis(phenylenethynyl) amides meta linked
to benzene 9 and 2,6-pyridine 10 that recognize G-quadruplex
DNA. Such compounds are neither polycyclic, nor macrocyclic
and have free rotation around the triple bond enabling the
adoption of all possible twisted and planar conformations of
the aryl groups. Owing to their conformational flexibility, we
perceived ligands 9 and 10 would offer the potential for modes
of G-quadruplex recognition other than the more typical G-tetrad
binding site. The lone pair of the pyridine nitrogen atom of 10
and the free amino and amide groups of 9 and 10 have potential
to participate in H-bonding interactions with the grooves and
loops of the G-quadruplex DNA. In addition, there is potential
for electrostatic interactions of the amine side chains with the
negatively charged sugar phosphate backbone.
7 with amine 8. The amide coupling reactions were carried out
using EDC, HOBT and N-methylmorpholine (NMM) in DMF.
Ligand-Quadruplex Recognition. Ligand-quadruplex recogni-
tion was evaluated using a fluorescence resonance energy
transfer (FRET) melting assay,15 surface plasmon resonance
(SPR),16 circular dichroism (CD)13,17 and 1H nuclear magnetic
resonance (NMR) spectroscopy.18,19 In order to elucidate
differential recognition by the small molecule ligands 9 and 10,
we employed the three distinct biologically relevant promoter
G- quadruplex DNA targets c-myc,7a c-kit1,8a c-kit2,8b and a
duplex DNA (dup) as a control.
Fluorescence Resonance Energy Transfer (FRET) Melting
Assay. FRET melting analysis determines the ligand-induced
stabilization of a folded quadruplex by measurement of the
ligand induced shift in the melting temperature (∆Tm).15 The
FRET melting data, obtained using dual-labeled sequences, is
(15) (a) Darby, R. A. J.; Sollogoub, M.; McKeen, C.; Brown, L.; Risitano,
A.; Brown, N.; Barton, C.; Brown, T.; Fox, K. R. Nucleic Acids Res.
2002, 30, e39. (b) Cian, A. De.; Guittat, L.; Kaiser, M.; Sacca, B.;
Amrane, S.; Bourdoncle, A.; Alberti, P.; Teulade-Fichou, M.-P.;
Lacroix, L.; Mergny, J.-L. Methods 2007, 42, 183.
Results and Discussion
(16) (a) Teulade-Fichou, M.-P.; Carrasco, C.; Guittat, L.; Bailly, C.; Alberti,
P.; Mergny, J.-L.; David, A.; Lehn, J.-M.; Wilson, W. D. J. Am. Chem.
Soc. 2003, 125, 4732. (b) Schouten, J. A.; Ladame, S.; Mason, S. J.;
Cooper, M. A.; Balasubramanian, S. J. Am. Chem. Soc. 2003, 125,
5594.
Synthesis of Ligands. The water soluble bis-phenylethynyl
amides 9 and 10 were efficiently prepared in 64-68% overall
yields over 3 steps (Scheme 1). The synthesis involves Pd-
mediated Sonogashira coupling14 of iodoaniline derivative 1 with
1,3-diethynyl-benzene (2) and 2,6-diethynyl-pyridine (3) in the
presence of CuI, Et3N, and a catalytic amount of PdCl2(PPh3)2
in DMF. The corresponding diester derivatives 4 and 5 were
obtained in 78-83% yield.12b Basic hydrolysis of the diester
derivatives 4 and 5 afforded the diacids 6 and 7 respectively in
excellent yield. The amides 9 and 10 were acquired in 87-90%
yield by using chemoselective amide coupling of diacids 6 and
(17) (a) Paramasivan, S.; Rujan, I.; Bolton, P. H. Methods 2007, 43, 324.
(b) Balagurumoorthy, P.; Brahmachari, S. K. J. Biol. Chem. 1994,
269, 21858. (c) Jin, B.; Gaffney, L.; Wang, C.; Jones, R. A.; Breslauer,
K. J. Proc. Natl. Acad. Sci. U.S.A. 1992, 89, 8832.
(18) (a) Patel, D. J.; Phan, A. T.; Kuryavyi, V. Nucleic Acids Res. 2007,
35, 7429. (b) Silva, M. Webba da Methods 2007, 43, 264. (c) Phan,
A. T.; Kuryavyi, V.; Gaw, H. Y.; Patel, D. J. Nat. Chem. Biol. 2005,
1, 167. (d) Patel, D. J.; Phan, A. T. J. Am. Chem. Soc. 2003, 125,
15021. (e) Read, M. A.; Neidle, S. Biochemistry 2000, 39, 13422. (f)
Gavathiotis, E.; Heald, R. A.; Stevens, M. F. G.; Searle, M. S. Angew.
Chem., Int. Ed. 2001, 40, 4749. (g) Fedoroff, O. Y.; Salazar, M.; Han,
H.; Chemeris, V. V.; Kerwin, S. M.; Hurley, L. H. Biochemistry 1998,
37, 12367.
(13) White, E. W.; Tanious, F.; Ismail, M. A.; Reszka, A. P.; Neidle, S.;
Boykin, D. W.; Wilson, W. D. Biophysical Chemistry 2007, 126, 140.
(14) For reviews, see: (a) Sonogashira, K. In Metal-Catalyzed Cross-
coupling Reactions; Diederich, F., Stang, P. J., Eds.; Wiley-VCH:
Weiheim, Germany, 1998; pp 203-229. (b) Negishi, E.-I.; Anastasia,
L. Chem. ReV. 2003, 103, 1979.
(19) (a) Martino, L.; Virno, A.; Pagano, B.; Virgilio, A.; Di Micco, S.;
Galeone, A.; Giancola, C.; Bifulco, G.; Mayol, L.; Randazzo, A. J. Am.
Chem. Soc. 2007, 129, 16048. (b) Cocco, M. J.; Hanakahi, L. A.;
Huber, M. D.; Maizels, N. Nucleic Acids Res. 2003, 31, 2944. (c)
Randazzo, A.; Galeone, A.; Mayol, L. Chem. Commun. 2001, 1030.
9
J. AM. CHEM. SOC. VOL. 130, NO. 47, 2008 15951

A R T I C L E S
Dash et al.
Table 1. G-Quadruplex Stabilization (∆Tm) Potential by
as compared to 2:1 for c-myc and c-kit1. This distinction may
reflect the differences in binding sites between the three
quadruplexes, each of which has a unique configuration of loop
sequences. A clear outcome is that ligand 10 with a central
pyridine ring shows higher stabilization temperatures and
binding affinities compared to the benzene analogue 9 (Table
1, Figures 1 and 2).
FRET-Melting and Dissociation Constants (Kd) Measured by SPR
dup
(58 ( 1)a
Ligand
c-myc (77 ( 1)a
c-kit2 (71 ( 1)a
c-kit1 (57 ( 1)a
∆Tm at 1 µM conc. (°C)
9
2.9
6.0
9.2
8.9
0.2
0.2
10 7.3
13.5
Kd [µM] and stoichiometry (n)
2.68 ( 0.06 (2:1) 4.44 ( 0.55 (2:1) 9.65(0.41(2:1)
10 0.57 ( 0.02 (2:1) 0.69 ( 0.03 (1:1) 3.04(0.08(2:1)
CD and NMR Spectroscopic Study of c-kit2 DNA G-quadru-
9
ndb
ndb
1
plex. CD spectroscopy13,17 and H NMR18,19 spectroscopy can
reveal the preference of ligands to induce or recognize a
particular quadruplex structure and can provide some insights
into the binding mode of ligands. To examine the fundamental
properties of G-quadruplex recognition we carried out ligand
binding studies with and without stabilizing salt. The CD
spectrum of c-kit2 suggests that, in the absence of any added
salt, it exists as a mixture of a parallel structure,8b with a major
positive peak at 263 nm, and a small proportion of an antiparallel
conformation as indicated by a minor peak at 295 nm (Figure
3A). Similarly the 1H NMR spectrum of c-kit2 reveals two sets
of imino proton resonances in the region of the spectrum
characteristic of G-tetrad formation; one cluster at δ 10.8-12
ppm18a and the other more dispersed at δ 9.6 and 12.3-13.8
ppm (Figure 4A). Based on the corresponding CD spectral data
for c-kit2 under similar salt and pH conditions, we attribute
that these imino proton resonances of c-kit2 corresponds to
parallel and antiparallel conformations. We performed a real
time titration of ligand 10 with c-kit2 quadruplex forming
sequences, in the absence of added salt, monitored by CD and
NMR spectroscopy (Figures 3 and 4). Upon each addition of
ligand 10 to c-kit2 quadruplex there are noteworthy changes in
the CD spectrum that involve an increase in ellipticity at 263
nm, with the disappearance of signal at 295 nm. This is
consistent with the induction of a predominantly parallel
conformation of the c-kit2 quadruplex by ligand 10 (Figure
3A).21 In the corresponding NMR experiment addition of ligand
10 to c-kit2 results in a concomitant decrease in intensity of
the dispersed set of signals at δ 9.6 and 12.3-13.8 ppm, and
an increase in intensity of the clustered set of signals at δ
10.8-12 ppm. The imino proton resonances of c-kit2, in the
presence of K+, are only observed in the region of δ 10.8-12
ppm (bottom spectra in red, Figure 4A), supporting our assertion
than ligand 10 favors the parallel conformation. We have
recently determined the dominant topology of c-kit2, in the
presence of K+, as a parallel conformation by multidimensional
1H NMR spectroscopy.22 In line with the structural information,
the CD spectra of c-kit2 shows existence of a predominantly
parallel conformation8b in the presence of K+ and ligand induced
CD spectral changes were less prominent (Figure 3B). Upon
addition of excess ligand (up to 10 mol equiv) to c-kit2, a slight
increase in ellipticity at 263 nm was observed.
a Tm in 60 mM potassium cacodylate buffer, pH 7.4 without ligand.
b No significant binding up to 25 µM.
summarized in Table 1 (Figure 1). Both ligands showed
moderate stabilization for G-quadruplexes (∆Tm ranging from
3-13 °C) with no detectable stabilization of duplex DNA.
Ligand 10 exhibits good stabilization potential (∆Tm ) 7.3 °C,
i.e. a Tm of 84 °C) for the c-myc quadruplex at 1 µM ligand
concentration (Figure 1B). The stabilization potential for c-kit2
by ligand 10 was found out to be 9.2 °C at 1 µM (i.e., Tm ) 80
°C). The observed ∆Tm of ligand 10 for c-kit1 was 13.5 °C
(i.e., Tm ) 71 °C) at 1 µM concentration. Ligand 9 exhibits a
stabilization potential of 2.9 °C for c-myc, 6.0 °C for c-kit2
and 8.9 °C for c-kit1 quadruplex at 1 µM concentration (Figure
1A, Table 1). It is interesting to note that ligands, 9 and 10
both show very high preference for stabilizing G-quadruplex
DNA over duplex DNA.
Surface Plasmon Resonance (SPR). While FRET melting
analysis provides a measure of the ligand-induced stabilization
of a folded quadruplex, SPR measures equilibrium binding. It
is noteworthy in SPR analysis that ligands show high affinity
for G-quadruplex motifs (Table 1, Figure 2). The dissociation
constant of ligand 10 for c-myc quadruplex DNA (Kd ) 570
nM) is comparable with the data obtained for one of the best
reported quadruplex ligands Se2SAP (Kd ) 620 nM for one of
the c-myc sequence).20 Similarly the Kd of ligand 10 for the
c-kit1 quadruplex (3.04 µM) compared favorably with the best
ligands (4.90 µM) from our recently reported isoalloxazine
series.9c Ligand 10 also binds to c-kit2 quadruplex with 1:1
stoichiometry and a submicromolar equilibrium dissociation
constant (Kd ) 690 nM). A 2:1 stoichiometry was found for
ligand 10 with c-myc and c-kit1 quadruplex targets, suggestive
of more than one mode of binding (Table 1, Figure 2B). Ligand
9 was found to bind c-myc, c-kit2 and c-kit1 with dissociation
constants (Kd) of 2.68, 4.44 and 9.65 µM, respectively (Table
1, Figure 2A). Ligands 9 and 10 show 1-2 fold selectivity for
c-myc over c-kit2, and 4-6 fold for c-myc over the c-kit1
quadruplex (Table 1).
The correlation between stabilization (∆Tm) and equilibrium
binding (Kd) is not straightforward and thus there is no simple
relationship between ∆Tm and Kd. However, for ligands 9 and
10 the trend for the Kd values obtained by SPR and G-
quadruplex stabilization effects as determined by FRET (Table
1), for a giVen quadruplex target were consistent with the
tightest binder (i.e., lower Kd) also inducing better thermal
stabilization (i.e., larger ∆Tm). For ligands 9 and 10 no detectable
binding to duplex DNA was observed by SPR, which was
consistent with very low ∆Tm vales by FRET melting, and
confirms the high selectivity for G-quadruplex DNA (Table 1).
Ligand 10 binds c-kit2 with an apparent stoichiometry of 1:1
Mode of Binding. When an achiral ligand binds to DNA, a
positive ICD signal has been taken as an indicator of groove
binding to duplex23,24 and to quadruplex13,25 structures. In the
CD spectroscopic analysis with c-kit2 (Figure 3), besides the
(21) Since the absorbance of achiral 10 (263, 351 nm) also overlaps at
263 nm, we can not rule out the contribution of ICD signal (at 263
nm) due to the chirality transfer of DNA to the ligand.
(22) Hsu, S.-T. D.; et al. Unpublished results.
(23) Eriksson, M.; Norde´n, B. Methods Enzymol. 2001, 340, 68.
ˇ
(24) (a) Hranjec, M.; Piantanida, I.; Kralj, M.; Suman, L.; Pavelie´, K.;
Karminski-Zamola, G. J. Med. Chem. 2008, 51, 4899. (b) Catoen-
Chackal, S.; Facompre´, M.; Houssin, R.; Pommery, N.; Goossens, J.-
F.; Colson, P.; Bailly, C.; He´nichart, J.-P. J. Med. Chem. 2004, 47,
3665.
(20) Seenisamy, J.; Bashyam, S.; Gokhale, V.; Vankayalapati, H.; Sun,
D.; Siddiqui-Jain, A.; Streiner, N.; Shin-ya, K.; White, E.; Wilson,
W. D.; Hurley, L. H. J. Am. Chem. Soc. 2005, 127, 2944.
9
15952 J. AM. CHEM. SOC. VOL. 130, NO. 47, 2008

Genomic Promoter DNA G-Quadruplexes
A R T I C L E S
Figure 1. FRET stabilization curves for ligand 9 (A) and ligand 10 (B) upon binding to c-myc, c-kit2, c-kit1, and dup DNA (buffer: 60 mM potassium
cacodylate pH 7.4).
Figure 2. SPR binding curves for ligand 9 (A) and ligand 10 (B) binding to c-myc, c-kit2, and c-kit1 (running buffer: 50 mM Tris-HCl pH 7.4, 100 mM
KCl).
Figure 3. CD spectra of a solution of 12.5 µM c-kit2 in Tris buffer (pH 7.4), in the absence (A) and presence (B) of added salt, 0-10 equiv of ligand 10.
ligand dependent increase in ellipticity at 263 nm21 we also
observed the appearance of a red-shifted induced signal (ICD)
at 380 nm. A bathochromic shift of 30 nm was also observed
in the UV/vis titration of ligand 10 with the c-kit2 G-quadruplex
forming sequence (see Supporting Information, S.I.). A similar
CD titration of 10 with c-myc quadruplex also revealed
induction of a parallel quadruplex structure and an ICD band
at 380 nm (S.I.). An ICD band at 380 nm was also observed
upon titration of 10 with the c-kit1 quadruplex, but with no
significant increase in ellipticity at 263 nm21 (parallel structure,
S.I.).26 The positive ICD signal shown by binding of 10 to c-kit2
(Figure 3), c-myc (S.I.) and c-kit1 (S.I.) is suggestive of a groove
binding mode in the quadruplex, and is consistent with our
design hypothesis which did not necessarily target G-tetrad
recognition.
(25) (a) Yamashita, T.; Uno, T.; Ishikawa, Y. Bioorg. Med. Chem. 2005,
13, 2423. (b) Sun, H.; Tang, Y.; Xiang, J.; Xu, G.; Zhang, Y.; Zhang,
H.; Xu, L. Bioorg. Med. Chem. Lett. 2006, 16, 3586.
(26) An apparent quadruplex unfolding was observed for c-kit1 quadruplex
upon addition of ligand 10 (at higher concentration than the Kd) in
the presence of K+ (see S.I.).
9
J. AM. CHEM. SOC. VOL. 130, NO. 47, 2008 15953

A R T I C L E S
Dash et al.
H8 protons in the G-terad, which argues against end-stacking
to a G-tetrad.19b In addition, we also observe some degrees of
protection for the amino protons of c-kit2, which also reside in
the groove region and may be sequestered from solvent
exchange in the presence of ligand 10, as evidenced by the
presence of some very broad amino proton (NH2) correlations
in the 2D NOESY spectrum; such correlations are completely
absent in the spectrum of free c-kit2 (S.I.). Together, these NMR
spectroscopic data strongly support groove binding mode for
ligand 10.
Experimental Section
Chemistry. All experiments were carried out under inert
atmosphere unless otherwise stated. 1H NMR spectra were recorded
1
at 500 MHz using Bruker DRX 500 instrument. H spectra were
recorded in deuterated solvents as detailed. Chemical shifts are
reported in parts per million (ppm) and are referenced to the residual
solvent peak. The following abbreviations are used: s, singlet; d,
doublet; t, triplet; q, quartet; m, multiplet; br, broad. Data are
reported in the following manner: chemical shift (multiplicity,
coupling constant if appropriate, integration). Coupling constants
(J) are reported in Hertz to the nearest 0.5 Hz. 13C NMR spectra
were recorded at 125 MHz using Bruker DRX 500 instrument. Flash
column chromatography (FC) was performed using Merck Kieselgel
60 (40-63 mm, 230-40 mesh) silica gel. Thin layer chromatog-
raphy were carried out on glass plates precoated with Merck silica
gel 60 F254 which were visualized either by quenching of UV
fluorescence or by dipping in a KMnO4/H2O solution followed by
heat, as appropriate. Melting points were recorded using a Griffin
melting point apparatus and are uncorrected. Mass spectra were
recorded on Micromass Q-Tof (ESI) or Kratos Concept (EI)
spectrometers. HPLC was performed using a varian pursuit C18 5
µ column (250 × 10 mm) and a gradient elution with 0.1% TFA/
MeCN and 0.1% TFA/H2O at a flow rate of 12 mL/min. Unless
otherwise noted, all materials were obtained from commercial
suppliers and used without further purification.
Synthesis, General Procedures: Sonogashira Coupling. A
reaction flask containing iodoaniline derivative 1 (2 equiv), diethy-
nyl compounds 2 or 3 (1 equiv), PdCl2(PPh3)2 (10 mol%), and CuI
(20 mol%) was evacuated and filled with argon. To the mixture
DMF (5 mL/1 mmol) and triethylamine (10 equiv) were added.
After stirring at rt under an argon atmosphere for 9 h, the mixture
was quenched with water and extracted with 3 × ethylacetate. The
combined organic solution was washed with 1 × brine, dried with
Na2SO4 and removed in Vacuo. The residue was purified by
chromatography on silica gel to afford the corresponding cross
coupled product 4 or 5.
Figure 4. NMR titration study of a solution of 260 µM c-kit2 complexed
with ligand 10; (A) the imino proton spectra of c-kit2 with 0, 0.5, 1 equiv
of ligand 10 in the absence of added salt; bottom spectra (red) shows the
imino proton spectrum of c-kit2 in presence K+. (B) 1D jump-and-return
1H NMR spectra of c-kit2 in the absence (red) and in the presence (black)
of 1 equiv of ligand 10 without added salt; the difference spectrum of the
two is shown in blue with regions of different proton types indicated above;
inset: a top view of a molecular model of three-layer G-tetrad in a parallel
conformation22 with H2′/H2′′, H8 and H1 protons shown in red, gold and
gray spheres.
To gain further insights into the structural basis of the c-kit2
recognition by ligand 10, we carried out NMR titration
experiments by adding ligand 10 into a solution containing 260
µM of c-kit2 in H2O to monitor structural changes upon ligand
binding. Due to ring current shielding, the imino proton
resonances of G-quadruplexes have been reported to undergo
significant upfield chemical shift changes upon small molecules
binding by end stacking onto the G-tetrad.18b-d,f However, in
our case, upon titration of ligand 10, the imino resonances at δ
Hydrolysis of Esters. NaOH (10 equiv, 2N solution in water)
was added to a solution of the methyl ester 4 or 5 (1 equiv) in
methanol and THF (1:1) at 0 °C. After stirring for 12 h at rt, the
reaction mixture was removed in Vacuo and the residue was
dissolved in water. After washing with EtOAc, the aqueous phase
was acidified with formic acid and subsequently extracted with 3
× EtOAc. The combined organic layers were dried with Na2SO4.
Removal of the solvent provided the crude product 6 or 7, which
was used without further purification.
1
10.8-12 ppm in the H NMR spectra, which correspond to a
parallel conformation, exhibit significant line-broadening without
marked upfield shifts, while concomitant disappearance of
another set of the more dispersed imino proton resonances at δ
12.5-14 ppm are observed (Figure 4A, B and S.I.). The absence
of upfield-shifted chemical shift changes is consistent with a
mode of binding by ligand 10 that is not via G-tetrad stacking.
1
By comparing the full H NMR spectra of free and liganded
Amide Coupling. A mixture of dicarboxylic acid 6 or 7 (0.25
mmol), EDC (1.06 mmol, 4.24 equiv), HOBt (1.06 mmol, 4.24
equiv), NMM (2.10 mmol, 8.40 equiv), amine 8 (0.78 mmol, 3.12
equiv) in DMF (5 mL) was stirred at rt for 10 h. The solvent was
removed in Vacuo and purified by HPLC (gradient: starting from
H2O:MeCN (1% TFA) 20:80 to pure MeCN (1% TFA) over 35
min, 12 mL/min, provided the desired compounds 9 or 10.
Diester Derivative 4. Yield (78%); colorless solid; 152-153
c-kit2 in the absence of added salt, we found similar line
broadening in other regions of the liganded spectrum of c-kit2
but with negligible chemical shift changes. Note that the line
broadening, indicative of restricted motions upon ligand binding,
is most pronounced for the ribose protons H2′/H2′′, which are
located in the proximity of the grooves of G-tetrads (Figure
4B). Such differential line-broadening has also been reported
for distamycin A, a common DNA groove-binder, binding to
the grooves of a parallel G-qudruplex19a and such groove
binding also induces negligible chemical shift changes of the
1
°C; H NMR (CDCl3): δ ) 8.07 (d, J ) 1.7 Hz, 2H), 7.81 (dd, J
) 8.56, 1.0 Hz, 2H), 7.66 (s, 1H), 7.47-7.45 (m, 2H), 7.35-7.30
1
(m, 1H), 6.69 (d, J ) 8.6 Hz, 2H), 4.72 (s, 4H), 3.85 (s, 6H); H
NMR (d6-DMSO): δ ) 8.00 (m, 1H), 7.83 (d, J ) 2.0 Hz, 2H),
9
15954 J. AM. CHEM. SOC. VOL. 130, NO. 47, 2008

Genomic Promoter DNA G-Quadruplexes
A R T I C L E S
7.66-7.64 (m, 4H), 7.44 (t, J ) 7.5 Hz, 1H), 6.76 (d, J ) 8.7 Hz,
2H), 6.45 (s, 4H), 3.76 (s, 6H); 13C NMR (d6-DMSO): δ ) 165.7,
153.8, 134.2, 134.1, 131.3, 131.2, 128.9, 123.2, 116.3, 113.4, 104.5,
93.4, 86.3, 51.6; HRMS (ESI): calcd for C26H20N2O4 [M + H]+
424.1422, found 424.1418.
Diester Derivative 5. Yield (83%); colorless solid; 136-138
°C; 1H NMR (CDCl3): δ ) 7.92 (t, J ) 7.6 Hz, 1H), 7.89 (d, J )
2.0 Hz, 2H), 7.81 (d, J ) 7.9 Hz, 2H), 7.70 (d, J ) 8.6, 2.0 Hz,
2H), 6.80 (d, J ) 8.8 Hz, 2H), 6.47 (br, 4H), 3.77 (s, 6H); 13C
NMR (d6-DMSO): δ ) 165.6, 154.1, 142.9, 137.4, 134.6, 131.9,
126.8, 116.5, 113.7, 103.5, 93.3, 85.8, 51.6; HRMS (ESI): calcd
for C25H19N3O4 [M + H]+ 426.1459, found 426.1442; [M + Na]+
448.1278, found 448.1264.
Dicarboxylic Acid Derivative 6. Yield (94%); light brown solid;
271-271 °C (decomp); yield1H NMR (d6-DMSO): δ ) 8.07 (d, J
) 1.7 Hz, 1H), 7.84 (d, J ) 1.9 Hz, 2H), 7.67-7.64 (m, 4H), 7.5
(d, J ) 8.7 Hz, 1H), 6.76 (d, J ) 8.0 Hz, 2H), 6.33 (s, 4H); OH
could not be detected; 13C NMR (d6-DMSO): δ ) 167.2, 153.8,
134.6, 134.5, 131.9, 131.5, 129.3, 123.6, 118.0, 113.6, 104.8, 93.6,
86.9; HRMS (ESI): calcd for C24H16N2O4 [M + Na]+ 419.1002,
found 419.1021.
Dicarboxylic Acid Derivative 7. Yield (91%); orange solid; mp
272-274 °C (decomp); 1H NMR (d6-DMSO): δ ) 7.89 (dd, J1 )
J2 ) 7.1 Hz, 1H), 7.87 (d, J ) 2.0 Hz), 7.78 (d, J ) 7.9 Hz, 2H),
7.68 (dd, J ) 8.7, 2.1 Hz, 2H), 6.78 (d, J ) 8.7 Hz, 2H), 6.39 (s,
4H), OH could not be determined; 13C NMR (d6-DMSO): δ )
166.8 (s), 153.9, 143.1, 137.2, 134.6, 132.1, 126.7, 117.8, 113.5,
103.4, 93.3, 85.8; HRMS (ESI): calcd for C23H15N3O4 [M + H]+
398.1146, found 398.1131.
aliquoting 50 µL of the annealed DNA into each well, followed by
50 µL of the compound solutions using Beckman Coulter liquid-
handling robot. For each compound, a minimum of 10 different
concentrations were tested. Fluorescence melting curves were
determined in a Roche light cycler 480, using a total reaction
volume of 100 µL. Measurements were made in duplicate with
excitation at 483 nm and detection at 533 nm. Final analysis of the
data was carried out using Origin 7.5 (OriginLab Corp., Northamp-
ton, MA) and shown in Figure 1.
Surface Plasmon Resonance. Surface plasmon resonance
measurements were performed on a four-channel BIAcore 3000
optical biosensor system (Biacore Inc.) using a streptavidin-coated
sensor chip (Biacore SA-chip). We have used four biotinylated
G-quadruplex forming sequences comprised of c-myc promoter
G-quadruplex DNA, c-myc d(biotin-[TGAGGGTGGGTAGGGT-
GGGTAA]) and the two c-kit promoter G-quadruplex DNA, c-kit1
d(biotin-[AGGGAGGGCGCTGGGAGGAGGG]) and c-kit2 d(bi-
otin-[CCCGGGCGGGCGCGAGGGAGGGGAGG]). We have also
used a duplex DNA d(biotin-[GGGCATAGTGCGTGGCGTT-
TAGC]) hybridized with its complementary sequence as a non-
quadruplex control. The DNA oligonucleotides were folded in
filtered and degassed running buffer (Tris-HCl 50 mM pH 7.4, 100
mM KCl; 95 °C for 5 min then cooled to room temperature
overnight) and immobilized (500 RU) in flow cells 2, 3 and 4,
leaving the first flow cell empty as a blank. DNA binding
experiments were carried out with running buffer at a flow rate of
20 µL min-1. Ligand solutions 9 and 10 were freshly prepared
with running buffer by serial dilutions from stock solutions. These
solutions were injected using the KINJECT command (Biacore 3000
Control Software version 3.0.1) for 2 min followed by a 30 s 1 M
KCl injection and a 30 s running buffer injection for chip
regeneration. Each sample injection was repeated in duplicate. The
response at equilibrium (Req) was plotted against concentration of
analyte to generate a hyperbolic binding curve. The final graphs
were obtained by subtracting blank sensorgrams from the duplex
or quadruplex sensorgrams. For ligands 9 and 10 dissociation
constants were determined by fitting the binding curve using the
steady state affinity algorithm (Biaevaluation 3.0.2).
Bis-phenylethynyl Amide Derivative 9. Yield (87%); light
yellow oil; 1H NMR (CD3CN): δ ) 9.26 (s, 2H), 7.85 (d, J ) 2.1
Hz, 1H), 7.81-7.80 (m, 1H), 7.62 (dd, J ) 8.7, 2.2 Hz, 2H), 7.58
(dd, J ) 7.7, 1.6 Hz, 2H), 7.44 (td, J ) 8.0, 0.4 Hz, 1H), 3.43 (q,
J ) 6.1 Hz, 4H), 3.06 (q, J ) 6.1 Hz, 4H), 3.08 (q, J ) 5.9 Hz,
2H), 2.82 (s, 6H), 2.81 (s, 6H), 1.98-1.95 (m, 4H); 13C NMR
(CD3CN): δ ) 169.6, 153.2, 134.9, 133.0, 132.2, 130.4, 130.0,
124.4, 122.1, 114.3, 106.6, 94.5, 86.7, 55.6, 43.5, 36.3, 25.8; HRMS
(ESI): calcd for C34H41N6O2 [M + H]+ 565.3286, found 565.3306.
Bis-phenylethynyl Amide Derivative 10. Yield (90%); yellow
1
solid, mp 92-93 °C; H NMR (CD3CN): δ ) 9.30 (s, 2H), 7.96
Circular Dichroism (CD). Circular dichroism (CD) spectroscopy
was used to elucidate ligand effects on the promoter intramolecular
G-quadruplex sequences in the presence and absence of added salt
(K+). CD spectra were recorded on a Applied Photophysics
Chirascan Circular Dichroism Spectrophotometer (Applied Photo-
physics Ltd., UK) using a quartz cell of 1-mm optical path length
and an instrument scanning speed of 100 nm/min with a response
time of 2 s, and over a wavelength range of 200-330 nm and
200-450 nm. We used three different G-quadruplex forming
oligonucleotides in the study, the two c-kit promoter G-quadruplex
DNA; c-kit1 d(GGGAGGGCGCTGGGAGGGAGGG) and c-kit2
d(GGGCGGGCGCGAGGGAGGGG) and c-myc promoter G-
quadruplex DNA; c-myc d(TGAGGGTGGGTAGGGTGGGTAA).
All DNA samples were dissolved in Tris buffer (50 mM, pH 7.4).
Where appropriate, the samples also contained 100 mM KCl. Ligand
10 (1 mM solution with MQ water) was titrated into the DNA
samples at 1 mol equiv up to 10 mol equivs The DNA strand
concentrations used were 12.5 µM, and the CD data are a
representation of three averaged scans taken at 23 °C. All CD
spectra are zero corrected and baseline-corrected for signal con-
tributions due to the buffer.
(t, J ) 7.7 Hz, 1H), 7.95 (d, J ) 2.1 Hz, 2H), 7.71-7.69 (m, 4H),
6.87 (d, J ) 7.5 Hz, 2H), 3.49 (sex, J ) 5.2 Hz, 4H), 3.46 (dt, J
) 6.2, 5.9 Hz, 4H), 3.08 (q, J ) 5.9 Hz, 4H), 2.87 (s, 6H), 2.86 (s,
6H), 2.09-1.94 (m, 4H); 13C NMR (CD3CN): δ ) 169.5, 153.9,
143.0, 139.5, 133.5, 131.4, 127.8, 122.1, 114.6, 104.9, 93.2, 88.2,
55.5, 43.5, 36.1, 25.9; HRMS (ESI): calcd for C34H40N6O2 [M +
H]+ 566.3238, found 566.3223.
Fluorescence Resonance Energy Transfer (FRET) Assay. All
the oligonucleotides and their fluorescent conjugates (Eurogentec,
Southampton, UK) were initially dissolved as a 100 µM stock
solution in purified water; further dilutions were carried out in the
relevant buffer. The ability of the compounds to stabilize G-
quadruplex DNA was investigated using a fluorescence resonance
energy transfer (FRET) assay modified to be used as a high-
throughput screen in a 96-well format. We have used four different
labeled oligonucleotides comprised of c-kit1: FAM-d(GGGA-
GGGCGCTGGGAGGAGGG)-TAMRA, c-kit2: FAM-d(GGGC-
GGGCGCGAGGGAGGGG)-TAMRA, c-myc: FAM-d(TGAGGGT-
GGGTAGGGTGGGTAA)-TAMRA and a duplex DNA FAM-
d(TATAGCTATA-HEG-TATAGCTATA)-TAMRA; donor fluorophore
FAM is 6-carboxyfluorescein; acceptor fluorophore TAMRA is
6-carboxytetramethyl-rhodamine]. As a typical experiment, the
oligonucleotides were prepared as a 400 nM solution in a 60 mM
potassium cacodylate buffer (pH 7.4) and then annealed by heating
to 90 °C for 2 min, followed by cooling to room temperature.
Compounds were stored at -80 °C and dilutions were done with
60 mM potassium cacodylate buffer (pH 7.4). One mM stock
solution of ligands 9 and 10 were made up in MQ water. The 96-
well plates (MJ Research, Waltham, MA) were prepared by
1
NMR Experiments. H NMR spectra of c-kit2 were recorded
at 298K (700 MHz Bruker Avance spectrometer equipped with a
cryogenic TXI probe) with jump and return water suppression to
minimize saturation of labile proton signals.18a The titration
experiments started with 500 µL of 260 µM c-kit2 DNA G-
quadruplex d[CGGGCGGGCGCGAGGGAGGGG] in 20 mM Tris
buffer, pH 7.4 and aliquots of compound 10 (5 mM in the same
9
J. AM. CHEM. SOC. VOL. 130, NO. 47, 2008 15955

A R T I C L E S
Dash et al.
buffer) were added in steps to yield 0-2 equiv (S.I.). NMR spectra
Acknowledgment. We thank the BBSRC for project grant
funding, Cancer Research UK for programme funding and the
European Commission (Marie Curie Incoming Postdoctoral Fel-
lowship to J.D. for funding). S.T.D.H. is a recipient of a Netherlands
Ramsay Memorial Fellowship and a Human Frontier Science
Program Long-term Fellowship (LT00798/2005). We thank Raphae¨l
Rodriguez and Zoe¨ A. E. Waller for useful discussions relating to
the SPR experiments.
were recorded immediately after individual titration steps.
Conclusion
In summary we have identified bis-phenylethynyl amide
derivatives as a potent G-quadruplex binding small molecule
scaffold. These ligands show very good binding affinity,
excellent quadruplex:duplex selectivity and also promising
discrimination between intramolecular promoter quadruplexes.
Our data suggests, such compounds induce parallel G-quadru-
plex structure and have potential for G-quadruplex groove
recognition. We believe that the modes of G-quadruplex
recognition other than via the G-tetrad stacking should be
seriously considered for second generation ligands. The biologi-
cal properties of these molecules are currently under investigation.
Supporting Information Available: CD, UV and NMR
spectroscopic data. This material is available free of charge via
the Internet at http://pubs.acs.org.
JA8046552
9
15956 J. AM. CHEM. SOC. VOL. 130, NO. 47, 2008