A High-Throughput Assay for Arylamine Halogenation Based on a Peroxidase-Mediated Quinone-Amine Coupling with Applications in the Screening of Enzymatic Halogenations

Article abstract of DOI:10.1002/chem.201403953

Arylhalides are important building blocks in many fine chemicals, pharmaceuticals and agrochemicals, and there has been increasing interest in the development of more "green" halogenation methods based on enzyme catalysis. However, the screening and development of new enzymes for biohalogenation has been hampered by a lack of high-throughput screening methods. Described herein is the development of a colorimetric assay for detecting both chemical and enzymatic arylamine halogenation reactions in an aqueous environment. The assay is based on the unique UV/Vis spectrum created by the formation of an ortho-benzoquinone-amine adduct, which is produced by the peroxidase-catalysed benzoquinone generation, followed by Michael addition of either a halogenated or non-halogenated arylamine. This assay is sensitive, rapid and amenable to high-throughput screening platforms. We have also shown this assay to be easily coupled to a flavin-dependent halogenase, which currently lacks any convenient colorimetric assay, in a "one-pot" workflow.

Full text of DOI:10.1002/chem.201403953

DOI: 10.1002/chem.201403953
Full Paper
&
Enzyme Catalysis
A High-Throughput Assay for Arylamine Halogenation Based on
a Peroxidase-Mediated Quinone–Amine Coupling with
Applications in the Screening of Enzymatic Halogenations
Joseph Hosford, Sarah A. Shepherd, Jason Micklefield, and Lu Shin Wong*[a]
Abstract: Arylhalides are important building blocks in many
fine chemicals, pharmaceuticals and agrochemicals, and
there has been increasing interest in the development of
more “green” halogenation methods based on enzyme catal-
ysis. However, the screening and development of new en-
zymes for biohalogenation has been hampered by a lack of
high-throughput screening methods. Described herein is the
development of a colorimetric assay for detecting both
chemical and enzymatic arylamine halogenation reactions in
an aqueous environment. The assay is based on the unique
UV/Vis spectrum created by the formation of an ortho-ben-
zoquinone-amine adduct, which is produced by the perox-
idase-catalysed benzoquinone generation, followed by Mi-
chael addition of either a halogenated or non-halogenated
arylamine. This assay is sensitive, rapid and amenable to
high-throughput screening platforms. We have also shown
this assay to be easily coupled to a flavin-dependent halo-
genase, which currently lacks any convenient colorimetric
assay, in a “one-pot” workflow.
Introduction
Arylhalides are key building blocks in many fine chemicals in-
cluding pharmaceuticals, polymers and agrochemicals
(Figure 1).[1] Halogenated arenes are also widely utilised in tran-
sition-metal-catalysed cross-coupling reactions.[2] Common
routes for the production of halogenated aromatics primarily
rely on electrophilic aromatic substitution, but these ap-
proaches lack regioselectivity[3] and often require Lewis acid
catalysis. As a result they generate large amounts of waste
acid that is environmentally unfriendly[4] and lacking in atom
efficiency.[5] Due to the inherent usefulness of halogenated ar-
ylamine compounds, there has been significant interest in
more efficient and selective routes to their production. Transi-
tion-metal-catalysed halogenations have been reported,[6]
which have been shown to provide regioselectivity by ligand-
chelate control.[7] An alternative approach that avoids the use
of transition metals is to harness enzymes to perform the halo-
genation of arylamines. Biocatalysis is attractive because it po-
tentially offers highly efficient synthesis in terms of yields and
chemical selectivity, together with an inherent environmental
Figure 1. Examples of fine chemicals synthesised from halogenated aryl-
amines.
sustainability stemming from an ability to promote reactions
under mild conditions and a minimal reliance on toxic or ex-
pensive feedstocks.[8]
To date, two discrete classes of enzymes are known to per-
form biological halogenation reactions, which are categorised
by their oxidation partner.[9] Flavin-dependent and non-heme
iron(II)-dependent enzymes require oxygen as an electron ac-
ceptor and have been termed oxygen-dependent halogenases,
whereas heme- and vanadium-dependent enzymes use hydro-
gen peroxide (H2O2) and are termed haloperoxidases.[10] More
recently, the use of biocatalysts to produce halogenated aryl-
amines has been explored using regioselective flavin-depen-
dent tryptophan halogenases.[11] These enzymes are particularly
interesting because they have been shown to install a chlorine
[a] J. Hosford, Dr. S. A. Shepherd, Prof.Dr. J. Micklefield, Dr. L. S. Wong
Manchester Institute of Biotechnology and School of Chemistry
University of Manchester, 131 Princess Street
Manchester M1 7DN (UK)
E-mail: l.s.wong@manchester.ac.uk
Supporting information for this article is available on the WWW under
http://dx.doi.org/10.1002/chem.201403953.
ꢀ 2014 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
This is an open access article under the terms of the Creative Commons At-
tribution License, which permits use, distribution and reproduction in any
medium, provided the original work is properly cited.
Chem. Eur. J. 2014, 20, 16759 – 16763
16759 ꢀ 2014 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Full Paper
atom regioselectively on an array of aromatic substrates.[12] The
proposed mechanism involves the in situ production of hypo-
halous acid, which binds to an active-site lysine residue; this
residue is then thought to guide the regioselective attack of
the substrate.[13] In contrast, heme-dependent enzymes release
free hypohalous acid, which reacts with a substrate in solution
and thus lacks good regiocontrol.[10] Early reports of vanadium-
dependent enzymes suggested that they are also unselective
due to the escape of hypohalous acid[10] but, more recently,
a number of reports have now emerged indicating that good
regiocontrol is possible.[14]
Results and Discussion
Development of halogenation assay
The basis for the assay is the distinct UV/Vis spectrum of qui-
none–aniline adduct that is formed by the stoichiometric Mi-
chael addition of the amino component to the ortho-benzoqui-
none, formed by the oxidation of catechol by HRP.[20] Previous-
ly, this adduct formation had been used to quantify the con-
centration of peroxidases in solution, but by using an excess of
HRP and H2O2 it is instead possible to use the adduct pro-
duced by the reaction for quantification of the amino compo-
nent. If the reaction mixture contains multiple amino compo-
nents, each resulting adduct can be differentiated by their re-
spective lmax peaks in the overall UV/Vis spectra. In the case of
arylamines and halogenated arylamines it was found that the
lmax values were typically in the range of ꢀ520 and ꢀ425 nm,
respectively (Figure 2).
In all cases, any efforts aimed at discovering new halogenas-
es[10] or genetically reengineering existing enzymes[15] require
the capacity to detect and quantify halogenation activity. One
possible approach to this end is the application of assays for
the detection of free hypohalous acid in solution,[16,17] but this
is an indirect method of detecting enzyme turnover and would
not be applicable to halogenating enzymes that bind hypoha-
lous acid in their active site, such as the tryptophan halogenas-
es. As a result, most analyses of these substrates has been con-
ducted with serial and inherently low-throughput methods
such as HPLC, LC–MS and NMR.[11,18] Therefore, the further de-
velopment of halogenating enzymes would greatly benefit
from a high-throughput screen, which would aid in the screen-
ing of enzyme libraries.
Previously, it has been shown that the oxidation of catechols
by horseradish peroxidase (HRP) to their corresponding 1,2-
benzoquinone (ortho-quinone) can be combined with a subse-
quent Michael addition of an aniline to the quinone in a “one-
pot” reaction.[19] Because the resulting quinone–aniline adduct
was highly coloured, this reaction sequence has been applied
in an assay for peroxidase activity.[20] We have observed that
different anilines, even those closely related in structure, result
in the formation of adducts that have significantly different
UV/Vis spectra. In comparing halogenated anilines to their un-
halogenated parent compounds, these spectral differences
were sufficiently large to be visually distinguishable.
Figure 2. UV/Vis spectra of adduct formed from 4-methyl-catechol (4-MC)
with either 2-aminobenzoic acid (0.5 mm, X=H) or 2-amino-6-chlorobenzoic
acid (0.5 mm, X=Cl) in K2HPO4 (50 mm) at pH 7.4.
Based on these observations, we now report the develop-
ment of this reaction sequence into a colorimetric assay for
the detection and quantification of halogenated arylamines.
The assay described is generally applicable to a wide range of
arylamines, rapid and high-throughput. Furthermore, since the
oxidation of the catechol is also enzymatically driven, it can be
performed sequentially after an enzymatic halogenation reac-
tion in a “one-pot” procedure (Scheme 1).
A number of experimental considerations were taken into
account to simplify the analysis and enable a one-pot proce-
dure. Firstly, 4-methylcatechol (4-MC) was employed as the cat-
echol component, because it was known to be a good sub-
strate for HRP. The resulting ortho-quinone gives only a single-
conjugate product, because the 4-methyl substituent blocks
further addition at this position.[21] To prevent any oxidation of
the arylamine by HRP at low pH,[22] all assays were carried out
in pH 7.4 buffered conditions. To
confirm that only the desired
product was formed under these
conditions, test reactions were
carried out with 4-MC and either
2-aminobenzoic acid or 2-amino-
6-chlorobenzoic acid; HPLC and
MS analysis of the reaction mix-
tures confirmed single-product
Scheme 1. General scheme illustrating the HRP-catalysed oxidation of catechols to their corresponding ortho-qui-
none (upper pathway) and the formation of the arylamine–catechol adduct. This reaction can be coupled to a bio-
catalytic halogenation reaction (lower pathway).
formation and that the reaction
was complete within 5 min.
Chem. Eur. J. 2014, 20, 16759 – 16763
www.chemeurj.org
16760 ꢀ 2014 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Full Paper
Substrate range
10:0 to 0:10 to a total concentration 0.5 mm.
As an illustrative example, the UV/Vis spectra were recorded
for mixtures of 2-aminobenzoic acid and 2-amino-6-chloroben-
zoic acid (6) that were subjected to the assay. It was found
that, as the ratio of 2-amino-6-chlorobenzoic acid increased,
the absorbance at 437 nm increased with a concomitant de-
crease at 535 nm, with a corresponding visually observable
colour change from red to yellow (Figure 4a and b, full-colour
version available in the Supporting Information). A calibration
graph was then constructed by plotting the absorbance of the
peak in the 500–550 nm region, corresponding to lmax of the
arylamine–catechol adduct produced (which, in the case of 2-
amino-6-chlorobenzoic acid, was at 535 nm), against the con-
centration of the halogenated component (Figure 4c). This
methodology was then extended to a range of other halogen-
ated and unhalogenated mixture-pairs and, in all cases, the re-
sulting calibration plot fitted a linear relationship with a high
statistical significance (R2 >0.99, Table 2). The detection limit
for the halogenated product was dependent on the sensitivity
of the UV/Vis assay. In these cases, it was possible to detect
conversion rates as low as 5% (0.025 mm in 0.5 mm of total
adduct).
To confirm the trend that the lmax values of adducts formed
from the Michael addition were lower than the corresponding
non-halogenated arylamines, a further series of analogues was
tested (Figure 3). From the data collated, it can be observed
that halogenated substrates have a lower lmax than their non-
halogenated counterparts throughout the series (Table 1). The
results show that the trend is also seen with the more-substi-
tuted arylamines as well as with the aminopyridine tested.
Figure 3. Structures of substrates tested with the coupled assay. X=H, Cl, Br
or I.
Coupling with flavin-dependent
halogenase system
Table 1. UV/Vis lmax and e values of the aniline–catechol adducts formed by the assay. “–”=not determined.
In order to demonstrate the ap-
plicability of this assay to biocat-
alytic halogenation reactions, ef-
forts were then directed to the
development of an end-point
assay that could be conducted
sequentially in the same reaction
vessel.
X=H
lmax
X=Cl
lmax
X=Br
lmax
X=I
lmax
Arylamine[a]
e
e
e
e
[nm]
[MÀ1 cmÀ1
]
[nm]
[MÀ1 cmÀ1
]
[nm]
[MÀ1 cmÀ1
]
[nm]
[MÀ1 cmÀ1
]
1
2
3
4
5
6
508
537
516
500
535
535
4141
5050
1966
1919
4706
4706
441
403
438
398
436
437
2386
1027
1489
1710
3789
4548
432
400
437
413
436
–
1964
1108
1086
1244
2770
–
431
–
–
–
–
2029
–
–
–
–
–
As a model tryptophan halo-
genase enzyme, the tryptophan-
7-halogenase RebH from Leche-
–
[a] See Figure 3 for structure.
Quantitative analysis
The corresponding molar ab-
sorption coefficients (e) for the
lmax values that were determined
in Table 1 were then used to
allow quantification of binary
mixtures of the halogenated ar-
ylamines and their unhalogenat-
ed analogues. For this purpose,
calibration plots were construct-
ed for each of the arylamines by
reacting different ratios of
known concentrations of the
halogenated and non-halogenat-
ed arylamine. Here, the halogen-
ated and non-halogenated aryla-
mine were added in ratios from
Figure 4. Illustrative data for mixtures of 2-aminobenzoic acid and 2-amino-6-chlorobenzoic acid solutions. a) Pho-
tograph of one row of wells in a microtitre plate with adducts produced from mixtures of 2-aminobenzoic acid
and 2-amino-6-chlorobenzoic acid (total concentration 0.5 mm). b) UV/Vis spectra for the mixtures in a range of
ratios to a total concentration of 5 mm. c) The calibration graph produced by plotting the absorbance of the peak
at 535 nm against the concentration of 2-amino-6-chlorobenzoic acid.
Chem. Eur. J. 2014, 20, 16759 – 16763
www.chemeurj.org
16761 ꢀ 2014 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Full Paper
Table 2. Parameters calculated from the best fit of calibration plots for
the binary mixtures of the halogenated and unhalogenated arylamine–
catechol adducts.
Arylamine[a] Ring substituent X Gradient y-intercept Coefficient of
determination (R2)
1
H vs. Cl
H vs. Br
H vs. I
À0.9916 0.8139
À1.2304 0.8099
À0.9916 0.8139
À1.706 1.0078
À1.7988 1.0479
À0.4588 0.4082
À0.6210 0.4132
À0.3803 0.3973
À0.7111 0.4744
À1.4900 0.9705
À1.5853 0.9781
À1.3299 0.9444
0.9977
0.9951
0.9977
0.9997
0.9992
0.9982
0.9910
0.9906
0.9933
0.9921
0.9910
0.9999
2
3
4
5
6
H vs. Cl
H vs. Br
H vs. Cl
H vs. Br
H vs. Cl
H vs. Br
H vs. Cl
H vs. Br
H vs. Cl
Figure 5. Graph showing the increase in the concentration 1-chloronaptha-
len-2-amine against length of time of the halogenation reaction. Inset: assay
graph calibration plot for assay analysis produced using RebH halogenation
reagents and conditions.
[a] See Figure 3 for structure.
valieria aerocolonigenes was chosen because it is known to cat-
alyse the chlorination of 2-naphthylamine to 1-chloronaphtha-
len-2-amine (3).[11] Because RebH is a flavin-dependent enzyme,
the biocatalytic halogenation system required the inclusion in
the reaction mixture of a co-factor-regeneration system com-
posed of flavin reductase[23] (Fre, from Escherichia coli) and glu-
cose dehydrogenase[24] (GDH2, from Bacillus megaterium).
The overall sequential biocatalytic halogenation and assay
procedure thus involved the execution of the halogenation,
which was terminated at pre-determined time points by heat-
ing to 958C. After a brief cooling period, HRP, H2O2 and 4-MC
were added and incubated for a further 5 min (Scheme 2).
Each mixture was then analysed to quantify the amount of the
respective halogenated and unhalogenated 4-MC adducts by
using the UV/Vis method described above, and the time
limit) and provides both qualitative and quantitative analysis.
In all the examples described, the reaction results in a suffi-
ciently large lmax shift that it can even be visually observed,
making it a genuine colorimetric assay. It has also been shown
to be amenable to coupling with reactions carried out by
flavin-dependent halogenase enzymes in a one-pot procedure
and can be applied in a high-throughput multi-well format. Be-
cause the assay functions under mild physiological conditions,
this assay can in principle be used in a similar manner to halo-
genation reactions catalysed by other classes of enzymes.
It is thus envisaged that a key application of this assay will
be in efforts to discover and reengineer new halogenase en-
zymes for synthetic applications, and is an improvement over
previously described methods
that only identify enzyme activi-
ty indirectly by the detection of
hypohalous acid production.
Indeed, previous programmes in
the development of new biocat-
alysts have shown that the avail-
Scheme 2. Reaction sequence for RebH halogenation followed by in situ HRP oxidation of 4-MC and coupling of
the naphthylamine(s).
ability of
a
suitable high-
course of the biotransformation was plotted (Figure 5). The
quantifications were also conducted by HPLC as a comparator
and a good correlation between both analytical methods was
observed, thus validating the spectrometric method (see the
Supporting Information for detailed UV/Vis absorbance data
and HPLC chromatograms). Due to the rapidity of the quinone
generation and adduct formation, it was also possible to per-
form the second step of the assay without the need to stop
the halogenation reaction beforehand.
throughput screening methodology has been crucial to their
success.[25]
Ideally, an authenticated sample of the desired product is re-
quired in order to provide accurate quantification, but, in most
cases, standards can be obtained through conventional (non-
enzymatic) chemistry. Also, it is possible to derive semi-quanti-
tative data by applying computationally simulated UV/Vis spec-
tra.[26] Even in cases for which information on the product is
limited, a simple absorbance measurement of any wavelength
in the 500–550 nm range can serve as a qualitative test, which
is usually sufficient as a first-pass library screening tool.
Though the original intention was to develop a colorimetric
assay for enzymatic arylamine halogenations, it could also be
equally applied to any halogenation reaction of aryl systems
that possess an exocyclic nucleophile (e.g., arylmercaptans, ar-
ylphosphines).[19,27] Thus, this general procedure of in situ HRP-
Conclusion
In summary, a UV/Vis spectrometric assay for the halogenation
of arylamines based on in situ oxidation of 4-methylcatechol
by HRP and conjugate addition has been developed. The pre-
sented assay is rapid (5 min), sensitive (0.025 mm detection
Chem. Eur. J. 2014, 20, 16759 – 16763
www.chemeurj.org
16762 ꢀ 2014 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim

Full Paper
mediated quinone oxidation, followed by conjugate addition,
has substantial scope for further development into assays for
a wide range of substrates.
Keywords: halogenation
addition · high-throughput screening
·
enzyme catalysis
·
Michael
Experimental Section
[1] a) S. A. Lawrence, Amines: Synthesis Properties and Applications, Cam-
bridge University Press, Cambridge, 2006; b) M. J. O’Neil, The Merck
Index: An Encyclopedia of Chemicals, Drugs, and Biologicals, Vol. 15,
Royal Society of Chemistry, Cambridge, 2013.
Reagents and materials
All reagents and enzyme substrates were purchased from com-
mercial suppliers and used without additional purification. Per-
oxidase from horseradish (Type VI-A), b-nicotinamide adenine
dinucleotide dipotassium salt (NAD), flavin adenine dinucleo-
tide disodium salt (FAD) and sequencing primers were pur-
chased from Sigma Aldrich (UK). The RebH gene was amplified
from the genomic DNA of Lechevalieria aerocolonigenes using
primers 5’–GTACGTCATATGTCCGGCAAGATTGACAAG–3’ and 5’–
GTCAGCAAGCTTTCAGCGGCCGTGCTGTGCC–3’with NdeI and
HindIII restriction sites. The gene was cloned into the corre-
sponding restriction sites of pET28a.[28] The flavin reductase
(Fre) gene was amplified from the genomic DNA of E. coli BL21
[2] N. Miyaura, A. Suzuki, Chem. Rev. 1995, 95, 2457–2483.
[3] P. Kovacic, N. O. Brace, J. Am. Chem. Soc. 1954, 76, 5491–5494.
[4] M. Noꢁ, A. Perosa, M. Selva, L. Zambelli, Green Chem. 2010, 12, 1654–
1660.
[5] B. M. Trost, Science 1991, 254, 1471–1477.
[6] D. Kalyani, A. R. Dick, W. Q. Anani, M. S. Sanford, Org. Lett. 2006, 8,
2523–2526.
[7] K. M. Engle, J. Q. Yu, J. Org. Chem. 2013, 78, 8927–8955.
[8] a) M. T. Reetz, J. Am. Chem. Soc. 2013, 135, 12480–12496; b) M. A.
Fisher, D. Tullman-Ercek, Curr. Opin. Biotechnol. 2013, 24, 1010–1016;
c) G. W. Huisman, S. J. Collier, Curr. Opin. Chem. Biol. 2013, 17, 284–292;
d) U. T. Bornscheuer, G. W. Huisman, R. J. Kazlauskas, S. Lutz, J. C. Moore,
K. Robins, Nature 2012, 485, 185–194.
[9] C. D. Murphy, J. Appl. Microbiol. 2003, 94, 539–548.
[10] a) F. H. Vaillancourt, E. Yeh, D. A. Vosburg, S. Garneau-Tsodikova, C. T.
Walsh, Chem. Rev. 2006, 106, 3364–3378; b) A. Butler, M. Sandy, Nature
2009, 460, 848–854.
(DE3)
using
primers
5’–AAAAAAGGTACCATGACAACCT-
TAAGCTGTAAA–3’ and 3’–AAAAAACTCGAGTCAGATAAATG-
CAAACGCATC–5’, and digested using KpnI and XhoI before li-
gating into the pET45b expression vector. The pET21b/GDH2
plasmid[24] was a kind gift from Prof. N. S. Scrutton’s laboratory.
All vectors were confirmed by DNA sequencing. E. coli ArcticEx-
press (DE3) cells were purchased from Agilent and BL21(DE3)
cells were purchased from Invitrogen. Details of halogenase
enzyme production, enzymatic halogenation and assay analysis
can be found in the Supporting Information.
[11] J. T. Payne, M. C. Andorfer, J. C. Lewis, Angew. Chem. 2013, 125, 5379–
5382; Angew. Chem. Int. Ed. 2013, 52, 5271–5274.
[12] K. H. van Pꢂe, E. Patallo, Appl. Microbiol. Biotechnol. 2006, 70, 631–641.
[13] a) C. Dong, S. Flecks, S. Unversucht, C. Haupt, K. H. Van Pꢂe, J. H. Nai-
smith, Science 2005, 309, 2216–2219; b) E. Yeh, L. C. Blasiak, A. Koglin,
C. L. Drennan, C. T. Walsh, Biochemistry 2007, 46, 1284–1292.
[14] a) J. M. Winter, B. S. Moore, J. Biol. Chem. 2009, 284, 18577–18581; b) L.
Kaysser, P. Bernhardt, S.-J. Nam, S. Loesgen, J. G. Ruby, P. Skewes-Cox,
P. R. Jensen, W. Fenical, B. S. Moore, J. Am. Chem. Soc. 2012, 134,
11988–11991.
[15] W. S. Glenn, E. Nims, S. E. O’Connor, J. Am. Chem. Soc. 2011, 133,
19346–19349.
[16] a) E. Verhaeghe, D. Buisson, E. Zekri, C. Leblanc, P. Potin, Y. Ambroise,
Anal. Biochem. 2008, 379, 60–65; b) L. P. Hager, D. R. Morris, F. S. Brown,
H. Eberwein, J. Biol. Chem. 1966, 241, 1769–1777.
[17] C. Wagner, I. M. Molitor, G. M. Kçnig, Phytochemistry 2008, 69, 323–332.
[18] M. Frese, P. H. Guzowska, H. Voß, N. Sewald, ChemCatChem 2014, 6,
1270–1276.
[19] V. K. Tandon, H. K. Maurya, Tetrahedron Lett. 2009, 50, 5896–5902.
[20] A. Molaei Rad, H. Ghourchian, A. A. Moosavi-Movahedi, J. Hong, K.
Nazari, Anal. Biochem. 2007, 362, 38–43.
[21] a) S. Uchiyama, Y. Hasebe, J. Nishimoto, H. Hamana, Y. Maeda, Y. Yoshi-
da, Electroanalysis 1998, 10, 647–650; b) S. Witayakran, A. J. Ragauskas,
Eur. J. Org. Chem. 2009, 2009, 358–363.
[22] W. Liu, J. Kumar, S. Tripathy, K. J. Senecal, L. Samuelson, J. Am. Chem.
Soc. 1999, 121, 71–78.
[23] G. Spyrou, E. Haggard-Ljungquist, M. Krook, H. Jornvall, E. Nilsson, P.
Reichard, J. Bacteriol. 1991, 173, 3673–3679.
[24] T. Nagao, T. Mitamura, X. H. Wang, S. Negoro, T. Yomo, I. Urabe, H.
Okada, J. Bacteriol. 1992, 174, 5013–5020.
General assay procedure
All UV/Vis data was collected on a Synergy HT Multi-Mode Mi-
croplate Reader (BioTek Instruments). Calibration curves were
constructed from experiments performed at a 150 mL per well
scale by combining, 4-methyl-catachol (0.5 mm), hydrogen per-
oxide (3 mm) and the mixture of arylamine substrates to be an-
alysed (0.5 mm total concentration) in potassium phosphate
buffer (20 mm) at pH 7.4 with isopropanol (5%v/v) to aid the
dissolution of the organic amine. HRP (1 mL, 0.1 mgmLÀ1 in po-
tassium phosphate buffer (20 mm) at pH 7.4) was then added
to commence the reaction. The plate was then agitated for
5 min and the UV/Vis spectra recorded. In all cases, the reac-
tions were performed in triplicate. OriginPro 8 was used for all
data analysis, using linear least-squares fitting to calculate the
calibration curve.
[25] V. Kçhler, Y. M. Wilson, M. Dꢃrrenberger, D. Ghislieri, E. Churakova, T.
Quinto, L. Knçrr, D. Hꢄussinger, F. Hollmann, N. J. Turner, T. R. Ward, Nat.
Chem. 2012, 5, 93–99.
Acknowledgements
[26] V. Barone, Computational Strategies for Spectroscopy, John Wiley & Sons,
Hoboken, NJ, 2011.
[27] D. V. Moiseev, B. O. Patrick, B. R. James, T. Q. Hu, Inorg. Chem. 2007, 46,
9389–9399.
[28] E. Yeh, S. Garneau, C. T. Walsh, Proc. Natl. Acad. Sci. USA 2005, 102,
3960–3965.
L.S.W. acknowledges financial support from the UK Engineering
and Physical Sciences Research Council (grants EP/K011685/1,
EP/K024485/1) and a graduate studentship for J.H. J.M. is
grateful to the Centre of Excellence for Biocatalysis, Biotrans-
formations and Biocatalytic Manufacture (CoEBio3) for a gradu-
ate studentship to S.A.S.
Received: June 13, 2014
Published online on October 15, 2014
Chem. Eur. J. 2014, 20, 16759 – 16763
www.chemeurj.org
16763 ꢀ 2014 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim