An exocyclic methylene group acts as a bioisostere of the 2′-oxygen atom in lna

Article abstract of DOI:10.1021/ja105875e

We show for the first time that it is possible to obtain LNA-like (Locked Nucleic Acid 1) binding affinity and biological activity with carbocyclic LNA (cLNA) analogs by replacing the 2′-oxygen atom in LNA with an exocyclic methylene group. Synthesis of t

Full text of DOI:10.1021/ja105875e

Published on Web 10/01/2010
An Exocyclic Methylene Group Acts As a Bioisostere of the
2′-Oxygen Atom in LNA
Punit P. Seth,*,† Charles R. Allerson,† Andres Berdeja,‡ Andrew Siwkowski,§
Pradeep S. Pallan,| Hans Gaus,‡ Thazha P. Prakash,† Andrew T. Watt,§
Martin Egli,| and Eric E. Swayze†
Departments of Medicinal Chemistry, Structural Biology, and Antisense Drug DiscoVery, Isis
Pharmaceuticals, Inc., 1891 Rutherford Road, Carlsbad, California 92008, and Department of
Biochemistry, Vanderbilt UniVersity, School of Medicine, NashVille, Tennessee 37232
Received July 2, 2010; E-mail: pseth@isisph.com
Abstract: We show for the first time that it is possible to obtain LNA-like (Locked Nucleic Acid 1) binding
affinity and biological activity with carbocyclic LNA (cLNA) analogs by replacing the 2′-oxygen atom in
LNA with an exocyclic methylene group. Synthesis of the methylene-cLNA nucleoside was accomplished
by an intramolecular cyclization reaction between a radical at the 2′-position and a propynyl group at the
C-4′ position. Only methylene-cLNA modified oligonucleotides showed similar thermal stability and mismatch
discrimination properties for complementary nucleic acids as LNA. In contrast, the close structurally related
methyl-cLNA analogs showed diminished hybridization properties. Analysis of crystal structures of cLNA
modified self-complementary DNA decamer duplexes revealed that the methylene group participates in a
tight interaction with a 2′-deoxyribose residue of the 5′-terminal G of a neighboring duplex, resulting in the
formation of a CH...O type hydrogen bond. This indicates that the methylene group retains a negative
polarization at the edge of the minor groove in the absence of a hydrophilic 2′-substituent and provides a
rationale for the superior thermal stability of this modification. In animal experiments, methylene-cLNA
antisense oligonucleotides (ASOs) showed similar in vivo activity but reduced toxicity as compared to LNA
ASOs. Our work highlights the interchangeable role of oxygen and unsaturated moieties in nucleic acid
structure and emphasizes greater use of this bioisostere to improve the properties of nucleic acids for
therapeutic and diagnostic applications.
Introduction
for the target RNA and these ASOs are still subject to nuclease
mediated degradation.4 Second generation ASOs are chimeric
Antisense drug discovery technology represents a powerful
method to control gene expression in animals and in cell
culture.1 Antisense oligonucleotides (ASOs) bind to their
cognate mRNA (mRNA) by Watson-Crick base pairing. Upon
binding they can modulate splicing, interfere with translation,
or promote degradation of the mRNA by recrutiment of RNase
H or by degradation via the RISC pathway. Chemical modifica-
tions have been used extensively in antisense therapeutics to
modulate stability, binding affinity, and pharmacokinetic and
toxicological properties of ASOs.2 First generation ASOs were
fully phosphorothioate (PS) modified DNA oligonucleotides,
where one of the oxygen atoms in the backbone phosphodiester
linkage is replaced with a sulfur atom.3 The PS linkage protects
the ASO against nuclease degradation and promotes binding to
plasma proteins thereby permitting distribution to peripheral
tissues. However, the PS modification reduces binding affinity
oligonucleotides which have a central gap region of 10 to 16
deoxyribonucleotides flanked on the 3′- and 5′-ends with
modified residues such as 2′O-methoxyethyl nucleotides (MOE).
The MOE residues improve affinity for target mRNA and further
stabilize the olignucleotide against exonuclease digestion.5,6
Currently there are more than 20 second generation antisense
oligonucleotides (ASOs) in various stages of clinical trials for
a number of indications including hypercholesterolemia, dia-
betes, and cancer among others. The most advanced second
generation ASO, Mipomersen, an inhibitor of Apolipoprotein
B 100 (ApoB 100) biosynthesis,7 has shown mean reductions
of ∼25% in plasma LDL cholesterol in two phase III clinical
trials at a dose of 200 mg/week.8
In addition to MOE, a number of other 2′-modified ribo-
nucleosides such as 2′O-methyl and 2′-fluoro have been
(4) Geary, R. S.; Yu, R. Z.; Levin, A. A. Curr. Opin. InVestig. Drugs
2001, 2, 562–73.
† Department of Medicinal Chemistry, Isis Pharmaceuticals, Inc.
‡ Department of Structural Biology, Isis Pharmaceuticals, Inc.
§ Department of Antisense Drug Discovery, Isis Pharmaceuticals, Inc.
| Vanderbilt University.
(5) Martin, P. HelV. Chim. Acta 1995, 78, 486–504.
(6) Teplova, M.; Minasov, G.; Tereshko, V.; Inamati, G. B.; Cook, P. D.;
Manoharan, M.; Egli, M. Nat. Struct. Biol. 1999, 6, 535–539.
(7) Crooke, R. M.; Graham, M. J.; Lemonidis, K. M.; Whipple, C. P.;
Koo, S.; Perera, R. J. J. Lipid Res. 2005, 46, 872–84.
(8) Raal, F. J.; Santos, R. D.; Blom, D. J.; Marais, A. D.; Charng, M. J.;
Cromwell, W. C.; Lachmann, R. H.; Gaudet, D.; Tan, J. L.; Chasan-
Taber, S.; Tribble, D. L.; Flaim, J. D.; Crooke, S. T. Lancet 2010,
375, 998–1006.
(1) Bennett, C. F.; Swayze, E. E. Annu. ReV. Pharmacol. Toxicol. 2010,
50, 259–93.
(2) Swayze, E. E.; Bhat, B. In Antisense Drug Technology: Principles,
Strategies, and Applications, 2nd ed.; Crooke, S. T., Ed.; CRC Press:
Boca Raton, FL, 2008; pp 143-182.
(3) Eckstein, F. Antisense Nucleic Acid Drug DeV. 2000, 10, 117–21.
9
14942 J. AM. CHEM. SOC. 2010, 132, 14942–14950
10.1021/ja105875e  2010 American Chemical Society

Exocyclic Methylene Group Acts As a Bioisostere in LNA
A R T I C L E S
investigated for various antisense applications.9 These modifica-
tions were found to be tolerated in both the sense and antisense
strands of siRNA duplexes10 and have found applications in
improving the therapeutic properties of oligonucleotide aptam-
ers.11 2′-Fluoro modified ASOs have also found utility as
miRNA antagonists where they displayed a remarkable im-
provement in in ViVo activity which has been ascribed to altered
subcellular pharmacokinetic properties.12 To further improve
the binding affinity of oligonucleotides, Wengel and Imanishi
independently introduced 2′,4′-methyleneoxy bridged nucleic
acids, also commonly known as Locked nucleic acid 1 (LNA).13
LNA modified oligonucleotides show unprecedented improve-
ment in the thermal stability of oligonucleotide duplexes.14 LNA
ASOs have also demonstrated promising results for down
regulating gene expression,15,16 splice modulation,17 and as
micro RNA (miRNA) antagonists18 in various animal models.
However, some LNA ASOs appear to be associated with an
increased risk for causing hepatotoxicity.19
The synthesis of other 2′,4′-conformationally restricted
nucleoside analogs has been an active area of interest recently
given the successful applications of LNA within the antisense
paradigm.20 As part of a comprehensive program aimed at
understanding the structure-activity relationships (SAR) of
ASOs containing LNA and other related conformationally
restricted 2′,4′-bridged nucleic acids (BNA), we recently
reported the synthesis and biological evaluation of 2′,4′-
constrained Ethyl (cEt) modified nucleic acids 2 (R-cEt) and 3
(S-cEt).21-23 We found that replacing LNA with the cEt
modifications resulted in an improvement in the therapeutic
profile of “gapmer”24 ASOs targeting Mus. musculus phos-
phatase and tensin homologue (mouse PTEN). We speculated
that the improved therapeutic profile of the cEt ASOs was a
result of altered interactions of these ASOs with cellular
macromolecules. To investigate if changing the position of the
alkyl substituent along the 2′,4′-bridging group could provide
further improvements in the therapeutic profile, we wished to
evaluate substituted carbocyclic LNA (cLNA) analogs 4 (R-
methyl-cLNA) and 5 (S-methyl-cLNA) where the 2′-oxygen
atom of LNA was replaced with a substituted carbon atom.
At the time we initiated our synthesis program there were
no literature reports describing the synthesis of carbocyclic LNA
analogs. We envisaged a strategy where both the R- and
S-methyl-cLNA analogs 4 and 5 as well as other cLNA analogs
could be prepared from the methylene-cLNA nucleoside 7 by
synthetic manipulation of the exocyclic double bond. For
example, the double bond can be hydroborated to provide the
hydroxymethyl analog or cleaved oxidatively to provide the keto
compound, both of which could serve as intermediates for a
myriad of chemical transformations (alkylation, fluorination,
reduction, oxidation etc.) to provide other cLNA analogs.
Retrosynthetically, methylene-cLNA 7 could be prepared from
a suitable nucleoside precursor 8 by means of an intramolecular
radical cyclization reaction (Figure 1). This strategy was inspired
by previous work by Chattopadhyaya25,26 and Matsuda,27,28 who
independently showed that it was possible to form intramolecular
carbon-carbon bonds by generating and trapping a radical at
the 2′ position of a nucleoside with a suitable acceptor group.
We were also motivated to evaluate the antisense properties of
the methylene-cLNA 6 itself, as replacing an oxygen atom with
a methylene group has been successfully utilized in the antiviral
arena (Entecavir)29 and in the search for novel nucleic acid
mimics (cyclohexenyl nucleic acids, CeNA).30
While our work was in progress, Chattopadhyaya and co-
workers reported the synthesis and biophysical properties of
oligonucleotides containing a mixture of R- and S-methyl-cLNA
analogs 4 and 5.31 Since the initial report, Chattopadhyaya has
also reported the synthesis and properties of a number of
differentially substituted cENA and cLNA analogs (1a-c,
Figure 2).32-34 Recently, Nielsen and co-workers reported the
synthesis and biophysical properties of a number of carbocyclic
ENA analogs using intramolecular ring closing metathesis and
ene-alkyne metathesis reactions (1d-f, Figure 2).35,36 All the
cLNA and cENA analogs reported thus far show moderate to
(9) Prakash, T. P.; Bhat, B. Curr. Top. Med. Chem. 2007, 7, 641–649.
(10) Allerson, C. R.; Sioufi, N.; Jarres, R.; Prakash, T. P.; Naik, N.; Berdeja,
A.; Wanders, L.; Griffey, R. H.; Swayze, E. E.; Bhat, B. J. Med. Chem.
2005, 48, 901–4.
(11) Ng, E. W.; Shima, D. T.; Calias, P.; Cunningham, E. T., Jr.; Guyer,
D. R.; Adamis, A. P. Nat. ReV. Drug DiscoVery 2006, 5, 123–32.
(12) Davis, S.; Propp, S.; Freier, S. M.; Jones, L. E.; Serra, M. J.; Kinberger,
G.; Bhat, B.; Swayze, E. E.; Bennett, C. F.; Esau, C. Nucleic Acids
Res. 2009, 37, 70–7.
(13) Obika, S.; Nanbu, D.; Hari, Y.; Andoh, J.-I.; Morio, K.-I.; Doi, T.;
Imanishi, T. Tetrahedron Lett. 1998, 39, 5401–5404.
(14) Wengel, J. Acc. Chem. Res. 1999, 32, 301–310.
(15) Sapra, P.; Wang, M.; Bandaru, R.; Zhao, H.; Greenberger, L. M.;
Horak, I. D. Nucleosides, Nucleotides Nucleic Acids 2010, 29, 97–
112.
(25) Xi, Z.; Rong, J.; Chattopadhyaya, J. Tetrahedron 1994, 50, 5255–
5272.
(26) Xi, Z.; Agback, P.; Plavec, J.; Sandstro¨m, A.; Chattopadhyaya, J.
Tetrahedron 1992, 48, 349–370.
(16) Fluiter, K.; Frieden, M.; Vreijling, J.; Rosenbohm, C.; De Wissel,
M. B.; Christensen, S. M.; Koch, T.; Orum, H.; Baas, F. ChemBioChem
2005, 6, 1104–9.
(27) Sukeda, M.; Shuto, S.; Sugimoto, I.; Ichikawa, S.; Matsuda, A. J. Org.
Chem. 2000, 65, 8988–8996.
(17) Graziewicz, M. A.; Tarrant, T. K.; Buckley, B.; Roberts, J.; Fulton,
L.; Hansen, H.; Orum, H.; Kole, R.; Sazani, P. Mol. Ther. 2008, 16,
1316–22.
(28) Sukeda, M.; Ichikawa, S.; Matsuda, A.; Shuto, S. J. Org. Chem. 2003,
68, 3465–3475.
(29) Bisacchi, G. S.; Chao, S. T.; Bachard, C.; Daris, J. P.; Innaimo, S.;
Jacobs, G. A.; Kocy, O.; Lapointe, P.; Martel, A.; Merchant, Z.;
Slusarchyk, W. A.; Sundeen, J. E.; Young, M. G.; Colonno, R.; Zahler,
R. Bioorg. Med. Chem. Lett. 1997, 7, 127–132.
(18) Lanford, R. E.; Hildebrandt-Eriksen, E. S.; Petri, A.; Persson, R.;
Lindow, M.; Munk, M. E.; Kauppinen, S.; Orum, H. Science 2010,
327, 198–201.
(19) Swayze, E. E.; Siwkowski, A. M.; Wancewicz, E. V.; Migawa, M. T.;
Wyrzykiewicz, T. K.; Hung, G.; Monia, B. P.; Bennett, C. F. Nucleic
Acids Res. 2007, 35, 687–700.
(30) Wang, J.; Verbeure, B.; Luyten, I.; Lescrinier, E.; Froeyen, M.;
Hendrix, C.; Rosemeyer, H.; Seela, F.; Van Aerschot, A.; Herdewijn,
P. J. Am. Chem. Soc. 2000, 122, 8595–8602.
(20) Zhou, C.; Chattopadhyaya, J. Curr. Opin. Drug DiscoVery DeV. 2009,
12, 876–898.
(31) Srivastava, P.; Barman, J.; Pathmasiri, W.; Plashkevych, O.; Wenska,
M.; Chattopadhyaya, J. J. Am. Chem. Soc. 2007, 129, 8362–8379.
(32) Zhou, C.; Plashkevych, O.; Chattopadhyaya, J. J. Org. Chem. 2009,
74, 3248–3265.
(21) Swayze, E. E.; Seth, P. P. PCT Int. Appl. 2007, WO 2007090071.
(22) Seth, P. P.; Vasquez, G.; Allerson, C. A.; Berdeja, A.; Gaus, H.;
Kinberger, G. A.; Prakash, T. P.; Migawa, M. T.; Bhat, B.; Swayze,
E. E. J. Org. Chem. 2010, 75, 1569–81.
(33) Zhou, C.; Liu, Y.; Andaloussi, M.; Badgujar, N.; Plashkevych, O.;
Chattopadhyaya, J. J. Org. Chem. 2009, 74, 118–134.
(34) Xu, J.; Liu, Y.; Dupouy, C.; Chattopadhyaya, J. J. Org. Chem. 2009,
74, 6534–6554.
(23) Seth, P. P.; Siwkowski, A.; Allerson, C. R.; Vasquez, G.; Lee, S.;
Prakash, T. P.; Wancewicz, E. V.; Witchell, D.; Swayze, E. E. J. Med.
Chem. 2009, 52, 10–3.
˜
(35) Kumar, S.; Hansen, M. H.; AlbA|k, N.; Steffansen, S. I.; Petersen,
(24) Monia, B. P.; Lesnik, E. A.; Gonzalez, C.; Lima, W. F.; McGee, D.;
Guinosso, C. J.; Kawasaki, A. M.; Cook, P. D.; Freier, S. M. J. Biol.
Chem. 1993, 268, 14514–22.
M.; Nielsen, P. J. Org. Chem. 2009, 74, 6756–6769.
(36) Albæk, N.; Petersen, M.; Nielsen, P. J. Org. Chem. 2006, 71, 7731–
7740.
9
J. AM. CHEM. SOC. VOL. 132, NO. 42, 2010 14943

A R T I C L E S
Seth et al.
Figure 1
Huntington alleles over wild-type transcripts.39,40 However, there
are no reports which conclusively explain why cLNA analogs
reported thus far show reduced hybridization properties relative
to their “oxa” counterparts. Moreover, there are no reports that
describe the in ViVo properties of cLNA modified ASOs. In this
manuscript we show for the first time that it is possible to obtain
LNA-like binding affinity with cLNA analogs by replacing the
2′-oxygen with an exocyclic methylene group and rationalize
the improved thermodynamic properties using crystal structure
data. We also report, for the first time, the biological evaluation
of cLNA modified ASOs in animal experiments and demonstrate
the usefulness of this class of nucleoside modifications for
antisense applications.
Results and Discussion
Figure 2
Synthesis of the methylene-cLNA nucleoside commenced
from the known 5′-O-TBDPS-3′O-(2-methylnapthalene)-allo-
furanose derivative 9 (Scheme 1).22 Swern oxidation41 of the
primary alcohol followed by a Wittig reaction provided olefin
10 in excellent yield (92%, two steps). Hydroboration of the
double bond using 9-BBN/sodium perborate42 provided the
primary alcohol 11 in good yield (76%). A Swern oxidation of
the primary alcohol followed by a Corey-Fuchs43 reaction
provided the dibromo olefin 12 (81%, two steps). Attempts to
convert 12 directly to the alkyne 15 using nBuLi were
unsuccessful. Treatment of 12 with nBuLi resulted in the
formation of a dark green colored solution indicative of single
electron transfer into the neighboring naphthlene ring.44 To avoid
this problem, the naphthyl group (Nap) was deprotected with
significantly reduced binding affinity for complementary RNA
relative to LNA that can be partially restored by introducing
hydrophilic groups along the 2′,4′-bridging substituent. Interest-
ingly, both Chattopadhyaya and Nielsen also showed that cLNA
analogs appear to recognize complementary DNA less efficiently
relative to RNA. They proposed that replacing the 2′-oxygen
atom with carbon reduces the hydration of the duplex in the
minor groove which in turn affects recognition of DNA more
severely as compared to RNA.34,35 Recently, Bramsen and co-
workers have reported on the utility of cLNA ASOs for
positional modification of sense and antisense strands of
siRNAduplexes.37,38 In addition, Corey has shown that cLNA
ASOs may have utility in selective targeting of mutant
(39) Hu, J.; Matsui, M.; Gagnon, K. T.; Schwartz, J. C.; Gabillet, S.; Arar,
K.; Wu, J.; Bezprozvanny, I.; Corey, D. R. Nat. Biotechnol. 2009,
27, 478–84.
(37) Bramsen, J. B.; Laursen, M. B.; Nielsen, A. F.; Hansen, T. B.; Bus,
C.; Langkjaer, N.; Babu, B. R.; Hojland, T.; Abramov, M.; Van
Aerschot, A.; Odadzic, D.; Smicius, R.; Haas, J.; Andree, C.; Barman,
J.; Wenska, M.; Srivastava, P.; Zhou, C.; Honcharenko, D.; Hess, S.;
Muller, E.; Bobkov, G. V.; Mikhailov, S. N.; Fava, E.; Meyer, T. F.;
Chattopadhyaya, J.; Zerial, M.; Engels, J. W.; Herdewijn, P.; Wengel,
J.; Kjems, J. Nucleic Acids Res. 2009, 37, 2867–2881.
(40) Gagnon, K. T.; Hu, J.; Swayze, E. E.; Bennett, C. F.; Potier, P.;
Montaillier, C.; Roesch, E.; Lemaitre, M.; Randolph, J.; Deleavey,
G.; Damha, M.; Corey, D. CHDI’s 5th Annual Huntington’s Disease
Therapeutics Conference; 2010.
(41) Mancuso, A. J.; Huang, S.-L.; Swern, D. J. Org. Chem. 1978, 43,
2480–2482.
(38) Bramsen, J. B.; Pakula, M. M.; Hansen, T. B.; Bus, C.; Langkjaer,
N.; Odadzic, D.; Smicius, R.; Wengel, S. L.; Chattopadhyaya, J.;
Engels, J. W.; Herdewijn, P.; Wengel, J.; Kjems, J. Nucleic Acids
Res. 2010, 38, 5761–5773.
(42) Peng, C. G.; Damha, M. J. Nucleic Acids Res. 2005, 33, 7019–7028.
(43) Corey, E. J.; Fuchs, P. L. Tetrahedron Lett. 1972, 13, 3769–3772.
(44) Holy, N. L. Chem. ReV. 1974, 74, 243–277.
9
14944 J. AM. CHEM. SOC. VOL. 132, NO. 42, 2010

Exocyclic Methylene Group Acts As a Bioisostere in LNA
A R T I C L E S
Scheme 1
Scheme 2
DDQ45 to provide 13 (99%), which was further treated with
nBuLi to provide the alkyne 14 efficiently (97%). Reprotection
of the 3′-hydroxyl group as the naphthyl ether provided the
desired alkyne 15 (81%). Acetolysis of the 1,2-isopropylidene
group, followed by synthesis of the nucleoside by means of a
Vorbruggen reaction46 with persilylated uracil and deprotection
of the 2′-O-acetyl group, provided nucleoside 16 in good yield
(72%, three steps). The 2′-hydoxyl group in 16 was converted
to the thiocarbonate 17 by treatment with tolyl-chlorothiono-
formate (86%). Treatment of the thiocarbonate 17 with tribu-
tyltin hydride and AIBN provided the cyclized nucleoside 18
by means of intramolecular radical cyclization reaction. Interest-
ingly, Chattopadyaya had previously reported that unsubstituted
alkynes do not participate efficiently in intramolecular radical
cyclization reactions due to decomposition of the alkyne moiety
under the reaction conditions employed (AIBN/nBu3SnH).25
However, in the case of nucleoside 17, no further protection of
the alkyne was required for efficient cyclization to occur. It is
conceivable that, in the case of 17, the radical cyclization occurs
faster than the competing decomposition reactions. The naphthyl
protecting group was next cleanly removed using DDQ to
provide 19 (62%). Deprotection of the 5′O-TBDPS ether
provided nucleoside 20 (69%). Protection of the 5′-hydroxyl
group as the 4,4′-dimethoxytrityl (DMTr) ether (96%) followed
by a phosphitylation reaction provided the desired amidite 22
in good yield (83%).
of the known nucleosides 23 and 24 (Scheme 2)(Supporting
Information).31
Thermal Stability and Mismatch Discrimination Properties of
cLNA Analogs. All the modified nucleoside phosphoramidites
were incorporated into oligonucleotides using standard phos-
phoramidite chemistry described previously.22 We first evaluated
the cLNA analogs in an oligonucleotide sequence used by
Imanishi13 to evaluate the hybridization properties of LNA and
compared them to R-cEt, S-cEt, and LNA modified oligonucle-
otides (Table 1). In this sequence, methylene-cLNA (A2, ∆Tm
+ 4.8 °C/mod. vs RNA, -1.6 °C/mod. vs DNA) showed similar
thermal stability versus RNA as LNA (A7, ∆Tm + 4.5 °C/mod.
vs RNA, +0.1 °C/mod. vs DNA), S-cEt (A6, ∆Tm + 4.5 °C/
mod. vs RNA, -0.1 °C/mod. vs DNA), and R-cEt (A5, ∆Tm
+4.7 °C/mod. vs RNA, -1.1 °C/mod. vs DNA) but reduced
stability versus complementary DNA as compared to LNA and
S-cEt modified oligonucleotides. Chattopadhyaya had previously
reported the hybridization properties of a mixture of the
R-methyl and S-methyl thymine nucleobase modified cLNA
analogs in a different Tm sequence.31 We were able to separate
these nucleosides at the 5′O-DMTr stage and evaluate the
individual isomers in thermal denaturation studies. Evaluation
of the R-Me-cLNA (A3, ∆Tm +2.9 °C/mod. vs RNA, -3.1 °C/
mod. vs DNA) in the Imanishi sequence showed that this isomer
did not hybridize complementary RNA or DNA as efficiently
as LNA or methylene-cLNA oligonucleotides. The S-Me-cLNA
(A4, ∆Tm +2.0 °C/mod. vs RNA, -3.9 °C/mod. vs DNA)
showed the poorest hybridization properties compared to all the
analogs evaluated. In general the cLNA analogs exhibited
The structure of the methylene-cLNA nucleoside was estab-
lished by NMR spectroscopy. For the 2′,4′ cyclized nucleoside
18, the H1′, H2′, and H3′ proton resonances appear as singlets,
which is consistent with the furanose ring being locked in the
Northern conformation. In addition, the identity of the meth-
ylene-cLNA nucleoside was further confirmed by reducing the
exocyclic double bond in the 5′O-DMTr protected nucleoside
21 using catalytic hydrogenation to provide a separable mixture
(45) Xia, J.; Abbas, S. A.; Locke, R. D.; Piskorz, C. F.; Alderfer, J. L.;
Matta, K. L. Tetrahedron Lett. 2000, 41, 169–173.
(46) Vorbru¨ggen, H.; Bennua, B. Chem. Ber. 1981, 114, 1279–1286.
slightly improved selectivity (as measured by Tm RNA - Tm DNA/
9
J. AM. CHEM. SOC. VOL. 132, NO. 42, 2010 14945

A R T I C L E S
Seth et al.
Table 1. Thermal Stability Measurements of Methylene-cLNA, R-Me-cLNA, S-Me-cLNA, R-cEt, S-cEt, and LNA versus Complementary RNA
and DNA in the Imanishi Sequence
b
Tm (°C)
vs RNA
∆Tm
(°C)/mod.
Tm (°C)
vs DNA
∆ Tm
(°C)/mod.
(Tm RNA - Tm DNA)/
no. mod. (°C)
Oligomer
Modification
Sequencea (5′-3′)
A1
A2
A3
A4
A5
A6
A7
DNA
d(GCGTTTTTTGCT)
d(GCGTTUTTTGCT)
d(GCGTTUTTTGCT)
d(GCGTTUTTTGCT)
d(GCGTTUTTTGCT)
d(GCGTTUTTTGCT)
d(GCGTTUTTTGCT)
45.6
50.4
48.5
47.6
50.3
50.1
50.1
0
50.9
49.3
47.8
47.0
49.8
50.8
51.0
0
0
Methylene-cLNA
R-Me-cLNA
S-Me-cLNA
R-cEtc
+4.8
+2.9
+2.0
+4.7
+4.5
+4.5
-1.6
-3.1
-3.9
-1.1
-0.1
+0.1
+1.1
+0.7
+0.6
+0.5
-0.7
-0.9
S-cEtc
LNAc
a Bold letter indicates modified residue. b Tm values were measured in 10 mM sodium phosphate buffer (pH 7.2) containing 100 mM NaCl and 0.1
mM EDTA. Sequence of RNA complement: 5′-r(AGCAAAAAACGC)-3′. Sequence of DNA complement: 5′-d(AGCAAAAAACGC)-3′ c Reference 11.
Table 2. Mismatch Discrimination of DNA, Methylene-cLNA, R-Me-cLNA, S-Me-cLNA, and LNA versus Mismatched RNA Complements
Tm (∆Tm ) Tm(mismatch) - Tm(match)) (°C)b
X ) A
(match)
Oligomer
Sequence (5′-3′)a
G
C
U
A1 (DNA)
d(GCGTTTTTTGCT)
d(GCGTTUTTTGCT)
d(GCGTTUTTTGCT)
d(GCGTTUTTTGCT)
d(GCGTTUTTTGCT)
45.6
50.4
48.5
47.6
50.1
41.5 (-4.1)
44.6 (-5.8)
42.3 (-6.2)
39.8 (-7.8)
45.0 (-5.1)
32.3 (-13.3)
34.9 (-15.5)
34.8 (-13.7)
33.4 (-14.2)
35.2 (-14.9)
31.8 (-13.8)
37.2 (-13.2)
36.3 (-12.2)
35.3 (-12.3)
37.2 (-12.9)
A2 (methylene-cLNA)
A3 (R-Me-cLNA)
A4 (S-Me-cLNA)
A8 (LNA)c
a Bold letter indicates modified residue. b Tm values were measured in 10 mM sodium phosphate buffer (pH 7.2) containing 100 mM NaCl and 0.1
mM EDTA; sequence of RNA complement: 5′-r(AGCAAAXAACGC)-3′. c Reference 11.
Table 3. Thermal Stability Measurements of Methylene-cLNA, R-Me-cLNA, S-cEt LNA versus Complementary RNA and DNA in the
Herdewijn Sequence
Tm (°C)b
vs RNA
∆ Tm
(°C)/mod.
Tm (°C)
vs DNA
∆ Tm
(°C)/mod.
(Tm RNA - Tm DNA)/
no. mod. (°C)
Oligomer
Modification
Sequence (5′-3′)a
B1
B2
B3
B4
B5
DNA
d(CCAGTGATATGC)
d(CCAGUGAUAUGC)
d(CCAGUGAUAUGC)
d(CCAGUGAUAUGC)
d(CCAGUGAUAUGC)
42.6
64.0
58.9
61.8
61.0
0
48.7
60.7
54.2
59.3
59.4
0
0
Methylene-cLNA
R-Me-cLNA
S-cEt
+7.1
+5.4
+6.4
+6.1
+4.0
+1.8
+3.5
+3.6
+1.1
+1.6
+0.8
+0.5
LNA
a Bold letter indicates modified residue. b Tm values were measured in 10 mM sodium phosphate buffer (pH 7.2) containing 100 mM NaCl and 0.1
mM EDTA. Sequence of RNA complement: 5′-r(GCAUAUCACUGG)-3′. Sequence of DNA complement: 5′-d(GCATATCACTGG)-3′.
number of modifications) for RNA versus DNA as compared
to their “oxa” counterparts but the increase was very modest.
We next evaluated the mismatch selectivity of the cLNA
analogs versus mismatched RNA complements as reported by
Imanishi47 and compared them to LNA (Table 2). Methylene-
cLNA A2 and R-Me-cLNA A3 showed comparable (-6 °C)
mismatch selectivity while the S-Me-cLNA A4 showed slightly
improved (-8 °C) mismatch selectivity for the G-U mis-
matched pair as compared to LNA (-5 °C). All the cLNA
analogs showed excellent selectivity for the C-U (-14 to -16
°C) and the U-U (-12 to -13 °C) mismatched pair which
were essentially identical to that observed for LNA.
extension of a 9-mer sequence used by Wengel to evaluate the
hybridization properties of LNA and allows for three incorpora-
tions of U/T monomers at different positions of the oligonucle-
otide.48 In this sequence, the methylene-cLNA (B2, ∆Tm +7.1
°C/mod. vs RNA, +4.0 °C/mod. vs DNA) showed excellent
hybridization properties which were superior to those of R-Me-
cLNA (B3, ∆Tm +5.4 °C/mod. vs RNA, +1.8 °C/mod. vs DNA)
as well as S-cEt (B4, ∆Tm +6.4 °C/mod. vs RNA, +3.5 °C/
mod. vs DNA) and LNA (B5, ∆Tm +6.1 °C/mod. vs RNA, +3.6
°C/mod. vs DNA) modified oligonucleotides. As seen with the
Imanishi sequence, the methylene-cLNA (+1.1 °C) and R-Me-
cLNA (+1.6 °C) oligonucleotides showed only slightly im-
proved selectivity for RNA versus DNA as compared to LNA
(+0.5 °C) and S-cEt (+0.8 °C).
We also evaluated the hybridization properties of methylene-
cLNA and the R-Me-cLNA in a different oligonucleotide
sequence first described by Herdewijn for the evaluation of HNA
and related analogs (Table 3).30 This sequence is a three base
Thus it appears that replacing the 2′-oxygen atom in LNA
with an sp3 hybridized carbon atom (analogs 4 and 5) but not
(48) Koshkin, A. A.; Singh, S. K.; Nielsen, P.; Rajwanshi, V. K.; Kumar,
R.; Meldgaard, M.; Olsen, C. E.; Wengel, J. Tetrahedron 1998, 54,
3607–3630.
(47) AbdurRahman, S. M.; Seki, S.; Obika, S.; Yoshikawa, H.; Miyashita,
K.; Imanishi, T. J. Am. Chem. Soc. 2008, 130, 4886–4896.
9
14946 J. AM. CHEM. SOC. VOL. 132, NO. 42, 2010

Exocyclic Methylene Group Acts As a Bioisostere in LNA
A R T I C L E S
Table 4. Selected Crystal and Refinement Data
Oligonucleotide
Vindec
Rmedec
Smedec
Sequence
Modified nucleotide (U*)
Space group
d(GCGTAU*ACGC)
R-Me-cLNA-U E2
Methylene-cLNA-U E1
S-Me-cLNA-U E3
Orthorhombic P212121
Unit cell constants [Å]
R ) ꢀ ) γ ) 90°
Resolution [Å]
a ) 24.42, b ) 44.11, c ) 45.84
a ) 26.10, b ) 43.49, c ) 45.97
a ) 24.47, b ) 44.11, c ) 45.95
1.57
1.59
1.35
Outer shell [Å]
1.63-1.57
7,592
99.4 (99.7)
6.7 (24.8)
16.3
1.65-1.59
7,451
99.7 (97.9)
5.7 (52.7)
17.2
1.40-1.35
11,119
98.7 (91.7)
5.9 (43.6)
14.6
No. of unique reflections
Completeness (outer shell) [%]
R-merge (outer shell) [%]
R-work [%]
R-free [%]
20.8
23.7
18.6
No. of DNA atoms
No. of waters
408
65
408
48
408
78
Rms deviations bonds [Å]
Rms deviations angles [deg]
Avg B-factor, DNA atoms [Å2]
Avg B-factor, solvent [Å2]
PDB entry code
0.022
2.5
15.0
24.1
3OZ3
0.019
2.1
22.0
32.4
3OZ4
0.022
2.4
11.9
22.2
3OZ5
an sp2 hybridized carbon atom (Methylene-cLNA 6) results in
loss of binding affinity for complementary nucleic acids.
Moreover, changing the orientation of the methyl group at the
sp3 carbon from the (R) (in the minor groove) to the (S) (edge
of minor groove) configuration appears to diminish the binding
affinity for complementary DNA and RNA. Interestingly,
Chattopadhayaya recently reported the thermal stability of
oligonucleotides containing a cLNA analog where the 2′-oxygen
atom is replaced with an unsubstituted methylene group.34 Even
in that case, no improvement in binding affinity relative to the
mixture of methyl-substituted analogs 4/5 was observed.
Consistent with the reports of Nielsen and Chattopadhyaya, we
observed an enhancement in recognition of cDNA versus
complementary RNA for the cLNA analogs, although the
magnitude of stabilization was small and somewhat sequence
dependent. Nonetheless, the methylene-cLNA analog 6 repre-
sents the first example of a cLNA that shows LNA-like binding
affinity without the added need for hydrophilic substituents along
the 2′-4′-bridging group to restore duplex hydration.
It is conceivable that the methylene group in 6 does not
disrupt the water of hydration around the backbone phosphodi-
ester linkage and in the minor groove and this results in
improved binding affinity for complementary nucleic acids
relative to analogs 4 and 5 which have a saturated carbon atom
at the same position. To test this hypothesis, we examined the
crystal structure of methylene-cLNA as well as R- and S-Me-
cLNA modified oligonucleotides incorporated into a self-
complementary DNA decamer duplex.49
X-ray Crystallographic Studies of DNAs Containing Carbocy-
clic LNA Analogs. The crystal structures of decamer duplexes
with sequence d(GCGTAU*ACGC), whereby U* is methylene-
cLNA-U, R-Me-cLNA-U, or S-Me-cLNA-U were crystallized
(Supporting Information) (referred to as Vindec E1, Rmedec
E2, and Smedec E3, respectively), and their structures were
determined at resolutions of between 1.35 and 1.59 Å (Table
4). The three duplexes adopt an A-form geometry with average
values for helical rise and twist of ca. 2.8 Å and 32°,
respectively. All of them exhibit a kink of ca. 12° into the major
groove that is localized between the T4 and A5 residues
(nucleotides of one strand are numbered 1 to 10 and those in
the complementary strand are numbered 11 to 20; the modified
cLNA residues are U*6 and U*16). The local compression of
that groove goes along with an extended variant of the backbone
at residue A5; that is, the R and γ torsion angles are in the ap
range instead of in the standard sc- and sc+ ranges, respectively.
As expected, the conformations of sugars are virtually without
exception of the C3′-endo type. In particular, the sugars of all
six cLNA nucleotides fall into this pucker range.
The overall packing motifs in the three orthorhombic
crystal lattices of the Vindec, Rmedec, and Smedec structures
are quite similar. Terminal base pairs of duplexes stack
against the minor grooves of neighboring DNAs such that
each duplex acts as a receptor of two base pairs from nearest
neighbors. However, there are subtle differences in the
closeness of the interduplex contacts that allow insights into
the individual electrostatic potentials of cLNA sugars. Thus,
in the case of the Vindec duplex, the sugar of residue U*6
engages in a tight interaction with the 2′-deoxyribose moiety
of the 5′-terminal G from a neighboring strand (Figure 3A).
This leads to formation of a C-H...O-type hydrogen bond
between the outer methylene carbon from U*6 and O4′ of
G1# (# marks a symmetry mate; C...O distance 3.50 Å). By
comparison, the packing of duplexes in the Rmedec and
Smedec lattices is altered such that the neighboring terminal
guanidine does not approach the floor of the minor groove
and therefore the R- or S-methyl substituents of cLNA sugars
(Figure 3B and C). These observations provide an indication
that the methylene-cLNA moiety retains a negative polariza-
tion at the edge of the minor groove in the absence of a
hydrophilic 2′-substituent. Conversely, the R- and S-Me-
cLNA sugars in the Rmedec and Smedec structures are poorly
hydrated and unable to extend the water structure around the
edges of nucleobases toward the phosphate backbone.
The interaction between the methylene moiety of U*6 in the
Vindec structure is in some ways reminiscent of the environ-
ment of the 2′-O-allyl substituent in the crystal structure of
a decamer duplex of the same sequence containing 2′-O-
modified uridines at positions 6 and 16.50 The outer meth-
yleneic carbon of the 2′-allyl substituent at U6 displays
contacts to four water molecules with distances <3.3 Å.
Among these waters, two bridge the outer methylene carbon
atoms of the substituents at U6 and U16, whereby the
dC(H)2...OW distances are 2.88 and 3.28 Å for allyl(U6) and
3.45 and 3.51 Å for allyl(U16). The allyl moieties themselves
(49) Egli, M.; Usman, N.; Rich, A. Biochemistry 1993, 32, 3221–3237.
9
J. AM. CHEM. SOC. VOL. 132, NO. 42, 2010 14947

A R T I C L E S
Seth et al.
carried out using two different oligonucleotide sequences (14-
and 18-mer) targeting mouse PTEN (Table 5). The 14-mer
ASO sequence has a 10-base deoxynucleotide “gap” flanked
on the 5′ and the 3′ end with two modified residues (2-10-2
design) and was described by us previously to characterize
the in ViVo properties of the R- and S-cEt and LNA “gapmer”
ASOs.23,51 We first evaluated the ASOs in thermal stability
experiments. As seen in the Tm sequences, methylene cLNA
ASO C1 showed similar thermal stability to that of LNA
ASO C3 while the R-Me-cLNA ASO C2 showed lower
stability. The slightly improved thermal stability of LNA ASO
C3 could be attributed to the presence of 5-methyl substit-
uents on the pyrimidine nucleobases, which are known to
improve the thermal (approximately +0.5 °C/mod.)52 and
nuclease stability of oligonucleotides.53 The thermal stability
observations were essentially recapitulated in the 18-mer
sequence where the methylene-cLNA D1 ASO was similar
to LNA ASO D3 and both were slightly better than R-Me-
cLNA D2. However, the influence of the 5-methyl groups
was not as prominent for the 18-mer sequence as compared
to the 14-mer sequence. It is conceivable that the 18-mer
ASO is capable of forming a more stable duplex (∼1.7 helical
turns) as compared to the 14-mer ASO (∼1.3 helical turns)
and is less influenced by the added stabilization provided by
5-methyl groups on the pyrimidine nucleobases.
The ASOs were next evaluated in cell culture experiments
in brain endothelial cells (bEND) using electroporation to
assist ASO delivery. For the 14-mer ASOs, the activity in
cell culture essentially parallels the Tm data. LNA ASO C3
(2.8 µM) showed the best activity while the cLNA ASOs
C1 (3.9 µM) and C2 (7.9 µM) were slighly less potent. For
the 18-mer ASOs, the methylene-cLNA ASO D1 was the
most potent (4.9 µM) while the R-Me-cLNA ASO D2 (8.9
µM) and LNA ASO D3 (7.7 µM) were slightly less active.
ASOs C1, C2, and C3 were evaluated in animal experiments
using a subchronic dosing schedule. Mice (n ) 4 per dose group)
were injected i.p. with 0.5, 1.5, 5, and 15 mg/kg, twice a week
for 3 weeks, of ASOs C1, C2, and C3 (Figure 4). PTEN mRNA
levels in liver were measured using quantitative RT-PCR 72 h
after injection of the last ASO dose and normalized to saline
treated animals using protocols described previously.23 Plasma
alanine amino transferase (ALT) levels, a well established
marker for liver injury, were measured at sacrifice. The LNA
ASO C3 served as a positive control for the experiment. Dose
dependent down regulation of PTEN mRNA in liver tissue was
observed for all the ASOs tested. The LNA ASO C3 was the
most potent with an ED50 of 3.5 mg/kg. The methylene-cLNA
ASO C1 was slightly less potent (ED50 ) 4.9 mg/kg) while the
R-Me-cLNA ASO C2 (ED50 ) 8.7 mg/kg) was the least potent
Figure 3. Central A5pU*6:A15pU*16 base-pair steps viewed into the
minor grooves of the (A) Vindec E1, (B) Rmedec E2, and (C) Smedec E3
crystal structures. The strand with residues A5 and U*6 is on the left; carbon,
oxygen, nitrogen, and phosphorus atoms are colored in gray, red, blue, and
orange, respectively; and carbon atoms of cLNA sugars are highlighted in
yellow. Carbon atoms of a 5′-terminal G from a neighboring duplex and
an MPD (2-methyl-2,4-pentanediol) molecule in the Vindec crystal are
highlighted in green, water molecules are cyan, and hydrogen bonds are
thin solid lines.
are spaced at >5 Å across the minor groove and are thus too
far apart to allow for effective π-π stacking. Overall, the
structural data are in line with the superior RNA affinity of
methylene-cLNA modified oligonucleotides and demonstrate
that methylene-cLNA analogs offer benefits over other cLNA
analogs without the need of introducing hydrophilic chemistry.
Biological Evaluation of Antisense Oligonucleotides Contain-
ing Carbocyclic LNA Analogs. Biological evaluation of the
methylene-cLNA 6 and the R-Me-cLNA 4 modifications was
Table 5. Thermal Stability Measurements and in Vitro Acitivity of Gapmer cLNA ASOs Targeting Mouse PTEN
b
Tm
(°C)
IC50
(µM)c
ED50
(mg/kg)
ASO
Modification
Sequence (5′-3′)a
C1
C2
C3
D1
D2
D3
Methylene-cLNA (PS)
R-Me-cLNA (PS)
LNAd (PS)
Methylene-cLNA (PS)
R-Me-cLNA (PS)
LNA (PS)
CUTAGCACTGGCCU
61.9
57.3
65.4
60.5
58.8
61.6
3.9
7.9
2.8
4.9
8.9
7.7
4.9
8.7
3.5
4
17
4
CUTAGCACTGGCCU
mCTTAGCACTGGCmCT
CUGCTAGCCTCTGGATUU
CUGCTAGCCTCTGGATUU
mCTGCTAGCCTCTGGATTT
a Bold letters indicate modified nucleosides in “wings” flanking a central DNA “gap” region; all internucleosidic linkages are phosphorothioate; T )
Thymine, U ) Uracil, A ) Adenine, G ) Guanine, C ) cytosine, mC ) 5-methyl cytosine. b Tm values were measured in 10 mM sodium phosphate
buffer (pH 7.2) containing 100 mM NaCl and 0.1 mM EDTA. Sequence of RNA complement for ASOs C1, C2, and C3:
5′-r(UCAAGGCCAGUGCUAAGAGU)-3′. Sequence for ASOs D1, D2, and D3: 5′-r(UCAAAUCCAGAGGCUAGCAG)-3′. c IC50 values for ASOs
C1-3 and D1-3 were determined in mouse bEND cells using electroporation. d LNA ASO C3 with U/C nucleobases in the wings had a Tm of 61.3 °C.
9
14948 J. AM. CHEM. SOC. VOL. 132, NO. 42, 2010

Exocyclic Methylene Group Acts As a Bioisostere in LNA
A R T I C L E S
mg/kg). The big shift in the potency curve for ASO D2 was
especially surprising since all these ASOs exhibited very similar
IC50 values for down regulating PTEN mRNA in cell culture
experiments (Table 5). The Methylene-cLNA ASO D1 and the
R-Me-cLNA ASO D2 showed modest to no elevations in ALT
levels at the highest dose evaluated, while the LNA ASO was
toxic at the high dose.
Conclusion
We show for the first time that it is possible to obtain LNA-
like binding affinity using cLNA analogs by replacing the
2′-oxygen atom with an exocyclic methylene group. Meth-
ylene-cLNA 6 modified ASOs showed improved hybridiza-
tion for complementary nucleic acids relative to the close
structurally related methyl substituted cLNA analogs 4 and
5. We also show that, in the case of cLNA analogs 4 and 5,
the relative orientation of the methyl group (inside the minor
groove for R-Me-cLNA 4 and at the edge of the minor groove
for S-Me-cLNA 5) affects the thermal stability of duplexes
containing these modifications. The cLNA modifications
appear to improve the recognition of cognate RNA over
DNA, but the magnitude of stabilization is small and
somewhat sequence dependent. Analysis of crystal structures
of the cLNA analogs incorporated into a self-complementary
DNA decamer duplex revealed that the methylene group
participates in a tight interaction with a 2′-deoxyribose residue
of the 5′-terminal G of a neighboring duplex resulting in the
formation of a CH...O type hydrogen bond. This interaction
shows that the methylene-cLNA retains a negative polariza-
tion at the edge of the minor groove in the absence of a
hydrophilic 2′-substituent and provides a rationale for the
enhanced thermal stability of methylene-cLNA modified
oligonucleotides. Conversely, the sugar residues in the R-
and S-Me-cLNA analogs are poorly hydrated and unable to
extend the water structure around the edges of nucleobases
toward the phosphate backbone.
Figure 4. PTEN mRNA down regulation in liver and plasma ALT levels
for mice treated for 3 weeks with methylene-cLNA ASO C1, R-Me-cLNA
ASO C2, and LNA ASO C3.
Figure 5. PTEN mRNA down regulation in liver and plasma ALT levels
for mice treated with single dose of Methylene-cLNA ASO D1, R-Me-
cLNA D2, and LNA ASO D3.
Evaluation of gapmer ASOs in cell culture indicated that the
methylene-cLNA ASOs were generally as active as LNA, while
the R-Me-cLNA ASOs were slightly less potent. However, it
appears that the potency differences are magnified when the
ASOs were tested in animal experiments. The in ViVo data for
the 18-mer ASOs D1, D2, and D3 were especially remarkable
since all of them showed very similar thermal stability and
activity in cell culture but the R-Me-cLNA ASO D2 was 4-fold
less active in animals. This suggests that subtle differences in
structure between closely related chemically modified ASOs can
have a significant impact on their in ViVo properties. In this
regard, our work helps to further understand the intricate nature
of structure-activity relationships of chemically modified ASOs
and lays the groundwork for identifying optimal designs of
cLNA analogs for future in ViVo applications. Moreover, this
work also highlights the interchangeable role of oxygen and
unsaturated moieties in nucleic acid structure and emphasizes
greater use of this bioisostere to improve the properties of
nucleic acids for therapeutic and diagnostic applications.
ASO. In this experiment, slight elevations in plasma ALT levels
were observed for the LNA ASO C4, while no plasma ALT
elevations were observed for ASOs C1 and C2 at the highest
dose (15 mg/kg) tested.54 For ASOs C1 and C4, maximal
knockdown (>90%) of liver PTEN mRNA was observed for
mice in the high dose group.
ASOs D1, D2, and D3 were also evaluated in animal
experiments. Mice (n ) 4 per dose group) were injected i.p.
with 2, 6, 20, and 60 mg/kg of ASOs D1, D2, and D3, and the
plasma ALT levels and PTEN mRNA levels in liver were
measured 72 h after the last injection (Figure 5). Dose dependent
down regulation of PTEN mRNA in liver was observed for all
ASOs tested. The methylene-cLNA ASO D1 and LNA ASO
D4 exhibited very similar potencies (ED50 ) 4 mg/kg), while
the R-Me LNA ASO was significantly less potent (ED50 ) 17
Acknowledgment. This work was supported in part by NIH
Grant R01 GM55237 (to M.E.). We would like to thank Merry
Daniel for help with the crystallization experiments and Dr. Karsten
Schmidt for HRMS measurements. Vanderbilt University is a
member institution of LS-CAT at the Advanced Photon Source
(Argonne, IL). Use of the APS was supported by the U.S.
Department of Energy, Basic Energy Sciences, Office of Science,
under Contract No. W-31-109-Eng-38.
(50) Egli, M.; Minasov, G.; Tereshko, V.; Pallan, P. S.; Teplova, M.;
Inamati, G. B.; Lesnik, E. A.; Owens, S. R.; Ross, B. S.; Prakash,
T. P.; Manoharan, M. Biochemistry 2005, 44, 9045–57.
(51) Prakash, T. P.; Siwkowski, A.; Allerson, C. R.; Migawa, M. T.; Lee,
S.; Gaus, H. J.; Black, C.; Seth, P. P.; Swayze, E. E.; Bhat, B. J. Med.
Chem. 2010, 53, 1636–50.
(52) Freier, S. M.; Altmann, K. H. Nucleic Acids Res. 1997, 25, 4429–43.
(53) Terrazas, M.; Kool, E. T. Nucleic Acids Res. 2009, 37, 346–353.
(54) Elevations in ALT levels using LNA ASO C3 have been reproduced
in several animal experiments using the described dosing regimen.
9
J. AM. CHEM. SOC. VOL. 132, NO. 42, 2010 14949

A R T I C L E S
Seth et al.
Supporting Information Available: General experimental
procedures for synthesis of 10-28; 1H and 13C NMR spectra
and analytical data for all new compounds; 31P NMR spectra
for all phosphoramidites; analytical data for oligonucleotides
and dose response curves for cell culture experiments are
provided. Atomic coordinates and structure factor data for
the three crystal structures have been deposited in the Protein
Data Bank (Entry codes 3OZ3, 3OZ4 and 3OZ5). This
material is available free of charge via the Internet at http://
pubs.acs.org.
JA105875E
9
14950 J. AM. CHEM. SOC. VOL. 132, NO. 42, 2010