N-phenyl cinnamamide derivatives protect hepatocytes against oxidative stress by inducing cellular glutathione synthesis via nuclear factor (Erythroid-derived 2)-like 2 activation

Article abstract of DOI:10.3390/molecules26041027

Substituted N-phenyl cinnamamide derivatives were designed and synthesized to confirm activation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathway by the electronic effect on beta-position of Michael acceptor according to introducing the R1 and R2 group. Compounds were screened using the Nrf2/antioxidant response element (ARE)-driven luciferase reporter assay. Compound 1g showed desirable luciferase activity in HepG2 cells without cell toxicity. mRNA and protein expression of Nrf2/ARE target genes such as NAD(P)H quinone oxidoreductase 1, hemeoxygenase-1, and glutamate-cysteine ligase catalytic subunit (GCLC) were upregulated by compound 1g in a concentration-dependent manner. Treatment with 1g resulted in increased endogenous antioxidant glutathione, showing strong correlation with enhanced GCLC expression for synthesis of glutathione. In addition, tert-butyl hydroperoxide (t-BHP)-generated reactive oxygen species were significantly removed by 1g, and the results of a cell survival assay in a t-BHP-induced oxidative cell injury model showed a cytoprotective effect of 1g in a concentration dependent manner. In conclusion, the novel compound 1g can be utilized as an Nrf2/ARE activator in antioxidative therapy.

Full text of DOI:10.3390/molecules26041027

molecules
Article
N-Phenyl Cinnamamide Derivatives Protect Hepatocytes against
Oxidative Stress by Inducing Cellular Glutathione Synthesis
via Nuclear Factor (Erythroid-Derived 2)-Like 2 Activation
Sou Hyun Kim 1,†, Minwoo Kim 2,†, Doyoung Kwon 1,†, Jae Sung Pyo 2, Joo Hyun Kim 3, Jae-Hwan Kwak 2,
*
and
Young-Suk Jung 1,
*
1
2
3
College of Pharmacy, Pusan National University, Busan 46241, Korea; souhyun@pusan.ac.kr (S.H.K.);
doyoung.kwon@pusan.ac.kr (D.K.)
College of Pharmacy, Kyungsung University, Busan 48434, Korea; kkmmww0902@ks.ac.kr (M.K.);
jspyo@ks.ac.kr (J.S.P.)
Department of Polymer Engineering, Pukyong National University, Busan 48547, Korea; jkim@pknu.ac.kr
Correspondence: jhkwak@ks.ac.kr (J.-H.K.); youngjung@pusan.ac.kr (Y.-S.J.)
These authors contributed equally to this work.
*
†
Abstract: Substituted N-phenyl cinnamamide derivatives were designed and synthesized to confirm
activation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) pathway by the electronic effect on
beta-position of Michael acceptor according to introducing the R1 and R2 group. Compounds were
screened using the Nrf2/antioxidant response element (ARE)-driven luciferase reporter assay. Com-
pound 1g showed desirable luciferase activity in HepG2 cells without cell toxicity. mRNA and protein
expression of Nrf2/ARE target genes such as NAD(P)H quinone oxidoreductase 1, hemeoxygenase-1,
and glutamate-cysteine ligase catalytic subunit (GCLC) were upregulated by compound 1g in a
concentration-dependent manner. Treatment with 1g resulted in increased endogenous antioxidant
glutathione, showing strong correlation with enhanced GCLC expression for synthesis of glutathione.
In addition, tert-butyl hydroperoxide (t-BHP)-generated reactive oxygen species were significantly
removed by 1g, and the results of a cell survival assay in a t-BHP-induced oxidative cell injury model
showed a cytoprotective effect of 1g in a concentration dependent manner. In conclusion, the novel
compound 1g can be utilized as an Nrf2/ARE activator in antioxidative therapy.
ꢀꢁꢂꢀꢃꢄꢅꢆꢇ
ꢀꢁꢂꢃꢄꢅꢆ
Citation: Kim, S.H.; Kim, M.; Kwon,
D.; Pyo, J.S.; Kim, J.H.; Kwak, J.-H.;
Jung, Y.-S. N-Phenyl Cinnamamide
Derivatives Protect Hepatocytes
against Oxidative Stress by Inducing
Cellular Glutathione Synthesis via
Nuclear Factor (Erythroid-Derived
2)-Like 2 Activation. Molecules 2021,
26, 1027. https://doi.org/10.3390/
molecules26041027
Academic Editors:
Ana Estévez-Braun and
Ángel Amesty
Keywords: N-phenyl cinnamamide; nuclear factor (erythroid-derived 2)-like 2; antioxidant response
element; glutathione
Received: 27 January 2021
Accepted: 12 February 2021
Published: 15 February 2021
1. Introduction
Oxidative stress, imbalance between reactive oxygen species (ROS) production, and
cellular defense capacity lead to chronic diseases including cancer, inflammation, and
liver diseases [1,2]. Induction of antioxidant enzymes, including hemeoxygenase-1 (HO-1),
NAD(P)H quinone oxidoreductase 1 (NQO1), superoxide dismutase (SOD), catalase, and
antioxidant metabolite glutathione (GSH), is considered the primary target for detoxifying
Publisher’s Note: MDPI stays neutral
with regard to jurisdictional claims in
published maps and institutional affil-
iations.
ROS [
2)-like 2 (Nrf2), which is a master regulator of antioxidant response element (ARE)-driven
antioxidant gene expression [ ]. Cytoprotective effects exerted by natural compounds
3,4]. They are regulated by the transcription factor nuclear factor (erythroid-derived
5
through induction of antioxidant enzymes by activation of Nrf2 in vitro and in vivo have
been reported [6–9].
Copyright:
© 2021 by the authors.
Licensee MDPI, Basel, Switzerland.
This article is an open access article
distributed under the terms and
conditions of the Creative Commons
Attribution (CC BY) license (https://
creativecommons.org/licenses/by/
4.0/).
Cinnamic acid derivatives are aromatic carboxylic acids (C6–C3) as acrylic acid with a
phenyl group at 3-position, found in fruits, vegetables, and beverages such as coffee, tea,
and wine. According to substituents on the phenyl group, they are known as cinnamic acid
with hydrogen, coumaric acid with a mono-hydroxy group, ferulic acid with a 4-hydroxy-
3-methoxy group, and caffeic acid with a 3,4-dihydroxy group. Their various biological
activities, including anticancer, antioxidant, antimicrobial, and anti-inflammatory effects,
Molecules 2021, 26, 1027. https://doi.org/10.3390/molecules26041027
https://www.mdpi.com/journal/molecules

Molecules 2021, 26, 1027
2 of 13
have been reported [
1,
10–
12]. Of particular interest, as a natural compound, caffeic acid
phenethyl ester (CAPE) has antioxidant effects by activation of the Nrf2-mediated pathway
to induce transcription of HO-1. [12]. Ferulic acid ethyl ester (FAEE) has a cytoprotective
effect against oxidative damage and amyloid beta(Aβ)-induced oxidative stress in neuronal
cells through stimulation of the Nrf2 pathway [13
,
14]. In addition, it has been reported
that compounds such as N-cinnamoyl-5-oxo-L-proline methylester (oxoProCA) having
cinnamoyl moiety prevents photo-oxidative stress through activation of the Nrf2/ARE
pathway against skin cancer cells. They are potent Nrf2-activators and have an
α,β-
unsaturated carbonyl structure as a pharmacophore, playing a role as an electrophilic
Michael acceptor [15]. Several compounds, such as chalcone, dimethyl fumarate, curcumin,
and sofalcone, which induce inhibition of Keap1 (Kelch-like ECH-associated protein 1)
through a Michael type addition with its cysteine, have been reported to cause activation
of the Nrf2/ARE pathway [16].
In general, Nrf2 activators, classified as electrophilic activators, have an α,β-unsaturated
carbonyl structure as shown in Figure 1. An irreversible covalent bond is formed with the
cysteine residue of Keap1 as a major regulator, which modifies its structure followed by
activation of Nrf2. However, the electrophilic properties of the beta-position on the carbonyl
group have been reported to have adverse effects due to the interaction with the off-target
protein at high concentration [16–18]. In line with this, the toxicity of chalcone derivatives
is altered by modification of the Michael acceptor site [19]. The electron withdrawing group
on cinnamamides was also reported to increase Nrf2 transcriptional activity in comparison
with N-cinnamoyl-L-proline and oxoProCA [15].
Figure 1. Structure of electrophilic inducers in the nuclear factor (erythroid-derived 2)-like 2 (Nrf2)
pathway.
In this study, substituted N-phenyl cinnamamide derivatives were designed and
synthesized by introducing the R1 and R2 groups for confirmation of Nrf2 activity according
to the electronic effect on the beta-position of the Michael acceptor (Figure 2). Biological
activity was screened in HepG2 cells using an Nrf2/ARE luciferase reporter assay system.
We suggest a novel compound having the highest activity without cytotoxicity as an
adverse effect of high concentrations for defense of cells against oxidative stress.

Molecules 2021, 26, 1027
3 of 13
R2
O
O
δ+
2-7
δ+
OH
N
R1
R1
H
1a-i
R1 : H, 2-OH, 3-OH, 4-OH, 4-OMe, 3,4-diOH
R2 : Cl, NMe2, OMe, OEt, CN
Figure 2. Design of N-phenyl cinnamamide derivatives (1a–i) to confirm electronic effect of their
beta-position according to substituents.
2. Results and Discussion
2.1. Nrf2/ARE Agonistic Activity of Aromatic Carboxylic Acids (C6–C3)
First, six compounds of commercial 3-phenylprop-2-enoic acid derivatives includ-
ing cinnamic acid (
methoxycinnamic acid (
compounds in the Nrf2/ARE pathway was determined using a luciferase assay to con-
firm that biological activity of those containing an -unsaturated carbonyl structure
2), o-coumaric acid (
3), m-coumaric acid (
4), p-coumaric acid (5), 4-
6
), and caffeic acid (7) were prepared (Figure 3). Activity of these
α,β
was associated with an electronic effect and lipophilicity of the hydroxy group on the
phenyl ring.
Figure 3. Commercially available cinnamic acid derivatives.
According to the result, m-coumaric acid (
namic acid ( ) with a para-methoxy group, and cinnamic acid (
donating group, showed slightly higher activity compared with other compounds (Table 1).
On the other hand, compounds ( , and ) with a hydroxy group at ortho- or para-position
4) with a meta-hydroxy group, 4-methoxycin-
6
2
) without an electron-
3
,
5
7
showed reduced activity of the Nrf2/ARE pathway. Therefore, we confirmed that the
electron-donating effect by conjugation of the hydroxy group at the ortho- or para-position
reduces Nrf2/ARE activity through decreasing activity of the Michael acceptor and that
physical properties such as lipophilicity also influence the activity in 4-methoxycinnamic
acid (
In particular, compound
activity among the cinnamic acid derivatives, and the results of a luciferase assay showed
a 1.63-fold effect at 5 M. Although it increases the polarity of molecule, we speculate
that the activity of m-coumaric acid ( ) resulted from enhancing the electrophilic effect
on the beta-position of the Michael acceptor by electronegative induction of the meta-
hydroxy group in the comparison with cinnamic acid ( ). Therefore, substituted N-phenyl
6), with a cLogP value of 2.16 and compounds (3 and 5) with cLogP value of 1.57.
4
, despite having meta-hydroxy group, showed the most potent
µ
4
2
m-coumaric amides and N-phenyl cinnamamides were designed and synthesized, and
then their agonistic activity of the Nrf2/ARE pathway was evaluated.

Molecules 2021, 26, 1027
4 of 13
Table 1. Antioxidant response element (ARE) agonistic activity of compounds (2–7) on a HepG2 cell line.
Entry
Con
Concentration (µM)
Relative Luciferase Activity (Fold)
1.00 ± 0.056
0
Cinnamic acid (2)
o-Coumaric acid (3)
m-Coumaric acid (4)
p-Coumaric acid (5)
4-Methoxycinnamic acid (6)
Caffeic acid (7)
10
10
10
10
10
10
1.22 ± 0.036
1.16 ± 0.061
1.45 ± 0.033
1.12 ± 0.031
1.22 ± 0.058
1.01 ± 0.047
m-Coumaric acid (4)
1
3
5
1.21 ± 0.001
1.32 ± 0.150
1.63 ± 0.207
1.45 ± 0.033
10
2.2. Synthesis of Cinnamamide Derivatives
To examine the Nrf2/ARE activity of additional compounds, substituted N-phenyl
cinnamamides were synthesized from cinnamoyl chloride ( ) and m-coumaric acid (
according to the route shown in Scheme 1. For preparation of N-phenyl cinnamamide
derivatives (1a ), commercially available cinnamoyl chloride ( ) was treated with several
substituted aniline and triethylamine in anhydrous tetrahydrofuran. In addition, a similar
synthetic method using acid chloride from m-coumaric acid ( ) with thionyl chloride af-
forded N-4-chlorophenyl m-coumaric amide (1f). N-Phenyl m-coumaric amide derivatives
1g ) were obtained using a BOP (benzotriazol-1-yloxytris(dimethylamino)phosphonium
8
4)
–
e
8
4
(
–i
hexafluorophosphate) coupling reagent with several substituted aniline (see Supplemen-
tary Materials) [20].
Scheme 1. Synthesis of substituted N-phenyl cinnamamide derivatives (1a
ditions: Method A—SOCl2, K2CO3, THF, then 9a, TEA, THF, 18 h, 92%; Method B—9b
–
i
). Reagents and con-
, BOP
–
d
(benzotriazol-1-yloxytris(dimethylamino)phosphonium hexafluorophosphate), TEA, DCM/DMF,
16–24 h, 28–63%.

Molecules 2021, 26, 1027
5 of 13
2.3. Nrf2/ARE Agonistic Activity of Cinnamamide Derivatives
The synthesized substituted N-phenyl cinnamamide derivatives (1a
–i
) showed 3.57–
15.6 times more potent Nrf2/ARE luciferase activity compared with negative control
at 10 M (Table 1). Compound 1g showed the highest luciferase activity, as potent as
µ
tert-butyl hydroquinone (t-BHQ), an Nrf2/ARE activator used as positive control. In
addition to compound 1g, compounds possessing meta-hydroxy group were tested at
various concentrations (1, 3, 5, and 10 µM) for the determination of dose-dependent activity.
The results showed that compound 1f and 1g significantly increased activity according to
dose.
The results confirmed that a substituent R2 on N-phenyl ring influenced Nrf2/ARE
luciferase activity. In the cinnamamide derivatives (1a–1d), compound 1a, with a Cl group
on the para-position of the N-phenyl ring, showed the highest activity, a 15.3-fold effect,
and compounds 1b (R2: -NMe2), 1c (R2: -OMe), 1d (R2: -OEt), and 1e (R2: -CN) had 10.3-,
7.28-, 6.55-, and 3.57-fold effects, respectively. Of particular interest, compounds with a
nitrile group as an electron-withdrawing group showed poorer activity than compounds
with a dimethylamine, methoxy, or ethoxy group as an electron-donating group at 10
In the m-coumaric amide derivatives (1f
), compound 1f (R2: -NMe2), 1g (R2: -Cl), 1h (R2:
M, respectively.
µM.
–
i
-OMe), and 1i (R2: -OEt) had 15.6-, 8.85-, 4.1-, and 3.34-fold effects at 10
µ
The dimethylamine or chloro group, as a substituent R2 on N-phenyl ring, induced more
potent Nrf2/ARE luciferase activity than the methoxy or ethoxy group, similar to the
substituent-dependent activity of the cinnamamide derivatives. Based on the activity of
cinnamic acid (2) and m-coumaric acid (4), we suggest that electronegative induction of the
meta-hydroxy group enhances the electrophilic effect, followed by increasing its activity.
On the other hand, the negative role of the hydroxy group at the meta-position can be
clearly seen by comparing compounds 1f, 1h, and 1i with unsubstituted analogs (1a, 1c
and 1d). Exceptionally, only compound 1g (15.6-fold), despite including meta-hydroxy,
exhibited more potent activity of the Nrf2/ARE pathway than compound 1b (10.3-fold) at
10 µM (Table 2).
Table 2. Relative luciferase activity of N-phenyl cinnamamide derivatives (1a
hydroquinone (t-BHQ) in a HepG2 cell line.
–i) and tert-butyl
Entry
Con.
Concentration (µM)
Relative Luciferase Activity (Fold)
0
1.00 ± 0.056
t-BHQ
5
10
5.74 ± 0.439
15.6 ± 0.334
1a
1b
1c
1d
1e
1f
10
10
10
10
10
15.3 ± 0.903
10.3 ± 0.665
7.28 ± 0.437
6.55 ± 0.356
3.57 ± 0.543
0.95 ± 0.038
1.18 ± 0.029
3.36 ± 0.653
8.85 ± 1.081
1
3
5
10
1g
1h
1
3
5
0.84 ± 0.024
1.50 ± 0.018
5.00 ± 0.488
15.6 ± 1.783
0.81 ± 0.008
0.90 ± 0.020
1.51 ± 0.154
4.10 ± 0.306
10
1
3
5
10

Molecules 2021, 26, 1027
6 of 13
Table 2. Cont.
Entry
1i
Concentration (µM)
Relative Luciferase Activity (Fold)
1
3
5
0.90 ± 0.030
0.91 ± 0.003
1.78 ± 0.217
3.34 ± 0.303
10
2.4. Enhancement of Nrf2/ARE-Dependent Gene Expression by Compound 1g Treatment
Treatment with compound 1g resulted in significantly higher Nrf2/ARE luciferase
activity compared with other compounds, and more detailed experiments were performed
to determine whether it plays a role in cytoprotection against oxidative stress. The
concentration-effect relationship of compound 1g in Nrf2/ARE-driven luciferase activity
was examined as shown in Figure 4A. Cell viability was not affected by the same concen-
tration used in the luciferase assay (Figure 4B), indicating that compound 1g showed no
toxicity at these concentrations. In agreement with the effect of compound 1g on Nrf2/ARE
luciferase activity, treatment with compound 1g resulted in the increased dose-dependent
expression of Nrf2-dependent cytoprotective genes (Figure 5A) and their corresponding
protein (Figure 5B), such as HO-1 and glutamate-cysteine ligase catalytic subunit (GCLC).
These results suggest that compound 1g could protect cells against oxidative stress.
Figure 4. Induction of Nrf2/ARE-directed reporter gene activity by treatment of HepG2-ARE-luciferase cells with compound
1g. ( ) Luciferase activity was normalized to total protein and presented as mean fold change SD. Each experiment was
performed in triplicate and repeated at least three times; representative experimental results are shown. ( ) Cell viability at
A
±
B
the same doses used in a reporter gene assay. * and *** Significantly different from vehicle-treated control cells (0 µM) at
p < 0.05 and < 0.001, respectively (Student’s t-test).

Molecules 2021, 26, 1027
7 of 13
Figure 5. Induction of Nrf2/ARE-dependent genes and protein expression by treatment of HepG2-
ARE-luciferase cells with compound 1g. Expression level of (A) mRNA and (B) corresponding protein,
such as NQO1 (NAD(P)H quinone oxidoreductase 1), hemeoxygenase-1 (HO-1), and glutamate-
cysteine ligase catalytic subunit (GCLC). *, **, and *** Significantly different from vehicle-treated
control cells (0 µM) at p < 0.05, 0.01, and < 0.001, respectively (Student’s t-test).
2.5. Protective Effect of Compound 1g Against Oxidative Cell Death via Increasing GSH Level in
HepG2 Cell
GSH is an endogenous antioxidant composed of three amino acids, such as glutamate,
cysteine, and glycine [21]. GCLC, which is a rate-limiting enzyme in the synthesis of GSH,
produces γ-glutamylcysteine, a precursor of GSH [22]. Because treatment with compound
1g resulted in increased GCLC expression, cellular GSH level was determined by treatment
with various concentrations of compound 1g for 24 h. Treatment with compound 1g
resulted in a significant dose-dependent increase in GSH level (Figure 6A), which showed
a correlation with GCLC expression. To examine the protective effect of compound 1g on
tert-butyl hydroperoxide (t-BHP)-induced oxidative cell death, the cells were pretreated
with 1, 5, and 10
for 24 h. Pretreatment with compound 1g resulted in a significantly decreased ROS level
generated by t-BHP (Figure 6B). In addition, treatment at more than 5 M of compound
µM of compound 1g for 18 h, followed by incubation with 200 µM t-BHP
µ
1g completely prevented t-BHP-induced oxidative cell death (Figure 6C). These results
provide evidence that increased GSH level by treatment with compound 1g contributes to
scavenge t-BHP-induced ROS, which protects cells against oxidative stress-mediated cell
death.

Molecules 2021, 26, 1027
8 of 13
Figure 6. Protective effect of compound 1g on oxidative stress-mediated cell death. (
treatment of HepG2 cells with compound 1g. ( ) Reactive oxygen species (ROS) inhibiting effect of compound 1g in 200
of t-BHP-treated HepG2 cells. ( ) Increased cell viability by preincubation of compound 1g in 200 M t-BHP-treated HepG2
A) Cellular GSH level at 24 h after
B
µM
C
µ
cells. * and *** Significantly different from vehicle-treated control cells (0 µ
M) at p < 0.05 and < 0.001, respectively. , ## and
#
###
Significantly different from tert-butyl hydroperoxide (t-BHP)-treated cells at p < 0.05, < 0.01, and < 0.001, respectively
(Student’s t-test).
3. Materials and Methods
The chemicals, including acids (2–7) and t-BHQ, were purchased from commercial
sources without further purification. THF (tetrahydrofuran) was distilled using sodium
and benzopheneone, and DCM (dichloromethane) was distilled using calcium hydride
Nuclear magnetic resonance (NMR; 1H-NMR and 13C-NMR) was measured with a JEOL
JNM-EX400 (Tokyo, Japan); chemical shifts are reported in parts per million (ppm, δ) and
coupling constant is reported in hertz (Hz). Column chromatography isolations were
performed using silica gel 60 (230–400 mesh, Merck, Kenilworth, NJ, USA) and medium
pressure liquid chromatography (MPLC) system with Biotage Isolera One (Uppsala, Swe-
den). Analytical thin-layer chromatography (TLC) was performed using a Kieselgel 60
F254 plate (Merck). High resolution mass spectra (HRMS) were expressed in m/z using
the HR-ESI-MS, Agilent 6530 accurate-mass quadrupole time-of-flight (Q-TOF) system
(Santa Clara, CA, USA) at the Metabolomics Research Center for Functional Materials,
Kyungsung University, Republic of Korea.
3.1. Synthesis Procedure for N-Phenyl Cinnamamide Derivatives
3.1.1. General Procedure for 4-Substituted N-Phenyl Cinnamamide Derivatives (1a–e)
Substituted aniline (9a
–
e; 1.00 equiv.) and triethylamine (2.00 equiv.) were added to a
solution of cinnamolyl chloride (
8
; 1.00 equiv.) in THF. After stirring the mixture at room
temperature for 3 h, the solvent was removed in a vacuum, followed by extraction of the
residue mixture with EtOAc and 3N-HCl. The organic layer was dried using anhydrous
magnesium sulfate, and the products (1a–e) were isolated by column chromatography
(EtOAc:hexanes = 1:1~1:2).
N-(4-chlorophenyl)cinnamamide (1a)
Yield: 98 mg (63%); 1H-NMR (400 MHz, CDCl3)
δ 7.77 (d, J = 15.5 Hz, 1H), 7.56 (m,
4H), 7.36 (m, 6H), 6.53 (d, J = 15.5 Hz, 1H); 13C-NMR (101 MHz, ACETONE-D6)
δ 164.4,
142.0, 139.2, 135.9, 130.7, 129.8, 129.5, 128.7, 128.5, 122.5, 121.5; HRMS (ESI) m/z [M + H]+
calculated for C15H13ClNO: 258.0680 found: 258.0682.
N-(4-(dimethylamino)phenyl)cinnamamide (1b)
Yield: 29 mg (18%); 1H-NMR (400 MHz, CD3OD)
δ 7.58 (m, 3H), 7.47 (m, 2H), 7.38 (m,
3H), 6.76 (m, 3H), 2.89 (s, 6H); 13C-NMR (101 MHz, CD3OD)
δ 166.2, 149.5, 142.0, 136.4,
130.9, 130.1, 130.0, 128.9, 122.7, 122.4, 114.4, 41.3; HRMS (ESI) m/z [M + H]+ calculated for
C17H19N2O: 267.1492 found: 267.1492.

Molecules 2021, 26, 1027
9 of 13
N-(4-methoxyphenyl)cinnamamide (1c)
Yield: 98 mg (65%); 1H-NMR (400 MHz, CDCl3)
δ
7.74 (d, J = 15.5 Hz, 1H), 7.53 (m,
5H), 7.36 (m, 3H), 6.87 (d, J = 8.9 Hz, 2H), 6.57 (d, J = 15.5 Hz, 1H), 3.79 (s, 3H); 13C-NMR
(101 MHz, CDCl3) δ 164.1, 156.6, 142.1, 134.8, 131.3, 130.0, 129.0, 128.1, 121.9, 121.0, 114.3,
55.6; HRMS (ESI) m/z [M + H]+ calculated for C16H16NO2: 254.1176 found: 254.1178.
N-(4-ethoxyphenyl)cinnamamide (1d)
Yield: 105 mg (64%); 1H-NMR (400 MHz, CD3OD)
2H), 7.37 (m, 3H), 6.85 (d, J = 9.0 Hz, 2H), 6.73 (d, J = 15.7 Hz, 1H), 3.98 (q, J = 7.0 Hz,
δ 7.58 (m, 3H), 7.51 (d, J = 9.0 Hz,
2H), 1.34 (t, J = 7.0 Hz, 3H); 13C-NMR (101 MHz, CDCl3)
δ 164.1, 156.0, 142.0, 134.8, 131.2,
130.0, 129.0, 128.1, 121.9, 121.1, 114.9, 63.8, 15.0; HRMS (ESI) m/z [M + H]+ calculated for
C17H18NO2: 268.1332 found: 268.1343.
N-(4-cyanophenyl)cinnamamide (1e)
Yield: 32 mg (21%); 1H-NMR (400 MHz, CD3OD)
δ 7.85 (d, J = 9.0 Hz, 2H), 7.68 (m,
3H), 7.59 (m, 2H), 7.40 (m, 3H), 6.77 (d, J = 15.7 Hz, 1H); 13C-NMR (101 MHz, CD3OD)
δ
166.8, 144.6, 143.9, 136.0, 134.3, 131.3, 130.1, 129.1, 121.6, 120.9, 119.9, 107.6; HRMS (ESI)
m/z [M + H]+ calculated for C16H13N2O: 249.1022 found: 249.1022.
3.1.2. Procedure for (E)-N-(4-chlorophenyl)-3-(3-hydroxyphenyl)acrylamide (Method A; 1f
)
Thionyl chloride (2.00 equiv.) was added to a stirred solution of m-coumaric acid
(
1.00 equiv.) in THF [20]. The mixture was stirred under reflux conditions for 12 h, fol-
lowed by concentration under reduced pressure. The residue was dissolved in THF,
4-chloroaniline (9a; 1.00 equiv.), and triethylamine (excess), followed by stirring at room
temperature. After 2 h, the product was removed from the solvent under reduced pressure,
and compound 1f was isolated by column chromatography (EtOAc:hexanes = 2:3).
Yield: 154 mg (92%); 1H-NMR (400 MHz, CD3OD)
δ
7.65 (d, J = 8.9 Hz, 2H), 7.56 (d,
J = 15.7 Hz, 1H), 7.31 (d, J = 8.9 Hz, 2H), 7.21 (t, J = 7.8 Hz, 1H), 7.05 (d, J = 7.6 Hz, 1H),
6.99 (m, 1H), 6.81 (m, 1H), 6.69 (d, J = 15.7 Hz, 1H); 13C-NMR (101 MHz, CD3OD)
166.7,
δ
159.1, 143.3, 138.9, 137.4, 131.0, 130.1, 129.8, 122.5, 121.8, 120.5, 118.3, 115.2; HRMS (ESI)
m/z [M + H]+ calculated for C15H13ClNO2: 274.0629 found: 274.0628.
3.1.3. General Procedure for 4-Substituted N-Phenyl m-Coumaric Amide Derivatives
(Method B; 1g–i)
A solution of m-coumaric acid (1.00 equiv) in DCM was added to TEA (1.00 equiv.), sub-
stituted aniline (9b
–
d
; 1.00 equiv), and BOP ((benzotriazole-1-yloxy)-tris(di◦methylamino)
phosphonium hexafluorophosphate; 1.00 equiv.) dissolved in DCM at 0 C [20]. After
stirring the mixture at room temperature for 16–24 h, the solvent was removed in a vac-
uum, followed by extraction using EtOAc and 6N-HCl. The organic layer was dried
using anhydrous magnesium sulfate, and the products (1g–i) were isolated by column
chromatography (EtOAc:hexanes = 1:2~2:1).
(E)-N-(4-(Dimethylamino)phenyl)-3-(3-hydroxyphenyl)acrylamide (1g)
Yield: 58 mg (34%); 1H-NMR (400 MHz, CD3OD)
7.51 (d, J = 15.6 Hz, 1H), 7.47 (d,
δ
J = 9.0 Hz, 2H), 7.19 (t, J = 7.9 Hz, 1H), 7.03 (d, J = 7.8 Hz, 1H), 6.98 (t, J = 2.0 Hz, 1H),
6.80 (ddd, J = 8.1, 2.5, 0.8 Hz, 1H), 6.76 (d, J = 9.1 Hz, 2H), 6.68 (d, J = 15.7 Hz, 1H), 2.89
(s, 6H); 13C-NMR (101 MHz, CD3OD)
δ 166.3, 159.1, 149.6, 142.2, 137.7, 131.0, 130.1, 122.7,
122.3, 120.4, 118.0, 115.2, 114.4, 41.3; HRMS (ESI) m/z [M + H]+ calculated for C17H19N2O2:
283.1441 found: 283.1443.
(E)-3-(3-Hydroxyphenyl)-N-(4-methoxyphenyl)acrylamide (1h)
1
Yield: 88 mg (54%); H-NMR (400 MHz, CD3OD)
δ 7.53 (d, J = 9.2 Hz, 2H), 7.52
(d, J = 15.1 Hz, 1H) 7.19 (t, J = 7.8 Hz, 1H), 7.03 (d, J = 7.7 Hz, 1H), 6.98 (m, 1H), 6.88

Molecules 2021, 26, 1027
10 of 13
(d, J = 9.1 Hz, 2H), 6.79 (ddd, J = 8.1, 2.4, 0.8 Hz, 1H), 6.68 (d, J = 15.6 Hz, 1H), 3.76 (s,
3H); 13C-NMR (101 MHz, CD3OD)
δ 166.5, 159.1, 158.0, 142.6, 137.6, 133.0, 131.0, 122.9,
122.1, 120.4, 118.1, 115.2, 115.0, 55.8; HRMS (ESI) m/z [M + H]+ calculated for C16H16NO3:
270.1125 found: 270.1125.
(E)-N-(4-Ethoxyphenyl)-3-(3-hydroxyphenyl)acrylamide (1i)
Yield: 64 mg (37%); 1H-NMR (400 MHz, CD3OD)
δ 7.50 (d, J = 15.8 Hz, 1H), 7.49 (d,
J = 9.1 Hz, 2H), 7.17 (t, J = 7.8 Hz, 1H), 7.01 (d, J = 7.7 Hz, 1H), 6.96 (s, 1H), 6.83 (d,
mboxemphJ = 8.9 Hz, 2H), 6.77 (dd, J = 8.0, 2.0 Hz, 1H), 6.66 (d, J = 15.6 Hz, 1H), 3.96 (q, J
= 7.0 Hz, 2H), 1.33 (t, J = 7.0 Hz, 3H); 13C-NMR (101 MHz, CD3OD)
δ 166.4, 159.1, 157.3,
142.6, 137.6, 132.9, 131.0, 122.9, 122.1, 120.4, 118.1, 115.6, 115.2, 64.7, 15.2; HRMS (ESI) m/z
[M + H]+ calculated for C17H18NO3: 284.1281 found: 284.1285.
3.2. Evaluation of Biological Activity
3.2.1. Cell Culture
HepG2 human liver cancer cells (Korea Cell Line Bank, Seoul, Korea) were routinely
grown in DMEM medium (Hyclone, Logan, UT, USA) supplemented with 10% fetal bo-
vine serum (FBS, Hyclone), 2 mM glutamine (Sigma-Aldrich Corp., St. Louis, MO, USA),
100 U/mL penicillin (Hyclone), and 100 µg/mL streptomycin (GenDEPOT, Barker, TX,
USA) in a humidified atmosphere at 37 ◦C with 5% CO2.
3.2.2. Nrf2/ARE Luciferase Assay
HepG2 cells were seeded in a 6-well culture plate in antibiotic-free medium for 24 h,
followed by transfection with an ARE reporter vector that encodes for firefly luciferase
in the presence of Lipofectamine 3000 (Invitrogen, San Diego, CA, USA) according to the
manufacturer’s instruction. The cells were then treated with different concentrations of
compound 1g for 6 h. Luciferase Assay Reagent II (Promega, Madison, WI, USA) was
added to determine the activity of firefly luciferase.
3.2.3. Cell Viability Assay
The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, which
is a test of normal metabolic status of cells based on the estimated mitochondrial activities,
was used for determination of cell viability. HepG2 cells were seeded in a 96-well culture
plate at a density of 1.0
×
104 cells/well and incubated overnight. Following pretreatment
with different concentrations of compound 1g for 18 h, cells were treated with t-BHP for
24 h and incubated with 0.5 mg/mL MTT reagent at 37 ◦C for 1 h. Formazan granules
generated by live cells were dissolved in dimethyl sulfoxide (DMSO), and the absorbance
was measured at 540 nm using the MULTISKAN GO reader (Thermo Scientific, Sunnyvale,
CA, USA). Results were expressed as a percentage of viable compound 1g-treated cells
normalized to those of untreated cells.
3.2.4. Real-Time Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
The total RNA was harvested from cells using the Direct-zol RNA kit (Zymo Research,
Orange, CA, USA). The cDNA was synthesized by the iScript cDNA Synthesis system
(Bio-Rad, Hercules, CA, USA) according to the manufacturer’s protocols. Amplification of
transcripts was performed by using the SensiFAST SYBR qPCR mix (Bioline, London, UK).
The optimal number of PCR cycles was determined for each primer set to ensure a linear
range of amplification. The relative values of gene expression were normalized to 18 s. The
primer sequences are provided in Table 3.

Molecules 2021, 26, 1027
11 of 13
Table 3. List of human primer used for real-time reverse transcription-polymerase chain reaction
(RT-PCR).
Genes
Primer Sequences
NQO1
HO-1
GCLC
18s
F: AGGCTGGTTTGAGCGAGT
F: CGGGCCAGCAACAAAGTG
F: TGGCAATGCAGTGGTGGAT
F: CAGCCACCCGAGATTGAGCA
R: ATTGAATTCGGGCGTCTGCTG
R: AGTGTAAGGACCCATCGGAGAA
R: AACACACCTTCCTTCCCATTGA
R: TAGTAGCGACGGGCGGTGTG
3.2.5. Western Blot Analysis
Cells were harvested after treatment of compound 1g. Total cells were lysed with
ice-cold ProEXTM CETi protein extract solution (Translab, Daejeon, Korea), and the concen-
tration of the protein was measured using a BCA reagent (Thermo Scientific). Protein sam-
ples were denatured by boiling at 100 ◦C for 5 min in 4X laemmli sample buffer (Bio-Rad,
Hercules, CA, USA) and were separated by sodium dodecyl sulfate (SDS)-polyacrylamide
electrophoresis gel. Then it was transferred onto a nitrocellulose (NC) membrane (Bio-Rad,
Hercules, CA, USA). The membranes were blocked with TBS-T buffer (Tris-HCl (100 mM,
pH 7.5), NaCl (150 mM), and 0.2% Tween-20) containing 5% non-fat dry milk for 1 h at
room temperature. Then, the membranes were washed with TBS-T buffer and incubated
overnight at 4 ◦C with the primary antibodies. After washing with TBS-T, the membrane
was incubated for 1 h with the appropriate horseradish peroxidase-conjugated secondary
antibodies. The blot was detected using EZ-Western Lumi Pico (DOGEN, Seoul, Korea).
3.2.6. GSH Level in HepG2 Cell Line
HepG2 cells were seeded in a 60 mm culture plate for 24 h and then treated with
compound 1g for 18 h. Cells were lysed using a 4-fold volume of ice-cold 1M perchloric acid.
After the protein was removed by centrifugation at 10,000
×
g for 10 min, the supernatant
was assayed for the total GSH concentration using HPLC [23]. Glutathione was analyzed
with ortho-phthalaldehyde/2-mercaptoethanol and quantified using an HPLC system
equipped with a fluorescence detector (excitation 338 nm and emission 425 nm; FLD-3100,
Thermo Scientific) after separation using a Hector T-C18 column (3
Chiral Technology Korea, Daejeon, Korea).
µm
×
4.6 mm × 100 mm
;
3.2.7. Evaluation of ROS Level
To assess cellular ROS levels, HepG2 cells were seeded at 1.0
×
104 cells per well in a
96-well plate. The cells were pre-incubated with compound 1g for 18 h and then incubated
with t-BHP for another 4 h to induce the ROS production. ROS-Glo H2O2 assay system
kit (Promega) was used, and it was done following the manufacturer’s instructions. The
intensity of the fluorescence in the cells was measured using a Glomax Explorer System
(Promega). ROS production was calculated relative to the vehicle-treated control.
3.2.8. Statistical Analysis
All results expressed as the mean
two-tailed Student’s t-test. The acceptable level of significance was established at p < 0.05.
±
standard deviation (SD) were analyzed by a
4. Conclusions
In summary, nine substituted N-phenyl cinnamamide derivatives (1a
–
i) were designed
and synthesized according to biological evaluation with six cinnamic acid derivatives (
2–7).
Especially, substituent R2 at para-position on N-phenyl ring was introduced to confirm
activation of Nrf2/ARE pathway by electronic effect on the beta-position of a Michael
acceptor. Compounds with a chloro group or dimethylamine group as the R2 group showed
more potent activity than other compounds. Among them, compound 1g was screened
out to show significant concentration-dependent protection against t-BHP-induced HepG2
cell damage. Results of a mechanism study showed that compound 1g activates the Nrf2
pathway, resulting in increased expression of target genes such as NQO1, HO-1, and

Molecules 2021, 26, 1027
12 of 13
GCLC. In addition, an increase in GSH level was observed, reflecting the result of GCLC
expression, which is a rate-limiting enzyme in the synthesis of GSH. Considering that GSH
is a non-protein thiol for removal of reactive substances, use of compound 1g will lead
to improved endogenous antioxidant capacity, thus preventing cellular damage against
oxidative stress.
Supplementary Materials: The following are available online. Copies of 1H- and 13C-NMR spectra
of compound 1a–i.
Author Contributions: Conceptualization, J.H.K., J.-H.K. and Y.-S.J.; validation, S.H.K., M.K. and
D.K.; formal analysis, S.H.K., M.K. and D.K.; investigation, J.S.P., J.H.K., J.-H.K. and Y.-S.J.; writing—
original draft preparation, S.H.K., M.K., D.K., J.-H.K. and Y.-S.J.; writing—review and editing, J.-H.K.
and Y.-S.J.; visualization, J.-H.K. and Y.-S.J.; supervision, J.-H.K. and Y.-S.J.; funding acquisition, Y.-S.J.
All authors have read and agreed to the published version of the manuscript.
Funding: This research was supported by PNU-RENovation (2019–2020).
Data Availability Statement: The data that support the findings of this study are available from the
corresponding author upon reasonable request.
Conflicts of Interest: The authors declare no conflict of interest.
Sample Availability: Samples of the compounds are available from the corresponding author.
References
1.
Abramovicˇ, H. Chapter 93-Antioxidant Properties of Hydroxycinnamic Acid Derivatives: A Focus on Biochemistry, Physico-
chemical Parameters, Reactive Species, and Biomolecular Interactions. In Coffee in Health and Disease Prevention; Preedy, V.R., Ed.;
Academic Press: San Diego, CA, USA, 2015; pp. 843–852. [CrossRef]
2.
3.
4.
Muriel, P. Role of free radicals in liver diseases. Hepatol. Int. 2009, 3, 526–536. [CrossRef]
Surh, Y.J. Cancer chemoprevention with dietary phytochemicals. Nat. Rev. Cancer 2003, 3, 768–780. [CrossRef]
Kim, J.; Cha, Y.N.; Surh, Y.J. A protective role of nuclear factor-erythroid 2-related factor-2 (Nrf2) in inflammatory disorders.
Mutat. Res. 2010, 690, 12–23. [CrossRef]
5.
6.
7.
8.
9.
Itoh, K.; Chiba, T.; Takahashi, S.; Ishii, T.; Igarashi, K.; Katoh, Y.; Oyake, T.; Hayashi, N.; Satoh, K.; Hatayama, I.; et al. An
Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements.
Biochem. Biophys. Res. Commun. 1997, 236, 313–322. [CrossRef]
Hwang, Y.P.; Choi, J.H.; Han, E.H.; Kim, H.K.; Kang, S.K.; Chung, Y.C.; Jeong, H.G. Protective mechanisms of Aralia continentalis
extract against tert-butyl hydroperoxide-induced hepatotoxicity: In vivo and in vitro studies. Food Chem. Toxicol. 2008, 46,
3512–3521. [CrossRef]
Subramaniam, S.R.; Ellis, E.M. Esculetin-induced protection of human hepatoma HepG2 cells against hydrogen peroxide is
associated with the Nrf2-dependent induction of the NAD(P)H: Quinone oxidoreductase 1 gene. Toxicol. Appl. Pharmacol. 2011
250, 130–136. [CrossRef] [PubMed]
,
Senthil Kumar, K.J.; Liao, J.W.; Xiao, J.H.; Gokila Vani, M.; Wang, S.Y. Hepatoprotective effect of lucidone against alcohol-induced
oxidative stress in human hepatic HepG2 cells through the up-regulation of HO-1/Nrf-2 antioxidant genes. Toxicol. In Vitro 2012
,
26, 700–708. [CrossRef]
Truong, V.L.; Bak, M.J.; Jun, M.; Kong, A.N.; Ho, C.T.; Jeong, W.S. Antioxidant defense and hepatoprotection by procyanidins
from almond (Prunus amygdalus) skins. J. Agric. Food Chem. 2014, 62, 8668–8678. [CrossRef]
10. Liu, L.; Hudgins, W.R.; Shack, S.; Yin, M.Q.; Samid, D. Cinnamic acid: A natural product with potential use in cancer intervention.
Int. J. Cancer 1995, 62, 345–350. [CrossRef]
11. Yilmaz, S.; Sova, M.; Ergun, S. Antimicrobial activity of trans-cinnamic acid and commonly used antibiotics against important
fish pathogens and nonpathogenic isolates. J. Appl. Microbiol. 2018. [CrossRef] [PubMed]
12. Taofiq, O.; Gonzalez-Paramas, A.M.; Barreiro, M.F.; Ferreira, I.C. Hydroxycinnamic Acids and Their Derivatives: Cosmeceutical
Significance, Challenges and Future Perspectives, a Review. Molecules 2017, 22, 281. [CrossRef]
13. Perluigi, M.; Joshi, G.; Sultana, R.; Calabrese, V.; De Marco, C.; Coccia, R.; Cini, C.; Butterfield, D.A. In vivo protective effects of
ferulic acid ethyl ester against amyloid-beta peptide 1-42-induced oxidative stress. J. Neurosci. Res. 2006, 84, 418–426. [CrossRef]
14. Scapagnini, G.; Butterfield, D.A.; Colombrita, C.; Sultana, R.; Pascale, A.; Calabrese, V. Ethyl ferulate, a lipophilic polyphenol,
induces HO-1 and protects rat neurons against oxidative stress. Antioxid. Redox Signal. 2004, 6, 811–818. [CrossRef]
15. Wondrak, G.T.; Cabello, C.M.; Villeneuve, N.F.; Zhang, S.; Ley, S.; Li, Y.; Sun, Z.; Zhang, D.D. Cinnamoyl-based Nrf2-activators
targeting human skin cell photo-oxidative stress. Free Radic. Biol. Med. 2008, 45, 385–395. [CrossRef]
16. de Freitas Silva, M.; Pruccoli, L.; Morroni, F.; Sita, G.; Seghetti, F.; Viegas, C.; Tarozzi, A. The Keap1/Nrf2-ARE Pathway as a
Pharmacological Target for Chalcones. Molecules 2018, 23, 1803. [CrossRef]

Molecules 2021, 26, 1027
13 of 13
17. Robledinos-Antón, N.; Fernández-Ginés, R.; Manda, G.; Cuadrado, A. Activators and Inhibitors of NRF2: A Review of Their
Potential for Clinical Development. Oxidative Med. Cell. Longev. 2019, 2019, 9372182. [CrossRef]
18. Magesh, S.; Chen, Y.; Hu, L. Small molecule modulators of Keap1-Nrf2-ARE pathway as potential preventive and therapeutic
agents. Med. Res. Rev. 2012, 32, 687–726. [CrossRef]
19. Rucker, H.; Al-Rifai, N.; Rascle, A.; Gottfried, E.; Brodziak-Jarosz, L.; Gerhauser, C.; Dick, T.P.; Amslinger, S. Enhancing the
anti-inflammatory activity of chalcones by tuning the Michael acceptor site. Org. Biomol. Chem. 2015, 13, 3040–3047. [CrossRef]
20. Kim, M.; Baek, I.-h.; Kwak, J.-H. Synthesis of Phenyl m-coumarylamide Analogs and Their Anti-platelet Aggregation Activity.
Yakhak Hoeji 2019, 63, 70–74. [CrossRef]
21. Jung, Y.S. Metabolism of Sulfur-Containing Amino Acids in the Liver: A Link between Hepatic Injury and Recovery. Biol. Pharm.
Bull. 2015, 38, 971–974. [CrossRef] [PubMed]
22. Meister, A.; Anderson, M.E. Glutathione. Annu. Rev. Biochem. 1983, 52, 711–760. [CrossRef]
23. Lee, Y.H.; Kim, S.H.; Lee, S.; Kim, K.M.; Jung, J.C.; Son, T.G.; Ki, S.H.; Seo, W.D.; Kwak, J.H.; Hong, J.T.; et al. Antioxidant Effect
of Barley Sprout Extract via Enhancement of Nuclear Factor-Erythroid 2 Related Factor 2 Activity and Glutathione Synthesis.
Nutrients 2017, 9, 1252. [CrossRef]