Bisbenzimidazole to benzobisimidazole: From binding B-form duplex DNA to recognizing different modes of telomereG-quadruplex

Article abstract of DOI:10.1039/b819789j

A bisbenzimidazole was discovered to bind helix DNA, while related benzobisimidazole derivatives were found to bind and induce different G-quadruplex isomers. The Royal Society of Chemistry 2009.

Full text of DOI:10.1039/b819789j

View Article Online / Journal Homepage / Table of Contents for this issue
COMMUNICATION
www.rsc.org/chemcomm | ChemComm
Bisbenzimidazole to benzobisimidazole: from binding B-form duplex
DNA to recognizing different modes of telomere G-quadruplexw
a
a
a
Jing Huang,z Guorui Li,z Zhiguo Wu,z Zhibin Song,a Yangyang Zhou,a Liang Shuai,a
Xiaocheng Weng,a Xiang Zhou*a and Guangfu Yangb
Received (in Cambridge, UK) 5th November 2008, Accepted 5th January 2009
First published as an Advance Article on the web 22nd January 2009
DOI: 10.1039/b819789j
A bisbenzimidazole was discovered to bind helix DNA, while
related benzobisimidazole derivatives were found to bind and
induce different G-quadruplex isomers.
Scheme 1 Structures of bisbenzimidazole and benzobisimidazole.
G-Rich strands can fold into G-quadruplexes using Hoogsteen
hydrogen bonds and exist in telomeres and gene promoters.1
Many groups have reported their results targeting G-quadruplex
nucleic acids with small molecules as antitumor agents, since they
might block telomerase activity by stabilizing G-quadruplex
nucleic acids.2–4 Therefore, most of the G-quadruplex binding
ligands have been reported as potential anticancer drugs.5
As a strategy for G-quadruplex ligand design, high selec-
tivity between dsDNA and G-quadruplex DNA is the crucial
step for drug design.6,7 Additionally, the polymorphism of
G-quadruplex structures present in the genomes of organisms
may be associated with different biological function; thus the
challenge of discriminating between different G-quadruplexes
with small molecules is also significant.3,8 Benzimidazole
derivatives attracted our attention not only because of their
pharmacological effects in many drugs,9 but because of their
functional role in DNA ligands.10 A previous report has
indicated that bisbenzimidazole ligands preferentially bind in
the minor groove of A–T-rich sequences of B-form duplex
DNA.10a In 2003, Chowdhury et al. reported that Hoechst
33258 could bind c-myc G-quadruplex with modest affinity but
low selectivity.10b Recent data suggested that bisbenzimidazole,
linked with pyridine, could form a planar central core via
H bonds for G-quadruplex-selective binding.11 Considering the
importance of a planar central core in the G-quadruplex–
ligand interaction, we modified the bisbenzimidazole core to
Scheme 2 Synthesis of compounds 1–4. Reagents and conditions:
(i) 1-(2-chloroethyl)piperidine hydrochloride, K2CO3, NaI, acetone,
reflux for 18 h; (ii) 3,30-diaminobenzidine, 1,4-benzoquinone, ethanol,
reflux for 24 h; (iii) 1,2,4,5-benzenetetraamine tetrahydrochloride,
NaOH, 1,4-benzoquinone, ethanol, reflux for 18 h.
hydrochloride to afford the substituted aldehydes 5–7.
The molecules were then allowed to react with 3,30-diamino-
benzidine or 1,2,4,5-benzenetetraamine tetrahydrochloride,
using 1,4-benzoquinone as the aromatizing agent, to give the
desired compounds 1–4 in moderate yield. All of the new
compounds were fully characterized by NMR, HRMS and
HPLC (see ESI Fig. S1 and S2w).
The G-quadruplexes formed from DNA strands in the
presence of compounds 1–4 was monitored by circular dichroism
(CD). CD spectroscopy has been very useful for distinguishing
DNA secondary structures. As is known, the human telomeric
quadruplex is polymorphic. Parallel, antiparallel, and mixed-type
parallel–antiparallel G-quadruplex structures, depending on
strand orientation, exhibit distinct CD spectra.13 Surprisingly,
we found that the benzobisimidazoles with substituents at
different positions appear to induce the formation of all three
types of G-quadruplexes (Fig. 1A and Fig. S3, see ESIw). In this
study, after addition of compound 2, with a para orientation,
into human telomeric sequence d[T2AG3]4, a positive peak at
around 295 nm was observed in the CD spectrum, which is
characteristic of a hybrid G-quadruplex. Compound 3, which is
a
benzobisimidazole (Scheme 1). In this study, benzo-
bisimidazole derivatives were found to induce different types of
G-quadruplexes, and bisbenzimidazole selectively bound to the
B-form duplex.
Compounds 1–4 can be conveniently synthesized via
two steps, as shown in Scheme 2.12 First, the appropriate
hydroxybenzaldehyde was treated with chloroethylpiperidine
a College of Chemistry and Molecular Sciences, Wuhan University,
Hubei, Wuhan 430072, P. R. China. E-mail: xzhou@whu.edu.cn;
Fax: +86 27-87336380; Tel: +86 27-61056559
b Key Laboratory of Pesticide & Chemical Biology of Ministry of
Education, College of Chemistry, Central China Normal University,
Hubei, Wuhan, P. R. China
w Electronic supplementary information (ESI) available: Synthesis of
compounds 1–4, ESI HRMS spectra, 1H NMR and HPLC spectra of
compounds 1–4, CD titration, melting experiments, exonuclease I
hydrolysis assay, and TRAP-LIG assay. See DOI: 10.1039/b819789j
z These authors contributed equally to this work.
ꢀc
This journal is The Royal Society of Chemistry 2009
902 | Chem. Commun., 2009, 902–904

View Article Online
structures, have no obvious effects on the duplex DNA
(Fig. 1B). These non-homogeneous possibilities of induced
CD for benzobisimidazole and bisbenzimidazole were
attributed to the structures of the compounds. DFT geometry
optimization of compound 1 confirmed that the twist of the
dihedral angle between the two benzimidazole planes is 36.81
(Fig. S5, see ESIw), which favors helix DNA binding.15 Benzo-
bisimidazole derivative 4 is proposed to have an aromatic
conjugate surface, binding a G-quadruplex via p–p stacking.
To validate the CD results, an exonuclease I (Exo I)
hydrolysis assay was carried out. It is known that Exo I
degrades single-stranded DNA in the 30 to 50 direction,
releasing deoxyribonucleoside 50-monophosphates in a step-
wise manner and leaving 50-terminal dinucleotides intact. In
the presence of the ligands, the induction of the G-quadruplex
structure at the 30 terminal DNA T24G21 (T24(G3T2A)3G3)
blocks the hydrolysis reaction.11,16 In this case, the exo-
nuclease I hydrolysis assay could further testify to the induction
of the G-quadruplex structure by the compounds (Fig. S6, see
ESIw). A parallel experiment was also performed using the
oligomer T24RG21 (T24GTGTGAGTGGAGGTGTGAGGT)
that contains mutations (Fig. S6, see ESIw). Consistent with the
CD results, compounds 2–4 selectively stopped the degradation
of T24G21 by inducing G-quadruplex structures. Unlike the
other three compounds, compound 1 also inhibited the
hydrolysis of the mutated oligomer T24RG21, implying that
quadruplex-irrelevant inhibition was present.
Fig. 1 CD spectra of d[T2AG3]4 (12.5 mM) (A) and dsDNA (5 mM)
(B) in 10 mM Tris-HCl, 1 mM EDTA buffer at pH 7.4, in the presence
of different compounds (r = compound/DNA strand concentration).
The steady state of the telomere G-quadruplex induction required
2 equivalents of compound 4, while compounds 2 and 3 were less
effective.
We also evaluated the thermodynamic parameters to predict
the stability of G-quadruplex and duplex DNA in the presence
of these compounds. Based on the CD melting behavior
patterns, melting temperatures were calculated as described
previously.17 According to the data shown in Table S1
(see ESIw), the stabilization potential of compound 1 for
the duplex (DTm = 17.1 1C) is much higher than that of the
benzobisimidazole derivatives. There is also a large variation
between the benzobisimidazole derivatives (DTm = 13.6 1C for
compound 4) and bisbenzimidazole 1 (DTm = 4.1 1C) for
telomere G-quadruplex in K+ buffer. The results indicated
that benzobisimidazole compounds 2–4 were prominent
G-quadruplex ligands, while compound 1 preferred to bind
B-form duplex DNA.
meso substituted, induced a parallel type G-quadruplex in the
absence of stabilizing salts; the peak at 256 nm shifted to
265 nm and were accompanied by uplifting. When the titration
experiments were carried out with compound 4, it was
noteworthy that the ligand increased the CD signal at 295 nm
and suppressed the peak at 265 nm in the CD spectroscopic
analysis, supportive of the selective induction of an antiparallel
G-quadruplex structure. However, there are no significant
peaks of the G-quadruplex in the presence of compound 1.
This suggests that the bis-benzimidazole 1 does not show any
preference towards inducing a particular quadruplex structure
(Fig. S3, see ESIw).
CD was also used to characterize the B-form of DNA.
The duplex DNA (50-GCATTGGTAACTGTCAGACC-30)
exhibits a positive Cotton effect at 280 nm and a negative
Cotton effect at 250 nm, which is identical to the canonical CD
spectrum of B-DNA reported in a previous paper.14 The CD
spectra of dsDNA with compound 1 at various molar ratios
are shown in Fig. S4 (see ESIw). We considered that com-
pound 1 would dramatically change the spectral profile of
dsDNA. According to a previous report, these kinds of bis-
benzimidazole compounds could selectively bind in the minor
groove of B-form duplex DNA.10a One reasonable explanation
is that the selective binding alters the right-handed B-form
conformation. In contrast, the benzobisimidazole derivatives,
which were apt to induce folding of the G-quadruplex
Finally, all of the above encouraging results prompted us
to investigate the telomerase inhibiting ability of these com-
pounds. The TRAP-LIG assay provided qualitative and
quantitative estimates of telomerase inhibition by the small
molecules.18 Considering that the presence of the compounds
in the extended products would possibly interfere with the
PCR step, the ligands were removed prior to the amplification
step. Compounds 2–4 have significant telomerase inhibition
activity, with IC50 values of 10.7, 10.2 and 4.7 mM, respectively
(Fig. 2 and Fig. S7, see ESIw); compound 1 has an IC50 4 50 mM,
correlating with the results from the G-quadruplex binding
studies.
In conclusion, the results obtained using compound 1
supported the fact that bisbenzimidazole is bound to the
duplex, and that the other three benzobisimidazole derivatives
induce three different modes of G-quadruplexes. As reported
previously, the G-tetrad arrangement and the orientation of
the loops are important factors for the interaction,19 and the
ꢀc
This journal is The Royal Society of Chemistry 2009
Chem. Commun., 2009, 902–904 | 903

View Article Online
5 (a) J. Cuesta, M. A. Read and S. Neidle, Mini-Rev. Med. Chem.,
2003, 3, 11; (b) Z. A. E. Waller, P. S. Shirude, R. Rodriguez and
S. Balasubramanian, Chem. Commun., 2008, 1467; (c) J. E. Reed,
S. Neidle and R. Vilar, Chem. Commun., 2007, 4366; (d) K. Jantos,
R. Rodriguez, S. Ladame, P. S. Shirude and S. Balasubramanian,
J. Am. Chem. Soc., 2006, 128, 13662.
6 (a) W. A. Denny, G. J. Atwell, G. W. Rewcastle and B. C. Baguley,
J. Med. Chem., 1987, 30, 658; (b) W. A. Denny, G. J. Atwell,
G. W. Rewcastle and B. C. Baguley, J. Med. Chem., 1987, 30, 664.
7 (a) R. J. Harrison, S. M. Gowan, L. R. Kelland and S. Neidle,
Bioorg. Med. Chem. Lett., 1999, 9, 2463; (b) M. A. Read,
A. A. Wood, J. R. Harrison, S. M. Gowan, L. R. Kelland,
H. S. Dosanjh and S. Neidle, J. Med. Chem., 1999, 42, 4538;
(c) R. J. Harrison, J. Cuesta, G. Chessari, M. A. Read, S. K. Basra,
A. P. Reszka, J. Morrell, S. M. Gowan, C. M. Incles,
F. A. Tanious, W. D. Wilson, L. R. Kelland and S. Neidle,
J. Med. Chem., 2003, 46, 4463; (d) M. J. B. Moore,
C. M. Schultes, J. Cuesta, F. Cuenca, M. Gunaratnam,
F. A. Tanious, W. D. Wilson and S. Neidle, J. Med. Chem.,
2006, 49, 582; (e) N. H. Campbell, G. N. Parkinson,
A. P. Reszka and S. Neidle, J. Am. Chem. Soc., 2008, 130, 6722.
8 (a) E. H. Blackburn, Cell (Cambridge, MA, U. S.), 2001, 106, 661;
(b) T. R. Cech, Cell (Cambridge, MA, U. S.), 2004, 116, 273;
(c) J.-X. Dai, T. S. Dexheimer, D. Chen, M. Carver, A. Ambrus,
R. A. Jones and D.-Z. Yang, J. Am. Chem. Soc., 2006, 128, 1096;
(d) A. T. Phan, Y. S. Modi and D. J. Patel, J. Am. Chem. Soc.,
2004, 126, 8710; (e) A. T. Phan, V. Kurtavyi, S. Burge, S. Neidle
and D. J. Patel, J. Am. Chem. Soc., 2007, 129, 4386.
Fig. 2 (A) 12% non-denaturing gels showing elongated telomeric DNA
products of telomerase extension produced from the TRAP-LIG assay
with compound 4 at concentrations of 1–10 mM. + and ꢁ labels indicate
the presence and the absence of telomerase extracts. (B) Quantification of
the elongated telomeric DNA products from (A).
ligand side chains play a significant role in selecting DNA
topology.20 We identified that the conformation of the
aromatic core is determinate of binding selectivity; the strong
and selective binding of compounds 2–4 with intramolecular
G-quadruplexes may be attributed to their large ring systems,
which overlap completely with the G-tetrad plane. Conversely,
the twist of the dihedral angle between the two benzimidazole
rings probably makes compound 1 suitable to interact with
helix double-stranded DNA. The formation of G-quadruplex
isomers, depending on the orientation of the loops, is closely
correlated with the side chain of the ligands, especially the
substituent positions. Such interesting results provide us
with another new entry into G-quadruplex ligand design and
conformation studies.
9 A. R. Batteraby, J. Nat. Prod., 1988, 51, 643.
10 (a) C. Bailly, G. Chessari, C. Carrasco, A. Joubert, J. Mann,
W. D. Wilson and S. Neidle, Nucleic Acids Res., 2003, 31, 1514;
(b) S. Maiti, N. K. Chaudhury and S. Chowdhury, Biochem.
Biophys. Res. Commun., 2003, 310, 505; (c) J. Mann, A. Baron,
Y. Opoku-Boahen, E. Johansson, G. Parkinson, L. R. Kelland and
S. Neidle, J. Med. Chem., 2001, 44, 138; (d) X.-W. Sun, S. Neidle
and J. Mann, Tetrahedron Lett., 2002, 43, 7239.
11 G. R. Li, J. Huang, M. Zhang, Y. Y. Zhou, D. Zhang, Z. G. Wu,
S. R. Wang, X. C. Weng, X. Zhou and G. F. Yang, Chem.
Commun., 2008, 4564.
12 K. T. Hopkins, W. D. Wilson, B. C. Bender, D. R. McCurdy,
J. E. Hall, R. R. Tidwell, A. Kumar, M. Bajic and D. W. Boykin,
J. Med. Chem., 1998, 41, 3872.
13 (a) R. Rodriguez, G. D. Pantos, D. P. N. Goncalves, J. K.
M. Sanders and S. Balasubramanian, Angew. Chem., Int. Ed.,
2007, 46, 5405; (b) G. N. Parkinson, M. P. H. Lee and S. Neidle,
Nature, 2002, 417, 876; (c) Y. Wang and D. J. Patel, Structure
(Cambridge, MA, U. S.), 1993, 1, 263; (d) A. Ambrus, D. Chen,
J. Dai, T. Bialis, R. A. Jones and D. Yang, Nucleic Acids Res.,
2006, 34, 2723.
This work was partially supported by the National Science
of Foundation of China (No. 20672084, 20621502, 90813031),
the National Science Fund for Distinguished Young Scholars
(No. 20425206), the Cultivation Fund of the Key Scientific
and Technical Innovation Project, the Ministry of Education
of China (No. 706040).
14 (a) N. Sugimoto, S. Nakano, M. Katoh, A. Matsumura,
H. Nakamuta, T. Ohmichi, M. Yoneyama and M. Sasaki,
Biochemistry, 1995, 34, 11211; (b) M. Balaz, M. D. Napoli,
A. E. Holmes, A. Mammana, K. Nakanishi, N. Berova and
R. Purrello, Angew. Chem., Int. Ed., 2005, 44, 4006.
15 D. L. Boger and R. M. Garbaccio, Acc. Chem. Res., 1999, 32, 1043.
16 Y. Yao, Q. Wang, Y.-H. Hao and Z. Tan, Nucleic Acids Res., 2007,
35, e68.
Notes and references
1 (a) E. H. Blackburn, Cell (Cambridge, MA, U. S.), 1994, 77, 621;
(b) D. J. Patel, A. T. Phan and V. Kuryavyi, Nucleic Acids Res.,
2007, 35, 7429.
2 D. Monchaud and M.-P. Teulade-Fichou, Org. Biomol. Chem.,
2008, 6, 627.
3 (a) M.-P. Teulade-Fichou, C. Carrasco, L. Guittat, C. Bailly,
P. Alberti, J.-L. Mergny, A. David, J.-M. Lehn and
W. D. Wilson, J. Am. Chem. Soc., 2003, 125, 4732;
(b) E. M. Rezler, J. Seenisamy, S. Bashyam, M. Y. Kim,
E. White, W. D. Wilson and L. H. Hurley, J. Am. Chem. Soc.,
2005, 127, 9439; (c) J. E. Reed, A. A. Arnal, S. Neidle and R. Vilar,
J. Am. Chem. Soc., 2006, 128, 5992; (d) P. Wang, L.-G. Ren,
H.-P. He, F. Liang and X. Zhou, ChemBioChem, 2006, 7, 1155;
(e) L. X. Zhang, J. Huang, L. G. Ren, M. H. Bai, L. Wu, B. P. Zhai
and X. Zhou, Bioorg. Med. Chem., 2008, 16, 303.
17 (a) L.-G. Ren, A.-M. Zhang, J. Huang, P. Wang, X.-C. Weng,
L.-X. Zhang, F. Liang, Z. Tan and X. Zhou, ChemBioChem, 2007,
8, 775; (b) B.-Q. Fu, J. Huang, L.-G. Ren, X.-C. Weng,
Y.-Y. Zhou, Y.-H. Du, X.-J. Wu, X. Zhou and G.-F. Yang, Chem.
Commun., 2007, 3264.
18 J. Reed, M. Gunaratnam, M. Beltran, A. P Reszka, R. Vilar and
S. Neidle, Anal. Biochem., 2008, 380, 99.
19 J. Seenisamy, S. Bashyam, V. Gokhale, H. Vankayalapati, D. Sun,
A. Siddiqui-Jain, N. Streiner, K. Shin-ya, E. White, W. D. Wilson
and L. H. Hurley, J. Am. Chem. Soc., 2005, 127, 2944.
4 (a) A. Siddiqui-Jain, C. L. Grand, D. J. Bearss and L. H. Hurley,
Proc. Natl. Acad. Sci. U. S. A., 2002, 99, 11593; (b) T.-M. Ou,
Y.-J. Lu, C. Zhang, Z.-S. Huang, X.-D. Wang, J.-H. Tan, Y. Chen,
D.-L. Ma, K.-Y. Wong, J. C.-O. Tang, A. S.-C. Chan. and
L.-Q. Gu, J. Med. Chem., 2007, 50, 1465.
20 (a) L. Rossetti, M. Franceschin, A. Bianco, G. Ortaggi and
M. Savino, Bioorg. Med. Chem. Lett., 2002, 12, 2527;
(b) R. T. Wheelhouse, S. A. Jennings, V. A. Philips, D. Pletsas,
P. M. Murphy, N. C. Garbett, J. B. Chaires and T. C. Jenkins,
J. Med. Chem., 2006, 49, 5187.
ꢀc
This journal is The Royal Society of Chemistry 2009
904 | Chem. Commun., 2009, 902–904