Bioorganic synthesis of end-capped anti-HIV peptides by simultaneous cyanocysteine-mediated cleavages of recombinant proteins

Article abstract of DOI:10.1016/j.bmc.2009.09.015

Bioorganic synthesis of N- and C-terminal end-capped peptides by two simultaneous S-cyanocysteinemediated cleavages of recombinant proteins is described. This approach is demonstrated in the preparation of anti-HIV fusion inhibitory peptides.

Full text of DOI:10.1016/j.bmc.2009.09.015

Bioorganic & Medicinal Chemistry 17 (2009) 7487–7492
Contents lists available at ScienceDirect
Bioorganic & Medicinal Chemistry
journal homepage: www.elsevier.com/locate/bmc
Bioorganic synthesis of end-capped anti-HIV peptides by simultaneous
cyanocysteine-mediated cleavages of recombinant proteins
Michinori Tanaka a, Kazumi Kajiwara a,b, Rei Tokiwa a,b, Kentaro Watanabe a, Hiroaki Ohno a,
Hiroko Tsutsumi c, Yoji Hata c, Kazuki Izumi d, Eiichi Kodama d, Masao Matsuoka d,
a,
Shinya Oishi a, , Nobutaka Fujii
*
*
a Graduate School of Pharmaceutical Sciences, Kyoto University, Sakyo-ku, Kyoto 606-8501, Japan
b JST Innovation Plaza Kyoto, Japan Science and Technology Agency, Nishigyo-ku, Kyoto 615-8245, Japan
c Gekkeikan Research Institute, Gekkeikan Sake Company, Ltd, Fushimi-ku, Kyoto 612-8391, Japan
d Institute for Virus Research, Kyoto University, Sakyo-ku, Kyoto 606-8507, Japan
a r t i c l e i n f o
a b s t r a c t
Article history:
Bioorganic synthesis of N- and C-terminal end-capped peptides by two simultaneous S-cyanocysteine-
mediated cleavages of recombinant proteins is described. This approach is demonstrated in the prepara-
tion of anti-HIV fusion inhibitory peptides.
Received 12 August 2009
Revised 5 September 2009
Accepted 10 September 2009
Available online 15 September 2009
Ó 2009 Elsevier Ltd. All rights reserved.
Keywords:
Bioorganic synthesis
End-capped peptide
Fusion inhibitor
HIV-1
1. Introduction
ditions. In order to maintain the prolonged effect of peptide
therapeutics in vivo, the design of N-terminal acyl- and/or C-termi-
The recent upsurge of successes in recombinant protein-based
therapeutics, such as antibodies and cytokines, as well as advances
in formulation technology, has rekindled an interest in the poten-
tial development of biomolecule-derived pharmaceuticals such as
peptides and oligonucleotides.1 In order to accommodate large-
scale production for high daily dose requirements, facile access
to prepare homogeneous polymeric compounds is needed.2
Expression by recombinant technology is an alternative to chemi-
cal synthesis of bioactive peptides. This approach can overcome
major drawbacks associated with chemical synthesis including
concomitant production of chemical wastes derived from protect-
ing groups, organic solvents and resin for solid-phase synthesis.
Conversely, recombinant peptides from prokaryotes are usually
produced without post-translational modifications. Such modifica-
tions often provide characteristic functions including bioactivity
and biostability.3,4
nal amide-modified peptides has been attempted. Such modifica-
tions can prevent enzymatic scissions in the circulatory system.
However, practical recombinant methodology to prepare bioactive
peptides having two end-capping groups is not established. Site-
specific cleavage at the S-cyanocysteine site within recombinant
proteins 2 in the presence of ammonia has been reported (Scheme
1).5 Such a reaction gives rise to peptide acids and amides 4. This
reaction concomitantly releases the tail peptide 5 with a 2-imino-
thiazolidine-4-carbonylgroup at theN-terminus. On the basis of this
chemistry, we envisaged that cleavages of 6 at two S-cyanocysteines
across the target peptide sequence would generate a peptide amide
modification 7 with an N-terminal 2-iminothiazolidine-4-carbonyl
group. The current work represents the facile preparation of N-
and C-terminally protected anti-HIV peptides by two simultaneous
chemical cleavages of recombinant proteins.
Proteolytic cleavage by exopeptidases is one of the main path-
ways for degradation of bioactive peptides under physiological con-
2. Results and discussion
This type of cleavage presumably consists of nucleophilic attack
of amines and the consecutive iminothiazolidine formation
(Scheme 1). Since b-elimination of the thiocyanato group is a pos-
sible competing reaction of S-cyanocysteine, rapid progression of
* Corresponding authors. Tel.: +81 75 753 4551; fax: +81 75 753 4570 (S.O.).
E-mail addresses: soishi@pharm.kyoto-u.ac.jp (S. Oishi), nfujii@pharm.
kyoto-u.ac.jp (N. Fujii).
0968-0896/$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved.
doi:10.1016/j.bmc.2009.09.015

7488
M. Tanaka et al. / Bioorg. Med. Chem. 17 (2009) 7487–7492
Table 1
a
Cleavage reaction of S-cyanocysteine-containing peptides 9 by aqueous NH3
10a R = NH2
10b R = OH
Ac-YEQQK-X-R
R
NH3
Ac-YEQQK-X-C-EEYFKK-NH2
S
HN
8 R = H
9 R = CN
CDAP
N
H
O
EEYFKK-NH2
11
Ac-YEQQK-X-ΔAla-EEYFKK-NH2 12
(ΔAla: dehydroalanine)
O
H
O
H
Ac-YEQQK
N
Ac-YEQQK N
NH
NH
O
13
14
X
Conversionb (%)
Gly
Ala
Val
Leu
Ile
50
62
36
53
46
42
66
63
55
57
68
71
45
46
79c
65
82d
71
64
Pro
Met
Phe
Tyr
Trp
Ser
Thr
Asp
Glu
Asn
Gln
Lys
Arg
His
Scheme 1. Site-specific cleavage of recombinant proteins at S-cyanocysteine and
the preparative illustration of N- and C-terminally capped peptide 7.
these two steps is preferred.6 We expected that the presence of an
appropriate side-chain functional group in close proximity should
assist the cleavage.7 Using model synthetic peptides Ac-YEQQK-X-
C-EEYFKK-NH2 8, we evaluated the effect of the N-terminal-side
residue (X) of the cysteine on peptide amide formation. After the
standard Fmoc-based solid-phase peptide synthesis, the peptides
8 were treated with 1-cyano-4-dimethylaminopyridinium tetra-
fluoroborate (CDAP) in a 0.1 N AcOH solution to provide S-cyany-
lated peptides 9, which were purified by RP-HPLC. Cleavage
reactions of 9 with aqueous 3 M NH3 were monitored by RP-HPLC
analysis (Table 1), in which the production of the first segment
peptides 10a,b and the second segment 11 with the N-terminal
2-iminothiazolidine-4-carbonyl group were expected. Among the
19 natural amino acids utilized for the X position (except Cys),
bulky aliphatic amino acids such as Val, Ile, and Pro were unfavor-
able for the cleavage reaction. Peptides with an acidic amino acid
such as Asp and Glu mainly provided a b-eliminated product 12.8
In contrast, Ser and Thr were appropriate residues for the cleavage
reaction. Interestingly, the reaction of Asn- and Lys-containing
peptides accompanied production of characteristic C-terminally
protected peptides 13 and 14 in higher combined yields: from
the Asn peptide, formation of C-terminal aspartimide 13 was ob-
served along with the C-terminal peptide amide (10a:13 =
53:47).9 Cleavage of the Lys peptide produced a peptide 14 with
a C-terminal seven-membered lactam preferentially over the
C-terminal amide form (10a:14 = 22:78).10
a
All cleavage reactions were carried out in 3 M NH3 for 20 min at 20 °C.
The conversion yields were calculated based on the combined peak areas of
b
peptides 10a and 11 by RP-HPLC analysis.
c
Including C-terminal aspartimide product 13 (10a:13 = 53:47).
Including C-terminal e-lactam product 14 (10a:14 = 22:78).
d
C-terminal cyclic structures in aspartimide 13 and lactam 14
were verified by ESI LC/MS/MS and by the comparative analysis
using the peptides that were prepared by the alternative proce-
dures (Scheme 2). Briefly, (S)-3-aminosuccinimide 15a or (S)-3-
Scheme 2. Alternative synthesis of peptides 13 and 14. Reagents and conditions:
(a) Fmoc-Lys(Boc)-OH, HOBtꢀH2O, WSCꢀHCl, (S)-3-aminosuccinimide for 16a (94%)
or (S)-3-amino-e-caprolactam for 16b (99%); (b) 95% aqueous TFA (quant.); (c) (i) 4-
nitrophenyl chloroformate, (i-Pr)2EtN, DCM; (ii) 17a or 17b, (i-Pr)2EtN, DMF (18a:
51% loading, 18b: 45% loading); (d) (i) Fmoc-based SPPS; (ii) TFA/H2O/m-cresol/
thioanisole/1,2-ethanedithiol (80:5:5:5:5).
amino-e-caprolactam 15b was coupled with Fmoc-Lys(Boc)-OH
to give the protected C-terminal components 16a,b. After Boc-
deprotection of 16a,b, the resulting amine 17a,b were anchored
onto p-nitrophenyl carbonate resin, which was prepared by treat-
ment of NovaSyn TGA resin with 4-nitrophenyl chroloformate.
Fmoc-based solid-phase synthesis of the peptide sequence fol-
lowed by final deprotection gave the expected peptides 13 and

M. Tanaka et al. / Bioorg. Med. Chem. 17 (2009) 7487–7492
7489
Table 3
14. Comparative RP-HPLC analysis demonstrated that the peptides
Sequences and anti-HIV activity of N- and C-terminally capped SC34EK analogs
were coincident with the ones obtained by cyanocysteine-medi-
ated cleavage (see Supplementary data).
R1-WMEWDRKIEEYTKKIEELIKKSQEQQEKNEKELK-R2 19–21
a
Peptide
R1
R2
EC50 (nM) Tm
Both the ring structures of 13 and 14 were formed by intramo-
lecular cyclization of characteristic side-chains of Asn and Lys un-
der basic conditions. Since intramolecular imide or amide
formation was expected to assist the rapid cleavage, we searched
for appropriate conditions for two simultaneous ring-closing reac-
(°C)
SC34EK 19
Ac
NH2
0.60 0.10 71.2
S
O
H
HN
20a
0.48 0.13 71.0
N
tions including C-terminal aspartimide 13 or lysine e-lactam 14 as
N
H
NH
O
well as N-terminal iminothiazolidine formations (Table 2). Tertiary
amines such as Et3N and (i-Pr)2EtN generated the expected two
peptides 13 and 14 with cyclic structures. Treatment of 9 with
alkaline metal-based weak bases such as NaHCO3 and AcONa
recovered the starting material, while the expected 13 or 14 was
predominantly obtained by aqueous carbonates.11 Aqueous 0.3 M
K2CO3, which provided 13 or 14 most efficiently, was employed
for further experiments.
O
S
O
H
HN
N
NH
20b
21
0.58 0.24 71.0
N
H
O
H
OH
0.68 0.11
—
The established protocol was applied to bioorganic synthesis of
anti-HIV peptides from recombinant proteins. As a model peptide,
HIV fusion inhibitor SC34EK 19 was utilized, which was designed
a
EC50 was determined as the concentration that blocked HIV-1 replication by
50% in a MAGI assay.
based on the bioactive a-helix conformation of the C-terminal hep-
tad repeat in the envelop glycoprotein gp41 (Table 3, Scheme 3).12
Peptide 19 exerts anti-HIV activity by preventing formation of the
fusogenic six-helical bundle of gp41 and is potent against wild-
type and enfuvirtide-resistant HIV-1 viruses. The recombinant
thioredoxin-fused proteins 22a,b containing anti-HIV sequence
were expressed using the Escherichia coli BL21 strain and were
purified by affinity chromatography using Ni-NTA resin. After the
removal of imidazole by gel filtration, the protein concentration
was quantified by the standard Bradford assay. S-Cyanylation of
22a,b was carried out with 10 mM CDAP in 0.1 N AcOH containing
0.5 mM tris(2-carboxyethyl)phosphine (TCEP), which was added to
maintain reducing condition for keeping Cys residues.6b,13 The
resulting cyanylated proteins 23a,b were treated in a K2CO3 solu-
tion (0.3 M) to provide the expected end-capped peptides 20a
and 20b in 24% and 21% isolated yields, respectively (Fig. 1) and
were accompanied with the thioredoxin parts 24a,b.14
Scheme 3. Bioorganic synthesis of anti-HIV peptide SC34EK analogs 20a,b includ-
ing N- and C-terminal capping moieties.
Anti-HIV activity of the peptides 20a,b derived from recombi-
nant proteins was evaluated along with the parent SC34EK 19
and the end-capping free 21, which is usually expressed in pro-
karyotes (Table 3). Peptides 20a,b reproduced the bioactivity of
the original peptide 19 [EC50(20a) = 0.48 nM; EC50(20b) =
0.58 nM],15 indicating that the original anti-HIV activity was not
Table 2
Cleavage reaction of Asn-Cys(CN) or Lys-Cys(CN)-containing peptides by basic treatmenta
CN
10a,b
Ac-YEQQK-X-C-EEYFKK-NH2
base
+
+ 11
9a X = Asn
9b X = Lys
13 or 14
Entry
Base
From peptide 9a
From peptide 9b
Conversionb (%)
Ratio (13/10)c
Conversionb (%)
Ratio (14/10)c
1
2
3
4
5
6
7
8
9
3 M NH3
0.5 M NH3
1 M Et3N
1 M (i-Pr)2EtN
1 M AcONa
1 M NaHCO3
1 M Na2CO3
0.3 M Na2CO3
1 M K2CO3
0.3 M K2CO3
79
59
70
63
0.9
1.7
3.6
3.1
—
82
72
64
65
3.6
12.4
>30
>30
—
d
d
—
—
—
—
d
d
—
—
85
83
85
83
2.5
3.3
1.8
3.5
64
74
68
73
5.6
13.5
9.7
15.6
10
a
b
c
All cleavage reactions were carried out for 20 min at 20 °C.
The conversion yields were calculated based on the combined peak areas of peptides 10a (entries 1 and 2)/10b (entries 3–10), 11, and 13 or 14 by RP-HPLC analysis.
The ratios of the peak areas of aspartimide 13 or e-lactam 14 to peptide 10.
d
The starting material was recovered.

7490
M. Tanaka et al. / Bioorg. Med. Chem. 17 (2009) 7487–7492
Figure 3. Degradation of SC34EK 19 and the analogues 20a,b, 21 in mouse serum
(n = 5).
Figure 1. HPLC profiles of S-cyanocysteine-mediated cleavage of thioredoxin-fused
proteins. (a) Asn-Cys(CN)-mediated cleavage; (b) Lys-Cys(CN)-mediated cleavage.
Top: recombinant proteins 22a,b purified by affinity chromatography; middle: S-
cyanylated products 23a,b; bottom: products from basic treatment of 23a,b. HPLC
conditions: linear gradient of 30–60% solvent B in solvent A over 30 min.
3. Conclusions
Reported herein is the bioorganic synthesis of anti-HIV pep-
tides with two end-capping groups from recombinant proteins.
S-Cyanocysteine-mediated cleavage at the Asn-Cys(CN) and Lys-
Cys(CN) sites provided the characteristic C-terminal ring struc-
disturbed by the N- and C-terminal functional end-capping groups.
Biophysical characterization of these peptides was investigated by
circular dichroism (CD) analysis (Fig. 2 and Supplementary data).
tures, aspartimide and lysine
e-lactam, respectively. These ring
structures are not found in recombinant proteins and peptides
produced from prokaryotes. In the current anti-HIV peptide
study, capping functional groups did not disturb the original po-
tent bioactivity or modify the biophysical character. This ap-
proach is applicable to the preparation of plural end-capped
peptides from a single protein molecule having tandem target
sequences in conjunction with Lys-Cys(CN) sites.
The improved
a-helix property of 19 is retained in 20a and 20b,
and similar thermal stability of the six-helical bundle with N36
was observed (Table 3).
The protecting ability of iminothiazolidine for the N-terminus
as well as lysine e-lactam and aspartimide for the C-terminus from
the biodegradation by potential exopeptidases was assessed using
peptides 19–21. The quantity of the intact peptide during incuba-
tion in mouse serum was monitored by RP-HPLC (Fig. 3). Rapid
degradation was observed for peptide without capping groups at
both ends. The isolated digested product had two C-terminal resi-
dues deleted. Similarly, C-terminal aspartimide peptide 20a was
also gradually degraded at the C-terminus.16 In contrast, peptide
4. Experimental
4.1. General
For HPLC separations of synthetic peptides, a Cosmosil 5C18-
ARII analytical column (4.6 ꢁ 250 mm, flow rate 1 mL/min, Nacalai
Tesque, Kyoto Japan) or a Cosmosil 5C18-ARII preparative column
(20 ꢁ 250 mm, flow rate 10 mL/min) was employed. For HPLC
analysis of recombinant proteins 22a,b, 23a,b and the cleaved
products 20a,b (Fig. 1), a Cosmosil Protein-R analytical column
(4.6 ꢁ 150 mm, flow rate 1 mL/min) was employed. The eluting
products were detected by UV at 220 nm. A solvent system consist-
ing of 0.1% TFA solution (v/v, solvent A) and 0.1% TFA in MeCN (v/v,
solvent B) were used for HPLC elution. All peptides were character-
ized by a MALDI-TOF-MS (AXIMA-CFR plus, Shimadzu, Kyoto,
Japan) or by a QqTof (QSTAR pulsar i, Applied Biosystems). NMR
spectra were recorded on Bruker AVANCE500.
20b with a C-terminal
tion. As such, a combination of iminothiazolidine at the N-termi-
nus and lysine -lactam at the C-terminus is beneficial for
e-lactam was stable during the 24-h incuba-
e
stabilizing the anti-HIV peptide against potential exopeptidase-
mediated degradation without alteration of the biological and bio-
physical characters.
4.2. Peptide synthesis
Protected peptide-resins were manually constructed by stan-
dard Fmoc-based SPPS on Rink Amide resin (Novabiochem,
83 mg, 0.05 mmol). t-Bu for Tyr, Ser and Thr; t-Bu ester for Asp
and Glu; Boc for Lys; Trt for Cys, His, Asn and Gln; and 2,2,4,6,7-
pentamethyldihydrobenzofuran-5-sulfonyl (Pbf) for Arg were em-
ployed for side-chain protection, respectively. Fmoc-amino acids
were coupled using 5 equiv of reagents [Fmoc-amino acid, N,N0-
diisopropylcarbodiimide and HOBtꢀH2O] to free amino group in
DMF for 1.5 h. Fmoc deprotection was performed by 20% piperi-
dine in DMF (2 ꢁ 1 min, 1 ꢁ 20 min). The resulting protected resin
was treated with TFA/H2O/m-cresol/thioanisole/1,2-ethanedithiol
Figure 2. Circular dichroism spectra of N36-SC34EK analogue complexes.

M. Tanaka et al. / Bioorg. Med. Chem. 17 (2009) 7487–7492
7491
(80:5:5:5:5) at room temperature for 2 h. After removal of the re-
sin by filtration, ice-cold dry Et2O (30 mL) was added to the resi-
due. The resulting powder was collected by centrifugation and
then washed with ice-cold dry Et2O (3 ꢁ 15 mL). Purification of
the crude product by preparative HPLC afforded a colorless powder
of the desired peptide.
(m, 1H), 3.23–3.14 (m, 1H), 3.10–3.00 (m, 1H), 2.96–2.81 (m,
2H), 1.90–1.80 (m, 1H), 1.80–1.69 (m, 2H), 1.69–1.56 (m, 2H),
1.56–1.46 (m, 1H), 1.42–1.12 (m, 15H); 13C NMR (125 MHz,
DMSO-d6) d 174.0, 170.8, 155.9, 155.5, 143.8, 143.6, 140.6, 127.5,
125.3, 125.2, 120.0, 77.2, 65.6, 54.9, 51.2, 46.6, 40.5, 31.3, 30.9,
29.1, 28.7, 28.2, 27.5, 22.8. Anal. Calcd for C32H42N4O6: C, 66.41;
H, 7.32; N, 9.68. Found: C, 66.17; H, 7.03; N, 9.71.
4.3. General procedure for the preparation of S-cyanocysteine-
containing peptides 9
4.7. Synthesis of resin 18a
Compound 16a (0.56 g, 1 mmol) was dissolved in 95% aqueous
TFA (5 ml) and the solution was stirred at room temperature for
1 h. The solvent was removed under reduced pressure to give com-
pound 17a (0.58 g, quant.) as a colorless oil, which was utilized for
the next step without further purification. A solution of 0.3 M
4-nitrophenyl chloroformate and 0.3 M (i-Pr)2EtN in DCM (2 mL)
was added to NovaSynTGA resin (0.26 mmol/g, 192 mg, 0.05 mmol).
The mixture was stirred at room temperature for 4 h, and the resin
was washed with DCM (ꢁ3) and DMF (ꢁ3). A solution of 0.3 M com-
pound 17a, 0.3 M (i-Pr)2EtN in DMF (2 mL) was added to the resin
and the mixture was stirred at room temperature for 6 h. The resin
was washed by DMF (ꢁ5), DCM (ꢁ3) and MeOH (ꢁ3) and dried to
give the expected resin 18a (51% loading).
To a solution of peptide 8 (X = Lys, 5.8 mg) in 0.1 N AcOH
(0.58 mL) was added the solution of CDAP in 0.1 N AcOH (10 mg/
mL, 182 lL). After being stirred at room temperature for 30 min,
the solution was purified by preparative HPLC to give freeze-dried
powder of peptide 9 (X = Lys, 5.7 mg, 97%).
4.4. General procedure for cleavage reaction of S-
cyanocysteine-containing peptides 9 by aqueous NH3
Peptide 9 (ca. 1 mg) was dissolved in 100 lL of 3 M NH3 solu-
tion. After standing at 20 °C for 20 min, the reaction was monitored
by RP-HPLC. The results are summarized in Table 1.
4.5. Synthesis of compound 16a
4.8. Preparation of recombinant thioredoxin-fused proteins
22a,b
To a solution of Fmoc-Lys(Boc)-OH (2.34 g, 5.0 mmol) and
HOBtꢀH2O (0.77 g, 5.0 mmol) in DMF (20 mL) was added WSCꢀHCl
(0.96 g, 5.0 mmol) at 0 °C. After being stirred for 5 min. at room tem-
perature, a solution of (S)-3-aminosuccinimide 15a [prepared by
catalytic hydrogenation of (S)-3-N-carbobenzoxyaminosuccinimide
(1.61 g, 6.5 mmol)] in DMF (5 mL) was added. The reaction mixture
was stirred for 1 h and was poured into ice-cold water. The resulting
precipitate was extracted with AcOEt and the organic layer was
washed with citric acid solution and brine. After drying over MgSO4,
thesolventwasevaporatedunderreduced pressure. Theresiduewas
purified by silica-gel column chromatography to provide the com-
The cDNA sequence encoding KKC-SC34EK-KCW and KNC-
SC34EK-NCW was utilized as template for PCR amplification,
KNC-SC34EK-NCW: 50-CTCGGATCCAAAAATTGCTGGATGGAATGGG
ATCGTAAAATTGAAGAATATACCAAAAAAATTGAAGAACTGATTAAAA
AAAGCCAGGAACAGCAGGAAAAAAATGAAAAAGAACTGAAAAATTGC
TGGTAACTCGAG-30; KKC-SC34EK-KCW: 50-CTCGGATCCAAAAAATG
CTGGATGGAATGGGATCGTAAAATTGAAGAATATACCAAAAAAATTGA
AGAACTGATTAAAAAAAAGCCAGGAACAGCAGGAAAAAAATGAAAAA
GAACTGAAAAAATGCTGGTAACTCGAGGAG-30. The two restriction
sites for BamHI and XhoI are shown in bold. Codons were replaced
by more frequently used ones based on E. coli. codon usage. Each
segment was digested with BamHI and XhoI and inserted into
pET32a vector. Then the plasmids (pET32a-KKC-SC34EK-KCW
and pET32a-KNC-SC34EK-NCW) were transformed into E. coli BL21
(DE3)-RIL strain for expression. Isolated colonies were picked up
pound 16a (2.65 g, 94% yield) as a colorless powder: ½a D20
ꢃ31.4 (c
ꢂ
1.0, CHCl3); 1H NMR (500 MHz, DMSO-d6) d 11.22 (s, 1H), 8.51 (d,
J = 8.0 Hz, 1H), 7.92–7.80 (m, 2H), 7.75–7.66 (m, 2H), 7.52 (d,
J = 8.0 Hz, 1H), 7.44–7.36 (m, 2H), 7.36–7.27 (m, 2H), 6.78 (t,
J = 5.5 Hz, 1H), 4.59–4.46 (m, 1H), 4.34–4.14 (m, 3H), 3.98–3.83 (m,
1H), 2.94–2.78 (m, 3H), 2.42 (dd, J = 17.5, 5.5 Hz, 1H), 1.69–1.43
(m, 2H), 1.42–1.11 (m, 13H). 13C NMR (125 MHz, DMSO-d6) d
177.4, 176.3, 172.1, 155.9, 155.5, 143.8, 143.6, 140.6, 127.5, 127.0,
125.3, 120.0, 77.2, 65.6, 54.3, 49.2, 46.6, 38.9, 36.0, 31.4, 29.0, 28.2,
22.6. Anal. Calcd for C30H36N4O7ꢀH2O: C, 61.84; H, 6.57; N, 9.62.
Found: C, 61.92; H, 6.23; N, 9.72.
and cultured overnight in 10 mL of LB culture with 50
cillin at 30 °C with shaking. This culture was transferred into 1 L of
LB culture in the presence of 50 g/mL ampicillin. When the OD600
lg/mL ampi-
l
reached 0.6–0.8 at 30 °C, protein expression was initiated by add-
ing isopropyl b-D-1-thiogalactopyranoside (IPTG) (1 mM). After an
additional 6 h cultivation at 25 °C, cells were harvested by centri-
fugation at 4000 rpm for 20 min. Cells were resuspended in
B-PER (PIERCE) solution, and disrupted by sonication. After centri-
fugation at 12,000 rpm for 30 min, the supernatant, supplemented
0.5 mM TCEP, was transferred to column with Ni-NTA agarose
(QIAGEN). The column was washed with wash buffer (20 mM
phosphate, pH 6.0, containing 0.5 M NaCl and 0.5 mM TCEP). Pro-
tein was eluted from the column by the 150 mM imidazole in
phosphate buffer (pH 6.0) containing 0.5 mM TCEP. The expression
and purification of the fusion protein was analyzed by SDS–PAGE
(10–20% gradient gel). The yield of eluted protein was calculated
using Protein Assay Kit (BIO-RAD).
4.6. Synthesis of compound 16b
To a solution of Fmoc-Lys(Boc)-OH (2.34 g, 5.0 mmol) and
HOBtꢀH2O (0.77 g, 5.0 mmol) in DMF (20 mL) was added WSCꢀHCl
(0.96 g, 5.0 mmol) at 0 °C. After being stirred for 5 min at room
temperature,
a
solution of (S)-3-amino-e-caprolactam 15b
(0.77 g, 6.0 mmol) in DMF (5 mL) was added. The reaction mixture
was stirred for 1 h, and was poured into ice-cold water. The result-
ing precipitate was extracted with AcOEt and the organic layer was
washed with citric acid solution and brine. After drying over
MgSO4, the solvent was evaporated under reduced pressure. The
residue was purified by silica-gel column chromatography to pro-
vide the compound 16b (2.86 g, 99% yield) as a colorless powder:
4.9. General procedure for the preparation of the end-capped
anti-HIV peptide from recombinant protein
½
a 2D0
ꢂ
ꢃ8.6 (c 1.0, CDCl3); 1H NMR (500 MHz, DMSO-d6) d 7.92–
7.82 (m, 3H), 7.81 (d, J = 6.5 Hz, 1H), 7.76–7.69 (m, 2H), 7.67 (d,
J = 8.0 Hz, 1H), 7.45–7.38 (m, 2H), 7.36–7.25 (m, 2H), 6.78 (t,
J = 5.5 Hz, 1H), 4.40–4.30 (m, 1H), 4.30–4.13 (m, 3H), 4.00–3.89
The eluted protein 22a (6.8 mg quantified by Bradford assay)
from the NAP column (GE healthcare) was cyanylated by 10 mM
CDAP in the 0.1 N AcOH containing 0.5 mM TCEP for 30 min. After

7492
M. Tanaka et al. / Bioorg. Med. Chem. 17 (2009) 7487–7492
desalting by gel-filtration and freeze-drying, cyanylated protein
was treated with 0.3 M K2CO3 for 30 min. The reaction products
were analyzed using LC–MS. Purification of the product by pre-
parative HPLC provided the expected end-capped peptide 20a
(0.40 mg, 24%) that was quantified by UV absorbance at 280 nm.
Health and Labour Sciences Research Grants (Research on HIV/
AIDS).
Supplementary data
Supplementary data associated with this article can be found, in
the online version, at doi:10.1016/j.bmc.2009.09.015.
4.10. Determination of drug susceptibility of HIV-1
The peptide sensitivity of infectious clones was determined by
the MAGI assay with some modifications.17 Briefly, the target cells
(HeLa-CD4-LTR-b-gal; 104 cells/well) were plated in 96-well flat
microtiter culture plates. On the following day, the cells were inoc-
ulated with the HIV-1 clone (NL4-3, 60 MAGI U/well, giving 60 blue
cells after 48 h of incubation) and cultured in the presence of var-
ious concentrations of drugs in fresh medium. Forty-eight hours
after viral exposure, all the blue cells stained with X-Gal (5-bro-
References and notes
1. For reviews, see: (a) Frokjaer, S.; Otzen, D. E. Nat. Rev. Drug Disc. 2005, 4, 298;
(b) Leader, B.; Baca, Q. J.; Golan, D. E. Nat. Rev. Drug Disc. 2008, 7, 21.
2. (a) Andersson, L.; Blomberg, L.; Flegel, M.; Lepsa, L.; Nilsson, B.; Verlander, M.
Biopolymers 2000, 5, 227; (b) Bray, B. L. Nat. Rev. Drug Disc. 2003, 2, 587.
3. Dingermann, T. Biotechnol. J. 2008, 3, 90.
4. For recent reviews on the preparation of peptides and proteins having
nonproteinogenic amino acid(s) or post-translational modification, see: (a)
Muralidharan, V.; Muir, T. W. Nat. Methods 2006, 3, 429; (b) Bennett, C. S.;
Wong, C. H. Chem. Soc. Rev. 2007, 36, 1227; (c) Ohta, A.; Yamagishi, Y.; Suga, H.
Curr. Opin. Chem. Biol. 2008, 12, 159.
5. (a) Stark, G. R. Methods Enzymol. 1977, 47, 129; (b) Nakagawa, S.; Tamakashi, Y.;
Hamana, T.; Kawase, M.; Taketomi, S.; Ishibashi, Y.; Nishimura, O.; Fukuda, T. J.
Am. Chem. Soc. 1994, 116, 5513; (c) Nishimura, O.; Moriya, T.; Suenaga, M.;
Tanaka, Y.; Itoh, T.; Koyama, N.; Fujii, R.; Hinuma, S.; Kitada, C.; Fujino, M.
Chem. Pharm. Bull. 1998, 46, 1490; (d) Yang, Y.; Wu, J.; Watson, J. T. J. Am. Chem.
Soc. 1998, 120, 5834; (e) Suenaga, M.; Itoh, T.; Miwa, M.; Koyama, N.; Hinuma,
S.; Kitada, C.; Nishimura, O.; Fujino, M. J. Chem. Soc., Perkin Trans. 1 2000, 1183;
(f) Itoh, T.; Miwa, M.; Suenaga, M.; Ohtaki, T.; Kitada, C.; Nishimura, O.; Fujino,
M. J. Chem. Soc., Perkin Trans. 1 2000, 1333; (g) Nishimura, O.; Suenaga, M.;
Yamada, T.; Itoh, T.; Koyama, N.; Wakimasu, M.; Ohtaki, T.; Kitada, C.; Fujino,
M. J. Chem. Soc., Perkin Trans. 1 2001, 1748; (h) Qi, J.; Wu, J.; Somkuti, G. A.;
Watson, J. T. Biochemistry 2001, 40, 4531.
6. (a) Wu, J.; Watson, J. T. Anal. Biochem. 1998, 258, 268; (b) Tang, H. Y.; Speicher,
D. W. Anal. Biochem. 2004, 334, 48.
7. Hayashi, Y.; Takayama, K.; Suehisa, Y.; Fujita, T.; Nguyen, J. T.; Futaki, S.;
Yamamoto, A.; Kiso, Y. Bioorg. Med. Chem. Lett. 2007, 17, 5129.
8. Other side reactions including dimerization of the peptides by disulfide bond
formation were also observed.
9. The cyclic imide formation with concomitant peptide bond cleavage in
neutral and basic conditions was previously reported: (a) Geiger, T.; Clarke,
S. J. Biol. Chem. 1987, 262, 785; (b) Patel, K.; Borchardt, R. T. Pharm. Res.
1990, 7, 787.
mo-4-chloro-3-indolyl-b-D-galactopyranoside) were counted in
each well. The activity of test compounds was determined as the
concentration that blocked HIV-1 replication by 50% (50% effective
concentration [EC50]).
4.11. Measurement of CD spectra
Peptides 19 and 20a,b were incubated at 37 °C for 30 min (the
final concentrations of peptides were 10 lM in 5 mM HEPES buffer,
pH 7.2). CD spectra were acquired on a Jasco spectropolarimeter
(Model J-710, Jasco Inc., Tokyo, Japan) at 25 °C as the average of
8 scans. Thermal unfolding of potential six-helical bundle in the
presence of N36 was monitored by the [h]222 values at intervals
of 0.5 °C after a 0.25-min equilibration at the desired temperature
and an integration time of 1.0 s. The midpoint of the thermal
unfolding transition of each complex was defined as the melting
temperature (Tm).
4.12. Stability of SC34EK peptide or analogs in mouse serum
10. The e-lactam formation accompanying amide bond cleavage was previously
reported: (a) Takenawa, T.; Oda, Y.; Ishihama, Y.; Iwakura, M. J. Biochem. 1998,
123, 1137; (b) Ishihama, Y.; Ito, O.; Oda, Y.; Takenawa, T.; Iwakura, M.
Tetrahedron Lett. 1999, 40, 3415.
Peptides 19-21 (0.5 mM in PBS) were incubated at 37 °C in 50%
mouse serum in the presence of 0.1% m-cresol (internal standard).
0.010 mL samples were collected at 0, 1, 3, 6, 9 and 12 h and the
11. A small amount of a b-elimination product was observed under the various
cleavage conditions examined.
12. Otaka, A.; Nakamura, M.; Nameki, D.; Kodama, E.; Uchiyama, S.; Nakamura, S.;
Nakano, H.; Tamamura, H.; Kobayashi, Y.; Matsuoka, M.; Fujii, N. Angew. Chem.,
Int. Ed. 2002, 41, 2937.
13. Only partial S-cyanylations of two Cys residues in thioredoxin were observed.
This was also verified by the recovery of C-terminal capped thioredoxin 24a,b
after basic treatment in the next step.
reaction was terminated by the addition of 1 lL 0.1 N HCl and
0.040 mL of CH3CN. Samples were deproteinized by centrifugation
at 12000 rpm for 10 min and 0.010 mL of the supernatant was in-
jected into LC-MS. The percentage of intact peptides was calculated
by peak area and corrected against the internal standard.
14. Peptides 20a,b from 22a,b were identical to the authentic samples, which were
obtained by the cleavage reaction of the synthetic peptides.
Acknowledgments
15. Cytotoxicity of peptides 20a,b was not observed even at 10
lM in MAGI assay.
16. The presence of hydrolyzed ring-opening product indicates that the
a
This work was supported by Science and Technology Incubation
Program in Advanced Regions from Japan Science and Technology
Agency, Grants-in-Aid for Scientific Research from the Ministry of
Education, Culture, Sports, Science, and Technology of Japan, and
degradation presumably began with hydrolysis of the C-terminal
aspartimide, Ref. 9.
17. (a) Kodama, E. I.; Kohgo, S.; Kitano, K.; Machida, H.; Gatanaga, H.; Shigeta, S.;
Matsuoka, M.; Ohrui, H.; Mitsuya, H. Antimicrob. Agents Chemother. 2001, 45,
1539; (b) Maeda, Y.; Venzon, D. J.; Mitsuya, H. J. Infect. Dis. 1998, 177, 1207.